WorldWideScience

Sample records for pathogenic microorganisms cell

  1. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    OpenAIRE

    PURNIMA R. CHITLANGE

    2014-01-01

    Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP) is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check wh...

  2. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    Directory of Open Access Journals (Sweden)

    PURNIMA R. CHITLANGE

    2014-11-01

    Full Text Available Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check whether the cell phone act as a vector for transmission of various pathogens, a potential study was carried out in microbiology department of Shri Radhakisan Laxminarayan Toshniwal College of Science, Akola. Total 20 cell samples were screened. Two parameters were considered: College students and hospital staff. The isolated bacteria Staphylococcus aureus, E. coli, Pseudomonas sp., Bacillus subtilis, Aerobacter aerogenes, Salmonella, Shigella, Streptococci, P. vulgaris were identified on the basis of morphological and cultural characteristics. The main aim of present study was to check the contamination by bacterial pathogens on cell phones and also to check role of cell phone for transmission of pathogens from person to person or not.

  3. Pathogenic and opportunistic microorganisms in caves

    Directory of Open Access Journals (Sweden)

    Sanchez-Moral Sergio

    2010-01-01

    Full Text Available With today’s leisure tourism, the frequency of visits to many caves makes it necessary to know about possible potentially pathogenic microorganisms in caves, determine their reservoirs, and inform the public about the consequences of such visits. Our data reveal that caves could be a potential danger to visitors because of the presence of opportunistic microorganisms, whose existence and possible development in humans is currently unknown.

  4. Raft-like membrane domains in pathogenic microorganisms.

    Science.gov (United States)

    Farnoud, Amir M; Toledo, Alvaro M; Konopka, James B; Del Poeta, Maurizio; London, Erwin

    2015-01-01

    The lipid bilayer of the plasma membrane is thought to be compartmentalized by the presence of lipid-protein microdomains. In eukaryotic cells, microdomains composed of sterols and sphingolipids, commonly known as lipid rafts, are believed to exist, and reports on the presence of sterol- or protein-mediated microdomains in bacterial cell membranes are also appearing. Despite increasing attention, little is known about microdomains in the plasma membrane of pathogenic microorganisms. This review attempts to provide an overview of the current state of knowledge of lipid rafts in pathogenic fungi and bacteria. The current literature on characterization of microdomains in pathogens is reviewed, and their potential role in growth, pathogenesis, and drug resistance is discussed. Better insight into the structure and function of membrane microdomains in pathogenic microorganisms might lead to a better understanding of their pathogenesis and development of raft-mediated approaches for therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Viruses, Other Pathogenic Microorganisms and Esophageal Cancer.

    Science.gov (United States)

    Xu, Wenji; Liu, Zhongshu; Bao, Quncha; Qian, Zhikan

    2015-05-01

    Esophageal cancer (EC) is the eighth most prevalent malignant tumor and the sixth leading cause of cancer mortality throughout the world. Despite the technical developments in diagnosis and treatment, the 5-year survival rate is still low. The etiology of EC remains poorly understood; multiple risk factors may be involved and account for the great variation in EC incidence in different geographic regions. Infection with carcinogenetic pathogens has been proposed as a risk factor for EC. This review explores the recent studies on the association of human papillomavirus (HPV), Epstein-Barr virus (EBV), Helicobacter pylori and esophageal bacterial biota with EC. Among the above-mentioned pathogens, HPV most likely contributes to esophageal squamous cell carcinoma (ESCC) in high-risk populations. New techniques are being applied to studies on the role of infection in EC, which will inevitably bring novel ideas to the field in the near future. Multiple meta-analyses support the finding of a higher HPV detection rate in regions associated with high risk for ESCC compared to low-risk areas. A potential role of HPV in the rise of esophageal adenocarcinoma (EAC) was proposed recently. However, further studies are required before a firm conclusion can be drawn. Less work has been done in studying the association between EBV and ESCC, and the results are quite controversial. H. pylori infection is found to be inversely related to EC, which is probably due to the reduced incidence of gastroesophageal reflux disease. Analysis of the esophageal bacterial biota revealed distinct clusters of bacteria in normal and diseased esophagi. A type II microbiome rich in Gram-negative bacteria potentially contributes to EAC by inducing chronic inflammation. Novel findings from such studies as these may benefit public health by justifying anti-infection measures to prevent EC.

  6. UV inactivation of pathogenic and indicator microorganisms

    International Nuclear Information System (INIS)

    Chang, J.C.; Ossoff, S.F.; Lobe, D.C.; Dorfman, M.H.; Dumais, C.M.; Qualls, R.G.; Johnson, J.D.

    1985-01-01

    Survival was measured as a function of the dose of germicidal UV light for the bacteria Escherichia coli, Salmonella typhi, Shigella sonnei, Streptococcus faecalis, Staphylococcus aureus, and Bacillus subtilis spores, the enteric viruses poliovirus type 1 and simian rotavirus SA11, the cysts of the protozoan Acanthamoeba castellanii, as well as for total coliforms and standard plate count microorganisms from secondary effluent. The doses of UV light necessary for a 99.9% inactivation of the cultured vegetative bacteria, total coliforms, and standard plate count microorganisms were comparable. However, the viruses, the bacterial spores, and the amoebic cysts required about 3 to 4 times, 9 times, and 15 times, respectively, the dose required for E. coli. These ratios covered a narrower relative dose range than that previously reported for chlorine disinfection of E. coli, viruses, spores, and cysts

  7. UV inactivation of pathogenic and indicator microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Chang, J.C.; Ossoff, S.F.; Lobe, D.C.; Dorfman, M.H.; Dumais, C.M.; Qualls, R.G.; Johnson, J.D.

    1985-06-01

    Survival was measured as a function of the dose of germicidal UV light for the bacteria Escherichia coli, Salmonella typhi, Shigella sonnei, Streptococcus faecalis, Staphylococcus aureus, and Bacillus subtilis spores, the enteric viruses poliovirus type 1 and simian rotavirus SA11, the cysts of the protozoan Acanthamoeba castellanii, as well as for total coliforms and standard plate count microorganisms from secondary effluent. The doses of UV light necessary for a 99.9% inactivation of the cultured vegetative bacteria, total coliforms, and standard plate count microorganisms were comparable. However, the viruses, the bacterial spores, and the amoebic cysts required about 3 to 4 times, 9 times, and 15 times, respectively, the dose required for E. coli. These ratios covered a narrower relative dose range than that previously reported for chlorine disinfection of E. coli, viruses, spores, and cysts.

  8. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2009-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  9. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2010-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  10. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  11. Pathogenic microorganisms of medicinal herbal drugs

    Directory of Open Access Journals (Sweden)

    Stević Tatjana

    2012-01-01

    Full Text Available All the parts of plants (root, leaf, flower naturally have a high level of microorganisms, bacteria and fungi, especially molds. Microbial contamination could be a result of inappropriate harvesting, cleaning of the raw plant material, unhygienic processing of the plants, unsuitable transport and storage. After examination of over 40 dried medicinal plant species, the lowest microbial quality was determined for Maydis stigma, Mentha leaf and herb, Equisetum herb, Calendula flower, Urtica leaf, Melissa leaf, Serpylli herb, Chamomilla flower etc. Although mixed infections are recorded with different types of fungus, Fusarium was observed as the most dominant genus in most of the tested drugs, followed by Aspergillus and Alternaria. In addition to these fungi species from the following genera were identified: Phoma, Cephalosporium, Nigrospora, Cladosporium, Epicoccum, Gliocladium, Myrothecium, Cercospora, Phomopsis, Verticillium, Dreschlera (=Bipolaris, Rhizoctonia, Septoria, Trichoderma, Curvularia, Stachybotrys, Trichothecium, Puccinia, Botrytis, Mucor and Rhizopus sp., depending on plant species.

  12. Stethoscopes as potential intrahospital carriers of pathogenic microorganisms.

    Science.gov (United States)

    Campos-Murguía, Alejandro; León-Lara, Ximena; Muñoz, Juan M; Macías, Alejandro E; Alvarez, José A

    2014-01-01

    Stethoscopes can take part in the transmission of health care-associated infections. We cultured 112 stethoscopes by direct imprint on blood agar to estimate the prevalence of potentially pathogenic microorganisms. Forty-eight (47%) produced 50 potentially pathogenic microorganisms; from these, 43 (86%) were Staphylococcus aureus, of which 18 (42%) were methicillin-resistant S. aureus. We concluded that stethoscopes should be considered as potential fomites and must be disinfected routinely before and after each patient contact. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  13. Titanium photocatalyst against human pathogenic microorganisms

    International Nuclear Information System (INIS)

    Kussovski, V.; Stefchev, P.; Kirilov, R.

    2011-01-01

    The conventional methods of disinfection are not effective in the longer term. They are time and staff intensive and use aggressive chemicals. Photocatalytic oxidation on surfaces coated with titanium dioxide (TiO 2 ) might offer a possible alternative. The antimicrobial activity of TiO 2 powder P25 and thin films of TiO 2 on glass slides against representative strains of microorganisms associated with hospital-acquired infections (Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans) was investigated in vitro. High efficiency has been found in the case of the studied bacterial strains, particularly for the P. aeruginosa. It was shown that it is possible to disinfect surfaces coated with TiO 2 and stimulated by UV-A light. The reduction efficiencies for P. aeruginosa, S. aureus and C. albicans were 3.19, 2.32 and 1.22. In all cases sublethal UV-A doses provoked an important lethality in the presence of TiO 2 . (authors)

  14. Prevalence of pathogenic microorganisms in the oral cavity and their ...

    African Journals Online (AJOL)

    This study was conducted to determine the incidence of pathogenic microorganisms associated with dental caries and antimicrobial susceptibility test of some common dentifrice sold in Kano metropolis. A total of 50 samples were used in this study. The samples were taken using swab from human oral mucosa. The swabs ...

  15. The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission

    Directory of Open Access Journals (Sweden)

    Sarah I. Bonnet

    2017-06-01

    Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.

  16. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    Kord, M.; Khafagi, I.; Dewedar, A.

    2003-01-01

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  17. Prevalence of the pathogen microorganisms in raw cow milk

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2009-11-01

    Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

  18. Autophagic clearance of bacterial pathogens: molecular recognition of intracellular microorganisms.

    Science.gov (United States)

    Pareja, Maria Eugenia Mansilla; Colombo, Maria I

    2013-01-01

    Autophagy is involved in several physiological and pathological processes. One of the key roles of the autophagic pathway is to participate in the first line of defense against the invasion of pathogens, as part of the innate immune response. Targeting of intracellular bacteria by the autophagic machinery, either in the cytoplasm or within vacuolar compartments, helps to control bacterial proliferation in the host cell, controlling also the spreading of the infection. In this review we will describe the means used by diverse bacterial pathogens to survive intracellularly and how they are recognized by the autophagic molecular machinery, as well as the mechanisms used to avoid autophagic clearance.

  19. Survival of Spoilage and Pathogenic Microorganisms on Cardboard and Plastic Packaging Materials

    Directory of Open Access Journals (Sweden)

    Lorenzo Siroli

    2017-12-01

    Full Text Available The aim of this work was to study the interaction of corrugated and plastic materials with pathogenic and spoiling microorganisms frequently associated to fresh produce. The effect of the two packaging materials on the survival during the storage of microorganisms belonging to the species Escherichia coli, Listeria monocytogenes, Salmonella enteritidis, Saccharomyces cerevisiae, Lactobacillus plantarum, Pseudomonas fluorescens, and Aspergillus flavus was studied through traditional plate counting and scanning electron microscopy (SEM. The results obtained showed that cardboard materials, if correctly stored, reduced the potential of packaging to cross-contaminate food due to a faster viability loss by spoilage and pathogenic microorganisms compared to the plastic ones. In fact, the cell loads of the pathogenic species considered decreased over time independently on the inoculation level and packaging material used. However, the superficial viability losses were significantly faster in cardboard compared to plastic materials. The same behavior was observed for the spoilage microorganisms considered. The SEM microphotographs indicate that the reduction of superficial contamination on cardboard surfaces was due to the entrapping of the microbial cells within the fibers and the pores of this material. In addition, SEM data showed that the entrapped cells were subjected to more or less rapid lyses, depending on the species, due to the absence of water and nutrients, with the exception of molds. The latter spoilers were able to proliferate inside the cardboard fibers only when the absorption of water was not prevented during the storage. In conclusion, the findings of this work showed the reduction of cross-contamination potential of corrugated compared to plastic packaging materials used in fruit and vegetable sector. However, the findings outlined the importance of hygiene and low humidity during cardboard storage to prevent the mold growth on

  20. Effect of certain medicinal plants extracts on some pathogenic microorganisms

    International Nuclear Information System (INIS)

    Attia, S.H.

    2002-01-01

    A queous, alcoholic and active ingredients extracts of karkatde, tamarind and licorice showed different inhibitory effects on the growth of some pathogenic srains. Active ingredients wwere the most effective on bacterial strains than alcoholic and aqueous extracts. Extracts of karkade and tamarind were more effective on diplococcus sp. and pseudomonas aeruginosa, respectively than other bacterial strains under investigation and the minimum inhibitory concentration (MIC) were 2 mu1/6 mm diameter disc. The extracts of karkade, tamarind and licorice increased the mycelial dry weight of aspergillus flavus by increasing the concentration of extracts in the media. Effect of extracted substances of tested plants on the ultra-structure of diplococcus sp. and p. aeruginosa and the changes in the morphological changes of A. flovus aflatoxin producer strain were studied by using electron and light microscopes, respectively. The treatment of p. aeruginosa with MIC (2 mu 1 ) of tamarined extract induced rupture of cell wall lysis of cytoplasmic ocntent. However, treatment of diplococcus sp. with 2 mu 1 of karkade extract caused patial rupture of cell wall while cell content still keeping its normal pattern. On the other hand, licorice extract stimulated germination of spores of A. Flavus.Total protein and carbohydrate contents of diplococcus sp., and p. aeruginosa decreased as a result of inhibition effect of active substance on bacterial cells. While, in A. flavus, it increased as a result of the stimulation effect of licorice extract on fungal spores

  1. Ecophysiology of microorganisms in microbial elctrolysis cells

    NARCIS (Netherlands)

    Croese, E.

    2012-01-01

    One of the main challenges for improvement of the microbial electrolysis cell (MEC) has been the reduction of the cost of the cathode catalyst. As catalyst at the cathode, microorganisms offer great possibilities. Previous research has shown the principle possibilities for the biocathode for H2

  2. 77 FR 45350 - Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With...

    Science.gov (United States)

    2012-07-31

    ... ENVIRONMENTAL PROTECTION AGENCY Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With Focus on Food and Water AGENCY: Environmental Protection Agency (EPA). ACTION... risk assessment and also promote consistency in approaches and methods. The MRA Guideline can be...

  3. 9 CFR 381.94 - Contamination with Microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Contamination with Microorganisms... § 381.94 Contamination with Microorganisms; process control verification criteria and testing; pathogen... maintaining process controls sufficient to prevent fecal contamination. FSIS shall take further action as...

  4. A stochastic model simulating the capture of pathogenic micro-organisms by superparamagnetic particles in an isodynamic magnetic field

    International Nuclear Information System (INIS)

    Rotariu, O; Strachan, N J C; Badescu, V

    2004-01-01

    The method of immunomagnetic separation (IMS) has become an established technique to concentrate and separate animal cells, biologically active compounds and pathogenic micro-organisms from clinical, food and environmental matrices. One drawback of this technique is that the analysis is only possible for small sample volumes. We have developed a stochastic model that involves numerical simulations to optimize the process of concentration of pathogenic micro-organisms onto superparamagnetic carrier particles (SCPs) in a gradient magnetic field. Within the range of the system parameters varied in the simulations, optimal conditions favour larger particles with higher magnetite concentrations. The dependence on magnetic field intensity and gradient together with concentration of particles and micro-organisms was found to be less important for larger SCPs but these parameters can influence the values of the collision time for small particles. These results will be useful in aiding the design of apparatus for immunomagnetic separation from large volume samples

  5. Integrated oxide graphene based device for laser inactivation of pathogenic microorganisms

    Science.gov (United States)

    Grishkanich, Alexsandr; Ruzankina, Julia; Afanasyev, Mikhail; Paklinov, Nikita; Hafizov, Nail

    2018-02-01

    We develop device for virus disinfection of pathogenic microorganisms. Viral decontamination can be carried out due to hard ultraviolet irradiation and singlet oxygen destroying the genetic material of a virus capsid. UV rays can destroy DNA, leading to the formation of dimers of nucleic acids. This practically does not occur in tissues, tk. UV rays penetrate badly through them, however, the viral particles are small and UV can destroy their genetic material, RNA / DNA and the virus can not replicate. It is with the construction of the ultraviolet laser water disinfection system (UFLOV) based on the continuous and periodic pulsed ultraviolet laser sources (pump) binds to solve sterility and depyrogenation of water. It has been established that small doses of UV irradiation stimulate reproduction, and large doses cause the death of pathogenic microorganisms. The effect of a dose of ultraviolet is the result of photochemical action on the substance of a living bacterial cell or virion. Also complex photodynamic laser inactivation on graphene oxide is realized.

  6. Photodynamic action on some pathogenic microorganisms of oral cavity

    Science.gov (United States)

    Ovchinnikov, Ilya S.; Tuchin, Valery V.

    2001-10-01

    The work is devoted to an analysis of pre-clinical and clinical experiments on photodynamic action of HeNe laser radiation in aggregate with a cation thiazinium dye Methylene Blue (MB) on a mix of pathogenic and conditionally pathogenic aerobic bacteria being activators of pyoinflammatory diseases of oral cavity. Concentration of photosensitizes at which there is no own bactericidal influence on dying microflora, and parameters of influence at which the efficiency of irradiated microflora defeat reaches 99 % are determined.

  7. A Sensitive and Rapid Method to Determine the Adhesion Capacity of Probiotics and Pathogenic Microorganisms to Human Gastrointestinal Mucins

    Directory of Open Access Journals (Sweden)

    Bélinda Ringot-Destrez

    2018-05-01

    Full Text Available Mucus is the habitat for the microorganisms, bacteria and yeast that form the commensal flora. Mucins, the main macromolecules of mucus, and more specifically, the glycans that cover them, play essential roles in microbial gastrointestinal colonization. Probiotics and pathogens must also colonize mucus to have lasting positive or deleterious effects. The question of which mucin-harboured glycan motifs favour the adhesion of specific microorganisms remains very poorly studied. In the current study, a simple test based on the detection of fluorescent-labeled microorganisms raised against microgram amounts of mucins spotted on nitrocellulose was developed. The adhesion of various probiotic, commensal and pathogenic microorganisms was evaluated on a panel of human purified gastrointestinal mucins and compared with that of commercially available pig gastric mucins (PGM and of mucins secreted by the colonic cancer cell line HT29-MTX. The latter two proved to be very poor indicators of adhesion capacity on intestinal mucins. Our results show that the nature of the sialylated cores of O-glycans, determined by MALDI MS-MS analysis, potentially enables sialic acid residues to modulate the adhesion of microorganisms either positively or negatively. Other identified factors affecting the adhesion propensity were O-glycan core types and the presence of blood group motifs. This test should help to select probiotics with enhanced adhesion capabilities as well as deciphering the role of specific mucin glycotopes on microbial adhesion.

  8. [Evolution of pathogenic micro-organisms as a challenge for medicine].

    Science.gov (United States)

    Vaara, Martti

    2009-01-01

    Successful parasitic micro-organisms are able to adapt to the circumstances of the host's organ system, and it is usually not expedient for them to kill their host. Under selection pressure, the evolution of micro-organisms is vastly quicker that that of man. The selection pressure brought about by rapid ecological changes and alterations associated with human action provides for the development of new, dangerous pathogens and transformation of familiar pathogens to become more dangerous. Progress in molecular biology has thus far not yielded as many new tools for the treatment of infectious diseases as the hopes were in the early 2000's.

  9. Effect of helium-neon laser radiation on conventionally - pathogenous microorganisms

    International Nuclear Information System (INIS)

    Shesterina, M.V.; Kalyuk, A.N.; Maliev, B.M.

    1987-01-01

    Results are reported of single and multiple irradiation with low-energy helium-neon lasers (different doses and regimens) on growth and properties of conventionally-pathogenous microflora isolated from patients with pulmonary tuberculosis and cultures of standard microorganisms. The above mentioned laser radiation produced an inhibitory effect on some strains of conventionally-pathogenous microflora manifested in inhibition of the growth properties of cultures as the energy dose increased

  10. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  11. Efficacy of Sakacin on Selected Food Pathogenic Microorganisms ...

    African Journals Online (AJOL)

    USER

    technique and was characterized based on it colony, cell morphology and some ... De Man Rogosa Sharpe (MRS) broth for bacteriocin (sakacin) production. ... tremendous attention as potential bio preservatives in the food and dairy industries. .... positive result,-: Negative result, A : Acid production ,G :Gas production,.

  12. Microrganismos patogênicos, celularidade e resíduos de antimicrobianos no leite bovino produzido no sistema orgânico Pathogenic microorganisms, somatic cell count and drug residues evaluation in organic bovine milk

    Directory of Open Access Journals (Sweden)

    Márcio Garcia Ribeiro

    2009-01-01

    antimicrobianos em fazendas de leite orgânico.In last years increase the importance of milk quality and conditions of bovine milking. Simultaneously, increase the interest about organic milk and derivates. The aim of present study was investigate the milk pathogens, sensitivity and multiple drug resistance of isolates, somatic cell count and residues of drugs in milk, from cattle with and without mastitis, come from four little organic dairy farms in State of São Paulo, Brazil. Were used 148 cattle on the middle period of lactation. From these, two showed clinical mastitis, 72 subclinical mastitis and 74 without signs of mammary inflammation (controls. Staphylococcusaureus (25.7%, Streptococcus spp. (21.4%, Corynebacterium bovis (12.9%, Streptococcus agalactiae (4.3% and Staphylococcus spp. (4.3% were the more-frequent microorganisms isolated from animals with mastitis. Aspergillus spp. was isolated from one animal. Ceftiofur (95.2%, oxacillin (84.2%, gentamicin (76.3% and cefoperazone (70.3% were the more effective drugs. High resistance of isolates were found to penicillin (53.5%, ampicillin (41.6% and neomycin (38.6%. Multiple drug resistance to three or more drugs was observed in 40 (39.6% isolates. Media of somatic cell count encountered in animals with mastitis and controls were 175,742.67cs/mL and 58,227.6 cs/mL, respectively. Antimicrobials residues in milk were detected in four (2.7% animals. The present findings showed the low somatic cell count of animals, indicative of good quality of milk. However, pointed the need of control measures for contagious pathogens of bovine mastitis and more attention for prohibition of antimicrobial use in organic dairy farms.

  13. Potentially pathogenic amoeba-associated microorganisms in cooling towers and their control.

    Science.gov (United States)

    Pagnier, Isabelle; Merchat, Michèle; La Scola, Bernard

    2009-06-01

    Cooling towers provide a favorable environment for the proliferation of microorganisms. Cooling towers generate a biofilm and often aerosolize contaminated water, thereby increasing the risk of microorganism dissemination by human inhalation. This pathogen dissemination was first revealed by the epidemics of Legionnaires' disease that were directly related to the presence of cooling towers, and since then, the ecology of Legionella pneumophila has been well studied. Each country has specific standards regarding the acceptable amount of microorganisms in cooling tower systems. However, those standards typically only concern L. pneumophila, even though many other microorganisms can also be isolated from cooling towers, including protozoa, bacteria and viruses. Microbiological control of the cooling tower system can be principally achieved by chemical treatments and also by improving the system's construction. Several new treatments are being studied to improve the efficiency of disinfection. However, as most of these treatments continue to focus solely on L. pneumophila, reports of other types of pathogens continue to increase. Therefore, how their dissemination affects the human populous health should be addressed now.

  14. The global dispersion of pathogenic microorganisms by dust storms and its relevance to agriculture: Chapter 1

    Science.gov (United States)

    Gonzalez-Martin, Cristina; Teigell-Perez, Nuria; Valladares, Basilio; Griffin, Dale W.

    2014-01-01

    Dust storms move an estimated 500–5000 Tg of soil through Earth’s atmosphere every year. Dust-storm transport of topsoils may have positive effects such as fertilization of aquatic and terrestrial ecosystems and the evolution of soils in proximal and distal environments. Negative effects may include the stripping of nutrient-rich topsoils from source regions, sandblasting of plant life in downwind environments, the fertilization of harmful algal blooms, and the transport of toxins (e.g., metals, pesticides, herbicides, etc.) and pathogenic microorganisms. With respect to the long-range dispersion of microorganisms and more specifically pathogens, research is just beginning to demonstrate the quantity and diversity of organisms that can survive this type of transport. Most studies to date have utilized different assays to identify microorganisms and microbial communities using predominately culture-based, and more recently nonculture-based, methodologies. There is a clear need for international-scale research efforts that apply standardized methods to advance this field of science. Here we present a review of dust-borne microorganisms with a focus on their relevance to agronomy.

  15. Effects of pulsed electric fields on pathogenic microorganisms of major concern in fluid foods: a review.

    Science.gov (United States)

    Mosqueda-Melgar, Jonathan; Elez-Martínez, Pedro; Raybaudi-Massilia, Rosa M; Martín-Belloso, Olga

    2008-09-01

    Pathogenic microorganisms such as Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni have been implicated in foodborne diseases and outbreaks worldwide. These bacteria have been associated with the consumption of fresh fruit juices, milk, and dairy products, which are foodstuff, highly demanded by consumers in retails and supermarkets. Nowadays, consumers require high quality, fresh-like, and safe foods. Pulsed electric field (PEF) is a non-thermal preservation method, able to inactivate pathogenic microorganisms without significant loss of the organoleptic and nutritional properties of food. The PEF treatment effectiveness to destroy bacteria such as Listeria innocua, E. coli, Salmonella Typhimurium, E. coli O157:H7 and E. coli 8739 at pasteurization levels (> or = 5.0 log(10) cycles) in some fluid foods was reported. However, data on the inactivation of some microorganisms such as Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni in fluid foods by PEF processing is very limited. Therefore, future works should be focused toward the inactivation of these pathogenic bacteria in real foods.

  16. Particularities of pathogenic microorganism development at anthropogenic influence and estimate of their adaptation potential by means of radiobiological method

    International Nuclear Information System (INIS)

    Shilina, Yu.V.; Gushcha, N.I.; Dyachenko, A.I.; Dmitriev, A.P.; Molozhava, O.S.; Romashko, V.M.

    2008-01-01

    Influence of anthropogenic factors on ecosystems causes their structure disturbance and reduction of species variety. Some resistance nonspecific forms of pathogenic microorganisms, which have high adaptation potential, become dominant. Thus their aggressiveness can increase. (authors)

  17. A model of the transmission of micro-organisms in a public setting and its correlation to pathogen infection risks.

    Science.gov (United States)

    Gerhardts, A; Hammer, T R; Balluff, C; Mucha, H; Hoefer, D

    2012-03-01

    Gastro-intestinal infections are widespread in the community and have considerable economic consequences. In this study, we followed chains of infection from a public toilet scenario, looking at infection risks by correlating the transmission of bacteria, fungi and viruses to our current knowledge of infectious doses. Transmission of Escherichia coli, Bacillus atrophaeus spores, Candida albicans and bacteriophage MS2 from hands to surfaces was examined in a transmission model, that is toilet brush, door handle to water tap. The load of viable pathogens was significantly reduced during transfer from hands to objects. Nevertheless, it was shown that pathogens were successfully transferred to other people in contagious doses by contact with contaminated surfaces. Our results suggest that infection risks are mainly dependent on current infectious doses of pathogens. For enteritic viruses or bacteria, for example Norovirus or EHEC, only a few particles or cells are sufficient for infection in public lavatories, thus bearing a high risk of infection for other persons. However, there seems to be only a low probability of becoming infected with pathogens that have a high infectious dose whilst sharing the same bathroom. The transmission model for micro-organisms enables a risk assessment of gastro-intestinal infections on the basis of a practical approach. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  18. The hidden face of academic researches on classified highly pathogenic microorganisms.

    Science.gov (United States)

    Devaux, Christian A

    2015-01-01

    Highly pathogenic microorganisms and toxins are manipulated in academic laboratories for fundamental research purposes, diagnostics, drugs and vaccines development. Obviously, these infectious pathogens represent a potential risk for human and/or animal health and their accidental or intentional release (biosafety and biosecurity, respectively) is a major concern of governments. In the past decade, several incidents have occurred in laboratories and reported by media causing fear and raising a sense of suspicion against biologists. Some scientists have been ordered by US government to leave their laboratory for long periods of time following the occurrence of an incident involving infectious pathogens; in other cases laboratories have been shut down and universities have been forced to pay fines and incur a long-term ban on funding after gross negligence of biosafety/biosecurity procedures. Measures of criminal sanctions have also been taken to minimize the risk that such incidents can reoccur. As United States and many other countries, France has recently strengthened its legal measures for laboratories' protection. During the past two decades, France has adopted a series of specific restriction measures to better protect scientific discoveries with a potential economic/social impact and prevent their misuse by ill-intentioned people without affecting the progress of science through fundamental research. French legal regulations concerning scientific discoveries have progressively strengthened since 2001, until the publication in November 2011 of a decree concerning the "PPST" (for "Protection du Potentiel Scientifique et Technique de la nation", the protection of sensitive scientific data). Following the same logic of protection of sensitive scientific researches, regulations were also adopted in an order published in April 2012 concerning the biology and health field. The aim was to define the legal framework that precise the conditions for authorizing

  19. The pathogenic microorganisms in papanicolaou vaginal smears and correlation with inflammation.

    Directory of Open Access Journals (Sweden)

    Esmat Barouti

    2013-03-01

    Full Text Available Non-specific cervicitis or inflammatory changes in a smear report are common which are usually unclear for clinical approaches. To investigate the frequency of inflammation and pathogenic vaginal microorganisms in cervical smears among an Iranian population sample.This cross-sectional study was carried out on Pap smear samples of women referred to gynecological clinic of Taleghani Hospital in Tehran, Iran, between October 2008 and March 2009. This study was conducted on 528 conventional Papanicolaou cervical smears. The frequency and severity of inflammation and prevalence of bacterial vaginosis (BV, Trichomonas vaginalis (TV, and vaginal candidiasis (VC was determined in the samples. Also co-infection of the microorganisms in Pap samples was evaluated. percentage, mean±standard deviation of the outcome parameters were calculated. The comparison between data was performed with the Pearson's chi square or Fisher's exact test.The prevalence of BV, VC, and TV in Pap samples was 17%, 11%, and 0.4% respectively. Overall, the prevalence of these microorganisms in women of reproductive age was higher than menopausal women. There was a significant association between VC and the presence of inflammation in our samples.Based on our results, inflammation in the Pap smears can suggest an infection of VC and the patients should be considered for proper VC treatment.

  20. Monitoring of opportunistic and pathogenic microorganisms in surgical departments of Dniprodzerzhynsk

    Directory of Open Access Journals (Sweden)

    N. N. Donets

    2013-03-01

    Full Text Available The paper presents monitoring results of the spread of opportunistic and pathogenic microorganisms in patients of surgical departments of the Dniprodzerzhynsk city hospital No 7. 1464 strains of bacteria isolated from biological material of the patients from January to December 2012 were studied. Relevant standard methods of research and data interpretation in accordance with the regulatory guidelines were used. The microorganisms’ sensitivity to antibiotics was determined by the disk diffusion method. Assessment of the resistance of isolated microorganisms to antibiotics was made with the software Whonet 5.1. At the first stage of investigation sampling biological material and inoculation in the culture medium were made. The discharges of wounds, throat, nose, ears, vagina and urethra, and also urine from patients of surgical departments were sampled for bacteriological analysis. The main substratum was 5% blood agar. There may additionally be used the selective growth media (yolk-salt agar, Endo, and Saburo. At the second stage we identify microorganisms with bacterioscopic, bacteriological and biochemical methods. Identifying microorganisms of the genus Staphylococcus was made by the reaction of lecithinase presence, plasma-coagulation reaction and the mannitol oxidation reaction. For the identification of bacteria of the family Streptococcaceae the growth pattern in 0.5% sugar medium was used. It was differentiated from bacteria of the genus Enterococcus by plating onto egg yolk agar base and milk with 0.1% methylene blue. Identification of bacteria of the Enterobacteriaceae family was made by studying their colonies on dense differential diagnostic media. Suspicious colonies were transferred on a combined medium for primary identification (Olkenitsky's medium. Then the biochemical signs of enterobacteria were studied in the minimum number of tests. The third phase of the study included the determination of the sensitivity of

  1. Antimicrobial activity of methanolic extracts of selected marine macroalgae against some pathogenic microorganisms

    Directory of Open Access Journals (Sweden)

    Ehab Omer Abdalla

    2016-05-01

    Full Text Available Objective: To evaluate the antimicrobial activity of methanolic extracts of six marine macroalgae belonging to green algae (Chlorophyceae, brown algae (Phaeophyceae and the red algae (Rhodophyceae collected from the intertidal area of the Sudanese Red Sea coast near Port Sudan. Methods: Methanol was used for extracting the active principles of the algae and the disc diffusion method was performed to examine the activity and the minimum inhibitory concentration of the samples against four pathogenic bacteria and two fungi. Results: All tested algal extracts exhibited considerable bioactivity and inhibited the growth of all pathogenic microorganisms under investigation. The green alga Caulerpa racemosa produced the maximum inhibition zone (21 mm against Candida albicans while the red alga Laurencia papillosa showed low antimicrobial activity with the minimum inhibition zone of 10 mm against Pseudomonas aeruginosa. The tested algal extracts did not show any special antimicrobial influence on the selected microorganisms when they were considered as Grampositive and Gram-negative bacteria and fungi but the most efficient methanolic extracts in inhibiting microbial growth were those of green macroalgae followed by the brown and the red macroalgae respectively. Conclusions: The study demonstrated that the tested marine macroalgae from Sudanese Red Sea coast may represent a potential and alternative source for secondary metabolites with antimicrobial activity.

  2. Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

    International Nuclear Information System (INIS)

    Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fátima; Teófilo, Reinaldo F.; Vitor, Débora M.; Reis Coimbra, Jane Sélia dos; Andrade, Nélio José de; Sousa, Frederico B. de; Sinisterra, Rubén D.; Medeiros, Eber Antonio Alves

    2013-01-01

    Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na 4 P 2 O 7 ), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

  3. Use of Lactobacillus plantarum Strains as a Bio-Control Strategy against Food-Borne Pathogenic Microorganisms

    Science.gov (United States)

    Arena, Mattia Pia; Silvain, Amandine; Normanno, Giovanni; Grieco, Francesco; Drider, Djamel; Spano, Giuseppe; Fiocco, Daniela

    2016-01-01

    Lactobacillus plantarum is one of the most versatile species extensively used in the food industry both as microbial starters and probiotic microorganisms. Several L. plantarum strains have been shown to produce different antimicrobial compounds such as organic acids, hydrogen peroxide, diacetyl, and also bacteriocins and antimicrobial peptides, both denoted by a variable spectrum of action. In recent decades, the selection of microbial molecules and/or bacterial strains able to produce antagonistic molecules to be used as antimicrobials and preservatives has been attracting scientific interest, in order to eliminate or reduce chemical additives, because of the growing attention of consumers for healthy and natural food products. The aim of this work was to investigate the antimicrobial activity of several food-isolated L. plantarum strains, analyzed against the pathogenic bacteria Listeria monocytogenes, Salmonella Enteritidis, Escherichia coli O157:H7 and Staphylococcus aureus. Antagonistic activity was assayed by agar spot test and revealed that strain L. plantarum 105 had the strongest ability to contrast the growth of L. monocytogenes, while strains L. plantarum 106 and 107 were the most active microorganisms against E. coli O157:H7. The antimicrobial ability was also screened by well diffusion assay and broth micro-dilution method using cell-free supernatants (CFS) from each Lactobacillus strain. Moreover, the chemical nature of the molecules released in the CFS, and possibly underlying the antagonistic activity, was preliminary characterized by exposure to different constraints such as pH neutralization, heating, catalase, and proteinase treatments. Our data suggest that the ability of L. plantarum cultures to contrast pathogens growth in vitro depends, at least in part, on a pH-lowering effect of supernatants and/or on the presence of organic acids. Cluster analysis was performed in order to group L. plantarum strains according to their antimicrobial effect

  4. of gastro-intestinal discomfort (ID 2946, 2951, 2974), decreasing potentially pathogenic gastro-intestinal microorganisms (ID 2946, 2951, 2974), improved lactose digestion (ID 2946, 2951, 2974), and reduction in numbers of circulating CD34+ cells (ID 2947, 2952, 2975) (further assessment) pursuant

    DEFF Research Database (Denmark)

    Tetens, Inge

    of Lactobacillus acidophilus BCCM/LMG P-18806, Lactobacillus delbrueckii BCCM/LMG P-18805 and Streptococcus thermophilus BCCM/LMG P-18807 and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, improved lactose digestion, and reduction in numbers......, might be a beneficial physiological effect for the general population. The claimed effect, improved lactose digestion, is a beneficial physiological effect for individuals with lactose maldigestion. No human intervention studies were provided from which conclusions could be drawn for the scientific...... and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, and improved lactose digestion....

  5. Selected medicinal plants used in herbal industries; their toxicity against pathogenic microorganisms

    International Nuclear Information System (INIS)

    Fazal, H.; Ahmad, M.; Abbasi, B.H.

    2012-01-01

    Multi-drug resistant strains of fungi and bacteria are imposing the need for new drugs. Reliable natural sources with minor side effects are needed to control anti-human pathogenic invaders specially bacteria. Given the demands for natural products that are inherently safe and environmentally compatible, the advancement in antimicrobial potential has provided a better alternative to synthetic resistance antibiotics. In the present investigation such types of medicinal plants were selected for analyses that are used by local herbal practioners for multiple diseases. Thirty three extracts of Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina and Vetiveria zizanioides in chloroform, ethanol and hexane were investigated for their antimicrobial potential. These extracts were tested against eight microorganisms including four gram negative bacterial strains viz., Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Salmonella typhi, three gram positive bacterial strains Staphylococcus aureus, Bacillus subtilis and Bacillus cereus and a fungal strain viz., Candida albicans. Majority of the extracts showed marked antimicrobial potential against the tested microorganisms. (author)

  6. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    Energy Technology Data Exchange (ETDEWEB)

    Cramariuc, R [Competence Center in Electrostatics and Electrotechnologies, Bucharest (Romania); Popa, M; Mitelut, A; Geicu, M [University of Agronomic Science and Veterinary Medicine, Bucharest (Romania); Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L [Research and Development Institute in Viticulture and Vinification Valea Calugareasca (Romania); Cramariuc, B [IT Center for Science and Technology, Bucharest (Romania); Nisiparu, L, E-mail: raducramariuc@yahoo.com [Carol Davila University of Medicine and Pharmacy, Bucharest (Romania)

    2011-06-23

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  7. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    Science.gov (United States)

    Cramariuc, R.; Popa, M.; Tudorache, A.; Brînduşe, E.; Kontek, A.; Mitelut, A.; Fotescu, L.; Cramariuc, B.; Geicu, M.; Nisiparu, L.

    2011-06-01

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  8. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    International Nuclear Information System (INIS)

    Cramariuc, R; Popa, M; Mitelut, A; Geicu, M; Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L; Cramariuc, B; Nisiparu, L

    2011-01-01

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  9. Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fatima, E-mail: nfsoares1@gmail.com [Department of Food Technology, Federal University of Vicosa (Brazil); Teofilo, Reinaldo F. [Federal University of Vicosa, Department of Chemistry (Brazil); Vitor, Debora M.; Reis Coimbra, Jane Selia dos; Andrade, Nelio Jose de [Department of Food Technology, Federal University of Vicosa (Brazil); Sousa, Frederico B. de; Sinisterra, Ruben D. [Federal University of Minas Gerais, Department of Chemistry (Brazil); Medeiros, Eber Antonio Alves [Department of Food Technology, Federal University of Vicosa (Brazil)

    2013-01-15

    Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na{sub 4}P{sub 2}O{sub 7}), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

  10. Psidium guajava L., from ethnobiology to scientific evaluation: Elucidating bioactivity against pathogenic microorganisms.

    Science.gov (United States)

    Morais-Braga, Maria Flaviana B; Carneiro, Joara Nalyda P; Machado, Antonio Júdson T; Dos Santos, Antonia Thassya L; Sales, Débora L; Lima, Luciene F; Figueredo, Fernando G; Coutinho, Henrique Douglas M

    2016-12-24

    The use of popular plants has guided pharmaceutical research aimed at combating pathogenic microorganisms. Psidium guajava L. is a plant of great versatility and it has been used both as food and as a therapeutic agent. Root, bark, leaves, fruits, flowers and seeds are used for medicinal purposes, especially in infusions and decoctions for oral and topical use. P. guajava is utilized in symptomatology treatment related to organ malfunction and of diseases caused by the action of pathogenic and/or opportunistic microorganisms. Many pharmacological studies have been conducted to scientifically assess its therapeutic potential. The aim of the current study is to relate the popular use of this plant and its bioscientific assessment as a therapeutic agent in the treatment of diseases and symptoms caused by the action of protozoa, fungi, bacteria and viruses, and also evaluate the safety for the usage and the interaction with drugs. A bibliographic database the ethnobiology of Psidium guajava (2005-2015) and the pharmacological infections and parasitic diseases (2010-2015). Searches were done in scientific disclosure databases such as PubMed, Web of Science, and Scopus. P. guajava leaf extracts were scientifically investigated for the treatment of diseases caused by protozoa (leishmaniasis, malaria, giardiasis, amoebiasis and trichomoniasis), fungi (dermatosis, systemic and mucocutaneous diseases), bacteria (respiratory, mucocutaneous and gastrointestinal infections, cholera, gastritis and stomach ulcers, oral and periodontal infections, venereal diseases and urinary infections) and viruses (herpes, influenza, rotavirus disease and AIDS). The toxicity assays indicates the safet for usage. Highlight and elucidate the therapeutic potential and versatility of P. guajava. They also justify using ethnobiology efficiency to guide pharmacological studies. Some limitations can be observed in this kind of study, as the lack for ethnobiological informations and the absence of some

  11. New Approach to Inactivation of Harmful and Pathogenic Microorganisms by Photosensitization

    Directory of Open Access Journals (Sweden)

    Živile Lukšiene

    2005-01-01

    Full Text Available Photosensitization is a treatment involving the administration of a photoactive compound that selectively accumulates in the target cells or microorganisms and is followed by irradiation with visible light. The combination of the two absolutely nontoxic elements, drug and light, in the presence of oxygen results in the selective destruction of target microorganism. It is important to note that truly major advances have been made in photosensitized antimicrobial chemotherapy, in particular disinfection of the blood and blood products, or treating local infections. By no means, prevention of any disease by microbial control of environment, including food manufacturing, is of greatest importance. Thus, development of new antimicrobial methods is necessary. In this context, photosensitization has been shown to be really effective: different microorganisms such as drug-resistant bacteria, yeasts, viruses and parasites can be inactivated by this method. So far, a photosensitization phenomenon can open new and interesting avenues for the development of novel, effective and ecologically friendly antimicrobial treatment, which might be applied to increase food safety.

  12. Elimination of the risk resulting from pathogenic microorganisms in dried and smoked fish by gamma irradiation

    International Nuclear Information System (INIS)

    Gonzalez, O.N.

    1981-01-01

    The usefulness of irradiation in improving the microbiological quality and storage life of agricultural and fishery products was tried in a special study which had the following objectives: to determine the incidence of pathogenic organisms in dried, smoked and steamed fish; to determine the physico-chemical properties of these fish products; to determine the radiation dose necessary to eliminate the said pathogens at various levels of infections under practical conditions prevailing in the Philippines; to determine the organoleptic properties of the irradiated products. Staphylococcus aureus seemed to be the most radiation resistant among the test organisms used. For the purpose of the study the fish products were subjected to a radiation dose of 500 Kr. No significant difference of organoleptic properties at 0.05% level of significance existed between the irradiated and unirradiated counterparts. It was concluded that the use of low dose irradiation could be advantageously applied in combination with salting, drying and smoking and steaming not only to prolong the storage life of the fishery product but to eliminate the risk resulting from Salmonella, E. coli and Staphylococcus aureus pathogens - it appears that radiation could be most promising in smoked and steamed fish products where the low salt and high moisture contents provide less protection relative to dried fish against the growth of these microorganisms. Further the process would destroy much of the spoilage agents like the bacteria, insects, parasites, molds and yeasts which are known to be the main causes of losses in dried and smoked fishery products being experienced in developing countries like the Philippines

  13. Cell surface hydrophobicity of dental plaque microorganisms in situ.

    OpenAIRE

    Rosenberg, M; Judes, H; Weiss, E

    1983-01-01

    The cell surface hydrophobicity of bacteria obtained directly from human tooth surfaces was assayed by measuring their adherence to liquid hydrocarbons. Fresh samples of supragingival dental plaque were washed and dispersed in buffer. Adherence of the plaque microorganisms to hexadecane, octane, and xylene was tested turbidimetrically and by direct microscopic observation. The results clearly show that the vast majority of bacteria comprising dental plaque exhibit pronounced cell surface hydr...

  14. potentially pathogenic gastro-intestinal microorganisms (ID 1030, 2956, 2958, 2961, 2963, 2966, 2970), improved lactose digestion (ID 1030, 2956, 2958, 2961, 2963, 2966, 2970), “intestinal flora/digestive health” (ID 4231), defence against vaginal pathogens (ID 2950, 2957, 2967) and increasing IL-10

    DEFF Research Database (Denmark)

    Tetens, Inge

    and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, improved lactose digestion, “intestinal flora/digestive health”, defence against vaginal pathogens and increasing IL-10 production and/or enhancing the activity of natural killer cells. The food...

  15. Quantification of pathogenic microorganisms and microbial indicators in three wastewater reclamation and managed aquifer recharge facilities in Europe.

    Science.gov (United States)

    Levantesi, Caterina; La Mantia, Rosanna; Masciopinto, Costantino; Böckelmann, Uta; Ayuso-Gabella, M Neus; Salgot, Miquel; Tandoi, Valter; Van Houtte, Emmanuel; Wintgens, Thomas; Grohmann, Elisabeth

    2010-10-01

    Managed Aquifer Recharge (MAR) is becoming an attractive option for water storage in water reuse processes as it provides an additional treatment barrier to improve recharged water quality and buffers seasonal variations of water supply and demand. To achieve a better understanding about the level of pathogenic microorganisms and their relation with microbial indicators in these systems, five waterborne pathogens and four microbial indicators were monitored over one year in three European MAR sites operated with reclaimed wastewater. Giardia and Cryptosporidium (oo)cysts were found in 63.2 and 36.7% of the samples respectively. Salmonella spp. and helminth eggs were more rarely detected (16.3% and 12.5% of the samples respectively) and Campylobacter cells were only found in 2% of samples. At the Belgian site advanced tertiary treatment technology prior to soil aquifer treatment (SAT) produced effluent of drinking water quality, with no presence of the analysed pathogens. At the Spanish and Italian sites amelioration of microbiological water quality was observed between the MAR injectant and the recovered water. In particular Giardia levels decreased from 0.24-6.14 cysts/L to 0-0.01 cysts/L and from 0.4-6.2 cysts/L to 0-0.07 cysts/L in the Spanish and Italian sites respectively. Salmonella gene copies and Giardia cysts were however found in the water for final use and/or the recovered groundwater water at the two sites. Significant positive Spearman correlations (p<0.05, r(s) range: 0.45-0.95) were obtained, in all the three sites, between Giardia cysts and the most resistant microbial markers, Clostridium spores and bacteriophages. Copyright 2010 Elsevier B.V. All rights reserved.

  16. An Evaluation Method for the Suppression of Pathogenic Fusarium oxysporum by Soil Microorganisms Using the Dilution Plate Technique.

    Science.gov (United States)

    Mitsuboshi, Masahiro; Kioka, Yuuzou; Noguchi, Katsunori; Asakawa, Susumu

    2016-09-29

    Soil-borne diseases caused by pathogenic microorganisms are one of the main factors responsible for the decline in crop yields in farmlands. Pathogenic Fusarium oxysporum causes serious damage to various crops, and, thus, a feasible diagnostic method for soil-borne diseases is required. We herein examined a simple method to evaluate the suppressiveness of soil microorganisms against a pathogen by co-cultivating indigenous soil microorganisms and a pathogenic fungus (F. oxysporum f. sp. spinaciae). We inoculated F. oxysporum onto the center of agar medium plates mixed with a dilution series of a suspension of organic fertilizers or soil. After an approximately one-week cultivation, the growth degree of F. oxysporum was estimated based on the size of the colonies that formed on the plates. The growth degree of F. oxysporum significantly differed among the organic fertilizers tested, indicating the usefulness of the method for evaluating suppressiveness by organic fertilizers. Differences in the growth degrees of F. oxysporum were associated with the incidence of disease in spinach on soil treated with organic fertilizers and inoculated with a pathogenic F. oxysporum strain. These results suggested that this method provides some useful information on the suppressiveness of organic fertilizers and soil against Fusarium wilt.

  17. The hybrid methylene blue-zeolite system: a higher efficient photo catalyst for photo inactivation of pathogenic microorganisms

    International Nuclear Information System (INIS)

    Smolinska, M.; Cik, G.; Sersen, F.; Caplovicova, M.; Takacova, A.; Kopani, M.

    2015-01-01

    The composite system can be prepared by incorporation of methylene blue into the channels of zeolite and by adsorption on the surface of the crystals. The composite photo sensitizer effectively absorbs the red light (kmax = 648 nm) and upon illumination with light-emitting diode at a fluence rate of 1.02 mW cm-2 generates effectively reactive singlet oxygen in aqueous solution, which was proved by EPR spectroscopy. To test efficiency for inactivation of pathogenic microorganisms, we measured photo killing of bacteria Escherichia coli and Staphylococcus aureus and yeasts Candida albicans. We found out that after the microorganisms have been adsorbed at the surface of such modified zeolite, the photo generated singlet oxygen quickly penetrates their cell walls, bringing about their effective photo inactivation. The growth inhibition reached almost 50 % at 200 and 400 mg modified zeolite in 1 ml of medium in E. coli and C. albicans, respectively. On the other hand, the growth inhibition of S. aureus reached 50 % at far smaller amount of photo catalyst (30 lg per 1 ml of medium). These results demonstrate differences in sensitivities of bacteria and yeast growth. The comparison revealed that concentration required for IC50 was in case of C. albicans several orders of magnitude lower for a zeolite-immobilized dye than it was for a freely dissolved dye. In S. aureus, this concentration was even lower by four orders of magnitude. Thus, our work suggested a new possibility to exploitation of zeolite and methylene blue in the protection of biologically contaminated environment, and in photodynamic therapy.

  18. Cell surface engineering of industrial microorganisms for biorefining applications.

    Science.gov (United States)

    Tanaka, Tsutomu; Kondo, Akihiko

    2015-11-15

    In order to decrease carbon emissions and negative environmental impacts of various pollutants, biofuel/biochemical production should be promoted for replacing fossil-based industrial processes. Utilization of abundant lignocellulosic biomass as a feedstock has recently become an attractive option. In this review, we focus on recent efforts of cell surface display using industrial microorganisms such as Escherichia coli and yeast. Cell surface display is used primarily for endowing cellulolytic activity on the host cells, and enables direct fermentation to generate useful fuels and chemicals from lignocellulosic biomass. Cell surface display systems are systematically summarized, and the drawbacks/perspectives as well as successful application of surface display for industrial biotechnology are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Efferocytosis of Pathogen-Infected Cells

    Directory of Open Access Journals (Sweden)

    Niloofar Karaji

    2017-12-01

    Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

  20. The construction and evaluation of reference spectra for the identification of human pathogenic microorganisms by MALDI-TOF MS.

    Directory of Open Access Journals (Sweden)

    Di Xiao

    Full Text Available Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS is an emerging technique for the rapid and high-throughput identification of microorganisms. There remains a dearth of studies in which a large number of pathogenic microorganisms from a particular country or region are utilized for systematic analyses. In this study, peptide mass reference spectra (PMRS were constructed and evaluated from numerous human pathogens (a total of 1019 strains from 94 species, including enteric (46 species, respiratory (21 species, zoonotic (17 species, and nosocomial pathogens (10 species, using a MALDI-TOF MS Biotyper system (MBS. The PMRS for 380 strains of 52 species were new contributions to the original reference database (ORD. Compared with the ORD, the new reference database (NRD allowed for 28.2% (from 71.5% to 99.7% and 42.3% (from 51.3% to 93.6% improvements in identification at the genus and species levels, respectively. Misidentification rates were 91.7% and 57.1% lower with the NRD than with the ORD for genus and species identification, respectively. Eight genera and 25 species were misidentified. For genera and species that are challenging to accurately identify, identification results must be manually determined and adjusted in accordance with the database parameters. Through augmentation, the MBS demonstrated a high identification accuracy and specificity for human pathogenic microorganisms. This study sought to provide theoretical guidance for using PMRS databases in various fields, such as clinical diagnosis and treatment, disease control, quality assurance, and food safety inspection.

  1. Chemical Composition of Mentha spicata L. subsp. tomentosa and M. pulegium L., and their Antimicrobial Activity on Strong Pathogen Microorganisms

    Directory of Open Access Journals (Sweden)

    Emre SEVİNDİK

    2017-03-01

    Full Text Available Mentha L., recognized as a medical and aromatic plant, is a general name affiliated to mint species and belongs to Labiatae family. Some species are used as fresh vegetables in the Turkish kitchen and they can also be used in salads. In addition, some species have been used as a spice in food. In this study, chemical composition and antimicrobial activity towards some pathogenics (gram + and gram - microorganisms of the essential oils Mentha spicata L. subsp. tomentosa (Briq. Harley, Mentha pulegium L. grown under West Anatolian ecological conditions were investigated. Extractions were carried out with Clevenger apparatus and essential oil composition was determined by Gas Chromatography-Mass Spectrometry (GC-MS. Microorganisms used for the antimicrobial studies were Methicillin-resistant Staphylococcus aureus (MRSA, Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa, Enterecoccus faecium DSM 13590, Escherichia coli Q157:H7 and Bacillus cereus CCM99.  As a result, M. pulegium and M. spicata subsp. tomentosa were found to be rich in piperitenone oxide: 72.77% and 28.84%, respectively. Each of the oils was found to possess antimicrobial properties against test microorganisms. Essential oils obtained from Mentha species give positive effect on all microorganisms.

  2. Pathogenic microorganisms survival in ambrosia
    Sobrevivência de micro-organismos patogênicos em ambrósia

    OpenAIRE

    Cláudio Dias Timm; Daiani Teixeira Silva; Priscila Alves Dias; Rita de Cássia Santos Conceição

    2013-01-01

    Ambrosia is a kind of dulce de leche homemade with milk, eggs and sugar. It is usually sold in free markets and it is largely consumed in South America. Food contamination by pathogenic microorganisms can occur during the food processing, in distribution centers, in retail markets or in the consumer’s homes. The aim of this study was to evaluate the survival in ambrosia of main pathogenic microorganisms eventually transmitted by dairy products. Ambrosia fractions were experimentally contamina...

  3. Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.

    Science.gov (United States)

    Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel

    2011-09-01

    The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.

  4. MICROORGANISMS: A MARVELOUS SOURCE OF SINGLE CELL PROTEINS

    Directory of Open Access Journals (Sweden)

    Agam Nangul

    2013-08-01

    Full Text Available The increasing global population living below the poverty line is driving the scientific community to search for non-conventional protein sources that can replace conventional expensive ones. Microbial proteins, or single-cell protein (SCP, represent a potential future nutrient source for human food and animal feed. These microbial proteins can be grown rapidly on substrates with minimum dependence on soil, water and climate conditions. They can be produced from algae, fungi and bacteria the chief sources of SCP. It is convenient to use microorganisms for production of SCP as they grow rapidly and have high protein content. Industrially, they can be produced from algal biomass, yeast, fungi. There are several other ways of getting SCP as well. Despite numerous advantages of SCP, they have disadvantages and toxic effects too, especially related to mycotoxins and bacterial toxins.

  5. Probiotic Microorganisms Inhibit Epithelial Cell Internalization of Botulinum Neurotoxin Serotype A

    Directory of Open Access Journals (Sweden)

    Tina I. Lam

    2016-12-01

    Full Text Available Botulinum neurotoxins (BoNTs are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that both BoNT serotype A complex and holotoxin can bind and transit through the intestinal epithelia to disseminate in the blood. The timing of BoNT/A toxin internalization was shown to be comparable in both the Caco-2 in vitro cell culture and in the oral mouse intoxication models. Probiotic microorganisms have been extensively studied for their beneficial effects in not only maintaining the normal gut mucosa but also protection from allergens, pathogens, and toxins. In this study, we evaluate whether probiotic microorganisms will block BoNT/A uptake in the in vitro cell culture system using Caco-2 cells. Several probiotics tested (Saccharomyces boulardii, Lactobacillus acidophilus, Lactobacillus rhamnosus LGG, and Lactobacillus reuteri blocked BoNT/A uptake in a dose-dependent manner whereas a non-probiotic strain of Escherichia coli did not. We also showed that inhibition of BoNT/A uptake was not due to the degradation of BoNT/A nor by sequestration of toxin via binding to probiotics. These results show for the first time that probiotic treatment can inhibit BoNT/A binding and internalization in vitro and may lead to the development of new therapies.

  6. Probiotic Microorganisms Inhibit Epithelial Cell Internalization of Botulinum Neurotoxin Serotype A

    Science.gov (United States)

    Lam, Tina I.; Tam, Christina C.; Stanker, Larry H.; Cheng, Luisa W.

    2016-01-01

    Botulinum neurotoxins (BoNTs) are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that both BoNT serotype A complex and holotoxin can bind and transit through the intestinal epithelia to disseminate in the blood. The timing of BoNT/A toxin internalization was shown to be comparable in both the Caco-2 in vitro cell culture and in the oral mouse intoxication models. Probiotic microorganisms have been extensively studied for their beneficial effects in not only maintaining the normal gut mucosa but also protection from allergens, pathogens, and toxins. In this study, we evaluate whether probiotic microorganisms will block BoNT/A uptake in the in vitro cell culture system using Caco-2 cells. Several probiotics tested (Saccharomyces boulardii, Lactobacillus acidophilus, Lactobacillus rhamnosus LGG, and Lactobacillus reuteri) blocked BoNT/A uptake in a dose-dependent manner whereas a non-probiotic strain of Escherichia coli did not. We also showed that inhibition of BoNT/A uptake was not due to the degradation of BoNT/A nor by sequestration of toxin via binding to probiotics. These results show for the first time that probiotic treatment can inhibit BoNT/A binding and internalization in vitro and may lead to the development of new therapies. PMID:27999281

  7. Viability of probiotic micro-organism Lactobacillus acidophilus in dairy chocolate dessert and its action against foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Luciana Justo Beserra Rosa

    2015-01-01

    Full Text Available ABSTRACT:The ability to produce antimicrobial factors is considered an important feature of probiotic microorganisms. Bacteriocins, hydrogen peroxide, acetic acid and lactic acid are examples of these substances. The present research aimed to develop probiotic dairy desserts (DD with Lactobacillus acidophilusand evaluate the viability of this strain, as well as its action on food pathogens. Treatments with and without interactions between L. acidophilusand pathogenic Gram-negative bacteria (Salmonellasp. andEscherichiacoli O157:H7 and Gram positive (Bacillus cereusand Staphylococcus aureus were produced. The products were stored at a temperature of 8°C and analyzed at the times 24, 48, 72 hours, 7 days and 28 days (at 28 days, only T1 was analyzed because the other products were deteriorated. In an analysis of the potential for development of new products, the dairy dessert with L. acidophiluswas considered a probiotic product. Assessment of the counts of pathogens in dairy desserts with or without L. acidophilusshowed different behaviors of these products in response to pathogens, which could be justified by a possible action of bacteriocins or microbial competition, but there has been no overall reduction or reduction up to a safe level. It is concluded that the probiotic products developed reduced significant food pathogens, but not up to safe levels. Thus, we emphasize the importance of the use of quality tools in the development and monitoring of dairy desserts.

  8. An immunomagnetic separator for concentration of pathogenic micro-organisms from large volume samples

    International Nuclear Information System (INIS)

    Rotariu, Ovidiu; Ogden, Iain D.; MacRae, Marion; Badescu, Vasile; Strachan, Norval J.C.

    2005-01-01

    The standard method of immunomagnetic separation of pathogenic bacteria from food and environmental matrices processes 1 ml volumes. Pathogens present at low levels ( 50 ml). Preliminary results show that between 70 and 113 times more Escherchia coli O157 are recovered compared with the standard 1 ml method

  9. Analyzing indicator microorganisms, antibiotic resistant Escherichia coli, and regrowth potential of foodborne pathogens in various organic fertilizers.

    Science.gov (United States)

    Miller, Cortney; Heringa, Spencer; Kim, Jinkyung; Jiang, Xiuping

    2013-06-01

    This study analyzed various organic fertilizers for indicator microorganisms, pathogens, and antibiotic-resistant Escherichia coli, and evaluated the growth potential of E. coli O157:H7 and Salmonella in fertilizers. A microbiological survey was conducted on 103 organic fertilizers from across the United States. Moisture content ranged from approximately 1% to 86.4%, and the average pH was 7.77. The total aerobic mesophiles ranged from approximately 3 to 9 log colony-forming units (CFU)/g. Enterobacteriaceae populations were in the range of fertilizer, respectively, whereas E. coli O157:H7 grew approximately 4.6, 4.0, 4.0, and 4.8 log CFU/g, respectively. Our results revealed that the microbiological quality of organic fertilizers varies greatly, with some fertilizers containing antibiotic resistant E. coli and a few supporting the growth of foodborne pathogens after reintroduction into the fertilizer.

  10. Esterase screening using whole cells of Brazilian soil microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Mantovani, Simone M.; Oliveira, Luciana G. de; Marsaioli, Anita J., E-mail: anita@iqm.unicamp.b [Universidade Estadual de Campinas (IQ/UNICAMP), SP (Brazil). Inst. de Quimica

    2010-07-01

    A miniaturized enzymatic assay using fluorescent probes to reveal esterase producing microorganisms was optimized and applied to screen 64 soil bacterial strains. The best results were validated using traditional non-fluorogenic assays with acetyl and propanoyl phenylethanol to confirm the miniaturized results. The most active microorganisms belong to the genus Bacillus showing esterase activity and good enantiomeric ratios for the resolution of phenylethanol derivatives (E > 30). Part of the microorganisms are kept in our laboratory in glycerol or freezedried and the best microorganisms will be deposited in the CBMAI/CPQBA/UNICAMP culture collection. (author)

  11. Combating Pathogenic Microorganisms Using Plant-Derived Antimicrobials: A Minireview of the Mechanistic Basis

    Directory of Open Access Journals (Sweden)

    Abhinav Upadhyay

    2014-01-01

    Full Text Available The emergence of antibiotic resistance in pathogenic bacteria has led to renewed interest in exploring the potential of plant-derived antimicrobials (PDAs as an alternative therapeutic strategy to combat microbial infections. Historically, plant extracts have been used as a safe, effective, and natural remedy for ailments and diseases in traditional medicine. Extensive research in the last two decades has identified a plethora of PDAs with a wide spectrum of activity against a variety of fungal and bacterial pathogens causing infections in humans and animals. Active components of many plant extracts have been characterized and are commercially available; however, research delineating the mechanistic basis of their antimicrobial action is scanty. This review highlights the potential of various plant-derived compounds to control pathogenic bacteria, especially the diverse effects exerted by plant compounds on various virulence factors that are critical for pathogenicity inside the host. In addition, the potential effect of PDAs on gut microbiota is discussed.

  12. Elimination of pathogenic microorganisms contained in sewage sludge by different anaerobic digestion technologies

    International Nuclear Information System (INIS)

    Rodriguez Morales, J. A.; Hernandez Lehmann, A.; Herandez Munoz, A. F.

    2010-01-01

    sewage sludge should be treated to facilitate handling and avoid possible problems like the smell of pathogens. These treatments modify the properties of the sludge making them more suitable for reuse or disposal. (Author) 5 refs.

  13. Regulatory T cells and immunity to pathogens.

    Science.gov (United States)

    Rouse, Barry T; Suvas, Susmit

    2007-09-01

    Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

  14. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Control of Salmonella and other pathogenic and spoilage microorganisms in poultry by gamma and electron irradiation

    International Nuclear Information System (INIS)

    Singh, H.

    1992-07-01

    Salmonella contamination of chicken is a major public health concern, causing sickness and loss of productivity. Modern, concentrated production methods increase the difficulty of Salmonella control. The current and suggested treatments with chlorinated water or heat pasteurization are unsatisfactory. In pasteurization, the end product is partially cooked, and in the chlorine water wash the poultry skin gets bleached if too much chlorine is used. There is also a risk of formation of toxic chloro-organic compounds. Further, the chlorine water wash does not completely eliminate salmonella. Low-dose radiation treatment is much more effective for the control of Salmonella and has the additional benefit of preserving the freshness of the product. Irradiation of fresh chicken carcasses, pieces or deboned chicken meat with a dose of 2.5 kGy appears to be sufficient to eliminate naturally occurring Salmonella contamination, which is generally present in extremely low numbers on this continent (1 to 30 cells/100 g). For elimination of Salmonella in frozen chicken, doses higher than 2.5 kGy are required. There is a large range of D 10 - values for the different Salmonella serotypes that have been tested, with the highest being 0.72 kGy for S. oranienberg at 22 degrees C. Thus the 2.5-kGy dose would reduce the most radio-resistant Salmonella serotype by four orders of magnitude, and the most common serotypes (with D 10 - values of 0.3 to 0.4 kGy) by greater than six orders of magnitude. The 2.5-kGy dose also appears to be sufficient to eliminate other bacterial pathogens, such as Campylobactor jejuni and Yersinia enterocolitica. The microbiological shelf life of fresh chicken carcass or deboned chicken meat (6 to 11 d) is extended by a factor of 2 to 3 with irradiation to a dose of 2.5 kGy followed by storage between 1 and 4 degrees C. In radappertization (at a dose of ≥ 45 kGy at -30 degrees C), the shelf life of enzyme-inactivated chicken meat is extended to years, on

  16. Post irradiation effect on some antiphagocytic substances produced by pathogenic microorganisms

    International Nuclear Information System (INIS)

    Shehata, M.M.K.

    2003-01-01

    Some clinical isolated microorganiams can produce antiphagocytic virulence substance. In this study 43 bacterial strains were isolated from cervix of 50 patients. Escheruchia coli was the most common species isolated (39.53%) followed by Klebsiella pneumoniae (23.26), Pseudomonas aeruginosa (11.63%), Proteus mirabilis (9.30%), Klebsiella oxytoca (4.65%), Staphylococcus warneri (4.65%), Klebsiella group 47 (2.33%), Morganella morganii (2.33%) and Staphylococcus hominis (2.33%) four yeast fungal organisms were isolated in this study Candida albicans was the only Candida species isolated representing 8.51% of total number of pathogenic bacteria and yeast fungi isolated. Radiotherapy of these cancer patients had many effects on the microbial cells. The tested isolates were exposed to in-vivo multiple fractionated doses 10-50Gy and in-vitro single equivalent dose 7.04-20Gy. The isolated strains were tested for antimicrbial agent susceptibility using 18 different antibiotics for bacterial isolates and anystatin for Candida albicans. The effect of bacterial and yeast fungal virulence factors on neutrophil phagocytosis and antimicrobial activity was examined. Disk susceptibility testing suggested that, the isolated producer strains which were positive for extracellular proteinase enzyme and/or for slime production that correlate with infectivity were resistant to erythromycin, streptomycin, neomycin, kanamycin, tetracycline, cephalothin and sulphamethoxazol/trimethoprim and rarely susceptible to amoxicillin /clavulanic acid and cefotaxime. In contrast, many non-producer strains were susceptible to most of the tested antibiotics with marked variability among species. In case of Candida albicans all the tested strains were susceptible to the tested antimycotic agent used before and after in-vitro irradiation at a dose level of 20gy. It was found that slime substance and/or proteinase enzyme reduced the phagocytic activity of the leukocytes against the producer bacterial

  17. Plumbing of hospital premises is a reservoir for opportunistically pathogenic microorganisms: a review.

    Science.gov (United States)

    Williams, Margaret M; Armbruster, Catherine R; Arduino, Matthew J

    2013-01-01

    Several bacterial species that are natural inhabitants of potable water distribution system biofilms are opportunistic pathogens important to sensitive patients in healthcare facilities. Waterborne healthcare-associated infections (HAI) may occur during the many uses of potable water in the healthcare environment. Prevention of infection is made more challenging by lack of data on infection rate and gaps in understanding of the ecology, virulence, and infectious dose of these opportunistic pathogens. Some healthcare facilities have been successful in reducing infections by following current water safety guidelines. This review describes several infections, and remediation steps that have been implemented to reduce waterborne HAIs.

  18. The hair follicle mites (Demodex spp.). Could they be vectors of pathogenic microorganisms?

    Science.gov (United States)

    Wolf, R; Ophir, J; Avigad, J; Lengy, J; Krakowski, A

    1988-01-01

    The hair follicle mites Demodex folliculorum and D. brevis are the most common permanent ectoparasites of Man. Ordinarily they are harmless to their human host and appear to be of no medical significance. We present, however, an unusual finding regarding this mite, namely, that in a potassium hydroxide mount of a skin scraping from a mycotic plaque we found numerous Demodex mites containing inside them spores of Microsporum canis. This could mean that the putatively inoffensive Demodex has the potential to ingest various microorganisms that are found in its niche and transport them to other areas of the skin or possibly to other individuals.

  19. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  20. 9 CFR 310.25 - Contamination with microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... criteria and testing; pathogen reduction standards. (a) Criteria for verifying process control; E. coli... 1 (E.coli) Establishments that slaughter more than one type of livestock or both livestock and... E. coli that is approved as an AOAC Official Method of the AOAC International (formerly the...

  1. Detection of pathogenic micro-organisms on children's hands and toys during play.

    Science.gov (United States)

    Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C

    2014-06-01

    This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.

  2. Pathogenic microorganisms survival in ambrosiaSobrevivência de micro-organismos patogênicos em ambrósia

    Directory of Open Access Journals (Sweden)

    Cláudio Dias Timm

    2013-09-01

    Full Text Available Ambrosia is a kind of dulce de leche homemade with milk, eggs and sugar. It is usually sold in free markets and it is largely consumed in South America. Food contamination by pathogenic microorganisms can occur during the food processing, in distribution centers, in retail markets or in the consumer’s homes. The aim of this study was to evaluate the survival in ambrosia of main pathogenic microorganisms eventually transmitted by dairy products. Ambrosia fractions were experimentally contaminated with Salmonella enterica subsp. enterica serotype Typhimurium, Escherichia coli O157:H7, Listeria monocytogenes and Staphylococcus aureus. Analysis to evaluate the microorganisms’ viability were made after storage for 0, 1, 2, 3, 5, 10, 20 and 30 days. Salmonella and L. monocytogenes were recovered from all samples during the 30 days of study. E. coli O157:H7 was isolated until the tenth day and S. aureus until the third day. It was demonstrated that important pathogenic microorganisms are able to survive up to 30 days in ambrosia, which makes this product a potential carrier of food-borne diseases. This work is the first study about the possibility of ambrosia transmitting relevant public-health danger pathogenic microorganisms. Ambrosia é um tipo de doce de leite preparado artesanalmente com leite, ovos e açúcar, comumente comercializado em feiras livres e muito consumido na América do Sul. A contaminação de alimentos por microrganismos patogênicos pode ocorrer durante as etapas de processamento, nos centros de distribuição, no mercado varejista ou na casa do consumidor. O trabalho teve como objetivo avaliar a sobrevivência em ambrosia dos principais microrganismos patogênicos eventualmente transmitidos por leite e derivados. Alíquotas de ambrosia foram experimentalmente contaminadas com Salmonella enterica subsp. enterica sorotipo Typhimurium, Escherichia coli O157:H7, Listeria monocytogenes e Staphylococcus aureus. Foram realizadas

  3. Effect of γ-irradiation on the occurrence of pathogenic microorganisms and nutritive value of four principal cereal grains

    International Nuclear Information System (INIS)

    Aziz, N.H.; Souzan, R.M.; Shahin Azza, A.

    2006-01-01

    The effects of 60 Co γ-photon-irradiation on the natural occurrence of pathogenic microorganisms in four principal cereal grains and on amino acids and vitamins in these cereals were investigated. The total numbers of aerobic bacteria were reduced by three logarithmic decades when grains were given a dose of 10 kGy. Coliforms and 'coagulase- positive' staphylococci were inhibited by a dose of 1 kGy, whereas fungi were inhibited by a dose of 5 kGy. The 15 kGy dose eliminated viable microorganisms in cereal grains, and about 10-30 colony-forming units of Clostridium sp. per gram of grain survived after this dose. The dose of 10 kGy did not cause any measurable destruction of total amino acids. Thiamin was reduced by 22-33% and riboflavin by 10-16% after a dose of 10 kGy. Irradiation did not increase the acid values significantly, but did increase the peroxide values, which was not accompanied by the off-odors of cereals. We conclude that the overall dose of 10 kGy is very effective for microbial decontamination of cereal grains, and does not adversely affect the nutritional quality of cereal grains

  4. Soil eukaryotic microorganism succession as affected by continuous cropping of peanut--pathogenic and beneficial fungi were selected.

    Directory of Open Access Journals (Sweden)

    Mingna Chen

    Full Text Available Peanut is an important oil crop worldwide and shows considerable adaptability but growth and yield are negatively affected by continuous cropping. Soil micro-organisms are efficient bio-indicators of soil quality and plant health and are critical to the sustainability of soil-based ecosystem function and to successful plant growth. In this study, 18S rRNA gene clone library analyses were employed to study the succession progress of soil eukaryotic micro-organisms under continuous peanut cultivation. Eight libraries were constructed for peanut over three continuous cropping cycles and its representative growth stages. Cluster analyses indicated that soil micro-eukaryotic assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. Six eukaryotic groups were found and fungi predominated in all libraries. The fungal populations showed significant dynamic change and overall diversity increased over time under continuous peanut cropping. The abundance and/or diversity of clones affiliated with Eurotiales, Hypocreales, Glomerales, Orbiliales, Mucorales and Tremellales showed an increasing trend with continuous cropping but clones affiliated with Agaricales, Cantharellales, Pezizales and Pyxidiophorales decreased in abundance and/or diversity over time. The current data, along with data from previous studies, demonstrated that the soil microbial community was affected by continuous cropping, in particular, the pathogenic and beneficial fungi that were positively selected over time, which is commonplace in agro-ecosystems. The trend towards an increase in fungal pathogens and simplification of the beneficial fungal community could be important factors contributing to the decline in peanut growth and yield over many years of continuous cropping.

  5. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed. PMID:25332721

  6. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Directory of Open Access Journals (Sweden)

    Kamal Rai Aneja

    2014-01-01

    Full Text Available Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  7. Emerging preservation techniques for controlling spoilage and pathogenic microorganisms in fruit juices.

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  8. Distribution of pathogenic microorganisms isolated from dental hospital workers in Korea

    Directory of Open Access Journals (Sweden)

    Su Jung Kim

    2013-04-01

    Full Text Available With the significant rise in hospital infection management in dental hospitals as well as in hospitals, and in order to identify the distribution of pathogenic bacteria on hands and nasal cavity of workers in a dental hospital, bacteria from the hands and nasal cavities of six dentists and 44 dental hygienists from four dental hospitals were investigated. The results showed Staphylococcus aureus (13, Staphylococcus capitis (1, Staphylococcus epidermidis (12, Staphylococcus hominis (4, Staphylococcus warneri (3, Staphylococcus xylosus (14, Staphylococcus. Lugdunensis (1, and Neisseria spp. (2 were isolated from the nasal cavity and Staphylococcus aureus (9, Staphylococcus capitis (4, Staphylococcus epidermidis (16, Staphylococcus hominis (8, Staphylococcus warneri (5, Staphylococcus xylosus (22, Staphylococcus leutus (3, Micrococcus spp. (4, Staphylococcus cohnii (1, Serratia marcescens (2, Pseudomonas aeruginosa (3, Klebsiella pneumonia (2 and Pseudomonas pneumotropica (1 from the hands. An antimicrobial disk diffusion test was conducted on Staphylococcus aureus isolated from the hands and nasal cavity to detect MRSA by means of oxacillin. Two strains were detected. When the genes of penicillin binding protein 2 (mecA were detected from the 2 strains, MRSA was found from both strains. The results of this investigation on the distribution of various pathogenic bacteria and MRSA on hands and nasal cavity of workers of a dental hospital, will contribute to the basic data for the future infection management in a dental hospital.

  9. Behaviour of pathogenic microorganisms and parasites in biogas production from sewage sludge and municipal wastes

    Energy Technology Data Exchange (ETDEWEB)

    Walter-Matsui, R.; Seipp, M.

    With a grant from VW-Stiftung a project was investigated by the 'Medizinisches Zentrum fuer Hygiene, Philipps-Universitaet, Marburg' and the 'Faculty of Agriculture, Fayum, University Cairo'. The aim was to modify the biogas process to get an optimal amount of biogas and to kill the pathogen bacteria at the same time. The effect of different materials, for example, plant wastes, sewage sludge, cow dung and town refuse and their various amounts of dry matters (2% - 16%) were tested. Also the bactericidal effects of pH, Lactobacilli and higher temperatures were checked. It was found that only a pasteurisation before the fermentation decontaminate the sludge without declining amounts of biogas. It was also proved that the development of Schistosoma eggs was interrupted by the fermentation process.

  10. Regioselective Galactofuranosylation for the Synthesis of Disaccharide Patterns Found in Pathogenic Microorganisms.

    Science.gov (United States)

    Legentil, Laurent; Cabezas, Yari; Tasseau, Olivier; Tellier, Charles; Daligault, Franck; Ferrières, Vincent

    2017-07-21

    Koenigs-Knorr glycosylation of acceptors with more than one free hydroxyl group by 2,3,5,6-tetrabenzoyl galactofuranosyl bromide was performed using diphenylborinic acid 2-aminoethyl ester (DPBA) as inducer of regioselectivity. High regioselectivity for the glycosylation on the equatorial hydroxyl group of the acceptor was obtained thanks to the transient formation of a borinate adduct of the corresponding 1,2-cis diol. Nevertheless formation of orthoester byproducts hampered the efficiency of the method. Interestingly electron-withdrawing groups on O-6 or on C-1 of the acceptor displaced the reaction in favor of the desired galactofuranosyl containing disaccharide. The best yield was obtained for the furanosylation of p-nitrophenyl 6-O-acetyl mannopyranoside. Precursors of other disaccharides, found in the glycocalix of some pathogens, were synthesized according to the same protocol with yields ranging from 45 to 86%. This is a good alternative for the synthesis of biologically relevant glycoconjugates.

  11. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    Directory of Open Access Journals (Sweden)

    Chotiah S

    2013-06-01

    Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

  12. Anti-lipolytic activity and phytochemical screening ofChelianthesalbomarginataagainst pathogenic microorganisms

    Directory of Open Access Journals (Sweden)

    Rini Jarial

    2017-12-01

    Full Text Available ABSTRACT:The aim of the present study was to evaluate the therapeutic properties of selected fern, Chelianthusalbomarginataand to identify its functional compounds. The methanolic fern-extract (MFE of these ferns was assessed for anti-bacterial activities by measuring inhibition zones against a panel of pathogenic bacterial strains using agar diffusion method. MFE at a concentration of 25 μg/ml showed marked anti-bacterial activity against all bacterial strains (6-23mm zone of inhibition and was maximum against Enterobacter sp (23 mm. In addition, the MFE of C. albomarginatahad the best MIC values of 2.25µg/ml against S. aureus and Enterobacter sp., respectively. The MFE also possessed good anti-lipolytic activity (66.5% against a porcine pancreatic lipase (PPL and cholesterol oxidase inhibition (79%. This result showed that MFE of C. albomarginataunder optimal concentrationis not only a potent source of natural anti-oxidants and anti-bacterial activity but also possesses efficient cholesterol degradation and anti-lipolytic activities, that is to be beneficial in the body weight management.

  13. The use of ionizing radiation as a method of eliminating pathogenic microorganism in hamburgers

    International Nuclear Information System (INIS)

    Zarate, H.; Espinoza B, J; Maier, L; Silva, J.R

    2002-01-01

    The application of ionizing energy in hamburgers of a trade mark, was studied by the University Santo Tomas in conjunction with the Chilean Nuclear Energy Commission in order to eliminate pathogens such as Escherichia coli and Salmonella sp and to search for organoleptic characteristic by means of determined doses. A total of 144 frozen hamburgers (-18 o C) were analyzed and divided into three equal groups. Each hamburger - weighting 115 g - was put into sealed polietilene bags. The first two sample groups were sterilized with an irradiation doses of 25 kGy, then inoculated with Escherichia coli O157:H7 strain ATCC 25922 ISP (Instituto de Salud Publica) and Salmonella sp strain ATCC 2714-99 ISP. The third group was not sterilized because it corresponded to the control group. The samples of each group were treated with gamma irradiation ( 60 Co), with doses of 0, 1, 2 and 4 kGy analyzing the bacteria counts after 24 hours, 30 days and 60 days post radiation. D 10 values of 0,472 to 0,494 kGy for the Escherichia coli and 0,649 to 0,697 kGy for the Salmonella sp were found. The storage time did not time exert any influence on the D 10 values. The storage time also showed meaningful differences between the days 1, 30 and 60, nevertheless, this fact was not reflected in the results obtained in the D 10 value. The organoleptic analysis of hamburger was done by means of a trained sensorial panel who evaluated samples with 0; 1,5 and 3 kGy. Each person tasted 55 approximately of each sample and evaluated; appearance, color, aroma, sweetness, acidity, bitterness, texture, flavor and acceptability. Statistically, none attribute showed significant differences (p .05) between the radiated samples and the control group, concluding that the level of the hamburger acceptability was qualified as good (au)

  14. The Evaluation of Small Intestinal Volvulus Caused by PathogenicMicroorganisms in a Thoroughbred Mare

    Directory of Open Access Journals (Sweden)

    Javad Javanbakht

    2013-11-01

    Full Text Available Background: Small intestinal (SI volvulus is defined as a rotation of greater than 180 degrees about its mesentery of a segment of jejunum or ileum. Horses of all ages have been affected. There is typically an acute onset of signs of mild to severe pain. Objectives: The objective of this study was to evaluate the microbial pathogens of the duodenum, ileum, cecum, colon and rectum (feces in associated with volvulus horse, and to determine whether rectal (fecal samples are representative of proximal segments of the gastrointestinal tract. Materials and Methods: A brown 26 years old mare, BCS (body condition score 4 was found dead in stall in the morning. It was moved to a suitable area to conduct a post-mortem exam. The mare was examined in hanging position and then left lateral-recumbent. Advanced abdominal tympany was present. Clinical signs, laboratory data, surgical or necropsy findings, clinic-histopathological findings and outcome for horse with SI volvulus was obtained from medical records, and identified by manual review. Horsefeces and colon were collected in autopsy. Fecal material was scooped from the center of a freshly defecated bolus into sterile sample cups, which were placed into plastic anaerobe jars with PackAnaero sachets (Mitsubishi Gas Co. via Remel, Lenexa, KS and transported to the laboratory. Alternatively, colon contents were collected from horse at the autopsy by direct incision into the colon immediately after the horse was autopsied. The samples were transported anaerobically to the laboratory. Results: On opening the abdominal cavity; a large quantity of sanguineous, foul-smelling fluid with pus exited the perforated bowel wall (hemoperitoneum. Additionally, signs of an acute diffuse peritonitis were visible. The blood vessels of the stomach and intestines were distended. Small intestinal volvulus was observed in several segments (360 degree rotation involving the mesentery. This information may aid diagnosis and

  15. The use of ionizing radiation as a method of eliminating pathogenic microorganism in Chicken Nuggets

    International Nuclear Information System (INIS)

    Kaempffer R, Daniela; Espinoza B, Juan; Maier N, Liliana; Torres, Ximena; Zarate S, Herman

    2005-01-01

    In order to determine an effective treatment of ionizing energy on chicken nuggets a study was developed so as to eliminate pathogens such as Escherichia coli and Salmonella enteritidis. The experiment included 3 types of analyses: aerobic plate count, organoleptic evaluation and chemical analyses. A total of 144 frozen nuggets (-18 o C )were analyzed and divided into two equal groups for proceeding with artificial contamination.Each nugget -weighting 25 g -was put into sealed polietilene bags.The two sample groups were sterilized with irradiation doses of 25 kGy, then inoculated with Escherichia coli O157:H7 strain ATCC 25922 ISP (Instituto de Salud Publica) and Salmonella enteritidis strain ATCC 1833-99 ISP. The samples of each group were treated with gamma irradiation (Co 60 ), with doses of 0,3;0,6 and 0,9 kGy,except for one group (control) which was not irradiated, and stored for 24 hours, 30 and 60 days post radiation. The D 10 values mid-point were found for the Escherichia coli to be 0,242 kGy and 0,295 kGy for the Salmonella enteritidis. A third group, composed by 9 randomly selected nuggets without sterilization was chosen to determine the total aerobic plate counts, resulting in an initial count of 6,15x 10 4 ufc/g. The sensory analysis of nuggets was done by means of a trained sensorial panel who evaluated samples with 0,75 and 1,5 kGy and those of the control group non irradiated. Each person tasted the whole sample (25 g)and evaluated: appearance, color, odor, bitterness, texture, flavor and acceptability. Statistically, none attribute showed significant differences (p≤0.05)between the radiated samples and the control group, concluding that the level of the nugget acceptability was qualified as very good. The chemical analysis of nuggets was done in two groups: A control group and an irradiated group with 1.5 kGy. It evaluated the percentage of proteins, fats, ashes, humidity and carbohydrates. Statistically, none of the nutrients showed significant

  16. The use of ionizing radiation as a method of eliminating pathogenic microorganisms in hamburgers

    International Nuclear Information System (INIS)

    Zarate S, Herman; Espinoza B, Juan; Maier N, Liliana; Silva, Jose R

    2003-01-01

    Radiation as a food preservation method has long been used in many countries, among them Chile. The application of this technology to brand name hamburgers was studied by Santo Tomas University together with the Chilean Nuclear Energy Commission in order to eliminate pathogens such as Escherichia coli and Salmonella sp and to identify organoleptic characteristics using specific doses. A total of 144 frozen hamburgers (-18 o C) were analyzed and divided into three equal groups. Each hamburger - weighing 115 g approximately - was put into sealed polyethylene bags. The first two sample groups were sterilized with irradiation doses of 25 kGy, then inoculated with Escherichia coli O157:H7 strain ATCC 25922 ISP (Instituto de Salud Publica) and Salmonella sp strain ATCC 2714-99 ISP. The inoculating strains were prepared in the Microbiology Laboratory of Santo Tomas University. The third group was not sterilized because it was the control group. The samples were treated with gamma irradiation (Co 60 ), with doses of 0, 1, 2 and 4 kGy analyzing the bacteria counts after 24 hours, 30 days and 60 days post radiation. Their values D 10 were also investigated finding values of 0.472 to 0.494 kGy for the Escherichia coli and 0.649 to 0.697 kGy for the Salmonella sp. The storage time did not influence the values D 10 . The statistical analysis reveals that there are significant differences among the species (p 0,05), due to the diverse nature of the bacteria. Similarly, storage times also showed meaningful differences between days 1, 30 and 60, but this fact was not reflected in the results obtained in the D 10 . The organoleptic analysis of hamburger was done by means of a sensory evaluation panel of 12 members, which evaluated samples with 0; 1.5 and 3 kGy. Each person tasted about 55 of each sample and evaluated nine attributes such as appearance, color, aroma, sweetness, acidity, bitterness, texture, flavor and acceptability. Statistically, no attribute showed significant

  17. The use of ionizing radiation as a method of eliminating pathogenic microorganisms in hamburgers

    International Nuclear Information System (INIS)

    Zarate Segovia, Herman Eduardo

    2002-01-01

    Radiation as a food preservation method has long been used in many countries, among them Chile. The application of this technology to brand name hamburgers was studied by Santo Tomas University together with the Chilean Nuclear Energy Commission in order to eliminate pathogens such as Escherichia coli and Salmonella sp and to identify organoleptic characteristics using specific doses. A total of 144 frozen hamburgers (-18 deg C) were analyzed and divided into three equal groups. Each hamburger - weighing 115 g approximately - was put into sealed polyethylene bags. The first two sample groups were sterilized with irradiation doses of 25 kGy, then inoculated with Escherichia coli 0157:H7 strain ATCC 25922 ISP (Instituto de Salud Publica) and Salmonella sp strain ATCC 2714-99 ISP. The inoculating strains were prepared in the Microbiology Laboratory of Santo Tomas University. The third group was not sterilized because it was the control group. The samples were treated with gamma irradiation (Co 60 ), with doses of 0, 1, 2 and 4 kGy analyzing the bacteria counts after 24 hours, 30 days and 60 days post radiation. Their values D 10 were also investigated finding values of 0.472 to 0.494 kGy for the Escherichia coli and 0.649 to 0.697 kGy for the Salmonella sp. The storage time did not influence the values D 10 . The statistical analysis reveals that there are significant differences among the species (p ≤0,05), due to the diverse nature of the bacteria. Similarly, storage times also showed meaningful differences between days 1, 30 and 60, but this fact was not reflected in the results obtained in the D 10 . The organoleptic analysis of hamburger was done by means of a sensory evaluation panel of 12 members, which evaluated samples with 0; 1.5 and 3 kGy. Each person tasted about 55 of each sample and evaluated nine attributes such as appearance, color, aroma, sweetness, acidity, bitterness, texture, flavor and acceptability. Statistically, no attribute showed

  18. Biofilm inhibition activity of traditional medicinal plants from Northwestern Argentina against native pathogen and environmental microorganisms

    Directory of Open Access Journals (Sweden)

    Cintia Mariana Romero

    Full Text Available Abstract: INTRODUCTION: Plants have been commonly used in popular medicine of most cultures for the treatment of disease. The in vitro antimicrobial activity of certain Argentine plants used in traditional medicine has been reported. The aim of this study was to investigate the antimicrobial, anti-biofilm, and anti-cell adherence activities of native plants (Larrea divaricata, Tagetes minuta, Tessaria absinthioides, Lycium chilense, and Schinus fasciculatus collected in northwestern Argentina. METHODS: The activities of the five plant species were evaluated in Bacillus strains and clinical strains of coagulase-negative Staphylococcus isolated from northwestern Argentina and identified by 16S rDNA. RESULT: Lycium chilense and Schinus fasciculatus were the most effective antimicrobial plant extracts (15.62µg/ml and 62.50µg/ml for Staphylococcus sp. Mcr1 and Bacillus sp. Mcn4, respectively. The highest (66% anti-biofilm activity against Bacillus sp. Mcn4 was observed with T. absinthioides and L. divaricate extracts. The highest (68% anti-biofilm activity against Staphylococcus sp. Mcr1 was observed with L. chilense extract. T. minuta, T. absinthioides, and L. divaricata showed percentages of anti-biofilm activity of between 55% and 62%. The anti-adherence effects of T. minuta and L. chilense observed in Bacillus sp. Mcn4 reflected a difference of only 22% and 10%, respectively, between anti-adherence and biofilm inhibition. Thus, the inhibition of biofilm could be related to cell adherence. In Staphylococcus sp. Mcr1, all plant extracts produced low anti-adherence percentages. CONCLUSION: These five species may represent a source of alternative drugs derived from plant extracts, based on ethnobotanical knowledge from northwest Argentina.

  19. Phytochemical profiles and antimicrobial activity of aromatic Malaysian herb extracts against food-borne pathogenic and food spoilage microorganisms.

    Science.gov (United States)

    Aziman, Nurain; Abdullah, Noriham; Noor, Zainon Mohd; Kamarudin, Wan Saidatul Syida Wan; Zulkifli, Khairusy Syakirah

    2014-04-01

    Preliminary phytochemical and flavonoid compounds of aqueous and ethanolic extracts of 6 aromatic Malaysian herbs were screened and quantified using Reverse-Phase High Performance Liquid Chromatography (RP-HPLC). The herbal extracts were tested for their antimicrobial activity against 10 food-borne pathogenic and food spoilage microorganisms using disk diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)/minimum fungicidal concentration (MFC) of herbal extracts were determined. In the phytochemical screening process, both aqueous and ethanolic extracts of P. hydropiper exhibited presence of all 7 tested phytochemical compounds. Among all herbal extracts, the aqueous P. hydropiper and E. elatior extracts demonstrated the highest antibacterial activity against 7 tested Gram-positive and Gram-negative bacteria with diameter ranging from 7.0 to 18.5 mm and 6.5 to 19 mm, respectively. The MIC values for aqueous and ethanolic extracts ranged from 18.75 to 175 mg/mL and 0.391 to 200 mg/mL, respectively while the MBC/MFC values for aqueous and ethanolic extracts ranged from 25 to 200 mg/mL and 3.125 to 50 mg/mL, respectively. Major types of bioactive compounds in aqueous P. hydropiper and E. elatior extracts were identified using RP-HPLC instrument. Flavonoids found in these plants were epi-catechin, quercetin, and kaempferol. The ability of aqueous Persicaria hydropiper (L.) H. Gross and Etlingera elatior (Jack) R.M. Sm. extracts to inhibit the growth of bacteria is an indication of its broad spectrum antimicrobial potential. Hence these herbal extracts may be used as natural preservative to improve the safety and shelf-life of food and pharmaceutical products. © 2014 Institute of Food Technologists®

  20. Biological activities of Rosmarinus officinalis L. (rosemary) extract as analyzed in microorganisms and cells

    Science.gov (United States)

    de Jesus, Daiane; Figueira, Leandro Wagner; de Oliveira, Felipe Eduardo; Pacheco Soares, Cristina; Camargo, Samira Estves Afonso; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

    2017-01-01

    ≤ 50 mg/mL), showed anti-inflammatory effect, and was not genotoxic. Impact statement Rosmarinus officinalis L. extract effectively contributed to in vitro control of important species of microorganisms such as Candida albicans, Staphylococcus aureus, Enterococcus faecalis, Streptococcus mutans, and Pseudomonas aeruginosa in mono- and polymicrobial biofilms that are responsible for several infections in oral cavity as in other regions of the body. Furthermore, this extract promoted also cell viability above 50% at concentrations ≤ 50 mg/mL, excellent anti-inflammatory effect, showing inhibition or reduction of the synthesis of proinflammatory cytokines, being also non-genotoxic to cell lines studied. Thus, this extract may be a promising therapeutic agent that can be added in some medical and dental formulations such as toothpastes, mouthwashes, irrigating root canals, ointments, soaps, in order to control pathogenic microorganisms and biofilms, with anti-inflammatory effect and absence of cytotoxic and genotoxic. PMID:28093936

  1. A combined microscopic and macroscopic approach to modeling the transport of pathogenic microorganisms from nonpoint sources of pollution

    DEFF Research Database (Denmark)

    Yeghiazarian, L.L.; Walker, M.J.; Binning, Philip John

    2006-01-01

    is important for accurate risk assessment and prediction of water contamination events. This paper presents a stochastic Markov model of microorganism transport, with distinct states of microorganism behavior capturing the microbial partitioning between solid and aqueous phases in runoff and soil surface...

  2. Pulsed electric field processing of different fruit juices: impact of pH and temperature on inactivation of spoilage and pathogenic micro-organisms.

    Science.gov (United States)

    Timmermans, R A H; Nierop Groot, M N; Nederhoff, A L; van Boekel, M A J S; Matser, A M; Mastwijk, H C

    2014-03-03

    Pulsed electrical field (PEF) technology can be used for the inactivation of micro-organisms and therefore for preservation of food products. It is a mild technology compared to thermal pasteurization because a lower temperature is used during processing, leading to a better retention of the quality. In this study, pathogenic and spoilage micro-organisms relevant in refrigerated fruit juices were studied to determine the impact of process parameters and juice composition on the effectiveness of the PEF process to inactivate the micro-organisms. Experiments were performed using a continuous-flow PEF system at an electrical field strength of 20 kV/cm with variable frequencies to evaluate the inactivation of Salmonella Panama, Escherichia coli, Listeria monocytogenes and Saccharomyces cerevisiae in apple, orange and watermelon juices. Kinetic data showed that under the same conditions, S. cerevisiae was the most sensitive micro-organism, followed by S. Panama and E. coli, which displayed comparable inactivation kinetics. L. monocytogenes was the most resistant micro-organism towards the treatment conditions tested. A synergistic effect between temperature and electric pulses was observed at inlet temperatures above 35 °C, hence less energy for inactivation was required at higher temperatures. Different juice matrices resulted in a different degree of inactivation, predominantly determined by pH. The survival curves were nonlinear and could satisfactorily be modeled with the Weibull model. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    Indian Academy of Sciences (India)

    DANG SUN

    Two regulatory T cell clones (Tregs) were used in this study. Treg1 cells were clone-derived from the previously described. Keywords. methylation; cDNA microarray; type 1 diabetes; pathogenic T cells; .... Gender-specific differences in.

  4. Cell surface engineering of microorganisms towards adsorption of heavy metals.

    Science.gov (United States)

    Li, Peng-Song; Tao, Hu-Chun

    2015-06-01

    Heavy metal contamination has become a worldwide environmental concern due to its toxicity, non-degradability and food-chain bioaccumulation. Conventional physical and chemical treatment methods for heavy metal removal have disadvantages such as cost-intensiveness, incomplete removal, secondary pollution and the lack of metal specificity. Microbial biomass-based biosorption is one of the approaches gaining increasing attention because it is effective, cheap, and environmental friendly and can work well at low concentrations. To enhance the adsorption properties of microbial cells to heavy metal ions, the cell surface display of various metal-binding proteins/peptides have been performed using a cell surface engineering approach. The surface engineering of Gram-negative bacteria, Gram-positive bacteria and yeast towards the adsorption of heavy metals are reviewed in this article. The problems and future perspectives of this technology are discussed.

  5. Genetic reprogramming of host cells by bacterial pathogens.

    Science.gov (United States)

    Tran Van Nhieu, Guy; Arbibe, Laurence

    2009-10-29

    During the course of infection, pathogens often induce changes in gene expression in host cells and these changes can be long lasting and global or transient and of limited amplitude. Defining how, when, and why bacterial pathogens reprogram host cells represents an exciting challenge that opens up the opportunity to grasp the essence of pathogenesis and its molecular details.

  6. Artificial inorganic Biohybrids: the functional combination of microorganisms and cells with inorganic materials.

    Science.gov (United States)

    Holzmeister, Ib; Schamel, Martha; Groll, Jürgen; Gbureck, Uwe; Vorndran, Elke

    2018-04-23

    Biohybrids can be defined as the functional combination of proteins, viable cells or microorganisms with non-biological materials. This article reviews recent findings on the encapsulation of microorganisms and eukaryotic cells in inorganic matrices such as silica gels or cements. The entrapment of biological entities into a support material is of great benefit for processing since the encapsulation matrix protects sensitive cells from shear forces, unfavourable pH changes, or cytotoxic solvents, avoids culture-washout, and simplifies the separation of formed products. After reflecting general aspects of such an immobilization as well as the chemistry of the inorganic matrices, we focused on manufacturing aspects and the application of such biohybrids in biotechnology, medicine as well as in environmental science and for civil engineering purpose. The encapsulation of living cells and microorganisms became an intensively studied and rapidly expanding research field with manifold applications in medicine, bio- and environmental technology, or civil engineering. Here, the use of silica or cements as encapsulation matrices have the advantage of a higher chemical and mechanical resistance towards harsh environmental conditions during processing compared to their polymeric counterparts. In this perspective, the article gives an overview about the inorganic material systems used for cell encapsulation, followed by reviewing the most important applications. The future may lay in a combination of the currently achieved biohybrid systems with additive manufacturing techniques. In a longer perspective, this would enable the direct printing of cell loaded bioreactor components. Copyright © 2018. Published by Elsevier Ltd.

  7. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis

    Science.gov (United States)

    Khan, Raees; Roy, Nazish; Choi, Kihyuck

    2018-01-01

    The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed

  8. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

    Directory of Open Access Journals (Sweden)

    Raees Khan

    Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

  9. Electrical resistivity and dielectric properties of helical microorganism cells coated with silver by electroless plating

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Jun, E-mail: jun_cai@buaa.edu.cn [Bionic and Micro/Nano/Bio Manufacturing Technology Research Center, School of Mechanical Engineering and Automation, Beihang University, Beijing 100191 (China); Lan, Mingming; Zhang, Deyuan; Zhang, Wenqiang [Bionic and Micro/Nano/Bio Manufacturing Technology Research Center, School of Mechanical Engineering and Automation, Beihang University, Beijing 100191 (China)

    2012-09-01

    Highlights: Black-Right-Pointing-Pointer We use the microorganism cells as forming templates to fabricate the bio-based conductive particles. Black-Right-Pointing-Pointer The microorganism cells selected as forming templates are Spirulina platens, which are of natural helical shape and high aspect ratio. Black-Right-Pointing-Pointer The sliver-coated Spirulina cells are a kind of lightweight conductive particles. Black-Right-Pointing-Pointer The composites containing sliver-coated Spirulina cells exhibit a lower percolation value. - Abstract: In this paper, microorganism cells (Spirulina platens) were used as forming templates for the fabrication of the helical functional particles by electroless silver plating process. The morphologies and ingredients of the coated Spirulina cells were analyzed with scanning electron microscopy and energy dispersive spectrometer. The crystal structures were characterized by employing the X-ray diffraction. The electrical resistivity and dielectric properties of samples containing different volume faction of sliver-coated Spirulina cells were measured and investigated by four-probe meter and vector network analyzer. The results showed that the Spirulina cells were successfully coated with a uniform silver coating and their initial helical shapes were perfectly kept. The electrical resistivity and dielectric properties of the samples had a strong dependence on the volume content of sliver-coated Spirulina cells and the samples could achieve a low percolation value owing to high aspect ratio and preferable helical shape of Spirulina cells. Furthermore, the conductive mechanism was analyzed with the classic percolation theory, and the values of {phi}{sub c} and t were obtained.

  10. A Quantitative Assessment of the Morphofunctional Activity of the Population of Mast Cells Exposed to Biotechnological Strains of Microorganisms

    Directory of Open Access Journals (Sweden)

    Natalia Sheina

    2018-06-01

    Full Text Available In order to assess the sensitizing properties of bacteria, micromycetes and actinomycetes, the morphofunctional activity of the population of mast cells was tested in rats exposed to biotechnological microorganisms. The result showed the high informative value of the test of peritoneal must cell degranulation. Both the result and the intensity of the response of mast cells to the exposure to the tested strains depend on the taxonomy of microorganisms, their concentration and the mode of inoculation. The test of peritoneal must cell degranulation can be recommended for assessing the biological safety of industrial microorganisms.

  11. Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

    Science.gov (United States)

    García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

    2016-01-01

    The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

  12. Study of molasses / vinasse waste ratio for single cell protein and total microorganisms

    Directory of Open Access Journals (Sweden)

    Marcia Luciana Cazetta

    2006-02-01

    Full Text Available Different molasses/ vinasse ratio were used as substrate to investigate single cell protein and total lipids production by five microorganisms: four yeasts strains: Candida lipolytica, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, a yeast isolated from vinasse lake (denominated LLV98 and a bacterium strain, Corynebacterium glutamicum. The media utilized were: a 50% molasses and 50% vinasse; b 25% molasses and 75% vinasse and c 75% molasses and 25% vinasse. The objective of this work was to study the growth of microorganisms and also evaluate protein and lipids content in the biomass obtained from these by-products. The highest single cell protein production was obtained by S. cerevisiae, 50.35%, followed by R. mucilaginosa, 41.96%. The lowest productions were obtained by C. glutamicum. The higher total lipids productions, more than 26%, were founded in molasses plus vinasse at 50%/50% by S. cerevisiae and C. glutamicum.

  13. Lipids in host-pathogen interactions: pathogens exploit the complexity of the host cell lipidome.

    Science.gov (United States)

    van der Meer-Janssen, Ynske P M; van Galen, Josse; Batenburg, Joseph J; Helms, J Bernd

    2010-01-01

    Lipids were long believed to have a structural role in biomembranes and a role in energy storage utilizing cellular lipid droplets and plasma lipoproteins. Research over the last decades has identified an additional role of lipids in cellular signaling, membrane microdomain organization and dynamics, and membrane trafficking. These properties make lipids an attractive target for pathogens to modulate host cell processes in order to allow their survival and replication. In this review we will summarize the often ingenious strategies of pathogens to modify the lipid homeostasis of host cells, allowing them to divert cellular processes. To this end pathogens take full advantage of the complexity of the lipidome. The examples are categorized in generalized and emerging principles describing the involvement of lipids in host-pathogen interactions. Several pathogens are described that simultaneously induce multiple changes in the host cell signaling and trafficking mechanisms. Elucidation of these pathogen-induced changes may have important implications for drug development. The emergence of high-throughput lipidomic techniques will allow the description of changes of the host cell lipidome at the level of individual molecular lipid species and the identification of lipid biomarkers.

  14. Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce

    Directory of Open Access Journals (Sweden)

    Sujata A. Sirsat

    2013-11-01

    Full Text Available Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce. Following this, an intervention study was performed to combat foodborne pathogen surrogates (Salmonella and E. coli, spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid significantly reduced Salmonella, E. coli, coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless, it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

  15. Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce.

    Science.gov (United States)

    Sirsat, Sujata A; Neal, Jack A

    2013-11-11

    Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens) production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce). Following this, an intervention study was performed to combat foodborne pathogen surrogates ( Salmonella and E. coli ), spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid) significantly reduced Salmonella , E. coli , coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless), it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

  16. Preclinical and clinical studies of photodynamic action on some pathogenic micro-organisms of the oral cavity

    Science.gov (United States)

    Ovchinnikov, Ilya S.; Tuchin, Valery V.; Ivanov, Krill I.; Titorenko, Vladimir A.

    2001-10-01

    The work is devoted to an analysis of pre-clinical and clinical experiments on photodynamic action of HeNe laser radiation in aggregate with a cation thiazinium dye Methylene Blue (MB) on a mix of pathogenic and conditionally pathogenic aerobic bacteria being activators of pyoinflammatory diseases of oral cavity. Concentration of photosensitizes at which there is no own bactericidal influence on dying microflora, and parameters of influence at which the efficiency of irradiated microflora defeat reaches 99% are determined.

  17. Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms

    International Nuclear Information System (INIS)

    Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z.; Gillow, J.B.; Francis, A.J.

    2004-01-01

    We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K d ) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N H 2 O ) and the degree of strength of ligand field (R E/M ) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K d of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K d , indicating that an exchange with Na + on the functional groups was involved in their sorption. The ΔN H 2 O (= 9 - N H 2 O ) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R E/M for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)

  18. Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z. [Advanced Science Research Center, Japan Atomic Energy Research Inst., Ibaraki (Japan); Gillow, J.B.; Francis, A.J. [Environmental Sciences Dept., Brookhaven National Lab., Upton, NY (United States)

    2004-07-01

    We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K{sub d}) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N{sub H{sub 2}O}) and the degree of strength of ligand field (R{sub E/M}) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K{sub d} of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K{sub d}, indicating that an exchange with Na{sup +} on the functional groups was involved in their sorption. The {delta}N{sub H{sub 2}O} (= 9 - N{sub H{sub 2}O}) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R{sub E/M} for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)

  19. Assets of the non-pathogenic microorganism Dictyostelium discoideum as a model for the study of eukaryotic extracellular vesicles [v1; ref status: indexed, http://f1000r.es/pa

    Directory of Open Access Journals (Sweden)

    Irène Tatischeff

    2013-03-01

    Full Text Available Dictyostelium discoideum microvesicles have recently been presented as a valuable model for eukaryotic extracellular vesicles. Here, the advantages of D. discoideum for unraveling important biological functions of extracellular vesicles in general are detailed. D. discoideum, a non-pathogenic eukaryotic microorganism, belongs to a billion-year-old Amoeboza lineage, which diverged from the animal-fungal lineage after the plant animal-split. During growth and early starvation-induced development, it presents analogies with lymphocytes and macrophages with regard to motility and phagocytosis capability, respectively. Its 6-chromosome genome codes for about 12,500 genes, some showing analogies with human genes. The presence of extracellular vesicles during cell growth has been evidenced as a detoxification mechanism of various structurally unrelated drugs. Controls led to the discovery of constitutive extracellular vesicle secretion in this microorganism, which was an important point. It means that the secretion of extracellular vesicles occurs, in the absence of any drug, during both cell growth and early development. This constitutive secretion of D. discoideum cells is very likely to play a role in intercellular communication. The detoxifying secreted vesicles, which can transport drugs outside the cells, can also act as "Trojan horses", capable of transferring these drugs not only into naïve D. discoideum cells, but into human cells as well. Therefore, these extracellular vesicles were proposed as a new biological drug delivery tool. Moreover, Dictyostelium, chosen by the NIH (USA as a new model organism for biomedical research, has already been used for studying some human diseases. These cells, which are much easier to manipulate than human cells, can be easily designed in simple conditioned medium experiments. Owing to the increasing consensus that extracellular vesicles are probably important mediators of intercellular communication, D

  20. How cells jump: Ultrafast motions in the single-celled micro-organism Halteria grandinella

    Science.gov (United States)

    Krishnamurthy, Deepak; Cockenpot, Fabien; Prakash, Manu

    Here we describe a novel behavior of ''jumping'' in micro-organisms, observed in the common freshwater ciliate Halteria grandinella. This organism's swimming motion is characterized by periods of forward swimming at around 10 body lengths/s punctuated by extremely rapid backward ''jumps'' where the organism reaches speeds of more than 150 body lengths/s. We show, using detailed measurements of the swimming motion through high-speed video microscopy, that the extreme swimming speeds are achieved by the motile cilia transitioning to a beating mode characterized by a significantly larger beat amplitude and an associated reversal in the direction of thrust production. We further show that H.grandinella cells can sense a fluid shear stress signal and ''jump'' in response: a possible predator avoidance mechanism. We investigate this mechanism of shear sensing and study the role of the long, slender structures known as ''cirri'' as microscale sensors of shear stress. The jumping of H.grandinella is at the limits of the metabolic rate of the organism and thus offers insights into the limiting factors governing energy storage and mechanical power release at the microscale. Concurrently their sensing apparatus allows an understanding of the physical limits of microscale mechanical sensing. This material is based on work supported by, or in part by, the US Army Research Laboratory and the US Army Research Office under contract/Grant Number W911NF-15-1-0358.

  1. Presence of pathogenic microorganisms in power-plant cooling waters. Report for October 1, 1979-September 30, 1981

    Energy Technology Data Exchange (ETDEWEB)

    Tyndall, R.L.

    1982-10-01

    Cooling waters from eleven geographically disparate power plants were tested for the presence of Naegleria fowleri and Legionella pneumophila (LDB). Control source waters for each plant were also tested for these pathogens. Water from two of the eleven plants contained pathogenic Naegleria, and infectious Legionella were found in seven of the test sites. Pathogenic Naegleria were not found in control waters, but infectious Legionella were found in five of the eleven control source water sites. Concentrations of nitrite, sulfate, and total organic carbon correlated with the concentrations of LDB. A new species of Legionella was isolated from one of the test sites. In laboratory tests, both Acanthamoeba and Naegleria were capable of supporting the growth of Legionella pneumophila.

  2. Stepwise screening of microorganisms for commercial use in biological control of plant pathogenic fungi and bacteria. Biological Control

    NARCIS (Netherlands)

    Köhl, J.; Postma, J.; Nicot, P.; Ruocco, M.

    2011-01-01

    The development of new biocontrol products against plant diseases requires screening of high numbers of candidate antagonists. Antagonists for commercial use have to fulfill many different requirements. Besides being active against the specific targeted plant pathogens they must be safe and

  3. Well-known surface and extracellular antigens of pathogenic microorganisms among the immunodominant proteins of the infectious microalgae Prototheca zopfii.

    Science.gov (United States)

    Irrgang, Alexandra; Murugaiyan, Jayaseelan; Weise, Christoph; Azab, Walid; Roesler, Uwe

    2015-01-01

    Microalgae of the genus Prototheca (P.) are associated with rare but severe infections (protothecosis) and represent a potential zoonotic risk. Genotype (GT) 2 of P. zopfii has been established as pathogenic agent for humans, dogs, and cattle, whereas GT1 is considered to be non-pathogenic. Since pathogenesis is poorly understood, the aim of this study was to determine immunogenic proteins and potential virulence factors of P. zopfii GT2. Therefore, 2D western blot analyses with sera and isolates of two dogs naturally infected with P. zopfii GT2 have been performed. Cross-reactivity was determined by including the type strains of P. zopfii GT2, P. zopfii GT1, and P. blaschkeae, a close relative of P. zopfii, which is known to cause subclinical forms of bovine mastitis. The sera showed a high strain-, genotype-, and species-cross-reactivity. A total of 198 immunogenic proteins have been analyzed via MALDI-TOF MS. The majority of the 86 identified proteins are intracellularly located (e.g., malate dehydrogenase, oxidoreductase, 3-dehydroquinate synthase) but some antigens and potential virulence factors, known from other pathogens, have been found (e.g., phosphomannomutase, triosephosphate isomerase). One genotype-specific antigen could be identified as heat shock protein 70 (Hsp70), a well-known antigen of eukaryotic pathogens with immunological importance when located extracellularly. Both sera were reactive to glyceraldehyde-3-phosphate-dehydrogenase of all investigated strains. This house-keeping enzyme is found to be located on the surface of several pathogens as virulence factor. Flow-cytometric analysis revealed its presence on the surface of P. blaschkeae.

  4. Well-known surface and extracellular antigens of pathogenic microorganisms among the immunodominant proteins of the infectious microalgae Prototheca zopfii

    Directory of Open Access Journals (Sweden)

    Alexandra eIrrgang

    2015-09-01

    Full Text Available Microalgae of the genus Prototheca (P. are associated with rare but severe infections (protothecosis and represent a potential zoonotic risk. Genotype (GT 2 of P. zopfii has been established as pathogenic agent for humans, dogs and cattle, whereas GT1 is considered to be non-pathogenic. Since pathogenesis is poorly understood, the aim of this study was to determine immunogenic proteins and potential virulence factors of P. zopfii GT2. Therefore, 2D western blot analyses with sera and isolates of two dogs naturally infected with P. zopfii GT2 have been performed. Cross-reactivity was determined by including the type strains of P. zopfii GT2, P. zopfii GT1 and P. blaschkeae, a close relative of P. zopfii, which is known to cause subclinical forms of bovine mastitis. The sera showed a high strain-, genotype-, and species-cross-reactivity. A total of 198 immunogenic proteins have been analysed via MALDI- TOF MS. The majority of the 86 identified proteins are intracellularly located (e.g. malate dehydrogenase, oxidoreductase, 3-dehydroquinate synthase but some antigens and potential virulence factors, known from other pathogens, have been found (e.g. phosphomannomutase, triosephosphate isomerase. One genotype-specific antigen could be identified as heat shock protein 70 (Hsp70, a well-known antigen of eukaryotic pathogens with immunological importance when located extracellularly. Both sera were reactive to glyceraldehyde-3-phosphate-dehydrogenase of all investigated strains. This house-keeping enzyme is found to be located on the surface of several pathogens as virulence factor. Flow-cytometric analysis revealed its presence on the surface of P. blaschkeae.

  5. Direct cell writing of 3D microorgan for in vitro pharmacokinetic model.

    Science.gov (United States)

    Chang, Robert; Nam, Jae; Sun, Wei

    2008-06-01

    A novel targeted application of tissue engineering is the development of an in vitro pharmacokinetic model for drug screening and toxicology. An in vitro pharmacokinetic model is needed to realistically and reliably predict in vivo human response to drug administrations and potential toxic exposures. This paper details the fabrication process development and adaptation of microfluidic devices for the creation of such a physiologically relevant pharmacokinetic model. First, an automated syringe-based, layered direct cell writing (DCW) bioprinting process creates a 3D microorgan that biomimics the cell's natural microenvironment with enhanced functionality. Next, soft lithographic micropatterning techniques are used to fabricate a microscale in vitro device to house the 3D microorgan. This paper demonstrates the feasibility of the DCW process for freeform biofabrication of 3D cell-encapsulated hydrogel-based tissue constructs with defined reproducible patterns, direct integration of 3D constructs onto a microfluidic device for continuous perfusion drug flow, and characterization of 3D tissue constructs with predictable cell viability/proliferation outcomes and enhanced functionality over traditional culture methods.

  6. Resistance of pathogenic and spoilage microorganisms to disinfectants in the presence of organic matter and their residual effect on stainless steel and polypropylene.

    Science.gov (United States)

    Iñiguez-Moreno, Maricarmen

    2018-04-23

    The effectiveness of disinfectants can vary according to the microorganism, type of residues and surface. Hence, the aim of this study was to determine the effectiveness of four disinfectants in the presence of organic matter and their residual effect on stainless steel grade 304 (SS) and polypropylene B (PP-B). The disinfectant effectiveness in the presence of meat extract, yolk egg and whole milk was determined according to AOAC and UNE-EN 1040:2015; the residual effect was realized according to UNE-EN 13697:2015, using approved strains. The disinfectant effectiveness was affect at different grades depending on the organic matter present; disinfectant A (400μgmL -1 , fifth generation quaternary ammonium compound, QAC) was most effective in the presence of 10% meat extract, while the disinfectant C (200μgmL -1 , peracetic acid) had better activity in the presence of 10% egg yolk and whole milk. In the evaluation of residual effect onto SS and PP-B, the QAC had the better effect, reducing 6 Log 10 CFU mL -1 of Listeria monocytogenes ATCC 19111 24h after their application. Conversely, the disinfectants had no residual effect against Pseudomonas aeruginosa ATCC 15442. The antimicrobial activity of disinfectants tested against pathogenic and spoilage microorganisms was affected according to the type of organic matter. Disinfectant A had a more residual effect than the other disinfectants evaluated. Moreover, the residual effect of a disinfectant is greater on SS than on PP-B and dependent on the microorganism tested. Copyright © 2018. Published by Elsevier Ltd.

  7. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

    Czech Academy of Sciences Publication Activity Database

    Pálková, Z.; Váchová, Libuše

    2016-01-01

    Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

  8. Pathogen-Reactive T Helper Cell Analysis in the Pig

    Directory of Open Access Journals (Sweden)

    Friederike Ebner

    2017-05-01

    Full Text Available There is growing interest in studying host–pathogen interactions in human-relevant large animal models such as the pig. Despite the progress in developing immunological reagents for porcine T cell research, there is an urgent need to directly assess pathogen-specific T cells—an extremely rare population of cells, but of upmost importance in orchestrating the host immune response to a given pathogen. Here, we established that the activation marker CD154 (CD40L, known from human and mouse studies, identifies also porcine antigen-reactive CD4+ T lymphocytes. CD154 expression was upregulated early after antigen encounter and CD4+CD154+ antigen-reactive T cells coexpressed cytokines. Antigen-induced expansion and autologous restimulation enabled a time- and dose-resolved analysis of CD154 regulation and a significantly increased resolution in phenotypic profiling of antigen-responsive cells. CD154 expression identified T cells responding to staphylococcal Enterotoxin B superantigen stimulation as well as T cells responding to the fungus Candida albicans and T cells specific for a highly prevalent intestinal parasite, the nematode Ascaris suum during acute and trickle infection. Antigen-reactive T cells were further detected after immunization of pigs with a single recombinant bacterial antigen of Streptococcus suis only. Thus, our study offers new ways to study antigen-specific T lymphocytes in the pig and their contribution to host–pathogen interactions.

  9. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    Indian Academy of Sciences (India)

    Reestablishing a well-balanced population of regulatory T cells (Tregs) and pathogenic T cells (Tpaths) is necessary for diabetic patients to regain glucose control. However, the molecular mechanisms modulating functional differentiation of Tpaths and Tregs remain unclear. In this study, we anal- ysed the gene expression ...

  10. Bioactivity of glycolipopeptide cell-bound biosurfactants against skin pathogens.

    Science.gov (United States)

    Vecino, X; Rodríguez-López, L; Ferreira, D; Cruz, J M; Moldes, A B; Rodrigues, L R

    2018-04-01

    The antimicrobial and anti-adhesive activities of the cell-bound biosurfactants, produced by Lactobacillus pentosus (PEB), characterized as glycolipopeptide macromolecules, were evaluated against several microorganisms present in the skin microflora, envisaging its potential use as a "natural" ingredient in cosmetic and personal care formulations. Their performance was compared with another cell-bound biosurfactants also characterized as glycolipopeptides produced by Lactobacillus paracasei (PAB). At concentrations of 50mg/mL, the PEB showed an important antimicrobial activity against Pseudomonas aeruginosa (85% when extracted with phosphate buffer (PB) and 100% when extracted with phosphate buffer saline (PBS)), Streptococcus agalactiae (100% for both extracts), Staphylococcus aureus (67% when extracted with PBS and 100% when extracted with PB), Escherichia coli (72% when extracted with PB and 89% when extracted with PBS), Streptococcus pyogenes (about 85% for both extracts) and Candida albicans (around 70% for both extracts), comparable with that obtained for the PAB. However, at lower concentrations the PAB exhibited in general higher antimicrobial activities. Biosurfactants produced by both microorganisms also showed significant anti-adhesive properties against all the microorganisms under study, except for E. coli and C. albicans (less than 30%). Overall, these cell-bound biosurfactants could be used as potential antimicrobial and anti-adhesive agents in cosmetic and pharmaceutical formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  12. Fate and control of pathogenic and spoilage micro-organisms in orange blossom (Citrus aurantium) and rose flower (Rosa centifolia) hydrosols.

    Science.gov (United States)

    Labadie, C; Cerutti, C; Carlin, F

    2016-12-01

    Hydrosols are hydrodistillation products used in food and cosmetic industries, perfumery, pharmacy and aromatherapy. The ability of preservatives to control previously reported bacterial proliferation and spoilage was evaluated. All tested preservatives were authorized for food and cosmetic application. Major pathogens of concern for foods and cosmetics were poorly able to grow in rose and orange blossom hydrosols when inoculated and incubated at 30°C. Commercial antimicrobials, such as isothiazolinone, chlorphenesin and paraben solutions, benzyl alcohol and sodium benzoate at pH = 5·0, controlled the growth of Pseudomonas and Burkholderia sp. strains representative of the natural microbiota of both hydrosols for >90 days at 30°C, only at concentrations close to the authorized limits. Concentrations of some of the tested preservatives that controlled growth at 5°C were lower than at 30°C. Pathogenic micro-organisms likely represent a low risk in rose flower and orange blossom hydrosol. However, the oligotrophic character of hydrosols and the antimicrobial properties of their essential oils do not prevent microbiological spoilage by the naturally present microbiota. In the absence of aseptic conditions and microbial inactivation process, only preservatives can stabilize hydrosols for a several-month storage. Several effective preservatives have been identified. © 2016 The Society for Applied Microbiology.

  13. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    DEFF Research Database (Denmark)

    Søndergaard, Jonas Nørskov

    for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

  14. The functional micro-organization of grid cells revealed by cellular-resolution imaging.

    Science.gov (United States)

    Heys, James G; Rangarajan, Krsna V; Dombeck, Daniel A

    2014-12-03

    Establishing how grid cells are anatomically arranged, on a microscopic scale, in relation to their firing patterns in the environment would facilitate a greater microcircuit-level understanding of the brain's representation of space. However, all previous grid cell recordings used electrode techniques that provide limited descriptions of fine-scale organization. We therefore developed a technique for cellular-resolution functional imaging of medial entorhinal cortex (MEC) neurons in mice navigating a virtual linear track, enabling a new experimental approach to study MEC. Using these methods, we show that grid cells are physically clustered in MEC compared to nongrid cells. Additionally, we demonstrate that grid cells are functionally micro-organized: the similarity between the environment firing locations of grid cell pairs varies as a function of the distance between them according to a "Mexican hat"-shaped profile. This suggests that, on average, nearby grid cells have more similar spatial firing phases than those further apart. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Fluorescent light irradiation and its mutagenic potential in microorganisms and cultured mammalian cells

    International Nuclear Information System (INIS)

    Thilagar, A.; Kumaraoo, P.V.; Ku, J.

    1994-01-01

    The photobiological effect of light is characterized by its energy emission at different wave lengths. Therefore by studying the energy emission spectra at different light sources and their photobiological activities, one can relate wavelength range(s) of the spectra to a particular photobiological effect. We studied the mutagenic and clastogenic potentials of light irradiation from standard fluorescent bulbs used in offices and laboratories. The energy emission spectrum of the bulbs was determined at every 10 nanometers from 300nM to 700nM. Salmonella typhimurium (strain TA100) and Escherichia coli (strain WP2uvrA) were used to study the induction of mutations in microorganisms. Chinese hamster ovary (CHO) cells were used to study the induction of chromosome aberrations. The microorganisms were plated under minimum light conditions ( 2 ) and exposed to the light source at 0.35mw/cm 2 for durations ranging from 0 to 40 minutes. The plates were incubated in darkness and the colonies were counted to determine the reversion frequencies. Similarly, the CHO cells are cultured in tissue culture flasks in minimum light conditions except for the light irradiations. The cultures were then evaluated for chromosome aberrations. The results of these studies indicated that irradiation from fluorescent lights induced a clear dose dependent increase in the reversion frequency in TA100. However the reversion frequencies in E. coli strain WP2uvrA were not substantially elevated at the maximum light irradiation condition. A significant increase in the chromosome aberrations frequency was not observed even at the maximum light irradiation dose used in this study. These results were compared to data obtained from similar experiments conducted with fluorescent bulbs with different energy emission spectra. The results of these studies are presented in this paper

  16. Microorganism immobilization

    Science.gov (United States)

    Compere, Alicia L.; Griffith, William L.

    1981-01-01

    Live metabolically active microorganisms are immobilized on a solid support by contacting particles of aggregate material with a water dispersible polyelectrolyte such as gelatin, crosslinking the polyelectrolyte by reacting it with a crosslinking agent such as glutaraldehyde to provide a crosslinked coating on the particles of aggregate material, contacting the coated particles with live microorganisms and incubating the microorganisms in contact with the crosslinked coating to provide a coating of metabolically active microorganisms. The immobilized microorganisms have continued growth and reproduction functions.

  17. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

    Science.gov (United States)

    Palková, Zdena; Váchová, Libuše

    2016-09-01

    Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Lignite microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Bulankina, M.A.; Lysak, L.V.; Zvyagintsev, D.G. [Moscow MV Lomonosov State University, Moscow (Russian Federation). Faculty of Soil Science

    2007-03-15

    The first demonstration that samples of lignite at a depth of 10 m are considerably enriched in bacteria is reported. According to direct microscopy, the abundance of bacteria was about 10{sup 7} cells/g. About 70% of cells had intact cell membranes and small size, which points to their anabiotic state. The fungal mycelium length was no more than 1 m. Lignite inoculation onto solid glucose-yeast-peptone medium allowed us to isolate bacteria of the genera Bacillus, Rhodococcus, Arthrobacter, Micrococcus, Spirillum, and Cytophaga. Representatives of the genera Penicillium and Trichoderma were identified on Czapek medium. Moistening of lignite powder increased the microbial respiration rate and microbial and fungal abundance but did not increase their generic diversity. This finding suggests that the studied microorganisms are autochthonous to lignite.

  19. Ecological significance of compatible solute accumulation by micro-organisms: from single cells to global climate.

    Science.gov (United States)

    Welsh, D T

    2000-07-01

    The osmoadaptation of most micro-organisms involves the accumulation of K(+) ions and one or more of a restricted range of low molecular mass organic solutes, collectively termed 'compatible solutes'. These solutes are accumulated to high intracellular concentrations, in order to balance the osmotic pressure of the growth medium and maintain cell turgor pressure, which provides the driving force for cell extension growth. In this review, I discuss the alternative roles which compatible solutes may also play as intracellular reserves of carbon, energy and nitrogen, and as more general stress metabolites involved in protection of cells against other environmental stresses including heat, desiccation and freezing. Thus, the evolutionary selection for the accumulation of a specific compatible solute may not depend solely upon its function during osmoadaptation, but also upon the secondary benefits its accumulation provides, such as increased tolerance of other environmental stresses prevalent in the organism's niche or even anti-herbivory or dispersal functions in the case of dimethylsulfoniopropionate (DMSP). In the second part of the review, I discuss the ecological consequences of the release of compatible solutes to the environment, where they can provide sources of compatible solutes, carbon, nitrogen and energy for other members of the micro-flora. Finally, at the global scale the metabolism of specific compatible solutes (betaines and DMSP) in brackish water, marine and hypersaline environments may influence global climate, due to the production of the trace gases, methane and dimethylsulfide (DMS) and in the case of DMS, also couple the marine and terrestrial sulfur cycles.

  20. Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Beatriz García

    2016-11-01

    Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

  1. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    NARCIS (Netherlands)

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles

  2. Lagooning microbial fuel cells: A first approach by coupling electricity-producing microorganisms and algae

    International Nuclear Information System (INIS)

    Lobato, Justo; González del Campo, Araceli; Fernández, Francisco J.; Cañizares, Pablo; Rodrigo, Manuel A.

    2013-01-01

    Highlights: • An algae cathode of a MFC has been used without artificial mediators or catalysts. • To perform a lagooning wastewater treatment coupled with energy-producing MFC. • The producing electricity operates under day/night irradiation cycles, is shown. - Abstract: The paper focused on the start-up and performance characterisation of a new type of microbial fuel cell (MFC), in which an algae culture was seeded in the cathodic chamber to produce the oxygen required to complete the electrochemical reactions of the MFC, thus circumventing the need for a mechanical aerator. The system did not use mediators or high cost catalysts and it can be started-up easily using a straightforward three-stage procedure. The start-up consists of the separate production of the electricity-producing microorganisms and the algae cultures (stage I), replacement of the mechanical aeration system by the algae culture (stage II) and a change in the light dosage from a continuous input to a dynamic day/night profile. The MFC was operated under a regime of 12 h light and 12 h dark and was also operated in batch and continuous substrate-feeding modes. The same cell voltage was achieved when the cathode compartment was operated with air supplied by aerators, which means that this configuration can perform as well as the traditional one. The results also show the influence of both the organic load and light irradiation on electricity production and demonstrate that this type MFC is a robust and promising technology that can be considered as a first approach to perform a lagooning wastewater treatment with microbial fuel cells

  3. Multiorganismal insects: diversity and function of resident microorganisms.

    Science.gov (United States)

    Douglas, Angela E

    2015-01-07

    All insects are colonized by microorganisms on the insect exoskeleton, in the gut and hemocoel, and within insect cells. The insect microbiota is generally different from microorganisms in the external environment, including ingested food. Specifically, certain microbial taxa are favored by the conditions and resources in the insect habitat, by their tolerance of insect immunity, and by specific mechanisms for their transmission. The resident microorganisms can promote insect fitness by contributing to nutrition, especially by providing essential amino acids, B vitamins, and, for fungal partners, sterols. Some microorganisms protect their insect hosts against pathogens, parasitoids, and other parasites by synthesizing specific toxins or modifying the insect immune system. Priorities for future research include elucidation of microbial contributions to detoxification, especially of plant allelochemicals in phytophagous insects, and resistance to pathogens; as well as their role in among-insect communication; and the potential value of manipulation of the microbiota to control insect pests.

  4. potentially pathogenic gastrointestinal microorganisms (ID 2972), improved lactose digestion (ID 2972) and increasing IL-10 production (ID 2973) (further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    of Lactobacillus paracasei CNCM I-1688 and Lactobacillus salivarius CNCM I-1794 and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, improved lactose digestion and increasing IL-10 production. The food constituent that is the subject of the health......-intestinal discomfort, is a beneficial physiological effect for the general population. The claimed effect, decreasing potentially pathogenic gastro-intestinal microorganisms, might be a beneficial physiological effect for the general population. The claimed effect, improved lactose digestion, is a beneficial...... physiological effect for individuals with lactose maldigestion. No human intervention studies were provided from which conclusions could be drawn for the scientific substantiation of the above-mentioned claims. On the basis of the data provided, the Panel concludes that a cause and effect relationship has...

  5. Biotransformation of terpenoids by mammals, microorganisms, and plant-cultured cells.

    Science.gov (United States)

    Ishida, Takashi

    2005-05-01

    This review article summarizes our knowledge of the metabolism of mono- and sesquiterpenoids in mammals, microorganisms, cloned-insect enzymes, and plant-cultured cells. A number of unusual enzymatic reactions and products are reported such as the stereoselective formation of primary alcohols from sterically congested Me2C groups. Such enzymatic processes, including unknown chemical transformations under abiotic conditions, could lead to the discovery of new chemical reactions and might be helpful in the design of new drugs. The transformations of the following mono- and sesquiterpenoids (in alphabetical order) are discussed: (+)-(1R)-aromadendrene (61), (-)-allo-aromadendrene (62), (+/-)-camphene (21), (-)-cis-carane (20), (+)-3-carene (17), (+/-)-carvone (27), (-)-beta-caryophyllene (43), (+)-cedrol (35), cuminaldehyde (25), (+)-curdione (69), (-)-cyclocolorenone (60), (-)-elemol (51), (2E,6E)-farnesol (31), germacrone (67), ginsenol (40), (-)-globulol (63), isoprobotryan-9alpha-ol (82a), juvenile hormone III (33), (+)-ledol (65), (+)-longifolene (46), myrcene (3), (-)-myrtenal (23), (+)-nootkatone (48), patchouli alcohol (37), (-)-perillaldehyde (24), (-)-alpha- and beta-pinene (8 and 9), alpha-santalol (28), (-)-6beta-santonin (83a), 6beta-tetrahydrosantonin (83b), beta-selinene (57), alpha-thujone (26a), beta-thujone (26b), T-2 toxin (87), and valerianol (53).

  6. De novo identification of viral pathogens from cell culture hologenomes

    Directory of Open Access Journals (Sweden)

    Patowary Ashok

    2012-01-01

    Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

  7. Translocation of cell-penetrating peptides into Candida fungal pathogens.

    Science.gov (United States)

    Gong, Zifan; Karlsson, Amy J

    2017-09-01

    Cell-penetrating peptides (CPPs) are small peptides capable of crossing cellular membranes while carrying molecular cargo. Although they have been widely studied for their ability to translocate nucleic acids, small molecules, and proteins into mammalian cells, studies of their interaction with fungal cells are limited. In this work, we evaluated the translocation of eleven fluorescently labeled peptides into the important human fungal pathogens Candida albicans and C. glabrata and explored the mechanisms of translocation. Seven of these peptides (cecropin B, penetratin, pVEC, MAP, SynB, (KFF) 3 K, and MPG) exhibited substantial translocation (>80% of cells) into both species in a concentration-dependent manner, and an additional peptide (TP-10) exhibiting strong translocation into only C. glabrata. Vacuoles were involved in translocation and intracellular trafficking of the peptides in the fungal cells and, for some peptides, escape from the vacuoles and localization in the cytosol were correlated to toxicity toward the fungal cells. Endocytosis was involved in the translocation of cecropin B, MAP, SynB, MPG, (KFF) 3 K, and TP-10, and cecropin B, penetratin, pVEC, and MAP caused membrane permeabilization during translocation. These results indicate the involvement of multiple translocation mechanisms for some CPPs. Although high levels of translocation were typically associated with toxicity of the peptides toward the fungal cells, SynB was translocated efficiently into Candida cells at concentrations that led to minimal toxicity. Our work highlights the potential of CPPs in delivering antifungal molecules and other bioactive cargo to Candida pathogens. © 2017 The Protein Society.

  8. Scientific Opinion on the substantiation of health claims related to Saccharomyces cerevisiae var. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms (ID 913, further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    . boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms. The food constituent that is the subject of the health claim, Saccharomyces cerevisiae var. boulardii CNCM I-1079, is sufficiently characterised. The claimed effect, defence against pathogenic gastro......-intestinal microorganisms, is a beneficial physiological effect. The proposed target population is the general population. The Panel notes that the evidence provided is not sufficient to establish that the strains Saccharomyces cerevisiae var. boulardii CNCM I-1079 and Saccharomyces cerevisiae var. boulardii Hansen CBS...... relationship has not been established between the consumption of Saccharomyces cerevisiae var. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms....

  9. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  10. Occurrence of mastitis pathogens in relation to somatic cells

    Directory of Open Access Journals (Sweden)

    Marcela Vyletělová Klimešová

    2013-01-01

    Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.

  11. Cross-species induction of antimicrobial compounds, biosurfactants and quorum-sensing inhibitors in tropical marine epibiotic bacteria by pathogens and biofouling microorganisms.

    Science.gov (United States)

    Dusane, Devendra H; Matkar, Pratiek; Venugopalan, Valayam P; Kumar, Ameeta Ravi; Zinjarde, Smita S

    2011-03-01

    Enhancement or induction of antimicrobial, biosurfactant, and quorum-sensing inhibition property in marine bacteria due to cross-species and cross-genera interactions was investigated. Four marine epibiotic bacteria (Bacillus sp. S3, B. pumilus S8, B. licheniformis D1, and Serratia marcescens V1) displaying antimicrobial activity against pathogenic or biofouling fungi (Candida albicans CA and Yarrowia lipolytica YL), and bacteria (Pseudomonas aeruginosa PA and Bacillus pumilus BP) were chosen for this study. The marine epibiotic bacteria when co-cultivated with the aforementioned fungi or bacteria showed induction or enhancement in antimicrobial activity, biosurfactant production, and quorum-sensing inhibition. Antifungal activity against Y. lipolytica YL was induced by co-cultivation of the pathogens or biofouling strains with the marine Bacillus sp. S3, B. pumilus S8, or B. licheniformis D1. Antibacterial activity against Ps. aeruginosa PA or B. pumilus BP was enhanced in most of the marine isolates after co-cultivation. Biosurfactant activity was significantly increased when cells of B. pumilus BP were co-cultivated with S. marcescens V1, B. pumilus S8, or B. licheniformis D1. Pigment reduction in the quorum-sensing inhibition indicator strain Chromobacterium violaceum 12472 was evident when the marine strain of Bacillus sp. S3 was grown in the presence of the inducer strain Ps. aeruginosa PA, suggesting quorum-sensing inhibition. The study has important ecological and biotechnological implications in terms of microbial competition in natural environments and enhancement of secondary metabolite production.

  12. Evaluation of Suppressiveness of Soils Exhibiting Soil-Borne Disease Suppression after Long-Term Application of Organic Amendments by the Co-cultivation Method of Pathogenic Fusarium oxysporum and Indigenous Soil Microorganisms.

    Science.gov (United States)

    Mitsuboshi, Masahiro; Kioka, Yuuzou; Noguchi, Katsunori; Asakawa, Susumu

    2018-03-29

    Preventive measures against soil-borne diseases need to be implemented before cultivation because very few countermeasures are available after the development of diseases. Some soils suppress soil-borne diseases despite the presence of a high population density of pathogens. If the suppressiveness of soil against soil-borne diseases may be predicted and diagnosed for crop fields, it may be possible to reduce the labor and cost associated with excessive disinfection practices. We herein evaluated the suppressiveness of soils in fields with the long-term application of organic amendments by examining the growth of pathogenic Fusarium oxysporum co-cultivated with indigenous soil microorganisms on agar plates. Soils treated with coffee residue compost or rapeseed meal showed suppressiveness against spinach wilt disease by F. oxysporum f. sp. spinaciae or spinach wilt and lettuce root rot diseases by F. oxysporum f. sp. spinaciae and F. oxysporum f. sp. lactucae, respectively, and the growth of pathogenic Fusarium spp. on agar plates was suppressed when co-cultured with microorganisms in a suspension from these soils before crop cultivation. These results indicate the potential of the growth degree of pathogenic F. oxysporum estimated by this method as a diagnostic indicator of the suppressiveness of soil associated with the inhabiting microorganisms. A correlation was found between the incidence of spinach wilt disease in spinach and the growth degree of F. oxysporum f. sp. spinaciae by this co-cultivation method, indicating that suppressiveness induced by organic amendment applications against F. oxysporum f. sp. spinaciae is evaluable by this method. The co-cultivation method may be useful for predicting and diagnosing suppressiveness against soil-borne diseases.

  13. Micro-Organ Device

    Science.gov (United States)

    Gonda, Steve R. (Inventor); Chang, Robert C. (Inventor); Starly, Binil (Inventor); Culbertson, Christopher (Inventor); Holtorf, Heidi L. (Inventor); Sun, Wei (Inventor); Leslie, Julia (Inventor)

    2013-01-01

    A method for fabricating a micro-organ device comprises providing a microscale support having one or more microfluidic channels and one or more micro-chambers for housing a micro-organ and printing a micro-organ on the microscale support using a cell suspension in a syringe controlled by a computer-aided tissue engineering system, wherein the cell suspension comprises cells suspended in a solution containing a material that functions as a three-dimensional scaffold. The printing is performed with the computer-aided tissue engineering system according to a particular pattern. The micro-organ device comprises at least one micro-chamber each housing a micro-organ; and at least one microfluidic channel connected to the micro-chamber, wherein the micro-organ comprises cells arranged in a configuration that includes microscale spacing between portions of the cells to facilitate diffusion exchange between the cells and a medium supplied from the at least one microfluidic channel.

  14. Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.

    Science.gov (United States)

    Ireton, Keith

    2013-07-17

    Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.

  15. Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

    OpenAIRE

    Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

    2013-01-01

    Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

  16. Pulsed electric field processing of different fruit juices: impac of pH and temperature on inactivation of spoilage and pathogenic micro-organisms

    NARCIS (Netherlands)

    Timmermans, R.A.H.; Nierop Groot, M.N.; Nederhoff, A.L.; Boekel, van M.A.J.S.; Matser, A.M.; Mastwijk, H.C.

    2014-01-01

    Pulsed electrical field (PEF) technology can be used for the inactivation of micro-organisms and therefore for preservation of food products. It is a mild technology compared to thermal pasteurization because a lower temperature is used during processing, leading to a better retention of the

  17. Studies on the radiation sensitivity of food microorganism by high dose irradiation

    International Nuclear Information System (INIS)

    Hwang, Han Joon; Lee, Eun Jung; Yu, Hyun Hee; Lee, Jae Ho

    2010-04-01

    We investigated the radio resistance of pathogenic microorganisms (Bacillus cereus, Staphylococcus aureus, Methicillin resistant Staphylococcus aureus(MRSA) and Escherichia coli O157) in irradiating environments. Their radiation conditions of pathogenic microorganisms varied with pH(3-10), salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition. In addition, the effect of γ-irradiation on the inactivation of pathogenic microorganisms inoculated into food (saengsik, sliced ham, chopped beef) was investigated. The radiation dose ranged from 0 to 3 kGy. The γ--irradiated B.cereus(γ--BC) St.aureus(γ--SA), MRSA(γ--MRSA) and E.coli O157(γ--EC) were then cultured and the viable cell count on plate count agar and D10-values(dose required to inactivate 90% of a microbial population) were calculated. The number of pathogenic microorganisms at pH(3-10) and salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition decreased by 1 log CFU/ml after irradiation. The D 10 -value of γ--SA in the optimum condition was 0.152 kGy, and these of γ--MRSA and γ--EC were 0.346 and 0.240 kGy, respectively. The initial cell counts of pathogenic microorganisms in culture broth were slightly decreased as the decrease of pH and the increase of salt concentration. However, radiation resistance of pathogenic microorganisms was increased at frozen state. Moreover, D 10 -values of these is test strains in saengsik, sliced ham and chopped beef were 0.597, 0.226 , 0.398 and 0.416 kGy, respectively. These results provide the basic information for the in activation of pathogenic microorganisms in foods by irradiation

  18. Studies on the radiation sensitivity of food microorganism by high dose irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Han Joon; Lee, Eun Jung; Yu, Hyun Hee; Lee, Jae Ho [Korea University, Seoul (Korea, Republic of)

    2010-04-15

    We investigated the radio resistance of pathogenic microorganisms (Bacillus cereus, Staphylococcus aureus, Methicillin resistant Staphylococcus aureus(MRSA) and Escherichia coli O157) in irradiating environments. Their radiation conditions of pathogenic microorganisms varied with pH(3-10), salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition. In addition, the effect of {gamma}-irradiation on the inactivation of pathogenic microorganisms inoculated into food (saengsik, sliced ham, chopped beef) was investigated. The radiation dose ranged from 0 to 3 kGy. The {gamma}--irradiated B.cereus({gamma}--BC) St.aureus({gamma}--SA), MRSA({gamma}--MRSA) and E.coli O157({gamma}--EC) were then cultured and the viable cell count on plate count agar and D10-values(dose required to inactivate 90% of a microbial population) were calculated. The number of pathogenic microorganisms at pH(3-10) and salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition decreased by 1 log CFU/ml after irradiation. The D{sub 10}-value of {gamma}--SA in the optimum condition was 0.152 kGy, and these of {gamma}--MRSA and {gamma}--EC were 0.346 and 0.240 kGy, respectively. The initial cell counts of pathogenic microorganisms in culture broth were slightly decreased as the decrease of pH and the increase of salt concentration. However, radiation resistance of pathogenic microorganisms was increased at frozen state. Moreover, D{sub 10}-values of these is test strains in saengsik, sliced ham and chopped beef were 0.597, 0.226 , 0.398 and 0.416 kGy, respectively. These results provide the basic information for the in activation of pathogenic microorganisms in foods by irradiation

  19. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Directory of Open Access Journals (Sweden)

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  20. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    Science.gov (United States)

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Electrochemically active microorganisms from an acid mine drainage-affected site promote cathode oxidation in microbial fuel cells

    KAUST Repository

    Rojas, Claudia; Vargas, Ignacio T.; Bruns, Mary Ann; Regan, John M.

    2017-01-01

    The limited database of acidophilic or acidotolerant electrochemically active microorganisms prevents advancements on microbial fuel cells (MFCs) operated under low pH. In this study, three MFCs were used to enrich cathodic biofilms using acid mine drainage (AMD) sediments as inoculum. Linear sweep voltammetry showed cathodic current plateaus of 5.5 (± 0.7) mA at about − 170 mV vs Ag/AgCl and 8.5 (± 0.9) mA between − 500 mV to − 450 mV vs Ag/AgCl for biofilms developed on small graphite fiber brushes. After gamma irradiation, biocathodes exhibited a decrease in current density approaching that of abiotic controls. Electrochemical impedance spectroscopy showed six-fold lower charge transfer resistance with viable biofilm. Pyrosequencing data showed that Proteobacteria and Firmicutes dominated the biofilms. Acidithiobacillus representatives were enriched in some biocathodes, supporting the potential importance of these known iron and sulfur oxidizers as cathodic biocatalysts. Other acidophilic chemolithoautotrophs identified included Sulfobacillus and Leptospirillum species. The presence of chemoautotrophs was consistent with functional capabilities predicted by PICRUSt related to carbon fixation pathways in prokaryotic microorganisms. Acidophilic or acidotolerant heterotrophs were also abundant; however, their contribution to cathodic performance is unknown. This study directs subsequent research efforts to particular groups of AMD-associated bacteria that are electrochemically active on cathodes.

  2. Electrochemically active microorganisms from an acid mine drainage-affected site promote cathode oxidation in microbial fuel cells

    KAUST Repository

    Rojas, Claudia

    2017-08-03

    The limited database of acidophilic or acidotolerant electrochemically active microorganisms prevents advancements on microbial fuel cells (MFCs) operated under low pH. In this study, three MFCs were used to enrich cathodic biofilms using acid mine drainage (AMD) sediments as inoculum. Linear sweep voltammetry showed cathodic current plateaus of 5.5 (± 0.7) mA at about − 170 mV vs Ag/AgCl and 8.5 (± 0.9) mA between − 500 mV to − 450 mV vs Ag/AgCl for biofilms developed on small graphite fiber brushes. After gamma irradiation, biocathodes exhibited a decrease in current density approaching that of abiotic controls. Electrochemical impedance spectroscopy showed six-fold lower charge transfer resistance with viable biofilm. Pyrosequencing data showed that Proteobacteria and Firmicutes dominated the biofilms. Acidithiobacillus representatives were enriched in some biocathodes, supporting the potential importance of these known iron and sulfur oxidizers as cathodic biocatalysts. Other acidophilic chemolithoautotrophs identified included Sulfobacillus and Leptospirillum species. The presence of chemoautotrophs was consistent with functional capabilities predicted by PICRUSt related to carbon fixation pathways in prokaryotic microorganisms. Acidophilic or acidotolerant heterotrophs were also abundant; however, their contribution to cathodic performance is unknown. This study directs subsequent research efforts to particular groups of AMD-associated bacteria that are electrochemically active on cathodes.

  3. Interactions of microorganisms isolated from gilthead sea bream, Sparus aurata L., on Vibrio harveyi, a pathogen of farmed Senegalese sole, Solea senegalensis (Kaup).

    Science.gov (United States)

    Chabrillón, M; Rico, R M; Arijo, S; Díaz-Rosales, P; Balebona, M C; Moriñigo, M A

    2005-09-01

    Four bacterial isolates from farmed gilthead sea bream, Sparus aurata, included in a previous study as members of the Vibrionaceae and Pseudomonodaceae and the genus Micrococcus, have been evaluated for their adhesive ability to skin and intestinal mucus of farmed Senegalese sole, Solea senegalensis, and their antagonistic effect on Vibrio harveyi, a pathogen of sole. These isolates showed higher adhesion to sole mucus than the pathogenic strains of V. harveyi assayed. Only two of the isolates showed antagonistic activity to V. harveyi. Interactions of the four isolates with V. harveyi in respect of adhesion to skin and intestinal mucus under exclusion, competition and displacement conditions were studied. Three isolates were able to reduce the attachment to skin and intestinal sole mucus of a pathogenic strain of V. harveyi under displacement and exclusion conditions, but not under competition conditions. The in vivo probiotic potential of isolate Pdp11 was assessed by oral administration followed by challenge with the pathogenic V. harveyi strain Lg14/00. A group of 50 Senegalese sole received a commercial diet supplemented with 10(8) cfu g(-1) of lyophilized Lg14/00 for 15 days. A second group of fish received a non-supplemented commercial diet. After challenge the mortality of the fish receiving the diet supplemented with the potential probiotic isolate was significantly lower than that in the fish receiving the non-supplemented commercial diet. This study has shown that the ability to interfere with attachment of pathogens, as well as the adhesion to host surfaces, are suitable criteria for selection of candidate probiotics for use in the culture of Senegalese sole.

  4. [Ultrastructure and molecular biochemistry on pathogenic fungal cells: the architecture of septal cell walls of dermatophytes].

    Science.gov (United States)

    Kitajima, Y

    2001-01-01

    This review provides abstracts of our research for which the year 2000 prize of The Japanese Society for Medical Mycology was awarded. The study consists of 4 fields: 1)Ultrastructure and biochemistry of the cell walls of dermatophytes. 2) Freeze-fracture electron microscopic study on the membrane systems of pathogenic fungi. 3) Action mechanisms of antifungal agents in terms of membrane structure and functions. 4) Dimorphism and virulence of pathogenic fungi in terms of molecular biology of membrane lipids. Since the detailed contents of these studies were reported in my previous review article (Jpn J Med Mycol 41: 211-217, 2000), I would like to mention these studies only briefly here, together with a detailed review of the septal cell wall architecture of dermatophytes, which I did not cover in my earlier articles.

  5. GC-MS analysis and antimicrobial activity determination of Citrus medica L. var proper leaf essential oil from South Sulawesi against skin pathogen microorganism

    Science.gov (United States)

    Aliyah; Himawan, A.; Rante, H.; Mufidah; Ningsih, D. R.

    2017-11-01

    A research about Citrus medica L. var sarcodactylis had been conducted and it showed a significant antimicrobial activity, thus drive our curiosity to investigate the other variety from the same species, Citrus medica L. var proper. This research focuses in chemical compound study and antimicrobial activity screening against Staphylococcus aureus, Propionibacterium acne, and Candida albicans of Citrus medica L. var Proper leaves’ essential oil. The essential oil is distillated from fresh leaves by hydrodestillation. The chemical compound was analysed using GC-MS instrument while the antimicrobial activity was tested using disk diffusion method. The results showed that the major component of the essential oil was Z-citral, citral and limonene compounds. The antimicrobial activity test results against the test microorganism are 9.15±0.15 mm, 11.15±1.3 mm and 8.02±0.48 mm, consecutively, for Staphylococcus aureus, Propionibacterium acne and Candida albicans.

  6. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  7. Associations between pathogen-specific clinical mastitis and somatic cell count patterns

    NARCIS (Netherlands)

    Haas, de Y.; Veerkamp, R.F.; Barkema, H.W.; Gröhn, Y.T.; Schukken, Y.H.

    2004-01-01

    Associations were estimated between pathogen-specific cases of clinical mastitis (CM) and somatic cell count (SCC) patterns based on deviations from the typical curve for SCC during lactation and compared with associations between pathogen-specific CM and lactation average SCC. Data from 274 Dutch

  8. The effects of material loading and flow rate on the disinfection of pathogenic microorganisms using cation resin-silver nanoparticle filter system

    Science.gov (United States)

    Mpenyana-Monyatsi, L.; Mthombeni, N. H.; Onyango, M. S.; Momba, M. N. B.

    2017-08-01

    Waterborne diseases have a negative impact on public health in instances where the available drinking water is of a poor quality. Decentralised systems are needed to provide safe drinking water to rural communities. Therefore, the present study aimed to develop and investigate the point-of-use (POU) water treatment filter packed with resin-coated silver nanoparticles. The filter performance was evaluated by investigating the effects of various bed masses (10 g, 15 g, 20 g) and flow rates (2 mL/min, 5 mL/min, 10 mL/min) by means of breakthrough curves for the removal efficiency of presumptive Escherichia coli, Shigella dysenteriae, Salmonella typhimurium and Vibrio cholerae from spiked groundwater samples. The results revealed that, as the bed mass increases the breakthrough time also increases with regards to all targeted microorganisms. However, when the flow rate increases the breakthrough time decreased. These tests demonstrated that resin-coated silver nanoparticle can be an effective material in removing all targeted microorganisms at 100% removal efficiency before breakthrough points are achieved. Moreover the filter system demonstrated that it is capable of producing 15 L/day of treated water at an operating condition of 10 mL/min flow rate and 15 g bed mass, which is sufficient to provide for seven individuals in the household if they consume 2 L/person/day for drinking purpose. Therefore, the bed mass of the filter system should be increased in order for it to produce sufficient water that will conform to the daily needs of an individual.

  9. Combined Effect of Thermosonication and Slightly Acidic Electrolyzed Water to Reduce Foodborne Pathogens and Spoilage Microorganisms on Fresh-cut Kale.

    Science.gov (United States)

    Mansur, Ahmad Rois; Oh, Deog-Hwan

    2015-06-01

    This study evaluated the efficacy of individual treatments (thermosonication [TS+DW] and slightly acidic electrolyzed water [SAcEW]) and their combination on reducing Escherichia coli O157:H7, Listeria monocytogenes, and spoilage microorganisms (total bacterial counts [TBC], Enterobacteriaceae, Pseudomonas spp., and yeast and mold counts [YMC]) on fresh-cut kale. For comparison, the antimicrobial efficacies of sodium chlorite (SC; 100 mg/L) and sodium hypochlorite (SH; 100 mg/L) were also evaluated. Each 10 g sample of kale leaves was inoculated to contain approximately 6 log CFU/g of E. coli O157:H7 or L. monocytogenes. Each inoculated or uninoculated samples was then dip treated with deionized water (DW; control), TS+DW, and SAcEW at various treatment conditions (temperature, physicochemical properties, and time) to assess the efficacy of each individual treatment. The efficacy of TS+DW or SAcEW was enhanced at 40 °C for 3 min, with an acoustic energy density of 400 W/L for TS+DW and available chlorine concentration of 5 mg/L for SAcEW. At 40 °C for 3 min, combined treatment of thermosonication 400 W/L and SAcEW 5 mg/L (TS+SAcEW) was more effective in reducing microorganisms compared to the individual treatments (SAcEW, SC, SH, and TS+DW) and combined treatments (TS+SC and TS+SH), which significantly (P 3.24 log CFU/g, respectively. The results suggest that the combined treatment of TS+SAcEW has the potential as a decontamination process in fresh-cut industry. © 2015 Institute of Food Technologists®

  10. Long-Term Live Cell Imaging of Cell Migration: Effects of Pathogenic Fungi on Human Epithelial Cell Migration.

    Science.gov (United States)

    Wöllert, Torsten; Langford, George M

    2016-01-01

    Long-term live cell imaging was used in this study to determine the responses of human epithelial cells to pathogenic biofilms formed by Candida albicans. Epithelial cells of the skin represent the front line of defense against invasive pathogens such as C. albicans but under certain circumstances, especially when the host's immune system is compromised, the skin barrier is breached. The mechanisms by which the fungal pathogen penetrates the skin and invade the deeper layers are not fully understood. In this study we used keratinocytes grown in culture as an in vitro model system to determine changes in host cell migration and the actin cytoskeleton in response to virulence factors produced by biofilms of pathogenic C. albicans. It is clear that changes in epithelial cell migration are part of the response to virulence factors secreted by biofilms of C. albicans and the actin cytoskeleton is the downstream effector that mediates cell migration. Our goal is to understand the mechanism by which virulence factors hijack the signaling pathways of the actin cytoskeleton to alter cell migration and thereby invade host tissues. To understand the dynamic changes of the actin cytoskeleton during infection, we used long-term live cell imaging to obtain spatial and temporal information of actin filament dynamics and to identify signal transduction pathways that regulate the actin cytoskeleton and its associated proteins. Long-term live cell imaging was achieved using a high resolution, multi-mode epifluorescence microscope equipped with specialized light sources, high-speed cameras with high sensitivity detectors, and specific biocompatible fluorescent markers. In addition to the multi-mode epifluorescence microscope, a spinning disk confocal long-term live cell imaging system (Olympus CV1000) equipped with a stage incubator to create a stable in vitro environment for long-term real-time and time-lapse microscopy was used. Detailed descriptions of these two long-term live

  11. . boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms (ID 3017, further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    , a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079, is sufficiently characterised. The claimed effect which is proposed for further assessment, defence against pathogenic gastro-intestinal microorganisms......, is a beneficial physiological effect. The proposed target population is the general population. No human intervention studies which investigated the effect of a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079 were...... provided. On the basis of the data presented, the Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079...

  12. Membrane Separated Flow Cell for Parallelized Electrochemical Impedance Spectroscopy and Confocal Laser Scanning Microscopy to Characterize Electro-Active Microorganisms

    International Nuclear Information System (INIS)

    Stöckl, Markus; Schlegel, Christin; Sydow, Anne; Holtmann, Dirk; Ulber, Roland; Mangold, Klaus-Michael

    2016-01-01

    Highlights: • Development of a membrane separated electrochemical flow cell. • Simultaneous combination of EIS and CLSM. • Monitoring of bacterial cell attachment to anode of MFC. • Cell attachment of Shewanella oneidensis is shown. - Abstract: Understanding the attachment of electro-active bacteria to electrode surfaces and their subsequent biofilm formation is one of the major challenges for the establishment of bacterial bioelectrochemial systems (BES). For a constant observation of biofilm growth, providing information on different stages of biofilm formation, continuous monitoring methods are required. In this paper a combination of two powerful analytical methods, Electrochemical Impedance Spectroscopy (EIS) and Confocal Laser Scanning Microscopy (CLSM), for biofilm monitoring is presented. A custom-built flow cell with a transparent indium tin oxide working electrode (WE) was constructed allowing monitoring of cell attachment to a working electrode simultaneously by EIS and CLSM. Cyclic Voltammetry (CV) and EIS of an iron (II)/iron (III) redox couple indicate that the flow cell is suitable for electrochemical experiments. An engineered Shewanella oneidensis MR-1 (ATCC700550) producing eGFP was used as electro-active model organism to demonstrate the practical application of the flow cell as BES to monitor cell attachment simultaneously with EIS and CLSM. Applying the flow cell as MFC (transparent working electrode poised as anode) produced a typical current curve for such a system. From the equivalent circuit used to interpret EIS data the charge transfer resistance R CT is sensitive to attachment of microorganisms. Fitted R CT was increased initially after cell inoculation and then lowered constantly with progressing experimental time. In parallel taken CLSM images show that bacteria already adhered to the WE 5 min after inoculation. A mono- respectively bilayer of electro-active cells was observed after 17 h on the WE surface. With the presented

  13. Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

    Directory of Open Access Journals (Sweden)

    Martin S Davey

    2011-05-01

    Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

  14. Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

    Science.gov (United States)

    Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

    2011-01-01

    Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

  15. Fabrication and electromagnetic interference shielding effectiveness of polymeric composites filled with silver-coated microorganism cells

    Energy Technology Data Exchange (ETDEWEB)

    Lan, Mingming, E-mail: lan_mingming@163.com [College of Mechanical and Electrical Engineering, Henan Agricultural University, Zhengzhou 450002 (China); Zhang, Deyuan; Cai, Jun; Hu, Yanyan; Yuan, Liming [Bionic and Micro/Nano/Bio Manufacturing Technology Research Center, School of Mechanical Engineering and Automation, Beihang University, Beijing 100191 (China)

    2014-07-01

    In this paper, helical silver-coated Spirulina cells were used as conductive fillers for the fabrication of polymeric composites. The morphology and composition of the coated Spirulina cells were analyzed with scanning electron microscope and energy dispersive X-ray spectrometer. The densities of silver-coated Spirulina cells were measured using the standard Archimedes method with distilled water. The electrical resistivity was measured by four-probe technique using ammeter and voltmeter whereas electromagnetic interference shielding effectiveness was measured by four-port method using vector network analyzer and coaxial-airline sample holder. The results showed that the silver-coated Spirulina cells with different coating thickness were lightweight fillers compared to the other typical conductive particles. The polymeric composites could achieve good conductivity at the lower content of silver-coated Spirulina cells owing to their helical shape. The shielding effectiveness of polymeric composites had a strong dependence on their conductivity. At the coating thickness of 0.96 μm and the content of 40 vol%, the shielding effectiveness could reach above 74.3 dB in entire test wave band.

  16. Microbial contamination of red meat and consideration of gamma irradiation effects for increasing the shelf-life and decontamination of pathogenic microorganisms

    International Nuclear Information System (INIS)

    Motamedee Sadeh, F.; Majd, F.; Fathollahee, H.; Arbabi, K.; Mohammad Beygi Abhari, M.

    2003-01-01

    Red meat has a lot of microbial flora from different sources. Prevention of outbreak of food born diseases that are caused by pathogenic agents and prevention of microbial spoilage of meat that makes many losses to the human health and economic of society are very important. Also, different methods for decreasing the microbial flora under a standard allowance for increasing the shelf life and decontamination of microbial pathogens have been proposed. In this research, irradiation technique was used for this purposes. After drawing dose/survival curves for all kinds of meats microbial contamination, an optimum dose of 3 kGy for decreasing the contamination and specially for decontamination of salmonella was obtained. When meat is irradiated by 3 kGy gamma rays, it can be kept in a 4-7 d ig C refrigerator for 2 week without appearing any spoilage nor color changes or odor. Also, some of biochemical factors were analyzed and amounts of 16 amino acids were measured in the irradiated and controlled samples and no difference was observed between the samples

  17. Evaluation of antimicrobial effect of azadirachtin plant extract (Soluneem ™ on commonly found root canal pathogenic microorganisms (viz. Enterococcus faecalis in primary teeth: A microbiological study

    Directory of Open Access Journals (Sweden)

    Shanal Shah

    2016-01-01

    Full Text Available Aim: The aim of this study is to evaluate the antimicrobial activity of Soluneem ™ when used as an irrigating solution along with other commonly used irrigating solution sodium hypochlorite (NaOCl against Enterococcus faecalis. Materials and Methods: Microorganism used in this study was E. faecalis (Microbial Type Culture Collection 439. Test substance used was Soluneem ™, which was obtained from Vittal Mallya Scientific Research Foundation (VMSRF, Bengaluru. This study was conducted in a microbiology laboratory (Biocare Research India Pvt., Ltd. Laboratory, Ahmedabad, Gujarat to evaluate the antimicrobial effect of Soluneem ™ (Azadirachtin on E. faecalis. Antimicrobial activity testing was performed using the macrobroth dilution method according to the Clinical Laboratory Standards Institute guidelines. All determinations were performed thrice. Results: Minimum bactericidal concentration (MBC was seen as 2.6% for Soluneem ™ while the same was seen at 0.1% for NaOCl. Independent sample t-test was carried out to compare the MBC of Soluneem ™ and NaOCl, which showed that there was no statistically significant difference between them, i.e., 2.6% Soluneem ™ was as effective as 0.1% NaOCl. Conclusion: Soluneem ™ showed antimicrobial activity against E. faecalis at various concentrations. It was also found that the efficacy of Soluneem ™ at 2.6% concentration and above was relatively similar to that of gold standard irrigating solution (NaOCl on inhibition of E. faecalis.

  18. Evaluation of antimicrobial effect of azadirachtin plant extract (Soluneem (™)) on commonly found root canal pathogenic microorganisms (viz. Enterococcus faecalis) in primary teeth: A microbiological study.

    Science.gov (United States)

    Shah, Shanal; Venkataraghavan, Karthik; Choudhary, Prashant; Mohammad, Shameer; Trivedi, Krishna; Shah, Shalin G

    2016-01-01

    The aim of this study is to evaluate the antimicrobial activity of Soluneem ™ when used as an irrigating solution along with other commonly used irrigating solution sodium hypochlorite (NaOCl) against Enterococcus faecalis. Microorganism used in this study was E. faecalis (Microbial Type Culture Collection 439). Test substance used was Soluneem ™, which was obtained from Vittal Mallya Scientific Research Foundation (VMSRF), Bengaluru. This study was conducted in a microbiology laboratory (Biocare Research India Pvt., Ltd. Laboratory, Ahmedabad, Gujarat) to evaluate the antimicrobial effect of Soluneem ™ (Azadirachtin) on E. faecalis. Antimicrobial activity testing was performed using the macrobroth dilution method according to the Clinical Laboratory Standards Institute guidelines. All determinations were performed thrice. Minimum bactericidal concentration (MBC) was seen as 2.6% for Soluneem ™ while the same was seen at 0.1% for NaOCl. Independent sample t-test was carried out to compare the MBC of Soluneem ™ and NaOCl, which showed that there was no statistically significant difference between them, i.e., 2.6% Soluneem ™ was as effective as 0.1% NaOCl. Soluneem ™ showed antimicrobial activity against E. faecalis at various concentrations. It was also found that the efficacy of Soluneem ™ at 2.6% concentration and above was relatively similar to that of gold standard irrigating solution (NaOCl) on inhibition of E. faecalis.

  19. Recent topics on the effect of high LET radiation on microorganisms and cultured mammalian cells

    International Nuclear Information System (INIS)

    Takahashi, Tan; Nakano, Kazushiro; Yatagai, Fumio; Kaneko, Ichiro; Kosaka, Toshifumi; Kasai, Kiyomi.

    1989-01-01

    Interpretation of inactivation cross sections of E. coli K-12 JC 1553 and AB 1157 by track structure of heavy ions and recent topics on the effect of heavy ions on mammalian cells are described. Calculation of the dose around the trajectory of an ion has also been made and the radial dose distribution has been compared with a recent experiment. (author)

  20. Initial study of three different pathogenic microorganisms by gas chromatography-mass spectrometry [version 3; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Najmeh Karami

    2018-01-01

    Full Text Available Background: Diagnoses  of  respiratory  tract  infections  usually happen  in  the  late  phase  of  the  disease  and  usually  result  in  reduction  of  the  pathogen  load after broad-spectrum  antibiotic  therapy,  but  not  in eradication of the pathogen.  The  development  of a  non-invasive,  fast,  and  accurate  method  to  detect  pathogens  has  always  been  of  interest  to  researchers  and  clinicians  alike.  Previous studies have shown that bacteria produce organic gases.  The  current  study  aimed  to  identify  the  volatile  organic  compounds  (VOCs  produced  by three  respiratory  tract  pathogens,  including  Staphylococcus  aureus,  Escherichia  coli  and  Candida  albicans. Methods: The  VOCs  produced  were identified by gas chromatography–mass spectrometry (GC-MS, with  prior  collection  of  microbial  volatile  compounds  using  solid  phase  microextraction  (SPME  fiber.  The volatile compounds were collected by obtaining bacterial headspace samples. Results: Results  showed  that  these  three  organisms  have  various  VOCs,  which  were  analyzed  under  different  conditions.  By ignoring common VOCs, some species-specific VOCs could be detected.  The most important VOC of E. coli was indole, also some important VOCs produced by S. aureus  were 2,3-pentandione,  cis-dihydro-α-terpinyl  acetate,  1-decyne,  1,3-heptadiene,  2,5-dimethyl  pyrazine,  ethyl  butanoate  and  cyclohexene,4-ethenyl. Furthermore,  most  of the identified  compounds  by  C.  albicans are  alcohols. Conclusions: The  detection  of  VOCs  produced  by  infectious  agents  maybe  the  key  to  make   a  rapid  and  precise  diagnosis  of  infection,  but  more  comprehensive  studies  must  be  conducted  in this  regard.

  1. Identification of Highly Pathogenic Microorganisms by Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry: Results of an Interlaboratory Ring Trial

    DEFF Research Database (Denmark)

    Lasch, Peter; Wahab, Tara; Weil, Sandra

    2015-01-01

    In the case of a release of highly pathogenic bacteria (HPB), there is an urgent need for rapid, accurate, and reliable diagnostics. MALDI-TOF mass spectrometry is a rapid, accurate, and relatively inexpensive technique that is becoming increasingly important in microbiological diagnostics...... mallei, Burkholderia pseudomallei, and Yersinia pestis, were characterized under blinded conditions. Microbial strains were inactivated by high-dose gamma irradiation before shipment. Preparatory investigations ensured that this type of inactivation induced only subtle spectral changes with negligible...... by the individual laboratories on the basis of spectral libraries available on site. All mass spectra were also tested against an in-house HPB library at the Robert Koch Institute (RKI). The averaged identification accuracy was 77% in the first case and improved to >93% when the spectral diagnoses were obtained...

  2. Properties of thermophilic microorganisms

    International Nuclear Information System (INIS)

    Ljungdahl, L.G.

    1984-01-01

    Microorganisms are called thermophilic or extreme thermophilic (caldo-active) if they grow and reproduce over 47 0 C and 70 0 C, respectively. A survey of growth characteristics of thermophiles is presented and it includes those which also live at extreme pH. The prevalent but not completely emcompassing theory of the ability of thermophiles to grow at high temperatures is that they have macromolecules and cell organelles with high thermostability. Work on some proteins and cell organelles from thermophiles is reviewed. The thermostabilities of these components are compared with those of the living cells, and factors which may govern optimum as well as minimum growth temperatures of microorganisms are discussed. Examples are from the literature but also include enzymes involved in tetrahydrofolate metabolism and other proteins of acetogenic therhmophilic bacteria which are presently studied in the author's laboratory

  3. Specific single-cell isolation and genomic amplification of uncultured microorganisms

    DEFF Research Database (Denmark)

    Kvist, Thomas; Ahring, Birgitte Kiær; Lasken, R.S.

    2007-01-01

    We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group-specific pri......We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group......-specific primers in combination with a terminal restriction fragment length polymorphism profile. Intact cells were extracted from the environmental sample, and fluorescent in situ hybridization probing with Cy3-labeled probes designed from the clone library was subsequently used to detect the organisms...... of interest. Single cells with a bright fluorescent signal were isolated using a micromanipulator and the genome of the single isolated cells served as a template for multiple displacement amplification (MDA) using the Phi29 DNA polymerase. The generated MDA product was afterwards used for 16S rRNA gene...

  4. Role of Proteolytic Enzymes in the Interaction of Phytopathogenic Microorganisms with Plants.

    Science.gov (United States)

    Valueva, T A; Zaichik, B Ts; Kudryavtseva, N N

    2016-12-01

    Various forms of participation of proteolytic enzymes in pathogenesis and defense in plants are reviewed. Along with extracellular proteinases, phytopathogenic microorganisms produce specific effectors having proteolytic activity and capable of acting on proteins inside plant cells. In turn, for defense against pathogens, plants use both extracellular and intracellular proteinases.

  5. Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

    Directory of Open Access Journals (Sweden)

    García-Pérez Blanca Estela

    2012-10-01

    Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

  6. Antimicrobial Effect of Jasminum grandiflorum L. and Hibiscus rosa-sinensis L. Extracts Against Pathogenic Oral Microorganisms--An In Vitro Comparative Study.

    Science.gov (United States)

    Nagarajappa, Ramesh; Batra, Mehak; Sharda, Archana J; Asawa, Kailash; Sanadhya, Sudhanshu; Daryani, Hemasha; Ramesh, Gayathri

    2015-01-01

    To assess and compare the antimicrobial potential and determine the minimum inhibitory concentration (MIC) of Jasminum grandiflorum and Hibiscus rosa-sinensis extracts as potential anti-pathogenic agents in dental caries. Aqueous and ethanol (cold and hot) extracts prepared from leaves of Jasminum grandiflorum and Hibiscus rosa-sinensis were screened for in vitro antimicrobial activity against Streptococcus mutans and Lactobacillus acidophilus using the agar well diffusion method. The lowest concentration of every extract considered as the minimum inhibitory concentration (MIC) was determined for both test organisms. Statistical analysis was performed with one-way analysis of variance (ANOVA). At lower concentrations, hot ethanol Jasminum grandiflorum (10 μg/ml) and Hibiscus rosa-sinensis (25 μg/ml) extracts were found to have statistically significant (P≤0.05) antimicrobial activity against S. mutans and L. acidophilus with MIC values of 6.25 μg/ml and 25 μg/ml, respectively. A proportional increase in their antimicrobial activity (zone of inhibition) was observed. Both extracts were found to be antimicrobially active and contain compounds with therapeutic potential. Nevertheless, clinical trials on the effect of these plants are essential before advocating large-scale therapy.

  7. Stimulating soil microorganisms for mineralizing the herbicide isoproturon by means of microbial electroremediating cells.

    Science.gov (United States)

    Rodrigo Quejigo, Jose; Dörfler, Ulrike; Schroll, Reiner; Esteve-Núñez, Abraham

    2016-05-01

    The absence of suitable terminal electron acceptors (TEA) in soil might limit the oxidative metabolism of environmental microbial populations. Microbial electroremediating cells (MERCs) consist in a variety of bioelectrochemical devices that aim to overcome electron acceptor limitation and maximize metabolic oxidation with the purpose of enhancing the biodegradation of a pollutant in the environment. The objective of this work was to use MERCs principles for stimulating soil bacteria to achieve the complete biodegradation of the herbicide (14) C-isoproturon (IPU) to (14) CO(2) in soils. Our study concludes that using electrodes at a positive potential [+600 mV (versus Ag/AgCl)] enhanced the mineralization by 20-fold respect the electrode-free control. We also report an overall profile of the (14) C-IPU metabolites and a (14) C mass balance in response to the different treatments. The remarkable impact of electrodes on the microbial activity of natural communities suggests a promising future for this emerging environmental technology that we propose to name bioelectroventing. © 2016 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  8. Final technical report for project titled Quantitative Characterization of Cell Aggregation/Adhesion as Predictor for Distribution and Transport of Microorganisms in Subsurface Environment

    Energy Technology Data Exchange (ETDEWEB)

    Gu, April Z. [Northeastern Univ., Boston, MA (United States); Wan, Kai-tak [Northeastern Univ., Boston, MA (United States)

    2014-09-02

    This project aims to explore and develop enabling methodology and techniques for nano-scale characterization of microbe cell surface contact mechanics, interactions and adhesion quantities that allow for identification and quantification of indicative properties related to microorganism migration and transport behavior in porous media and in subsurface environments. Microbe transport has wide impact and therefore is of great interest in various environmental applications such as in situ or enhanced subsurface bioremediation,filtration processes for water and wastewater treatments and protection of drinking water supplies. Although great progress has been made towards understanding the identities and activities of these microorganisms in the subsurface, to date, little is known of the mechanisms that govern the mobility and transport of microorganisms in DOE’s contaminated sites, making the outcomes of in situ natural attenuation or contaminant stability enhancement unpredictable. Conventionally, movement of microorganisms was believed to follows the rules governing solute (particle) transport. However, recent studies revealed that cell surface properties, especially those pertaining to cell attachment/adhesion and aggregation behavior, can cause the microbe behavior to deviate from non-viable particles and hence greatly influence the mobility and distribution of microorganisms in porous media.This complexity highlights the need to obtain detailed information of cell-cell and cell-surface interactions in order to improve and refine the conceptual and quantitative model development for fate and transport of microorganisms and contaminant in subsurface. Traditional cell surface characterization methods are not sufficient to fully predict the deposition rates and transport behaviors of microorganism observed. A breakthrough of methodology that would allow for quantitative and molecular-level description of intrinsic cell surface properties indicative for cell

  9. Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

    NARCIS (Netherlands)

    Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

    2003-01-01

    Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

  10. Coffee and spent coffee extracts protect against cell mutagens and inhibit growth of food-borne pathogen microorganisms

    OpenAIRE

    Cid, C. (Concepción); Peña, M.P. (María Paz) de; Arbillaga, L. (Leire); Vitas, A.I. (Ana Isabel); Bravo, J. (Jimena); Monente, C. (Carmen)

    2015-01-01

    Coffee consumption decreases the risk of oxidative stress-related diseases. The by-product obtained after brewing process (spent coffee) also has antioxidant capacity. Spent coffee and coffee brews (filter and espresso) extracts were obtained from Arabica and Robusta coffees, respectively. Spent coffee showed slightly high amounts in chlorogenic acids, but caffeine content was similar to their respective coffee brew. All samples exhibited strong protection activity against indirect acting mut...

  11. Pathogenic Acinetobacter: from the Cell Surface to Infinity and Beyond

    Science.gov (United States)

    Weber, Brent S.; Harding, Christian M.

    2015-01-01

    The genus Acinetobacter encompasses multiple nosocomial opportunistic pathogens that are of increasing worldwide relevance because of their ability to survive exposure to various antimicrobial and sterilization agents. Among these, Acinetobacter baumannii, Acinetobacter nosocomialis, and Acinetobacter pittii are the most frequently isolated in hospitals around the world. Despite the growing incidence of multidrug-resistant Acinetobacter spp., little is known about the factors that contribute to pathogenesis. New strategies for treating and managing infections caused by multidrug-resistant Acinetobacter strains are urgently needed, and this requires a detailed understanding of the pathobiology of these organisms. In recent years, some virulence factors important for Acinetobacter colonization have started to emerge. In this review, we focus on several recently described virulence factors that act at the bacterial surface level, such as the capsule, O-linked protein glycosylation, and adhesins. Furthermore, we describe the current knowledge regarding the type II and type VI secretion systems present in these strains. PMID:26712938

  12. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against pathogenic gastro-intestinal microorganisms (ID 939

    DEFF Research Database (Denmark)

    Tetens, Inge

    Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a health claim related to a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against...... pathogenic gastro-intestinal microorganisms. The food constituent that is the subject of the health claim, a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722, is sufficiently characterised. The claimed effect, defence against pathogenic gastro...... and effect relationship has not been established between the consumption of a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against pathogenic gastro-intestinal microorganisms....

  13. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    Indian Academy of Sciences (India)

    DANG SUN

    1School of Life Sciences, Tsinghua University, Qinghuayuan Road, Beijing 100084, People's Republic of China. 2Alliance ... Reestablishing a well-balanced population of regulatory T cells (Tregs) .... Definition of CpG methylation peaks: Log2 ratios between ..... How these eight genes work in T cell function differentiation.

  14. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Science.gov (United States)

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  15. Follicular B Cells Promote Atherosclerosis via T Cell-Mediated Differentiation Into Plasma Cells and Secreting Pathogenic Immunoglobulin G.

    Science.gov (United States)

    Tay, Christopher; Liu, Yu-Han; Kanellakis, Peter; Kallies, Axel; Li, Yi; Cao, Anh; Hosseini, Hamid; Tipping, Peter; Toh, Ban-Hock; Bobik, Alex; Kyaw, Tin

    2018-05-01

    B cells promote or protect development of atherosclerosis. In this study, we examined the role of MHCII (major histocompatibility II), CD40 (cluster of differentiation 40), and Blimp-1 (B-lymphocyte-induced maturation protein) expression by follicular B (FO B) cells in development of atherosclerosis together with the effects of IgG purified from atherosclerotic mice. Using mixed chimeric Ldlr -/- mice whose B cells are deficient in MHCII or CD40, we demonstrate that these molecules are critical for the proatherogenic actions of FO B cells. During development of atherosclerosis, these deficiencies affected T-B cell interactions, germinal center B cells, plasma cells, and IgG. As FO B cells differentiating into plasma cells require Blimp-1, we also assessed its role in the development of atherosclerosis. Blimp-1-deficient B cells greatly attenuated atherosclerosis and immunoglobulin-including IgG production, preventing IgG accumulation in atherosclerotic lesions; Blimp-1 deletion also attenuated lesion proinflammatory cytokines, apoptotic cell numbers, and necrotic core. To determine the importance of IgG for atherosclerosis, we purified IgG from atherosclerotic mice. Their transfer but not IgG from nonatherosclerotic mice into Ldlr -/- mice whose B cells are Blimp-1-deficient increased atherosclerosis; transfer was associated with IgG accumulating in atherosclerotic lesions, increased lesion inflammatory cytokines, apoptotic cell numbers, and necrotic core size. The mechanism by which FO B cells promote atherosclerosis is highly dependent on their expression of MHCII, CD40, and Blimp-1. FO B cell differentiation into IgG-producing plasma cells also is critical for their proatherogenic actions. Targeting B-T cell interactions and pathogenic IgG may provide novel therapeutic strategies to prevent atherosclerosis and its adverse cardiovascular complications. © 2018 American Heart Association, Inc.

  16. Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells

    Science.gov (United States)

    2017-05-01

    intestinal inflammation by reducing TH17 cells and preserving group 3 innate lymphoid cells . Nat Med, 2016. 22(3): p. 319-23.   ...stable population of YFP+  cells  similar  to  innate  IL‐17–producing  cells  (e.g., γδ T  cells ) during acute infection (Fig.2) , which is in sharp contrast...AWARD NUMBER: W81XWH-16-1-0100 TITLE: Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells PRINCIPAL INVESTIGATOR: Seon Hee

  17. Pathogenicity and cell wall-degrading enzyme activities of some ...

    African Journals Online (AJOL)

    Dr. J. T. Ekanem

    2005-12-17

    Dec 17, 2005 ... be attributed to the activities of these cell wall degrading enzymes. Keywords: Cowpea ... bacteria have long been known to produce enzymes capable of ... Inoculated seeds were sown in small plastic pots filled with steam- ...

  18. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2015-01-01

    with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

  19. Elimination of the risk resulting from pathogenic microorganisms in dried and smoked fish by gamma irradiation. Part of a coordinated programme on the wholesomeness of food irradiation

    International Nuclear Information System (INIS)

    Gonzalez, O.N.

    1979-02-01

    Results of examination made on commercial samples of dried and smoked hasa-hasa (Rastrelliger brachysomus), dried and smoked tunsoy (Sardinella fimbriata) and steamed sinaing na tulingan (Auxia thazand) showed high microbial counts. Laboratory-prepared samples of these products inoculated with 10 7 cells of either S. choleraesuis, S. paratyphi A, S. typhimurium, E. coli or S. aureus per g of sample and irradiated at doses varying from 0 to 500 krad showed S. aureus to be the most radio-resistant. S. typhimurium showed higher radiation resistance than other types of Salmonella in these fishery products. The 5 D 10 value of S. typhimurium was as high as 460 krad in steamed fish and as low as 100 krad in a smoked fish product. The 5 D 10 value of S. aureus in all products was approximately 500 krad. Thus, a dose at this level may be recommended as a radicidation dose for these types of products. No changes in organoleptic properties were detected in either dried, smoked or steamed fish irradiated with doses up to 500 krad

  20. Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

    Directory of Open Access Journals (Sweden)

    Francesco Marras

    2011-01-01

    Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

  1. Indicators for waterborne pathogens

    National Research Council Canada - National Science Library

    Committee on Indicators for Waterborne Pathogens, National Research Council

    2004-01-01

    ... not practical or feasible to monitor for the complete spectrum of microorganisms that may occur in water, and many known pathogens are difficult to detect directly and reliably in water samples.Â...

  2. Probiotic Modulation of Innate Cell Pathogen Sensing and Signaling Events

    Directory of Open Access Journals (Sweden)

    Amy Llewellyn

    2017-10-01

    Full Text Available There is a growing body of evidence documenting probiotic bacteria to have a beneficial effect to the host through their ability to modulate the mucosal immune system. Many probiotic bacteria can be considered to act as either immune activators or immune suppressors, which have appreciable influence on homeostasis, inflammatory- and suppressive-immunopathology. What is becoming apparent is the ability of these probiotics to modulate innate immune responses via direct or indirect effects on the signaling pathways that drive these activatory or suppressive/tolerogenic mechanisms. This review will focus on the immunomodulatory role of probiotics on signaling pathways in innate immune cells: from positive to negative regulation associated with innate immune cells driving gut mucosal functionality. Research investigations have shown probiotics to modulate innate functionality in many ways including, receptor antagonism, receptor expression, binding to and expression of adaptor proteins, expression of negative regulatory signal molecules, induction of micro-RNAs, endotoxin tolerisation and finally, the secretion of immunomodulatory proteins, lipids and metabolites. The detailed understanding of the immunomodulatory signaling effects of probiotic strains will facilitate strain-specific selective manipulation of innate cell signal mechanisms in the modulation of mucosal adjuvanticity, immune deviation and tolerisation in both healthy subjects and patients with inflammatory and suppressive pathology.

  3. Probiotic Modulation of Innate Cell Pathogen Sensing and Signaling Events

    Science.gov (United States)

    Llewellyn, Amy; Foey, Andrew

    2017-01-01

    There is a growing body of evidence documenting probiotic bacteria to have a beneficial effect to the host through their ability to modulate the mucosal immune system. Many probiotic bacteria can be considered to act as either immune activators or immune suppressors, which have appreciable influence on homeostasis, inflammatory- and suppressive-immunopathology. What is becoming apparent is the ability of these probiotics to modulate innate immune responses via direct or indirect effects on the signaling pathways that drive these activatory or suppressive/tolerogenic mechanisms. This review will focus on the immunomodulatory role of probiotics on signaling pathways in innate immune cells: from positive to negative regulation associated with innate immune cells driving gut mucosal functionality. Research investigations have shown probiotics to modulate innate functionality in many ways including, receptor antagonism, receptor expression, binding to and expression of adaptor proteins, expression of negative regulatory signal molecules, induction of micro-RNAs, endotoxin tolerisation and finally, the secretion of immunomodulatory proteins, lipids and metabolites. The detailed understanding of the immunomodulatory signaling effects of probiotic strains will facilitate strain-specific selective manipulation of innate cell signal mechanisms in the modulation of mucosal adjuvanticity, immune deviation and tolerisation in both healthy subjects and patients with inflammatory and suppressive pathology. PMID:29065562

  4. Microorganisms of Grape Berries

    Directory of Open Access Journals (Sweden)

    Kántor Attila

    2017-12-01

    Full Text Available Grape surface is an unstable habitat that changes greatly according to the stage of grape ripening. Different bacteria and yeasts can colonise the surface of grape berry and the diversity of microorganisms depends on the stage of ripening, pesticide application and health condition. The aim of this study was to study the microflora of the surface of grape berries. Altogether, 19 grape samples from Slovakia were collected. The spread plate method was applied and a 100 μL inoculum of each dilution (10−2, 10−3 was plated on TSA, MEA, and MRS agar for isolation of microorganisms from grapes. Proteins were extracted from cells by ethanol/formic acid extraction procedure. MALDI-TOF Mass Spectrometry was used for identification of microorganisms. In total, 11 genera of Gram-negative bacteria, 11 of Gram-positive bacteria and nine of yeasts were identified. Among 200 isolates, Gram-negative, Gram-positive bacteria and yeasts represented 11%, 27% and 62% of the total number of isolates studied. The most common genera of isolated yeasts were Hanseniaspora (37%, Metschnikowia (31%, and Rhodotorula (10%. The most frequently isolated among Gram-negative bacteria were Acinetobacter (22%, Pseudomonas (22% and Sphingomonas (13%. The most common genera of Gram-positive bacteria were Bacillus (20%, Lactobacillus (19%, Leuconostoc and Staphylococcus (11%, respectively.

  5. Cloning, overexpression, purification of bacteriocin enterocin-B and structural analysis, interaction determination of enterocin-A, B against pathogenic bacteria and human cancer cells.

    Science.gov (United States)

    Ankaiah, Dasari; Palanichamy, Esakkiraj; Antonyraj, Christian Bharathi; Ayyanna, Repally; Perumal, Venkatesh; Ahamed, Syed Ibrahim Basheer; Arul, Venkatesan

    2018-05-02

    In this present study, a gene (ent-B) encoding the bacteriocin enterocin-B was cloned, overexpressed and purified from Enterococcus faecium por1. The molecular weight of the bacteriocin enterocin-B was observed around 7.2 kDa and exhibited antimicrobial activity against several human pathogenic bacteria. The antimicrobial activity of cloned enterocin-B was increased effectively by combining with another bacteriocin enterocin-A from the same microorganism. Protein-protein docking and molecular dynamics simulation studies revealed that the bacteriocin enterocin-B is interacting with enterocin-A and formation of a heterodimer (enterocin A + B). The heterodimer of bacteriocin enterocin-A + B exhibited potential anti-bacterial, anti-biofilm activity against Staphylococcus aureus, Acinetobacter baumannii, Listeria monocytogenes and Escherichia coli. The bacteriocin enterocin-B, A and heterodimer of bacteriocin enterocin A + B showed no haemolysis on human RBC cells. This is the first report that the cell growth inhibitory activity of the bacteriocin enterocin B against HeLa, HT-29 and AGS human cancer cells and this cell growth inhibitory activity was significantly increased when cancer cells treated with the heterodimer of bacteriocins enterocin-A + B. The cell growth inhibitory activity of the bacteriocin enterocin-B and the heterodimer of bacteriocin enterocin-A + B were not observed in non-cancerous INT-407 cells (intestinal epithelial cells). Copyright © 2018. Published by Elsevier B.V.

  6. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    NARCIS (Netherlands)

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

    2015-01-01

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  7. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    NARCIS (Netherlands)

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  8. Microstructure of Cell Wall-Associated Melanin in the Human Pathogenic Fungus cryptococcus neoformans

    OpenAIRE

    Eisenman, H.C.; Nosanchuk, J.D.; Webber, J. Beau W.; Emerson, T.A.; Casadevall, A.

    2005-01-01

    Melanin is a virulence factor for many pathogenic fungal species,including Cryptococcus neoformans. Melanin is deposited in the cell wall, and melanin isolated from this fungus retains the shape of the cells, resulting in hollow spheres called ``ghosts''. In this study, atomic force, scanning electron, and transmission electron microscopy revealed that melanin ghosts are covered with roughly spherical granular particles approximately 40-130 nm in diameter, and that the melanin is arranged in ...

  9. Synthetic biology expands chemical control of microorganisms.

    Science.gov (United States)

    Ford, Tyler J; Silver, Pamela A

    2015-10-01

    The tools of synthetic biology allow researchers to change the ways engineered organisms respond to chemical stimuli. Decades of basic biology research and new efforts in computational protein and RNA design have led to the development of small molecule sensors that can be used to alter organism function. These new functions leap beyond the natural propensities of the engineered organisms. They can range from simple fluorescence or growth reporting to pathogen killing, and can involve metabolic coordination among multiple cells or organisms. Herein, we discuss how synthetic biology alters microorganisms' responses to chemical stimuli resulting in the development of microbes as toxicity sensors, disease treatments, and chemical factories. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

    Science.gov (United States)

    Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

    2017-07-21

    Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

  11. Proteolysis in hyperthermophilic microorganisms

    Directory of Open Access Journals (Sweden)

    Donald E. Ward

    2002-01-01

    Full Text Available Proteases are found in every cell, where they recognize and break down unneeded or abnormal polypeptides or peptide-based nutrients within or outside the cell. Genome sequence data can be used to compare proteolytic enzyme inventories of different organisms as they relate to physiological needs for protein modification and hydrolysis. In this review, we exploit genome sequence data to compare hyperthermophilic microorganisms from the euryarchaeotal genus Pyrococcus, the crenarchaeote Sulfolobus solfataricus, and the bacterium Thermotoga maritima. An overview of the proteases in these organisms is given based on those proteases that have been characterized and on putative proteases that have been identified from genomic sequences, but have yet to be characterized. The analysis revealed both similarities and differences in the mechanisms utilized for proteolysis by each of these hyperthermophiles and indicated how these mechanisms relate to proteolysis in less thermophilic cells and organisms.

  12. Altered T-cell responses by the periodontal pathogen Porphyromonas gingivalis.

    Directory of Open Access Journals (Sweden)

    Hazem Khalaf

    Full Text Available Several studies support an association between the chronic inflammatory diseases periodontitis and atherosclerosis with a crucial role for the periodontal pathogen Porphyromonas gingivalis. However, the interplay between this pathogen and the adaptive immune system, including T-cells, is sparsely investigated. Here we used Jurkat T-cells to determine the effects of P. gingivalis on T-cell-mediated adaptive immune responses. We show that viable P. gingivalis targets IL-2 expression at the protein level. Initial cellular events, including ROS production and [Ca(2+](i, were elevated in response to P. gingivalis, but AP-1 and NF-κB activity dropped below basal levels and T-cells were unable to sustain stable IL-2 accumulation. IL-2 was partially restored by Leupeptin, but not by Cathepsin B Inhibitor, indicating an involvement of Rgp proteinases in the suppression of IL-2 accumulation. This was further confirmed by purified Rgp that caused a dose-dependent decrease in IL-2 levels. These results provide new insights of how this periodontal pathogen evades the host adaptive immune system by inhibiting IL-2 accumulation and thus attenuating T-cell proliferation and cellular communication.

  13. Assessment of survival of food-borne microorganisms in the food chain by fluorescence ratio imaging microscopy

    DEFF Research Database (Denmark)

    Siegumfeldt, Henrik; Arneborg, Nils

    2011-01-01

    Traditionally, many data on food–borne microorganisms are obtained as an average of a whole population, under the assumption that the individual cells are clonal and therefore identical. However, it is now acknowledged that there may be a large heterogeneity within an isogenic population......, and consequently new methods focus on the individual cells. This mini-review will give an overview of the response of food-borne microorganisms; i.e. pathogenic bacteria, lactic acid bacteria, and yeasts, at a single-cell level to various food-related stress conditions, comprising acid-, disinfection-, salt...

  14. Hotspot autoimmune T cell receptor binding underlies pathogen and insulin peptide cross-reactivity

    Science.gov (United States)

    Cole, David K.; Bulek, Anna M.; Dolton, Garry; Schauenberg, Andrea J.; Szomolay, Barbara; Trimby, Andrew; Jothikumar, Prithiviraj; Fuller, Anna; Skowera, Ania; Rossjohn, Jamie; Zhu, Cheng; Miles, John J.; Wooldridge, Linda; Rizkallah, Pierre J.; Sewell, Andrew K.

    2016-01-01

    The cross-reactivity of T cells with pathogen- and self-derived peptides has been implicated as a pathway involved in the development of autoimmunity. However, the mechanisms that allow the clonal T cell antigen receptor (TCR) to functionally engage multiple peptide–major histocompatibility complexes (pMHC) are unclear. Here, we studied multiligand discrimination by a human, preproinsulin reactive, MHC class-I–restricted CD8+ T cell clone (1E6) that can recognize over 1 million different peptides. We generated high-resolution structures of the 1E6 TCR bound to 7 altered peptide ligands, including a pathogen-derived peptide that was an order of magnitude more potent than the natural self-peptide. Evaluation of these structures demonstrated that binding was stabilized through a conserved lock-and-key–like minimal binding footprint that enables 1E6 TCR to tolerate vast numbers of substitutions outside of this so-called hotspot. Highly potent antigens of the 1E6 TCR engaged with a strong antipathogen-like binding affinity; this engagement was governed though an energetic switch from an enthalpically to entropically driven interaction compared with the natural autoimmune ligand. Together, these data highlight how T cell cross-reactivity with pathogen-derived antigens might break self-tolerance to induce autoimmune disease. PMID:27183389

  15. The modular nature of dendritic cell responses to commensal and pathogenic fungi.

    Directory of Open Access Journals (Sweden)

    Lisa Rizzetto

    Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

  16. Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

    Directory of Open Access Journals (Sweden)

    Sophie Coudeyras

    2008-01-01

    Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

  17. Pathogen Trojan Horse Delivers Bioactive Host Protein to Alter Maize Anther Cell Behavior in Situ.

    Science.gov (United States)

    van der Linde, Karina; Timofejeva, Ljudmilla; Egger, Rachel L; Ilau, Birger; Hammond, Reza; Teng, Chong; Meyers, Blake C; Doehlemann, Gunther; Walbot, Virginia

    2018-03-01

    Small proteins are crucial signals during development, host defense, and physiology. The highly spatiotemporal restricted functions of signaling proteins remain challenging to study in planta. The several month span required to assess transgene expression, particularly in flowers, combined with the uncertainties from transgene position effects and ubiquitous or overexpression, makes monitoring of spatiotemporally restricted signaling proteins lengthy and difficult. This situation could be rectified with a transient assay in which protein deployment is tightly controlled spatially and temporally in planta to assess protein functions, timing, and cellular targets as well as to facilitate rapid mutagenesis to define functional protein domains. In maize ( Zea mays ), secreted ZmMAC1 (MULTIPLE ARCHESPORIAL CELLS1) was proposed to trigger somatic niche formation during anther development by participating in a ligand-receptor module. Inspired by Homer's Trojan horse myth, we engineered a protein delivery system that exploits the secretory capabilities of the maize smut fungus Ustilago maydis , to allow protein delivery to individual cells in certain cell layers at precise time points. Pathogen-supplied ZmMAC1 cell-autonomously corrected both somatic cell division and differentiation defects in mutant Zm mac1-1 anthers. These results suggest that exploiting host-pathogen interactions may become a generally useful method for targeting host proteins to cell and tissue types to clarify cellular autonomy and to analyze steps in cell responses. © 2018 American Society of Plant Biologists. All rights reserved.

  18. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  19. Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

    Science.gov (United States)

    David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

    2015-01-01

    Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widely recognized as an important player in innate immunity and the early response to infections. Here we review the complex relationship between Burkholderia species and epithelial cells with an emphasis on the most pathogenic species, Burkholderia pseudomallei and Burkholderia mallei. The current gaps in knowledge in our understanding are highlighted along with the epithelial host-pathogen interactions that offer potential opportunities for therapeutic intervention. PMID:26636042

  20. Microorganisms in food technology

    Energy Technology Data Exchange (ETDEWEB)

    Rose, A H

    1981-11-01

    Man has been using microorganisms for thousands of years to make bread, cheese, beer, wine, etc. Today, microorganisms can be specially grown or genetically manipulated so as to synthesize high-quality proteins even from low-grade basic materials.

  1. Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

    Science.gov (United States)

    Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

    2014-11-01

    The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

  2. The Cell Wall of the Human Fungal Pathogen Aspergillus fumigatus: Biosynthesis, Organization, Immune Response, and Virulence.

    Science.gov (United States)

    Latgé, Jean-Paul; Beauvais, Anne; Chamilos, Georgios

    2017-09-08

    More than 90% of the cell wall of the filamentous fungus Aspergillus fumigatus comprises polysaccharides. Biosynthesis of the cell wall polysaccharides is under the control of three types of enzymes: transmembrane synthases, which are anchored to the plasma membrane and use nucleotide sugars as substrates, and cell wall-associated transglycosidases and glycosyl hydrolases, which are responsible for remodeling the de novo synthesized polysaccharides and establishing the three-dimensional structure of the cell wall. For years, the cell wall was considered an inert exoskeleton of the fungal cell. The cell wall is now recognized as a living organelle, since the composition and cellular localization of the different constitutive cell wall components (especially of the outer layers) vary when the fungus senses changes in the external environment. The cell wall plays a major role during infection. The recognition of the fungal cell wall by the host is essential in the initiation of the immune response. The interactions between the different pattern-recognition receptors (PRRs) and cell wall pathogen-associated molecular patterns (PAMPs) orientate the host response toward either fungal death or growth, which would then lead to disease development. Understanding the molecular determinants of the interplay between the cell wall and host immunity is fundamental to combatting Aspergillus diseases.

  3. Culture of human cell lines by a pathogen-inactivated human platelet lysate.

    Science.gov (United States)

    Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L

    2016-08-01

    Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety.

  4. B cells promote obesity-associated periodontitis and oral pathogen-associated inflammation.

    Science.gov (United States)

    Zhu, Min; Belkina, Anna C; DeFuria, Jason; Carr, Jordan D; Van Dyke, Thomas E; Gyurko, Robert; Nikolajczyk, Barbara S

    2014-08-01

    Individuals with T2D and PD suffer significantly from the ability of one disease to intensify the other. Disease-associated inflammation is one mechanism thought to fuel this pathogenic feed-forward loop. Several lines of evidence indicate that proinflammatory B cells promote T2D and PD; thus, B cells are top candidates for a cell type that predisposes PD in T2D. To test directly the role of B cells in T2D-associated PD, we compared outcomes from oral Porphyromonas gingivalis challenge of lean WT or B cell-null mice with outcomes from mice that were obese and insulin-resistant before challenge. Obese WT mice responded to oral P. gingivalis challenge with significant periodontal bone loss, whereas obese B cell-null mice were protected completely from PD. By contrast, lean WT and B cell-null mice suffer similar periodontal bone loss in response to oral pathogen. B cells from obese/insulin-resistant hosts also support oral osteoclastogenesis and both oral and systemic production of inflammatory cytokines, including pro-osteoclastogenic TNF-α and MIP-2, an ortholog of human IL-8. B cells furthermore impact AT inflammation in obese, P. gingivalis-infected hosts. Taken together, these data show that fundamentally different mechanisms regulate PD in lean and obese hosts, with B cells able to promote PD only if the hosts are "primed" by obesity. These results justify more intense analysis of obesity-associated changes in B cells that predispose PD in human T2D. © 2014 Society for Leukocyte Biology.

  5. Antimicrobial activity of Lactobacillus and Bifidobacterium strains against pathogenic microorganisms “in vitro”Atividade antimicrobiana de Lactobacillus e Bifodobacterium frente a microrganismos patogênicos “in vitro”

    Directory of Open Access Journals (Sweden)

    Giselle Nobre Costa

    2012-10-01

    Full Text Available Lactobacilli and bifidobacteria have a long history of safe use in foods. These bacteria have biotechnological characteristics of interest such as the inhibition of pathogens. In this work, two lactobacilli strain and a bifidobacterium strain isolated from human gut were evaluated concerning to their ability to inhibit pathogenic microorganisms in foods by diffusion agar tests. Moreover, we assessed the metabolites produced in culture broth under static and shaking growth to simulate anaerobiosis and aerobiosis conditions, respectively. L. acidophilus LA5, L. plantarum DCTA 8420 and B. lactis DCTA 8724 showed ability to inhibit S. aureus FRI 196, strains producer toxins A and D, as well as B. cereus ATCC 25923, E. coli ATCC 25922 and S. Enteritidis, whose inhibition halos reached, on average, 24 mm in diameter. In the agar diffusion method with concentrated culture medium, it was possible to observe the effect of oxygen on the production of toxic substances. This result showed that cultivation of Lactobacillus under aerobic conditions seems to exert greater inhibitory effect, whereas for Bifidobacterium strain the effect was the opposite.Lactobacilos e bifidobactérias apresentam um longo histórico de uso seguro em alimentos, além de apresentarem características de interesse biotecnológico como a inibição de patógenos. Neste trabalho duas linhagens de lactobacilos e uma de bifidobactéria, isoladas do intestino humano, foram avaliadas em testes de difusão em ágar, quanto à capacidade de inibição de microrganismos patogênicos de ocorrência comuns em toxinfecções alimentares. Adicionalmente, foram avaliados os metabólitos produzidos em caldo de cultivo estático e em agitação para simular condições de anaerobiose a aerobiose, respectivamente. As três bactérias, L. acidophilus LA5, L. plantarum DCTA 8420 e B. lactis DCTA 8724 apresentaram capacidade de inibição para S. aureus FRI 196 linhagem produtora de toxinas A e D

  6. Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

    OpenAIRE

    Taborda, Carlos P.; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

    2008-01-01

    Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

  7. The Cell Wall-Associated Proteins in the Dimorphic Pathogenic Species of Paracoccidioides.

    Science.gov (United States)

    Puccia, Rosana; Vallejo, Milene C; Longo, Larissa V G

    2017-01-01

    Paracoccidioides brasiliensis and P. lutzii cause human paracoccidioidomycosis (PCM). They are dimorphic ascomycetes that grow as filaments at mild temperatures up to 28oC and as multibudding pathogenic yeast cells at 37oC. Components of the fungal cell wall have an important role in the interaction with the host because they compose the cell outermost layer. The Paracoccidioides cell wall is composed mainly of polysaccharides, but it also contains proportionally smaller rates of proteins, lipids, and melanin. The polysaccharide cell wall composition and structure of Paracoccidioides yeast cells, filamentous and transition phases were studied in detail in the past. Other cell wall components have been better analyzed in the last decades. The present work gives to the readers a detailed updated view of cell wall-associated proteins. Proteins that have been localized at the cell wall compartment using antibodies are individually addressed. We also make an overview about PCM, the Paracoccidioides cell wall structure, secretion mechanisms, and fungal extracellular vesicles. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Adaptive response to starvation in the fish pathogen Flavobacterium columnare: cell viability and ultrastructural changes

    Directory of Open Access Journals (Sweden)

    Arias Covadonga R

    2012-11-01

    Full Text Available Abstract Background The ecology of columnaris disease, caused by Flavobacterium columnare, is poorly understood despite the economic losses that this disease inflicts on aquaculture farms worldwide. Currently, the natural reservoir for this pathogen is unknown but limited data have shown its ability to survive in water for extended periods of time. The objective of this study was to describe the ultrastructural changes that F. columnare cells undergo under starvation conditions. Four genetically distinct strains of this pathogen were monitored for 14 days in media without nutrients. Culturability and cell viability was assessed throughout the study. In addition, cell morphology and ultrastructure was analyzed using light microscopy, scanning electron microscopy, and transmission electron microscopy. Revival of starved cells under different nutrient conditions and the virulence potential of the starved cells were also investigated. Results Starvation induced unique and consistent morphological changes in all strains studied. Cells maintained their length and did not transition into a shortened, coccus shape as observed in many other Gram negative bacteria. Flavobacterium columnare cells modified their shape by morphing into coiled forms that comprised more than 80% of all the cells after 2 weeks of starvation. Coiled cells remained culturable as determined by using a dilution to extinction strategy. Statistically significant differences in cell viability were found between strains although all were able to survive in absence of nutrients for at least 14 days. In later stages of starvation, an extracellular matrix was observed covering the coiled cells. A difference in growth curves between fresh and starved cultures was evident when cultures were 3-months old but not when cultures were starved for only 1 month. Revival of starved cultures under different nutrients revealed that cells return back to their original elongated rod shape upon

  9. Relationship of blood and milk cell counts with mastitic pathogens in Murrah buffaloes

    Directory of Open Access Journals (Sweden)

    C. Singh

    2010-02-01

    Full Text Available The present study was undertaken to see the effect of mastitic pathogens on the blood and milk counts of Murrah buffaloes. Milk and blood samples were collected from 9 mastitic Murrah buffaloes. The total leucocyte Counts (TLC and Differential leucocyte counts (DLC in blood were within normal range and there was a non-significant change in blood counts irrespective of different mastitic pathogens. Normal milk quarter samples had significantly (P<0.01 less Somatic cell counts (SCC. Lymphocytes were significantly higher in normal milk samples, whereas infected samples had a significant increase (P<0.01 in milk neutrophils. S. aureus infected buffaloes had maximum milk SCC, followed by E. coli and S. agalactiae. Influx of neutrophils in the buffalo mammary gland was maximum for S. agalactiae, followed by E.cli and S. aureus. The study indicated that level of mastitis had no affect on blood counts but it influenced the milk SCC of normal quarters.

  10. Expanding the potential of NAI-107 for treating serious ESKAPE pathogens: synergistic combinations against Gram-negatives and bactericidal activity against non-dividing cells.

    Science.gov (United States)

    Brunati, Cristina; Thomsen, Thomas T; Gaspari, Eleonora; Maffioli, Sonia; Sosio, Margherita; Jabes, Daniela; Løbner-Olesen, Anders; Donadio, Stefano

    2018-02-01

    To characterize NAI-107 and related lantibiotics for their in vitro activity against Gram-negative pathogens, alone or in combination with polymyxin, and against non-dividing cells or biofilms of Staphylococcus aureus. NAI-107 was also evaluated for its propensity to select or induce self-resistance in Gram-positive bacteria. We used MIC determinations and chequerboard experiments to establish the antibacterial activity of the examined compounds against target microorganisms. Time-kill assays were used to evaluate killing of exponential and stationary-phase cells. The effects on biofilms (growth inhibition and biofilm eradication) were evaluated using biofilm-coated pegs. The frequency of spontaneous resistant mutants was evaluated by either direct plating or by continuous sub-culturing at 0.5 × MIC levels, followed by population analysis profiles. The results showed that NAI-107 and its brominated variant are highly active against Neisseria gonorrhoeae and some other fastidious Gram-negative pathogens. Furthermore, all compounds strongly synergized with polymyxin against Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, and showed bactericidal activity. Surprisingly, NAI-107 alone was bactericidal against non-dividing A. baumannii cells. Against S. aureus, NAI-107 and related lantibiotics showed strong bactericidal activity against dividing and non-dividing cells. Activity was also observed against S. aureus biofilms. As expected for a lipid II binder, no significant resistance to NAI-107 was observed by direct plating or serial passages. Overall, the results of the current work, along with previously published results on the efficacy of NAI-107 in experimental models of infection, indicate that this lantibiotic represents a promising option in addressing the serious threat of antibiotic resistance. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial

  11. The varieties of immunological experience: of pathogens, stress, and dendritic cells.

    Science.gov (United States)

    Pulendran, Bali

    2015-01-01

    In the 40 years since their discovery, dendritic cells (DCs) have been recognized as central players in immune regulation. DCs sense microbial stimuli through pathogen-recognition receptors (PRRs) and decode, integrate, and present information derived from such stimuli to T cells, thus stimulating immune responses. DCs can also regulate the quality of immune responses. Several functionally specialized subsets of DCs exist, but DCs also display functional plasticity in response to diverse stimuli. In addition to sensing pathogens via PRRs, emerging evidence suggests that DCs can also sense stress signals, such as amino acid starvation, through ancient stress and nutrient sensing pathways, to stimulate adaptive immunity. Here, I discuss these exciting advances in the context of a historic perspective on the discovery of DCs and their role in immune regulation. I conclude with a discussion of emerging areas in DC biology in the systems immunology era and suggest that the impact of DCs on immunity can be usefully contextualized in a hierarchy-of-organization model in which DCs, their receptors and signaling networks, cell-cell interactions, tissue microenvironment, and the host macroenvironment represent different levels of the hierarchy. Immunity or tolerance can then be represented as a complex function of each of these hierarchies.

  12. Pathogen inactivation of Dengue virus in red blood cells using amustaline and glutathione.

    Science.gov (United States)

    Aubry, Maite; Laughhunn, Andrew; Santa Maria, Felicia; Lanteri, Marion C; Stassinopoulos, Adonis; Musso, Didier

    2017-12-01

    Dengue virus (DENV) is an arbovirus primarily transmitted through mosquito bite; however, DENV transfusion-transmitted infections (TTIs) have been reported and asymptomatic DENV RNA-positive blood donors have been identified in endemic countries. DENV is considered a high-risk pathogen for blood safety. One of the mitigation strategies to prevent arbovirus TTIs is pathogen inactivation. In this study we demonstrate that the amustaline and glutathione (S-303/GSH) treatment previously found effective against Zika virus in red blood cells (RBCs) is also effective in inactivating DENV. Red blood cells were spiked with high levels of DENV. Viral RNA loads and infectious titers were measured in the untreated control and before and after pathogen inactivation treatment of RBC samples. DENV infectivity was also assessed over five successive cell culture passages to detect any potential residual replicative virus. The mean ± SD DENV titer in RBCs before inactivation was 6.61 ± 0.19 log 50% tissue culture infectious dose (TCID 50 )/mL and the mean viral RNA load was 8.42 log genome equivalents/mL. No replicative DENV was detected either immediately after completion of treatment using S-303/GSH or after cell culture passages. Treatment using S-303/GSH inactivated high levels of DENV in RBCs to the limit of detection. In combination with previous studies showing the effective inactivation of DENV in plasma and platelets using the licensed amotosalen/UVA system, this study demonstrates that high levels of DENV can be inactivated in all blood components. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  13. Challenges and Strategies for Proteome Analysis of the Interaction of Human Pathogenic Fungi with Host Immune Cells.

    Science.gov (United States)

    Krüger, Thomas; Luo, Ting; Schmidt, Hella; Shopova, Iordana; Kniemeyer, Olaf

    2015-12-14

    Opportunistic human pathogenic fungi including the saprotrophic mold Aspergillus fumigatus and the human commensal Candida albicans can cause severe fungal infections in immunocompromised or critically ill patients. The first line of defense against opportunistic fungal pathogens is the innate immune system. Phagocytes such as macrophages, neutrophils and dendritic cells are an important pillar of the innate immune response and have evolved versatile defense strategies against microbial pathogens. On the other hand, human-pathogenic fungi have sophisticated virulence strategies to counteract the innate immune defense. In this context, proteomic approaches can provide deeper insights into the molecular mechanisms of the interaction of host immune cells with fungal pathogens. This is crucial for the identification of both diagnostic biomarkers for fungal infections and therapeutic targets. Studying host-fungal interactions at the protein level is a challenging endeavor, yet there are few studies that have been undertaken. This review draws attention to proteomic techniques and their application to fungal pathogens and to challenges, difficulties, and limitations that may arise in the course of simultaneous dual proteome analysis of host immune cells interacting with diverse morphotypes of fungal pathogens. On this basis, we discuss strategies to overcome these multifaceted experimental and analytical challenges including the viability of immune cells during co-cultivation, the increased and heterogeneous protein complexity of the host proteome dynamically interacting with the fungal proteome, and the demands on normalization strategies in terms of relative quantitative proteome analysis.

  14. , 971, 975, 983, 985, 994, 996, 998, 1006, 1014), decreasing potentially pathogenic gastro-intestinal microorganisms (ID 960, 967, 969, 971, 975, 983, 985, 994, 996, 998, 1006, 1014), and stimulation of immunological responses (ID 962, 968, 970, 972, 976, 984, 986, 995, 997, 999, 1007, 1015) (further, assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies (NDA) was asked to provide a scientific opinion on health claims pursuant to Article 13 of Regulation (EC) No 1924/2006 in the framework of further assessment related to various microorganisms...... and changes in bowel function, and digestion and absorption of nutrients, decreasing potentially pathogenic gastro-intestinal microorganisms, and stimulation of immunological responses. The food constituents, Bifidobacterium animalis subsp. lactis THT 010801, Bifidobacterium longum subsp. infantis THT 010201...... 030802, Lactobacillus salivarius THT 031001 and Streptococcus thermophilus THT 070102, are sufficiently characterised. The evidence provided did not establish that the proposed claimed effect, stimulation of immunological responses, is a beneficial physiological effect. The references provided...

  15. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to Lactobacillus johnsonii NCC 533 (La1) (CNCM I-1225) and improving immune defence against pathogenic gastro-intestinal microorganisms (ID 896), and protection, of the skin from UV-induced damage (ID 900) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to Lactobacillus johnsonii NCC 533 (La1) (CNCM I-1225) and improving immune defence against pathogenic gastro-intestinal microorganisms, and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...

  16. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

    Directory of Open Access Journals (Sweden)

    Nudelman Irina

    2010-10-01

    Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

  17. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase.

    Science.gov (United States)

    Patil, Sonali; Pincas, Hanna; Seto, Jeremy; Nudelman, German; Nudelman, Irina; Sealfon, Stuart C

    2010-10-07

    Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to pathogen detection. This map represents a navigable

  18. Suppression of immune-mediated liver injury after vaccination with attenuated pathogenic cells.

    Science.gov (United States)

    Mei, Yunhua; Wang, Ying; Xu, Lingyun

    2007-05-15

    Cell vaccination via immunization with attenuated pathogenic cells is an effective preventive method that has been successfully applied in several animal models of inflammatory or autoimmune diseases. Concanavalin A (Con A)-induced hepatitis (CIH) is a commonly used experimental model to study immune-mediated liver injury. Multiple cell types including T lymphocytes, macrophages and neutrophils have been found to be involved in the pathogenesis of CIH. In this study, we used attenuated spleen lymphocytes or peripheral blood lymphocytes as vaccines to investigate whether they could induce protective immune responses to prevent mice from developing CIH. We found that mice receiving such vaccination before CIH induction developed much milder diseases, exhibited a lower level of alanine aminotransferase (ALT) released into their plasma and had less inflammatory lesions in their livers. Such CIH-suppression is dose- and frequency-dependent. The suppressive effect was associated with inhibition of several major inflammatory mediators, pro-inflammatory cytokines and chemokines.

  19. Living biointerfaces based on non-pathogenic bacteria to direct cell differentiation

    Science.gov (United States)

    Rodrigo-Navarro, Aleixandre; Rico, Patricia; Saadeddin, Anas; Garcia, Andres J.; Salmeron-Sanchez, Manuel

    2014-07-01

    Genetically modified Lactococcus lactis, non-pathogenic bacteria expressing the FNIII7-10 fibronectin fragment as a protein membrane have been used to create a living biointerface between synthetic materials and mammalian cells. This FNIII7-10 fragment comprises the RGD and PHSRN sequences of fibronectin to bind α5β1 integrins and triggers signalling for cell adhesion, spreading and differentiation. We used L. lactis strain to colonize material surfaces and produce stable biofilms presenting the FNIII7-10 fragment readily available to cells. Biofilm density is easily tunable and remains stable for several days. Murine C2C12 myoblasts seeded over mature biofilms undergo bipolar alignment and form differentiated myotubes, a process triggered by the FNIII7-10 fragment. This biointerface based on living bacteria can be further modified to express any desired biochemical signal, establishing a new paradigm in biomaterial surface functionalisation for biomedical applications.

  20. Improved methods for binding acma-type protein anchor fusions yo cell-wall material of micro-organisms

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Ramasamy, R.; Steen, Anton; Kok, Jan; Buist, Girbe; Kuipers, Oscar

    2002-01-01

    The invention provides a method for improving binding of a proteinaceous substance to cell-wall material of a Gram-positive bacterium, said substance comprising an AcmA cell wall binding domain or homolog or functional derivative thereof, said method comprising treating said cell-wall material with

  1. Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov.

    Science.gov (United States)

    Visnuvinayagam, Sivam; Thangavel, K; Lalitha, N; Malmarugan, S; Sukumar, Kuppannan

    2015-01-01

    Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC) system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18(th)(final) passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

  2. Pathogen reduction by ultraviolet C light effectively inactivates human white blood cells in platelet products.

    Science.gov (United States)

    Pohler, Petra; Müller, Meike; Winkler, Carla; Schaudien, Dirk; Sewald, Katherina; Müller, Thomas H; Seltsam, Axel

    2015-02-01

    Residual white blood cells (WBCs) in cellular blood components induce a variety of adverse immune events, including nonhemolytic febrile transfusion reactions, alloimmunization to HLA antigens, and transfusion-associated graft-versus-host disease (TA-GVHD). Pathogen reduction (PR) methods such as the ultraviolet C (UVC) light-based THERAFLEX UV-Platelets system were developed to reduce the risk of transfusion-transmitted infection. As UVC light targets nucleic acids, it interferes with the replication of both pathogens and WBCs. This preclinical study aimed to evaluate the ability of UVC light to inactivate contaminating WBCs in platelet concentrates (PCs). The in vitro and in vivo function of WBCs from UVC-treated PCs was compared to that of WBCs from gamma-irradiated and untreated PCs by measuring cell viability, proliferation, cytokine secretion, antigen presentation in vitro, and xenogeneic GVHD responses in a humanized mouse model. UVC light was at least as effective as gamma irradiation in preventing GVHD in the mouse model. It was more effective in suppressing T-cell proliferation (>5-log reduction in the limiting dilution assay), cytokine secretion, and antigen presentation than gamma irradiation. The THERAFLEX UV-Platelets (MacoPharma) PR system can substitute gamma irradiation for TA-GVHD prophylaxis in platelet (PLT) transfusion. Moreover, UVC treatment achieves suppression of antigen presentation and inhibition of cytokine accumulation during storage of PCs, which has potential benefits for transfusion recipients. © 2014 AABB.

  3. Survival of microorganisms representing the three Domains of life inside the International Space Station

    Science.gov (United States)

    Francesco, Canganella; Giovanna, Bianconi

    2007-09-01

    The present work was mainly focused to study the response of representative non pathogenic microorganisms to the environment inside the space vehicle at different mission stages (10, 56, and 226 days) within the frame of the Italian ENEIDE mission, from Feb to Oct 2005. Microorganisms were chosen according to their phylogenetic position and cell structures; they were representatives of the three taxonomic domains and belonged to different ecosystems (food, soil, intestinal tract, plants, deep-sea). They were the followings: Thermococcus guaymasensis (Domain Archaea); Saccharomyces cerevisiae (Domain Eucarya); Escherichia coli, Bacillus subtilis, Lactobacillus acidophilus, Enterococcus faecium, Pseudomonas fluorescens, and Rhizobium tropici (Domain Bacteria). As main environmental parameters we were interested in: a) space radiations; b) microgravity; c) temperature. The response of microorganisms was investigated in terms of survival rates, cell structure modifications, and genomic damages. The survival of cells was affected by both radiation doses and intrinsec cell features. As expected, only samples kept on the ISS for 226 days showed significant levels of mortality. Asfar as regard the effect on cell structures, these samples showed also remarkable morphological changes, particularly for Escherichia coli, Enterococcus faecium, and Saccharomyces cerevisiae. The data collected allowed to get new insights into the biological traits of microorganisms exposed to space environment during the flight on a spacecraft. Moreover, the result obtained may be important for the improvement of human conditions aboard space vehicles (nutraceuticals for astronauts and disinfections of ISS modules) and also for the potential development of closed systems devoted to vegetable productions and organic recycling.

  4. Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.

    2008-01-01

    The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

  5. Microorganisms' mediated reduction of β-ketoesters

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Whole cells usually express a multitude of enzymatic activities; therefore an ... Each microorganism was cultivated for the biomass development on specific medium ..... Ketoester reductase for conversion of keto acid esters to ...

  6. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage.

    Science.gov (United States)

    Wang, Kai; Jin, Xiao-Lu; Shen, Xiao-Ge; Sun, Li-Ping; Wu, Li-Ming; Wei, Jiang-Qin; Marcucci, Maria Cristina; Hu, Fu-Liang; Liu, Jian-Xin

    2016-01-01

    Chinese propolis (CP), an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T), we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS), heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA) did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

  7. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-01-01

    Full Text Available Chinese propolis (CP, an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T, we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS, heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

  8. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to fructo-oligosaccharides (FOS) and decreasing potentially pathogenic gastro-intestinal microorganisms (ID 781), pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to fructo-oligosaccharides and decreasing potentially pathogenic gastro-intestinal microorganisms. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims and references that EFSA has received from......Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a list of health claims pursuant to Article 13 of Regulation (EC) No 1924/2006. This opinion addresses the scientific substantiation of health...... conclusions could be drawn for the scientific substantiation of the claim were provided. On the basis of the data presented, the Panel concludes that a cause and effect relationship has not been established between the consumption of fructo-oligosaccharides and decreasing potentially pathogenic gastro...

  9. The plant cell nucleus: a true arena for the fight between plants and pathogens.

    Science.gov (United States)

    Deslandes, Laurent; Rivas, Susana

    2011-01-01

    Communication between the cytoplasm and the nucleus is a fundamental feature shared by both plant and animal cells. Cellular factors involved in the transport of macromolecules through the nuclear envelope, including nucleoporins, importins and Ran-GTP related components, are conserved among a variety of eukaryotic systems. Interestingly, mutations in these nuclear components compromise resistance signalling, illustrating the importance of nucleocytoplasmic trafficking in plant innate immunity. Indeed, spatial restriction of defence regulators by the nuclear envelope and stimulus-induced nuclear translocation constitute an important level of defence-associated gene regulation in plants. A significant number of effectors from different microbial pathogens are targeted to the plant cell nucleus. In addition, key host factors, including resistance proteins, immunity components, transcription factors and transcriptional regulators shuttle between the cytoplasm and the nucleus, and their level of nuclear accumulation determines the output of the defence response, further confirming the crucial role played by the nucleus during the interaction between plants and pathogens. Here, we discuss recent findings that situate the nucleus at the frontline of the mutual recognition between plants and invading microbes.

  10. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Directory of Open Access Journals (Sweden)

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  11. Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

    Directory of Open Access Journals (Sweden)

    Marinela Contreras

    2017-07-01

    Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

  12. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other

  13. Use of an Optical Trap for Study of Host-Pathogen Interactions for Dynamic Live Cell Imaging

    OpenAIRE

    Tam, Jenny M.; Castro, Carlos E.; Heath, Robert J. W.; Mansour, Michael K.; Cardenas, Michael L.; Xavier, Ramnik J.; Lang, Matthew J.; Vyas, Jatin M.

    2011-01-01

    Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system1, 2; however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis3 have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous int...

  14. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  15. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  16. Anaerobic Co-Culture of Mesenchymal Stem Cells and Anaerobic Pathogens - A New In Vitro Model System

    OpenAIRE

    Kriebel, Katja; Biedermann, Anne; Kreikemeyer, Bernd; Lang, Hermann

    2013-01-01

    BACKGROUND: Human mesenchymal stem cells (hMSCs) are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIP...

  17. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Directory of Open Access Journals (Sweden)

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  18. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  19. Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

    Science.gov (United States)

    Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

    2016-02-01

    Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7-10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

  20. Resistance to cereal rusts at the plant cell wall - what can we learn from other host-pathogen systems?

    NARCIS (Netherlands)

    Collins, N.C.; Niks, R.E.; Schulze-Lefert, P.

    2007-01-01

    The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of

  1. Modelling and application of the inactivation of microorganism

    International Nuclear Information System (INIS)

    Oğuzhan, P.; Yangılar, F.

    2013-01-01

    Prevention of consuming contaminated food with toxic microorganisms causing infections and consideration of food protection and new microbial inactivation methods are obligatory situations. Food microbiology is mainly related with unwanted microorganisms spoiling foods during processing and transporting stages and causing diseases. Determination of pathogen microorganisms is important for human health to define and prevent dangers and elongate shelf life. Inactivation of pathogen microorganisms can provide food security and reduce nutrient losses. Microbial inactivation which is using methods of food protection such as food safety and fresh. With this aim, various methods are used such as classical thermal processes (pasteurisation, sterilisation), pressured electrical field (PEF), ionised radiation, high pressure, ultrasonic waves and plasma sterilisation. Microbial inactivation modelling is a secure and effective method in food production. A new microbiological application can give useful results for risk assessment in food, inactivation of microorganisms and improvement of shelf life. Application and control methods should be developed and supported by scientific research and industrial applications

  2. Dissecting HIV Virulence: Heritability of Setpoint Viral Load, CD4+ T-Cell Decline, and Per-Parasite Pathogenicity.

    Science.gov (United States)

    Bertels, Frederic; Marzel, Alex; Leventhal, Gabriel; Mitov, Venelin; Fellay, Jacques; Günthard, Huldrych F; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Battegay, Manuel; Rauch, Andri; Cavassini, Matthias; Calmy, Alexandra; Bernasconi, Enos; Schmid, Patrick; Scherrer, Alexandra U; Müller, Viktor; Bonhoeffer, Sebastian; Kouyos, Roger; Regoes, Roland R

    2018-01-01

    Pathogen strains may differ in virulence because they attain different loads in their hosts, or because they induce different disease-causing mechanisms independent of their load. In evolutionary ecology, the latter is referred to as "per-parasite pathogenicity". Using viral load and CD4+ T-cell measures from 2014 HIV-1 subtype B-infected individuals enrolled in the Swiss HIV Cohort Study, we investigated if virulence-measured as the rate of decline of CD4+ T cells-and per-parasite pathogenicity are heritable from donor to recipient. We estimated heritability by donor-recipient regressions applied to 196 previously identified transmission pairs, and by phylogenetic mixed models applied to a phylogenetic tree inferred from HIV pol sequences. Regressing the CD4+ T-cell declines and per-parasite pathogenicities of the transmission pairs did not yield heritability estimates significantly different from zero. With the phylogenetic mixed model, however, our best estimate for the heritability of the CD4+ T-cell decline is 17% (5-30%), and that of the per-parasite pathogenicity is 17% (4-29%). Further, we confirm that the set-point viral load is heritable, and estimate a heritability of 29% (12-46%). Interestingly, the pattern of evolution of all these traits differs significantly from neutrality, and is most consistent with stabilizing selection for the set-point viral load, and with directional selection for the CD4+ T-cell decline and the per-parasite pathogenicity. Our analysis shows that the viral genotype affects virulence mainly by modulating the per-parasite pathogenicity, while the indirect effect via the set-point viral load is minor. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Utilization of the human cell line HL-60 for chemiluminescence based detection of microorganisms and related substances

    DEFF Research Database (Denmark)

    Timm, Michael; Hansen, Erik W; Moesby, Lise

    2006-01-01

    species (ROS) when challenged with pyrogenic substances. In a luminol enhanced chemilumimetric assay the responsiveness of differentiated HL-60 cells is tested towards Salmonella typhimurium, Bacillus subtilis, Saccharomyces cerevisiae, Candida albicans, lipopolysaccharide (LPS) and lipoteichoic acid (LTA......). The results show a poor sensitivity to S. typhimurium but displays good sensitivity towards B. subtilis, LTA and LPS. Furthermore, the sensitivity towards the yeasts C. albicans and S. cerevisiae is considerably better than obtained in other in vitro cell systems. Overall these results indicate that the HL-60...... cell assay possibly could be evolved to a supplementary assay for the known pyrogenic detection assays. Furthermore, the utilization of the assay for pyrogenic examination of recombinant drugs derived from yeast expression systems would be relevant to examine....

  4. Biosurfactants from marine microorganisms

    Directory of Open Access Journals (Sweden)

    Suppasil Maneerat

    2005-11-01

    Full Text Available Biosurfactants are the surface-active molecules synthesized by microorganisms. With the advantage of environmental compatibility, the demand for biosurfactants has been steadily increasing and may eventually replace their chemically synthesized counterparts. Marine biosurfactants produced by some marine microorganisms have been paid more attention, particularly for the bioremediation of the sea polluted by crude oil. This review describes screening of biosurfactant-producing microorganisms, the determination of biosurfactant activity as well as the recovery of marine surfactant. The uses of marine biosurfactants for bioremediation are also discussed.

  5. Two is better than one: advances in pathogen-boosted immunotherapy and adoptive T-cell therapy.

    Science.gov (United States)

    Xin, Gang; Schauder, David M; Zander, Ryan; Cui, Weiguo

    2017-09-01

    The recent tremendous successes in clinical trials take cancer immunotherapy into a new era and have attracted major attention from both academia and industry. Among the variety of immunotherapy strategies developed to boost patients' own immune systems to fight against malignant cells, the pathogen-based and adoptive cell transfer therapies have shown the most promise for treating multiple types of cancer. Pathogen-based therapies could either break the immune tolerance to enhance the effectiveness of cancer vaccines or directly infect and kill cancer cells. Adoptive cell transfer can induce a strong durable antitumor response, with recent advances including engineering dual specificity into T cells to recognize multiple antigens and improving the metabolic fitness of transferred cells. In this review, we focus on the recent prospects in these two areas and summarize some ongoing studies that represent potential advancements for anticancer immunotherapy, including testing combinations of these two strategies.

  6. Microorganisms involved in MIC

    Energy Technology Data Exchange (ETDEWEB)

    Sorensen, K. [Danish Technological Institute (Denmark)

    2011-07-01

    Microbiologically influenced corrosion (MIC) is a widespread problem that is difficult to detect and assess because of its complex mechanism. This paper presents the involvement of microorganisms in MIC. Some of the mechanisms that cause MIC include hydrogen consumption, production of acids, anode-cathode formation and electron shuttling. A classic bio-corrosive microorganism in the oil and gas industry is sulphate-reducing prokaryotes (SRP). Methanogens also increase corrosion rates in metals. Some of the phylogenetic orders detected while studying SRP and methanogens are archaeoglobales, clostridiales, methanosarcinales and methanothermococcus. There were some implications, such as growth of SRP not being correlated with growth of methanogens; methanogens were included in MIC risk assessment. A few examples are used to display how microorganisms are involved in topside corrosion and microbial community in producing wells. From the study, it can be concluded that, MIC risk assessment includes system data and empirical knowledge of the distribution and number of microorganisms in the system.

  7. Enhanced interleukin-8 production in THP-1 human monocytic cells by lipopolysaccharide from oral microorganisms and granulocyte-macrophage colony-stimulating factor.

    Science.gov (United States)

    Baqui, A A; Meiller, T F; Falkler, W A

    1999-10-01

    Granulocyte-macrophage colony-stimulating factor (GM-CSF) has been used to assist in bone marrow recovery during cancer chemotherapy. Interleukin-8 (IL-8) plays an important role in macrophage mediated inflammatory processes including exacerbation of periodontal diseases, one of the most common complications in GM-CSF receiving cancer patients. The effect of GM-CSF supplementation on IL-8 production was investigated in a human monocyte cell line THP-1, stimulated with lipopolysaccharide extracted from two oral microorganisms, Porphyromonas gingivalis and Fusobacterium nucleatum. Resting THP-1 cells were treated with lipopolysaccharide (1 microgram/ml) of P. gingivalis or F. nucleatum and/or GM-CSF (50 IU/ml) for varying time periods. The production of IL-8 in THP-1 cells was measured by a solid-phase enzyme-linked immunosorbent assay (ELISA). A very low level of the cytokine IL-8 was produced constitutive in THP-1 cells. Starting from 8 h of treatment and afterwards GM-CSF alone significantly increased IL-8 production in THP-1 cells. Lipopolysaccharide (1 microgram/ml) extracts from either F. nucleatum or P. gingivalis amplified IL-8 production 500-800 times in comparison to resting THP-1 cells. When lipopolysaccharide of F. nucleatum or P. gingivalis was supplemented with 50 IU/ml of GM-CSF, there was a statistically significant enhanced production of IL-8 by THP-1 cells after 1 day to 7 days of treatment as compared with lipopolysaccharide treatment alone. GM-CSF (50 IU/ml) also significantly increased IL-8 production from 2-7 days of treatment of THP-1 cells when supplemented with a positive control, phorbol-12-myristate-13 acetate (PMA), as compared to PMA treatment alone. These investigations using the in vitro THP-1 human monocyte cell model indicate that there may be an increase in the response on a cellular level to oral endotoxin following GM-CSF therapy as evidenced by enhanced production of the tissue-reactive inflammatory cytokine, IL-8.

  8. Pathogen-induced ERF68 regulates hypersensitive cell death in tomato.

    Science.gov (United States)

    Liu, An-Chi; Cheng, Chiu-Ping

    2017-10-01

    Ethylene response factors (ERFs) are a large plant-specific transcription factor family and play diverse important roles in various plant functions. However, most tomato ERFs have not been characterized. In this study, we showed that the expression of an uncharacterized member of the tomato ERF-IX subgroup, ERF68, was significantly induced by treatments with different bacterial pathogens, ethylene (ET) and salicylic acid (SA), but only slightly induced by bacterial mutants defective in the type III secretion system (T3SS) or non-host pathogens. The ERF68-green fluorescent protein (ERF68-GFP) fusion protein was localized in the nucleus. Transactivation and electrophoretic mobility shift assays (EMSAs) further showed that ERF68 was a functional transcriptional activator and was bound to the GCC-box. Moreover, transient overexpression of ERF68 led to spontaneous lesions in tomato and tobacco leaves and enhanced the expression of genes involved in ET, SA, jasmonic acid (JA) and hypersensitive response (HR) pathways, whereas silencing of ERF68 increased tomato susceptibility to two incompatible Xanthomonas spp. These results reveal the involvement of ERF68 in the effector-triggered immunity (ETI) pathway. To identify ERF68 target genes, chromatin immunoprecipitation combined with high-throughput sequencing (ChIP-seq) was performed. Amongst the confirmed target genes, a few genes involved in cell death or disease defence were differentially regulated by ERF68. Our study demonstrates the function of ERF68 in the positive regulation of hypersensitive cell death and disease defence by modulation of multiple signalling pathways, and provides important new information on the complex regulatory function of ERFs. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  9. Cyanide utilization and degradation by microorganisms.

    Science.gov (United States)

    Knowles, C J

    1988-01-01

    Various microorganisms can produce (cyanogenesis) or degrade cyanide. They degrade cyanide either to detoxify it, or to use it as a source of nitrogen for growth. Significant amounts of cyanide are formed as a secondary metabolite by a wide range of fungi and a few bacteria by decarboxylation of glycine. When cyanide has been formed by the snow mould fungus it is degraded by conversion to carbon dioxide and ammonia via an unknown pathway. In contrast, cyanogenic bacteria either do not further catabolize cyanide or they convert it into beta-cyanoalanine by addition to cysteine or O-acetylserine. Several non-cyanogenic fungi that are pathogens of cyanogenic plants are known to degrade cyanide by hydration to formamide by the enzyme cyanide hydratase. Such fungi can be immobilized and used in packed-cell columns to continuously detoxify cyanide. ICI Biological Products Business market a preparation of spray-dried fungal mycelia, 'CYCLEAR', to detoxify industrial wastes. Novo Industri have also introduced a cyanidase preparation to convert cyanide directly into formate and ammonia. Bacteria have been isolated that use cyanide as a source of nitrogen for growth. Because cyanide, as KCN or NaCN, is toxic for growth, the bacteria (Pseudomonas fluorescens) have to be grown in fed-batch culture with cyanide as the limiting nutrient. Cyanide is converted to carbon dioxide and ammonia (which is then assimilated) by an NADH-linked cyanide oxygenase system.

  10. The response of CD1d-restricted invariant NKT cells to microbial pathogens and their products

    Directory of Open Access Journals (Sweden)

    Luc eVan Kaer

    2015-05-01

    Full Text Available Invariant natural killer T (iNKT cells become activated during a wide variety of infections. This includes organisms lacking cognate CD1d-binding glycolipid antigens recognized by the semi-invariant T cell receptor of iNKT cells. Additional studies have shown that iNKT cells also become activated in vivo in response to microbial products such as bacterial lipopolysaccharide, a potent inducer of cytokine production in antigen-presenting cells (APCs. Other studies have shown that iNKT cells are highly responsive to stimulation by cytokines such as interleukin-12. These findings have led to the concept that microbial pathogens can activate iNKT cells either directly via glycolipids, or indirectly by inducing cytokine production in APCs. iNKT cells activated in this manner produce multiple cytokines that can influence the outcome of infection, usually in favor of the host, although potent iNKT cell activation may contribute to an uncontrolled cytokine storm and sepsis. One aspect of the response of iNKT cells to microbial pathogens is that it is short-lived and followed by an extended time period of unresponsiveness to reactivation. This refractory period may represent a means to avoid chronic activation and cytokine production by iNKT cells, thus protecting the host against some of the negative effects of iNKT cell activation, but potentially putting the host at risk for secondary infections. These effects of microbial pathogens and their products on iNKT cells are not only important for understanding the role of these cells in immune responses against infections but also for the development of iNKT cell-based therapies.

  11. Pathogen-free, plasma-poor platelet lysate and expansion of human mesenchymal stem cells.

    Science.gov (United States)

    Iudicone, Paola; Fioravanti, Daniela; Bonanno, Giuseppina; Miceli, Michelina; Lavorino, Claudio; Totta, Pierangela; Frati, Luigi; Nuti, Marianna; Pierelli, Luca

    2014-01-27

    Supplements to support clinical-grade cultures of mesenchymal stem cells (MSC) are required to promote growth and expansion of these cells. Platelet lysate (PL) is a human blood component which may replace animal serum in MSC cultures being rich in various growth factors. Here, we describe a plasma poor pathogen-free platelet lysate obtained by pooling 12 platelet (PLT) units, to produce a standardized and safe supplement for clinical-grade expansion of MSC. PL lots were obtained by combining 2 6-unit PLT pools in additive solution (AS) following a transfusional-based procedure including pathogen inactivation (PI) by Intercept technology and 3 cycles of freezing/thawing, followed by membrane removal. Three PI-PL and 3 control PL lots were produced to compare their ability to sustain bone marrow derived MSC selection and expansion. Moreover, two further PL, subjected to PI or not, were also produced starting from the same initial PLT pools to evaluate the impact of PI on growth factor concentration and capacity to sustain cell growth. Additional PI-PL lots were used for comparison with fetal bovine serum (FBS) on MSC expansion. Immunoregulatory properties of PI-PL-generated MSC were documented in vitro by mixed lymphocyte culture (MLC) and peripheral blood mononuclear cells (PBMC) mitogen induced proliferation. PI-PL and PL control lots had similar concentrations of 4 well-described growth factors endowed with MSC stimulating ability. Initial growth and MSC expansion by PI-PL and PL controls were comparable either using different MSC populations or in head to head experiments. Moreover, PI-PL and PL control sustained similar MSC growth of frozen/thawed MSC. Multilineage differentiation of PI-derived and PI-PL-derived MSC were maintained in any MSC cultures as well as their immunoregulatory properties. Finally, no direct impact of PI on growth factor concentration and MSC growth support was observed, whereas the capacity of FBS to sustain MSC expansion in basic

  12. Bioelectricity generation from coconut husk retting wastewater in fed batch operating microbial fuel cell by phenol degrading microorganism

    International Nuclear Information System (INIS)

    Jayashree, C.; Arulazhagan, P.; Adish Kumar, S.; Kaliappan, S.; Yeom, Ick Tae; Rajesh Banu, J.

    2014-01-01

    Dual chamber microbial fuel cell (MFC) operated at fed batch mode for the treatment of retting wastewater has potently achieved both current generation and phenol removal. Hydraulic retention time (HRT) of the reactor was varied from 40 days to 10 days. COD (chemical oxygen demand) removal was 91% at 40 days HRT, with an initial COD concentration of 530 ± 50 g m −3 . Retting wastewater with an initial phenol concentration of 320 ± 60 g m −3 procured a highest phenol removal of 93% at 40 days HRT of the microbial fuel cell. Maximum power density of 362 mW m −2 was achieved using retting wastewater at HRT of 20 days with an internal resistance of 150 Ω in a dual chambered MFC. The bacterial strains in anode region, reported to be responsible for potential phenol removal, were identified as Ochrobactrum sp. RA1 (KJ408266), Ochrobactrum sp. RA2 (KJ408267) and Pesudomonas aeruginosa RA3 (KJ408268) using phylogenetic analysis. The study reveals that, dual chambered MFC effectively removed the phenol from retting wastewater along with power generation. - Highlights: • Maximum power density of 362 mW m −2 (150 Ω) was achieved at HRT of 20 days. • 91% COD removal and 93% phenol removal was observed at HRT of 40 days. • 25% coulombic efficiency was achieved in treatment of retting wastewater with MFC. • Phylogenetic analysis detect phenol degrading Ochrobactrum sp.RA1 in anode biofilm. • In addition, Ochrobactrum sp.RA2 and Pseudomonas aeruginosa RA3 were also isolated

  13. Dendritic-cell control of pathogen-driven T-cell polarization

    NARCIS (Netherlands)

    Kapsenberg, Martien L.

    2003-01-01

    Dendritic cells (DCs) are central in the orchestration of the various forms of immunity and tolerance. Their immunoregulatory role mainly relies on the ligation of specific receptors that initiate and modulate DC maturation resulting in the development of functionally different effector DC subsets

  14. Use of an optical trap for study of host-pathogen interactions for dynamic live cell imaging.

    Science.gov (United States)

    Tam, Jenny M; Castro, Carlos E; Heath, Robert J W; Mansour, Michael K; Cardenas, Michael L; Xavier, Ramnik J; Lang, Matthew J; Vyas, Jatin M

    2011-07-28

    Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system(1, 2); however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis(3) have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous intercellular contacts at the appropriate stage of interaction. The stochastic nature of these events renders this process tedious, and it is difficult to observe early or fleeting events in cell-cell contact by this approach. This method requires finding cell pairs that are on the verge of contact, and observing them until they consummate their contact, or do not. To address these limitations, we use optical trapping as a non-invasive, non-destructive, but fast and effective method to position cells in culture. Optical traps, or optical tweezers, are increasingly utilized in biological research to capture and physically manipulate cells and other micron-sized particles in three dimensions(4). Radiation pressure was first observed and applied to optical tweezer systems in 1970(5, 6), and was first used to control biological specimens in 1987(7). Since then, optical tweezers have matured into a technology to probe a variety of biological phenomena(8-13). We describe a method(14) that advances live cell imaging by integrating an optical trap with spinning disk confocal microscopy with temperature and humidity control to provide exquisite spatial and temporal control of pathogenic organisms in a physiological environment to facilitate interactions with host cells, as determined by the operator. Live, pathogenic organisms like Candida albicans and Aspergillus fumigatus, which can cause potentially lethal, invasive infections in immunocompromised individuals(15, 16) (e.g. AIDS

  15. Fossil Microorganisms in Archaean

    Science.gov (United States)

    Astafleva, Marina; Hoover, Richard; Rozanov, Alexei; Vrevskiy, A.

    2006-01-01

    Ancient Archean and Proterozoic rocks are the model objects for investigation of rocks comprising astromaterials. The first of Archean fossil microorganisms from Baltic shield have been reported at the last SPIE Conference in 2005. Since this confeence biomorphic structures have been revealed in Archean rocks of Karelia. It was determined that there are 3 types of such bion structures: 1. structures found in situ, in other words microorganisms even-aged with rock matrix, that is real Archean fossils biomorphic structures, that is to say forms inhabited early formed rocks, and 3. younger than Archean-Protherozoic minerali microorganisms, that is later contamination. We made attempt to differentiate these 3 types of findings and tried to understand of burial of microorganisms. The structures belongs (from our point of view) to the first type, or real Archean, forms were under examination. Practical investigation of ancient microorganisms from Green-Stone-Belt of Northern Karelia turns to be very perspective. It shows that even in such ancient time as Archean ancient diverse world existed. Moreover probably such relatively highly organized cyanobacteria and perhaps eukaryotic formes existed in Archean world.

  16. Perforin-2 is essential for intracellular defense of parenchymal cells and phagocytes against pathogenic bacteria

    Science.gov (United States)

    McCormack, Ryan M; de Armas, Lesley R; Shiratsuchi, Motoaki; Fiorentino, Desiree G; Olsson, Melissa L; Lichtenheld, Mathias G; Morales, Alejo; Lyapichev, Kirill; Gonzalez, Louis E; Strbo, Natasa; Sukumar, Neelima; Stojadinovic, Olivera; Plano, Gregory V; Munson, George P; Tomic-Canic, Marjana; Kirsner, Robert S; Russell, David G; Podack, Eckhard R

    2015-01-01

    Perforin-2 (MPEG1) is a pore-forming, antibacterial protein with broad-spectrum activity. Perforin-2 is expressed constitutively in phagocytes and inducibly in parenchymal, tissue-forming cells. In vitro, Perforin-2 prevents the intracellular replication and proliferation of bacterial pathogens in these cells. Perforin-2 knockout mice are unable to control the systemic dissemination of methicillin-resistant Staphylococcus aureus (MRSA) or Salmonella typhimurium and perish shortly after epicutaneous or orogastric infection respectively. In contrast, Perforin-2-sufficient littermates clear the infection. Perforin-2 is a transmembrane protein of cytosolic vesicles -derived from multiple organelles- that translocate to and fuse with bacterium containing vesicles. Subsequently, Perforin-2 polymerizes and forms large clusters of 100 Å pores in the bacterial surface with Perforin-2 cleavage products present in bacteria. Perforin-2 is also required for the bactericidal activity of reactive oxygen and nitrogen species and hydrolytic enzymes. Perforin-2 constitutes a novel and apparently essential bactericidal effector molecule of the innate immune system. DOI: http://dx.doi.org/10.7554/eLife.06508.001 PMID:26402460

  17. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa.

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M

    2016-08-05

    Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa.

  18. Extracellular electron transfer mechanisms between microorganisms and minerals

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Liang; Dong, Hailiang; Reguera, Gemma; Beyenal, Haluk; Lu, Anhuai; Liu, Juan; Yu, Han-Qing; Fredrickson, James K.

    2016-08-30

    Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels and nanomaterials.

  19. Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

    Directory of Open Access Journals (Sweden)

    Katja Kriebel

    Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

  20. AMPK in Pathogens

    OpenAIRE

    Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

    2016-01-01

    During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

  1. Inactivation of microorganisms for high pressures in the wine industry

    International Nuclear Information System (INIS)

    Montana B, Jaime Nelson; Ortegon T, Sandra Patricia

    2000-01-01

    In order to evaluate experimentally the capacity of N 2 and CO 2 under pressure to inactivate wild yeasts, which remain in the Puntalarga vineyard grape, musts were exposed to hyperbaric treatment with these gases. At the end of the pascalization (after 2 hours), CO 2 at 15 degrades Celsius under pressures from 1 to 5 MPa, reached high inactivation percentages of yeast cells (> 90%). Contrary to CO 2 treatment the use of N 2 at 15 degrades Celsius at 4 and 10 MPa failed to exert microbicide effect in a same treatment time. While CO 2 gas with high solubility in water has the potential to reduce microbial loads in musts, N 2 gas with low solubility in water have not effect on the survival of the pathogenic microorganisms in these juices

  2. Bioplastics from microorganisms.

    Science.gov (United States)

    Luengo, José M; García, Belén; Sandoval, Angel; Naharro, Germán; Olivera, Elías R

    2003-06-01

    The term 'biomaterials' includes chemically unrelated products that are synthesised by microorganisms (or part of them) under different environmental conditions. One important family of biomaterials is bioplastics. These are polyesters that are widely distributed in nature and accumulate intracellularly in microorganisms in the form of storage granules, with physico-chemical properties resembling petrochemical plastics. These polymers are usually built from hydroxy-acyl-CoA derivatives via different metabolic pathways. Depending on their microbial origin, bioplastics differ in their monomer composition, macromolecular structure and physical properties. Most of them are biodegradable and biocompatible, which makes them extremely interesting from the biotechnological point of view.

  3. [Sorption of microorganisms by fiber materials].

    Science.gov (United States)

    Nikovskaia, G N; Gordienko, A S; Globa, L I

    1986-01-01

    Candida guilliermondii and Escherichia coli cells were adsorbed on glass and basalt fibres with a similar specific surface, but with a different charge. The quantity of adsorbed microorganisms did not depend on the type and charge of a fibre surface. However, cells were adsorbed faster and more firmly on positively charged and uncharged fibres than on negatively charged fibres.

  4. Nanoscale organization of the pathogen receptor DC-SIGN mapped by single-molecule high-resolution fluorescence microscopy.

    NARCIS (Netherlands)

    Bakker, B.I. de; Lange, F. de; Cambi, A.; Korterik, J.P.; Dijk, E.M. van; Hulst, N.F. van; Figdor, C.G.; Garcia-Parajo, M.F.

    2007-01-01

    DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor

  5. Nanoscale organization of the pathogen receptor DC-SIGN mapped by single-molecule high-resolution flourescence microscopy

    NARCIS (Netherlands)

    de Bakker, B.I.; de Lange, Frank; Cambi, Alessandra; Cambi, A.; Korterik, Jeroen P.; van Dijk, E.M.H.P.; van Hulst, N.F.; Figdor, Carl; Garcia Parajo, M.F.

    2007-01-01

    DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor

  6. Motion of magnetotactic microorganisms

    International Nuclear Information System (INIS)

    Esquivel, D.M.S.; Barros, H.G. de P.L. de.

    1985-01-01

    Magnetic moments for different magnetotactic microorganisms are obtained by electron microscopy analyses and studies of motion by optical microscopy. The results are analysed in terms of a model due to C.Bean. The considerations presented suggest that magnetotaxy is an efficient mechanism for orientation only if the time for reorientation is smaller than the cycles of environmental perturbations. (Author) [pt

  7. C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

    Directory of Open Access Journals (Sweden)

    Ning Ma

    Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

  8. Microbial genome-enabled insights into plant-microorganism interactions.

    Science.gov (United States)

    Guttman, David S; McHardy, Alice C; Schulze-Lefert, Paul

    2014-12-01

    Advances in genome-based studies on plant-associated microorganisms have transformed our understanding of many plant pathogens and are beginning to greatly widen our knowledge of plant interactions with mutualistic and commensal microorganisms. Pathogenomics has revealed how pathogenic microorganisms adapt to particular hosts, subvert innate immune responses and change host range, as well as how new pathogen species emerge. Similarly, culture-independent community profiling methods, coupled with metagenomic and metatranscriptomic studies, have provided the first insights into the emerging field of research on plant-associated microbial communities. Together, these approaches have the potential to bridge the gap between plant microbial ecology and plant pathology, which have traditionally been two distinct research fields.

  9. Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

    Science.gov (United States)

    Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

    2016-04-01

    Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Science.gov (United States)

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  11. Gut Microorganisms Found Necessary for Successful Cancer Therapy | Poster

    Science.gov (United States)

    By Nancy Parrish, Staff Writer Humans play host to trillions of microorganisms that help our bodies perform basic functions, like digestion, growth, and fighting disease. In fact, bacterial cells outnumber the human cells in our bodies by 10 to 1.1 The tens of trillions of microorganisms thriving in our intestines are known as gut microbiota, and those that are not harmful to

  12. [DIFFERENTIAL SENSITIVITY OF MICROORGANISMS TO POLYHEXAMETHYLENEGUANIDINE].

    Science.gov (United States)

    Lysytsya, A V; Mandygra, Y M; Bojko, O P; Romanishyna, O O; Mandygra, M S

    2015-01-01

    Factors identified that affect the sensitivity of microorganisms to polyhexamethyleneguanidine (PHMG). Salts of PHMG chloride, valerate, maleate, succinate was to use. Test strains of Esherichia coli, Staphylococcus aureus, Bacillus cereus, Leptospira interrogans, Paenibacillus larvae, Mycobacterium bovis, M. avium, M. fortuitum, Aspergillus niger and some strains of viruses are taken as objects of research. We have determined that the cytoplasm membrane phospholipids is main "target" for the polycation molecules of PHMG. A differential sensitivity of the microorganisms to this drug is primarily determined by relative amount of lipids in membrane and their accessibility. Such trends exist: increase the relative contents of anionic lipids and more negative surface electric potential of membrane, and reduction of the sizes fat acid remainder of lipids bring to increase of microorganism sensitivity. Types of anion salt PHMG just have a certain value. Biocide activity of PHMG chloride is more, than its salts with organic acid. Feasibility of combining PHMG with other biocides in the multicomponent disinfectants studied and analyzed. This combination does not lead to a significant increase in the sensitivity of microorganisms tested in most cases. Most species of pathogenic bacteria can be quickly neutralized by aqueous solutions of PHMG in less than 1% concentrations.

  13. Inactivation of Microorganisms

    Science.gov (United States)

    Alzamora, Stella Maris; Guerrero, Sandra N.; Schenk, Marcela; Raffellini, Silvia; López-Malo, Aurelio

    Minimal processing techniques for food preservation allow better retention of product flavor, texture, color, and nutrient content than comparable conventional treatments. A wide range of novel alternative physical factors have been intensely investigated in the last two decades. These physical factors can cause inactivation of microorganisms at ambient or sublethal temperatures (e.g., high hydrostatic pressure, pulsed electric fields, ultrasound, pulsed light, and ultraviolet light). These technologies have been reported to reduce microorganism population in foods while avoiding the deleterious effects of severe heating on quality. Among technologies, high-energy ultrasound (i.e., intensities higher than 1 W/cm2, frequencies between 18 and 100 kHz) has attracted considerable interest for food preservation applications (Mason et al., 1996; Povey and Mason, 1998).

  14. Metal-microorganism interactions

    International Nuclear Information System (INIS)

    Andres, Y.; Thouand, G.; Redercher, S.; Boualam, M.; Texier, A.Cl.; Hoeffer, R.

    1997-01-01

    The physico-chemical procedures of treating the metalliferous effluents are not always adapted to de polluting the slightly concentrated industrial wastes. An alternative idea was advanced, implying the ability of some microorganisms to fix in considerable amounts the metal ions present in aqueous solutions, possibly in a selective way. This approach has been investigated thoroughly during the last 30 years, particularly from a mechanistic point of view. The advantage of the microorganisms lies mainly in the large diversity of bacteria and in their chemical state dependent interaction with metals, as well as, in the possibilities of developing their selective and quantitative separation properties. A biomass from Mycobacterium smegmatis, an acidic alcoholic resistant bacteria, has been used to prepare a bio-sorption support allowing the preferential sorption of thorium as compared to uranium and lanthanum. These studies have been extended to biological polymers such as chitosan and to studies related to bioaccumulation mechanisms and/or to the microbial resistances towards metals

  15. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand

    Directory of Open Access Journals (Sweden)

    Supawadee Piratae

    2017-04-01

    Full Text Available Objective: To evaluate the prevalence of blood parasite infection in stray dogs by PCR technique and the association between levels of packed cell volume (PCV and blood parasitic infection in stray dogs. Methods: A total of 65 blood samples were collected from stray dogs in animal quarantine station from Mahasarakham, Thailand to evaluate the levels of PCV before molecular screening for tick-borne pathogens infection. Results: Stray dogs were positive with one or more pathogens in 44 (67.69% out of 65 blood samples. Ehrlichia canis [43.1%, 95% confidence interval (CI: 38.1–48.1] was the most common blood pathogen found infecting in stray dogs in Mahasarakham Province, followed by Anaplasma platys (29.2%, 95% CI: 24.2–34.2, Hepatozoon canis (12.3%, 95% CI: 7.3–17.3 and Babesia canis vogeli (6.2%, 95% CI: 1.2–11.2, respectively. Moreover, co-infections with two pathogens were identified in 11 (16.9% of dogs examined and two (2.9% dogs were coinfections with three pathogens. Statistically significant relationship between the PCV levels and Ehrlichia canis infection was found (P < 0.05. Conclusions: This study indicated that blood pathogens are spreading in stray dogs and they are potentially high risk of agent transmission to human via exposure with tick vectors. It was also the first report of Anaplasma platys infection in dogs in north-eastern part of Thailand.

  16. Riboflavin-ultraviolet light pathogen reduction treatment does not impact the immunogenicity of murine red blood cells.

    Science.gov (United States)

    Tormey, Christopher A; Santhanakrishnan, Manjula; Smith, Nicole H; Liu, Jingchun; Marschner, Susanne; Goodrich, Raymond P; Hendrickson, Jeanne E

    2016-04-01

    Ultraviolet (UV) illumination/pathogen reduction effectively inactivates white blood cells (WBCs) in whole blood. Given that cotransfused WBCs may impact recipient immune responses, we hypothesized that pathogen reduction of whole blood may alter responses to RBC antigens. Transgenic mice expressing a model (HOD) antigen, authentic human (hGPA or KEL) antigens, or natural fluorescence (uGFP) on their RBCs were utilized as blood donors. Recipients were transfused with fresh whole blood to which riboflavin had been added or fresh whole blood treated by UV illumination/pathogen reduction treatment after the addition of riboflavin. Posttransfusion RBC recovery, survival, and alloimmunization were measured by flow cytometry. UV illumination/pathogen reduction treatment did not alter RBC antigen expression, and recipients of treated syngeneic RBCs had persistently negative direct antiglobulin tests. Greater than 75% of treated and untreated syngeneic RBCs were recovered 24 hours posttransfusion in all experiments, although alterations in the long-term posttransfusion survival of treated RBCs were observed. Treated and untreated KEL RBCs induced similar recipient alloimmune responses, with all recipients making anti-KEL glycoprotein immunoglobulins (p > 0.05). Alloimmune responses to treated HOD or hGPA RBCs were no different from untreated RBCs (p > 0.05). Pathogen inactivation treatment of fresh whole murine blood with riboflavin and UV illumination does not impact the rate or magnitude of RBC alloimmunization to three distinct RBC antigens. Further, UV illumination/pathogen reduction appears safe from an immunohematologic standpoint, with no immunogenic neoantigens detected on treated murine RBCs. Future studies with fresh and stored human RBCs are warranted to confirm these findings. © 2015 AABB.

  17. Cell wall modifications during conidial maturation of the human pathogenic fungus Pseudallescheria boydii

    NARCIS (Netherlands)

    Ghamrawi, Sarah; Rénier, Gilles; Saulnier, Patrick; Cuenot, Stéphane; Zykwinska, Agata; Dutilh, Bas E; Thornton, Christopher; Faure, Sébastien; Bouchara, Jean-Philippe

    Progress in extending the life expectancy of cystic fibrosis (CF) patients remains jeopardized by the increasing incidence of fungal respiratory infections. Pseudallescheria boydii (P. boydii), an emerging pathogen of humans, is a filamentous fungus frequently isolated from the respiratory

  18. Cell Wall Modifications during Conidial Maturation of the Human Pathogenic Fungus Pseudallescheria boydii

    NARCIS (Netherlands)

    Ghamrawi, S.; Renier, G.; Saulnier, P.; Cuenot, S.; Zykwinska, A.; Dutilh, B.E.; Thornton, C.; Faure, S.; Bouchara, J.P.

    2014-01-01

    Progress in extending the life expectancy of cystic fibrosis (CF) patients remains jeopardized by the increasing incidence of fungal respiratory infections. Pseudallescheria boydii (P. boydii), an emerging pathogen of humans, is a filamentous fungus frequently isolated from the respiratory

  19. Jasmonate ZIM-domain (JAZ protein regulates host and nonhost pathogen-induced cell death in tomato and Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Ishiga

    Full Text Available The nonhost-specific phytotoxin coronatine (COR produced by several pathovars of Pseudomonas syringae functions as a jasmonic acid-isoleucine (JA-Ile mimic and contributes to disease development by suppressing plant defense responses and inducing reactive oxygen species in chloroplast. It has been shown that the F-box protein CORONATINE INSENSITIVE 1 (COI1 is the receptor for COR and JA-Ile. JASMONATE ZIM DOMAIN (JAZ proteins act as negative regulators for JA signaling in Arabidopsis. However, the physiological significance of JAZ proteins in P. syringae disease development and nonhost pathogen-induced hypersensitive response (HR cell death is not completely understood. In this study, we identified JAZ genes from tomato, a host plant for P. syringae pv. tomato DC3000 (Pst DC3000, and examined their expression profiles in response to COR and pathogens. Most JAZ genes were induced by COR treatment or inoculation with COR-producing Pst DC3000, but not by the COR-defective mutant DB29. Tomato SlJAZ2, SlJAZ6 and SlJAZ7 interacted with SlCOI1 in a COR-dependent manner. Using virus-induced gene silencing (VIGS, we demonstrated that SlJAZ2, SlJAZ6 and SlJAZ7 have no effect on COR-induced chlorosis in tomato and Nicotiana benthamiana. However, SlJAZ2-, SlJAZ6- and SlJAZ7-silenced tomato plants showed enhanced disease-associated cell death to Pst DC3000. Furthermore, we found delayed HR cell death in response to the nonhost pathogen Pst T1 or a pathogen-associated molecular pattern (PAMP, INF1, in SlJAZ2- and SlJAZ6-silenced N. benthamiana. These results suggest that tomato JAZ proteins regulate the progression of cell death during host and nonhost interactions.

  20. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    Science.gov (United States)

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  1. Dendritic cells and immuno-modulation in autoimmune arthritis

    NARCIS (Netherlands)

    Spiering, R.|info:eu-repo/dai/nl/313939020

    2013-01-01

    The immune system consists of a broad array of immune cells to protect the body against invasive pathogenic microorganisms. Immune responses should however, be tightly controlled to ensure tolerance to the body’s own cells and proteins in order to limit damage to the host own cells and tissue.

  2. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

    LENUS (Irish Health Repository)

    Sibartie, Shomik

    2009-01-01

    BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

  3. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Barhoom Sima

    2008-02-01

    Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

  4. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  5. Differentiated THP-1 Cells Exposed to Pathogenic and Nonpathogenic Borrelia Species Demonstrate Minimal Differences in Production of Four Inflammatory Cytokines.

    Science.gov (United States)

    Stokes, John V; Moraru, Gail M; McIntosh, Chelsea; Kummari, Evangel; Rausch, Keiko; Varela-Stokes, Andrea S

    2016-11-01

    Tick-borne borreliae include Lyme disease and relapsing fever agents, and they are transmitted primarily by ixodid (hard) and argasid (soft) tick vectors, respectively. Tick-host interactions during feeding are complex, with host immune responses influenced by biological differences in tick feeding and individual differences within and between host species. One of the first encounters for spirochetes entering vertebrate host skin is with local antigen-presenting cells, regardless of whether the tick-associated Borrelia sp. is pathogenic. In this study, we performed a basic comparison of cytokine responses in THP-1-derived macrophages after exposure to selected borreliae, including a nonpathogen. By using THP-1 cells, differentiated to macrophages, we eliminated variations in host response and reduced the system to an in vitro model to evaluate the extent to which the Borrelia spp. influence cytokine production. Differentiated THP-1 cells were exposed to four Borrelia spp., Borrelia hermsii (DAH), Borrelia burgdorferi (B31), B. burgdorferi (NC-2), or Borrelia lonestari (LS-1), or lipopolysaccharides (LPS) (activated) or media (no treatment) controls. Intracellular and secreted interferon (IFN)-γ, interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α were measured using flow cytometric and Luminex-based assays, respectively, at 6, 24, and 48 h postexposure time points. Using a general linear model ANOVA for each cytokine, treatment (all Borrelia spp. and LPS compared to no treatment) had a significant effect on secreted TNF-α only. Time point had a significant effect on intracellular IFN-γ, TNF-α and IL-6. However, we did not see significant differences in selected cytokines among Borrelia spp. Thus, in this model, we were unable to distinguish pathogenic from nonpathogenic borreliae using the limited array of selected cytokines. While unique immune profiles may be detectable in an in vitro model and may reveal predictors for pathogenicity in borreliae

  6. The effect of antagonistic micro-organisms on the brood of honeybees (Apis mellifera) and bumblebees (Bombus terrestris) 2003

    NARCIS (Netherlands)

    Steen, van der J.J.M.; Dik, A.J.

    2002-01-01

    Several plant pathogenic fungi enter the plant trough open flowers. Spores of antagonistic micro-organisms present on the flowers can successfully compete with the possible pathogens. Honeybees and bumblebees can be used for transporting these antagonistic micro-organisms from the hive into flowers

  7. In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

    Science.gov (United States)

    Lew, Y Y; Michalak, T I

    2001-02-01

    Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

  8. Microorganisms in human milk: lights and shadows.

    Science.gov (United States)

    Civardi, Elisa; Garofoli, Francesca; Tzialla, Chryssoula; Paolillo, Piermichele; Bollani, Lina; Stronati, Mauro

    2013-10-01

    Human milk has been traditionally considered germ free, however, recent studies have shown that it represents a continuous supply of commensal and potentially probiotic bacteria to the infant gut. Mammary microbioma may exercise anti-infective, anti-inflammatory, immunomodulatory and metabolic properties. Moreover human milk may be a source of pathogenic microorganism during maternal infection, if contaminated during expression or in case of vaccination of the mother. The non-sterility of breast milk can, thus, be seen as a protective factor, or rarely, as a risk factor for the newborn.

  9. Paramecium species ingest and kill the cells of the human pathogenic fungus Cryptococcus neoformans.

    Science.gov (United States)

    Frager, Shalom Z; Chrisman, Cara J; Shakked, Rachel; Casadevall, Arturo

    2010-08-01

    A fundamental question in the field of medical mycology is the origin of virulence in those fungal pathogens acquired directly from the environment. In recent years, it was proposed that the virulence of certain environmental animal-pathogenic microbes, such as Cryptococcus neoformans, originated from selection pressures caused by species-specific predation. In this study, we analyzed the interaction of C. neoformans with three Paramecium spp., all of which are ciliated mobile protists. In contrast to the interaction with amoebae, some Paramecium spp. rapidly ingested C. neoformans and killed the fungus. This study establishes yet another type of protist-fungal interaction supporting the notion that animal-pathogenic fungi in the environment are under constant selection by predation.

  10. Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

    Science.gov (United States)

    Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

    2017-01-01

    The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

  11. Inactivation of certain insect pathogens by ultraviolet radiation

    International Nuclear Information System (INIS)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV. (orig.) [de

  12. Inactivation of certain insect pathogens by ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV.

  13. Lactobacillus paracasei CBA L74 metabolic products and fermented milk for infant formula have anti-inflammatory activity on dendritic cells in vitro and protective effects against colitis and an enteric pathogen in vivo.

    Directory of Open Access Journals (Sweden)

    Elena Zagato

    Full Text Available The rapid expansion of commercially available fermented food products raises important safety issues particularly when infant food is concerned. In many cases, the activity of the microorganisms used for fermentation as well as what will be the immunological outcome of fermented food intake is not known. In this manuscript we used complex in vitro, ex-vivo and in vivo systems to study the immunomodulatory properties of probiotic-fermented products (culture supernatant and fermented milk without live bacteria to be used in infant formula. We found in vitro and ex-vivo that fermented products of Lactobacillus paracasei CBA L74 act via the inhibition of proinflammatory cytokine release leaving anti-inflammatory cytokines either unaffected or even increased in response to Salmonella typhimurium. These activities are not dependent on the inactivated bacteria but to metabolic products released during the fermentation process. We also show that our in vitro systems are predictive of an in vivo efficacy by the fermented products. Indeed CBA L74 fermented products (both culture medium and fermented milk could protect against colitis and against an enteric pathogen infection (Salmonella typhimurium. Hence we found that fermented products can act via the inhibition of immune cell inflammation and can protect the host from pathobionts and enteric pathogens. These results open new perspectives in infant nutrition and suggest that L. paracasei CBA L74 fermented formula can provide immune benefits to formula-fed infants, without carrying live bacteria that may be potentially dangerous to an immature infant immune system.

  14. Functional microorganisms for functional food quality.

    Science.gov (United States)

    Gobbetti, M; Cagno, R Di; De Angelis, M

    2010-09-01

    Functional microorganisms and health benefits represent a binomial with great potential for fermented functional foods. The health benefits of fermented functional foods are expressed either directly through the interactions of ingested live microorganisms with the host (probiotic effect) or indirectly as the result of the ingestion of microbial metabolites synthesized during fermentation (biogenic effect). Since the importance of high viability for probiotic effect, two major options are currently pursued for improving it--to enhance bacterial stress response and to use alternative products for incorporating probiotics (e.g., ice cream, cheeses, cereals, fruit juices, vegetables, and soy beans). Further, it seems that quorum sensing signal molecules released by probiotics may interact with human epithelial cells from intestine thus modulating several physiological functions. Under optimal processing conditions, functional microorganisms contribute to food functionality through their enzyme portfolio and the release of metabolites. Overproduction of free amino acids and vitamins are two classical examples. Besides, bioactive compounds (e.g., peptides, γ-amino butyric acid, and conjugated linoleic acid) may be released during food processing above the physiological threshold and they may exert various in vivo health benefits. Functional microorganisms are even more used in novel strategies for decreasing phenomenon of food intolerance (e.g., gluten intolerance) and allergy. By a critical approach, this review will aim at showing the potential of functional microorganisms for the quality of functional foods.

  15. Microorganisms from hands of traditional Chinese medical doctors ...

    African Journals Online (AJOL)

    Background: In a central hospital, the heavy clinical workload makes one to overlook its hazard to health and can to a large extent promote the transmission of pathogenic microorganisms. It is not uncommon however, to observe practices that deviate from normal standards of hygiene. Hand contact between doctors of TCM ...

  16. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  17. Identification and characterization of smallest pore-forming protein in the cell wall of pathogenic Corynebacterium urealyticum DSM 7109.

    Science.gov (United States)

    Abdali, Narges; Younas, Farhan; Mafakheri, Samaneh; Pothula, Karunakar R; Kleinekathöfer, Ulrich; Tauch, Andreas; Benz, Roland

    2018-05-09

    Corynebacterium urealyticum, a pathogenic, multidrug resistant member of the mycolata, is known as causative agent of urinary tract infections although it is a bacterium of the skin flora. This pathogenic bacterium shares with the mycolata the property of having an unusual cell envelope composition and architecture, typical for the genus Corynebacterium. The cell wall of members of the mycolata contains channel-forming proteins for the uptake of solutes. In this study, we provide novel information on the identification and characterization of a pore-forming protein in the cell wall of C. urealyticum DSM 7109. Detergent extracts of whole C. urealyticum cultures formed in lipid bilayer membranes slightly cation-selective pores with a single-channel conductance of 1.75 nS in 1 M KCl. Experiments with different salts and non-electrolytes suggested that the cell wall pore of C. urealyticum is wide and water-filled and has a diameter of about 1.8 nm. Molecular modelling and dynamics has been performed to obtain a model of the pore. For the search of the gene coding for the cell wall pore of C. urealyticum we looked in the known genome of C. urealyticum for a similar chromosomal localization of the porin gene to known porH and porA genes of other Corynebacterium strains. Three genes are located between the genes coding for GroEL2 and polyphosphate kinase (PKK2). Two of the genes (cur_1714 and cur_1715) were expressed in different constructs in C. glutamicum ΔporAΔporH and in porin-deficient BL21 DE3 Omp8 E. coli strains. The results suggested that the gene cur_1714 codes alone for the cell wall channel. The cell wall porin of C. urealyticum termed PorACur was purified to homogeneity using different biochemical methods and had an apparent molecular mass of about 4 kDa on tricine-containing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Biophysical characterization of the purified protein (PorACur) suggested indeed that cur_1714 is the gene

  18. In vitro cell quality of buffy coat platelets in additive solution treated with pathogen reduction technology

    DEFF Research Database (Denmark)

    Ostrowski, Sisse R; Bochsen, Louise; Salado-Jimena, José A

    2010-01-01

    Pathogen reduction technologies (PRTs) may induce storage lesion in platelet (PLT) concentrates. To investigate this, buffy coat PLTs (BCPs) in PLT additive solution (AS; SSP+) with or without Mirasol PRT (CaridianBCT Biotechnologies) were assessed by quality control tests and four-color flow...

  19. Genetic correlations between pathogen-specific mastitis and somatic cell count in Danish Holsteins

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Mark, Thomas; Madsen, P.

    2009-01-01

    _170) or 300 d (LASCC_300) after calving, and the mastitis traits were unspecific mastitis (all mastitis treatments, both clinical and subclinical, regardless of the causative pathogen) and mastitis caused by either Streptococcus dysgalactiae, Escherichia coli, coagulase-negative staphylococci (CNS...

  20. Doppler speedometer for micro-organisms

    International Nuclear Information System (INIS)

    Penkov, F.; Tuleushev, A.; Lisitsyn, V.; Kim, S.; Tuleushev, Yu.

    1996-01-01

    Objective of Investigations: Development and creation of the Doppler speedometer for micro-organisms which allows to evaluate, in a real temporal scale, variations in the state of water suspension of micro-organisms under the effect of chemical, physical and other external actions. Statement of the Problem The main problem is absence of reliable, accessible for users and simple, in view of application, Doppler speedometers for micro-organisms. Nevertheless, correlation Doppler spectrometry in the regime of heterodyning the supporting and cell-scattered laser radiation is welt known. The main idea is that the correlation function of photo-current pulses bears an information on the averages over the assembly of cell velocities. For solving the biological problems, construction of auto-correlation function in the real-time regime with the delay time values comprising, function in the real-time regime with the delay time values comprising, nearly, 100 me (10 khz) or higher is needed. Computers of high class manage this problem using but the program software. Due to this, one can simplify applications of the proposed techniques provided he creates the Doppler speedometer for micro-organism on a base of the P entium . Expected Result Manufactured operable mock-up of the Doppler speedometer for micro-organisms in a form of the auxiliary computer block which allows to receive an information, in the real time scale, on the results of external effects of various nature on the cell assembly in transparent medium with a small volume of the studied cell suspension

  1. Human pathogenic Mycoplasma species induced cytokine gene expression in Epstein-Barr virus (EBV)-positive lymphoblastoid cell lines.

    Science.gov (United States)

    Schäffner, E; Opitz, O; Pietsch, K; Bauer, G; Ehlers, S; Jacobs, E

    1998-04-01

    We addressed the question whether the in vitro interaction of two Epstein-Barr virus (EBV)-genome-positive B cell lines (EB-3 and HilB-gamma) with either Mycoplasma pneumoniae or M. hominis, with the mycoplasma species (M. fermentans, M. fermentans subsp. incognitus, M. penetrans, M. genitalium) or with mycoplasma species known to be mere commensals of the respiratory tract (M. orale and M. salivarium) would result in expression of mRNAs for IL-2, IL-2R, IL-4 and IL-6 as determined by reverse transcriptase (RT)-PCR after 4 and 24 h of cocultivation. The pattern of cytokine gene expression observed depended on (i) the origin of the transformed cell line, (ii) the pathogenicity of the Mycoplasma species, and (iii) the length of cocultivation. The EBV-immortalized lymphoblastoid cell line HilB-gamma showed mRNA expression for IL-2, IL-2-receptor, IL-4 and IL-6 peaking 24 h after stimulation with M. pneumoniae and all AIDS-related mycoplasma species tested. The Burkitt lymphoma cell line EB-3 showed a distinct and isolated strong II-2/IL-2 R-mRNA expression within 4 h after contact with the pathogenic and all of the AIDS related mycoplasma species. In neither EBV-containing cell line cytokine was gene expression detectable after stimulation with the commensal mycoplasma species, M. orale and M. salivarium, indicating species differences in the ability of mycoplasmas to interact with and stimulate B-cell lines. Our data suggest that some mcyoplasma species may act as immunomodulatory cofactors by eliciting inappropriate cytokine gene expression in B cells latently infected with EBV. Therefore, this cultivation model may prove useful in evaluating the pathogenetic potential of novel isolated mycoplasma species. Copyright 1998 Academic Press Limited.

  2. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  3. The Effect of High Hydrostatic Pressure on Microorganisms in Food Preservation

    OpenAIRE

    M. Arici

    2006-01-01

    High hydrostatic pressure is a new food preservation technology known for its capacity to inactivate spoilage and pathogenic microorganisms. High-pressure treatments are receiving a great deal of attention for the inactivation of microorganisms in food processing, pressure instead of temperature is used as stabilizing factor. High hydrostatic pressure treatment is the most studied alternative process, many works reported successful results in inactivating a wide range of microorganisms under ...

  4. New micro-organism

    Energy Technology Data Exchange (ETDEWEB)

    Takakuwa, Masayoshi; Hashimoto, Gotaro

    1987-09-12

    Invention relates with a new organism for the coal liquefying desulfurization. This micro-organism conducts a good sporulation on a culture medium which contains a coal as an only carbon source. It belongs to Penicillium and named Penicillium MT-6001 registered at Fermentation Research Institute No. 8463. Coal powder is thrown into a reaction vessel which accommodated a culture solution of this bacteria, and the surface of the solution is covered with liquid paraffin; coal powder is treated of liquefaction for about 5 hours while maintaining the anaerobic condition and slowly agitating to form a transparent solution layer on the surface of the reactor together with liquid paraffin. Liquefied product shows an analysis pattern similar to naphthenic petroleum containing a lipid with polar radical. (2 figs)

  5. Systems Biology of Industrial Microorganisms

    Science.gov (United States)

    Papini, Marta; Salazar, Margarita; Nielsen, Jens

    The field of industrial biotechnology is expanding rapidly as the chemical industry is looking towards more sustainable production of chemicals that can be used as fuels or building blocks for production of solvents and materials. In connection with the development of sustainable bioprocesses, it is a major challenge to design and develop efficient cell factories that can ensure cost efficient conversion of the raw material into the chemical of interest. This is achieved through metabolic engineering, where the metabolism of the cell factory is engineered such that there is an efficient conversion of sugars, the typical raw materials in the fermentation industry, into the desired product. However, engineering of cellular metabolism is often challenging due to the complex regulation that has evolved in connection with adaptation of the different microorganisms to their ecological niches. In order to map these regulatory structures and further de-regulate them, as well as identify ingenious metabolic engineering strategies that full-fill mass balance constraints, tools from systems biology can be applied. This involves both high-throughput analysis tools like transcriptome, proteome and metabolome analysis, as well as the use of mathematical modeling to simulate the phenotypes resulting from the different metabolic engineering strategies. It is in fact expected that systems biology may substantially improve the process of cell factory development, and we therefore propose the term Industrial Systems Biology for how systems biology will enhance the development of industrial biotechnology for sustainable chemical production.

  6. Thermophilic microorganisms in biomining.

    Science.gov (United States)

    Donati, Edgardo Rubén; Castro, Camila; Urbieta, María Sofía

    2016-11-01

    Biomining is an applied biotechnology for mineral processing and metal extraction from ores and concentrates. This alternative technology for recovering metals involves the hydrometallurgical processes known as bioleaching and biooxidation where the metal is directly solubilized or released from the matrix for further solubilization, respectively. Several commercial applications of biomining can be found around the world to recover mainly copper and gold but also other metals; most of them are operating at temperatures below 40-50 °C using mesophilic and moderate thermophilic microorganisms. Although biomining offers an economically viable and cleaner option, its share of the world´s production of metals has not grown as much as it was expected, mainly considering that due to environmental restrictions in many countries smelting and roasting technologies are being eliminated. The slow rate of biomining processes is for sure the main reason of their poor implementation. In this scenario the use of thermophiles could be advantageous because higher operational temperature would increase the rate of the process and in addition it would eliminate the energy input for cooling the system (bioleaching reactions are exothermic causing a serious temperature increase in bioreactors and inside heaps that adversely affects most of the mesophilic microorganisms) and it would decrease the passivation of mineral surfaces. In the last few years many thermophilic bacteria and archaea have been isolated, characterized, and even used for extracting metals. This paper reviews the current status of biomining using thermophiles, describes the main characteristics of thermophilic biominers and discusses the future for this biotechnology.

  7. Mucosal-Associated Invariant T Cell Interactions with Commensal and Pathogenic Bacteria: Potential Role in Antimicrobial Immunity in the Child

    Directory of Open Access Journals (Sweden)

    Liana Ghazarian

    2017-12-01

    Full Text Available Mucosal-associated invariant T (MAIT cells are unconventional CD3+CD161high T lymphocytes that recognize vitamin B2 (riboflavin biosynthesis precursor derivatives presented by the MHC-I related protein, MR1. In humans, their T cell receptor is composed of a Vα7.2-Jα33/20/12 chain, combined with a restricted set of Vβ chains. MAIT cells are very abundant in the liver (up to 40% of resident T cells and in mucosal tissues, such as the lung and gut. In adult peripheral blood, they represent up to 10% of circulating T cells, whereas they are very few in cord blood. This large number of MAIT cells in the adult likely results from their gradual expansion with age following repeated encounters with riboflavin-producing microbes. Upon recognition of MR1 ligands, MAIT cells have the capacity to rapidly eliminate bacterially infected cells through the production of inflammatory cytokines (IFNγ, TNFα, and IL-17 and cytotoxic effector molecules (perforin and granzyme B. Thus, MAIT cells may play a crucial role in antimicrobial defense, in particular at mucosal sites. In addition, MAIT cells have been implicated in diseases of non-microbial etiology, including autoimmunity and other inflammatory diseases. Although their participation in various clinical settings has received increased attention in adults, data in children are scarce. Due to their innate-like characteristics, MAIT cells might be particularly important to control microbial infections in the young age, when long-term protective adaptive immunity is not fully developed. Herein, we review the data showing how MAIT cells may control microbial infections and how they discriminate pathogens from commensals, with a focus on models relevant for childhood infections.

  8. Lactobacillus crispatus L1: high cell density cultivation and exopolysaccharide structure characterization to highlight potentially beneficial effects against vaginal pathogens.

    Science.gov (United States)

    Donnarumma, Giovanna; Molinaro, Antonio; Cimini, Donatella; De Castro, Cristina; Valli, Vivien; De Gregorio, Vincenza; De Rosa, Mario; Schiraldi, Chiara

    2014-05-30

    Vaginal lactic acid bacteria defend the host against pathogens through a combination of competitive exclusion, competition for nutrients, production of antimicrobial substances and through the activation of the immune system. A new human isolate named Lactobacillus crispatus L1 was characterized in this work, and a preliminary evaluation of its probiotic potential is described together with a process to obtain a high productivity of viable biomass. In a simulated digestion process 1.8⋅10(10) cells∙ml(-1) survived the gastric environment with 80% viability, without being affected by small intestine juices. Experiments on six different C sources were performed to analyze growth and organic acids production and, glucose, provided the best performances. A microfiltration strategy was exploited to improve the cellular yield in 2 L-fermentation processes, reaching 27 g · l(-1) of dry biomass. Moreover, L. crispatus L1 demonstrated a greater stability to high concentrations of lactic acid, compared to other lactobacilli. The specific L. crispatus L1 exopolysaccharide was purified from the fermentation broth and characterized by NMR showing structural features and similarity to exopolysaccharides produced by pathogenic strains. Live L. crispatus L1 cells strongly reduced adhesion of a yeast pathogenic strain, Candida albicans in particular, in adherence assays. Interestingly a higher expression of the human defensin HBD-2 was also observed in vaginal cells treated with the purified exopolysaccharide, indicating a possible correlation with C. albicans growth inhibition. The paper describes the evaluation of L. crispatus L1 as potential vaginal probiotic and the fermentation processes to obtain high concentrations of viable cells.

  9. Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

    Science.gov (United States)

    Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

    2014-01-01

    Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

  10. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Directory of Open Access Journals (Sweden)

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  11. Differential Signaling and Sugar Exchanges in Response to Avirulent Pathogen- and Symbiont-Derived Molecules in Tobacco Cells

    Directory of Open Access Journals (Sweden)

    Carole Pfister

    2017-11-01

    Full Text Available Plants interact with microbes whose ultimate aim is to exploit plant carbohydrates for their reproduction. Plant–microbe interactions (PMIs are classified according to the nature of their trophic exchanges: while mutualistic microbes trade nutrients with plants, pathogens unilaterally divert carbohydrates. The early responses following microbe recognition and the subsequent control of plant sugar distribution are still poorly understood. To further decipher PMI functionality, we used tobacco cells treated with microbial molecules mimicking pathogenic or mutualistic PMIs, namely cryptogein, a defense elicitor, and chitotetrasaccharide (CO4, which is secreted by mycorrhizal fungi. CO4 was perceived by tobacco cells and triggered widespread transient signaling components such as a sharp cytosolic Ca2+ elevation, NtrbohD-dependent H2O2 production, and MAP kinase activation. These CO4-induced events differed from those induced by cryptogein, i.e., sustained events leading to cell death. Furthermore, cryptogein treatment inhibited glucose and sucrose uptake but not fructose uptake, and promoted the expression of NtSUT and NtSWEET sugar transporters, whereas CO4 had no effect on sugar uptake and only a slight effect on NtSWEET2B expression. Our results suggest that microbial molecules induce different signaling responses that reflect microbial lifestyle and the subsequent outcome of the interaction.

  12. DNA Delivery and Genomic Integration into Mammalian Target Cells through Type IV A and B Secretion Systems of Human Pathogens

    Directory of Open Access Journals (Sweden)

    Dolores L. Guzmán-Herrador

    2017-08-01

    Full Text Available We explore the potential of bacterial secretion systems as tools for genomic modification of human cells. We previously showed that foreign DNA can be introduced into human cells through the Type IV A secretion system of the human pathogen Bartonella henselae. Moreover, the DNA is delivered covalently attached to the conjugative relaxase TrwC, which promotes its integration into the recipient genome. In this work, we report that this tool can be adapted to other target cells by using different relaxases and secretion systems. The promiscuous relaxase MobA from plasmid RSF1010 can be used to deliver DNA into human cells with higher efficiency than TrwC. MobA also promotes DNA integration, albeit at lower rates than TrwC. Notably, we report that DNA transfer to human cells can also take place through the Type IV secretion system of two intracellular human pathogens, Legionella pneumophila and Coxiella burnetii, which code for a distantly related Dot/Icm Type IV B secretion system. This suggests that DNA transfer could be an intrinsic ability of this family of secretion systems, expanding the range of target human cells. Further analysis of the DNA transfer process showed that recruitment of MobA by Dot/Icm was dependent on the IcmSW chaperone, which may explain the higher DNA transfer rates obtained. Finally, we observed that the presence of MobA negatively affected the intracellular replication of C. burnetii, suggesting an interference with Dot/Icm translocation of virulence factors.

  13. Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum.

    Science.gov (United States)

    Wojtasik, Wioleta; Kulma, Anna; Dymińska, Lucyna; Hanuza, Jerzy; Czemplik, Magdalena; Szopa, Jan

    2016-03-22

    Fusarium oxysporum infection leads to Fusarium-derived wilt, which is responsible for the greatest losses in flax (Linum usitatissimum) crop yield. Plants infected by Fusarium oxysporum show severe symptoms of dehydration due to the growth of the fungus in vascular tissues. As the disease develops, vascular browning and leaf yellowing can be observed. In the case of more virulent strains, plants die. The pathogen's attack starts with secretion of enzymes degrading the host cell wall. The main aim of the study was to evaluate the role of the cell wall polymers in the flax plant response to the infection in order to better understand the process of resistance and develop new ways to protect plants against infection. For this purpose, the expression of genes involved in cell wall polymer metabolism and corresponding polymer levels were investigated in flax seedlings after incubation with Fusarium oxysporum. This analysis was facilitated by selecting two groups of genes responding differently to the infection. The first group comprised genes strongly affected by the infection and activated later (phenylalanine ammonia lyase and glucosyltransferase). The second group comprised genes which are slightly affected (up to five times) and their expression vary as the infection progresses. Fusarium oxysporum infection did not affect the contents of cell wall polymers, but changed their structure. The results suggest that the role of the cell wall polymers in the plant response to Fusarium oxysporum infection is manifested through changes in expression of their genes and rearrangement of the cell wall polymers. Our studies provided new information about the role of cellulose and hemicelluloses in the infection process, the change of their structure and the expression of genes participating in their metabolism during the pathogen infection. We also confirmed the role of pectin and lignin in this process, indicating the major changes at the mRNA level of lignin metabolism genes

  14. Radioresistant microorganisms and food irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, H [Japan Atomic Energy Research Inst., Takasaki, Gunma. Takasaki Radiation Chemistry Research Establishment

    1976-01-01

    This paper deals with Micrococcus radiodurans, Arthrobacter radiotolerance, etc., which were isolated and discovered as radioresistant microorganisms. As for the explanation of the mechanism of radioresistance of these microorganisms, the consideration that these organisms have marked repair power of the damaged DNA and have many opportunity to repair the damaged DNA because of their long fission term were cited. The relationship between the radioresistance of microorganisms and food irradiation was also mentioned.

  15. A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia.

    Science.gov (United States)

    Gisder, Sebastian; Möckel, Nadine; Linde, Andreas; Genersch, Elke

    2011-02-01

    The population of managed honey bees has been dramatically declining in the recent past in many regions of the world. Consensus now seems to be that pathogens and parasites (e.g. the ectoparasitic mite Varroa destructor, the microsporidium Nosema ceranae and viruses) play a major role in this demise. However, little is known about host-pathogen interactions for bee pathogens and attempts to develop novel strategies to combat bee diseases have been hampered by this gap in our knowledge. One reason for this dire situation is the complete lack of cell cultures for the propagation and study of bee pathogens. Here we present a cell culture model for two honey bee-pathogenic microsporidian species, Nosema apis and N. ceranae. Our cell culture system is based on a lepidopteran cell line, which proved to be susceptible to infection by both N. ceranae and N. apis and enabled us to illustrate the entire life cycle of these microsporidia. We observed hitherto undescribed spindle-shaped meronts and confirmed our findings in infected bees. Our cell culture model provides a previously unavailable means to explore the nature of interactions between the honey bee and its pathogen complex at a mechanistic level and will allow the development of novel treatment strategies.

  16. Edwardsiella tarda Endocarditis Confirmed by Indium-111 White Blood Cell Scan: An Unusual Pathogen and Diagnostic Modality

    Directory of Open Access Journals (Sweden)

    Kayleigh M. Litton

    2016-01-01

    Full Text Available Edwardsiella tarda is a freshwater marine member of the family Enterobacteriaceae which often colonizes fish, lizards, snakes, and turtles but is an infrequent human pathogen. Indium-111- (111In- labeled white blood cell (WBC scintigraphy is an imaging modality which has a wide range of reported sensitivity and specificity (from 60 to 100% and from 68 to 92%, resp. for diagnosing acute and chronic infection. We describe a case of suspected E. tarda prosthetic aortic valve and mitral valve endocarditis with probable vegetations and new mitral regurgitation on transthoracic and transesophageal echocardiograms which was supported with the use of 111In-labeled WBC scintigraphy.

  17. Andrographolide interferes quorum sensing to reduce cell damage caused by avian pathogenic Escherichia coli.

    Science.gov (United States)

    Guo, Xun; Zhang, Li-Yan; Wu, Shuai-Cheng; Xia, Fang; Fu, Yun-Xing; Wu, Yong-Li; Leng, Chun-Qing; Yi, Peng-Fei; Shen, Hai-Qing; Wei, Xu-Bin; Fu, Ben-Dong

    2014-12-05

    Avian pathogenic Escherichia coli (APEC) induce septicemia in chickens by invading type II pneumocytes to breach the blood-air barrier. The virulence of APEC can be regulated by quorum sensing (QS). Andrographolide is a QS inhibitor of Pseudomonas aeruginosa (P. aeruginosa). Therefore, we investigate whether andrographolide inhibits the injury of chicken type II pneumocytes by avian pathogenic E. coli O78 (APEC-O78) by disrupting the bacterial QS system. The results showed that sub-MIC of andrographolide significantly reduced the release of lactate dehydrogenase (LDH), F-actin cytoskeleton polymerization, and the degree of the adherence to chicken type II pneumocytes induced by APEC-O78. Further, we found that andrographolide significantly decreased the autoinducer-2 (AI-2) activity and the expression of virulence factors of APEC-O78. These results suggest that andrographolide reduce the pathogenicity of APEC-O78 in chicken type II pneumocytes by interfering QS and decreasing virulence. These results provide new evidence for colibacillosis prevention methods in chickens. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. The sugarcane defense protein SUGARWIN2 causes cell death in Colletotrichum falcatum but not in non-pathogenic fungi.

    Directory of Open Access Journals (Sweden)

    Flávia P Franco

    Full Text Available Plants respond to pathogens and insect attacks by inducing and accumulating a large set of defense-related proteins. Two homologues of a barley wound-inducible protein (BARWIN have been characterized in sugarcane, SUGARWIN1 and SUGARWIN2 (sugarcane wound-inducible proteins. Induction of SUGARWINs occurs in response to Diatraea saccharalis damage but not to pathogen infection. In addition, the protein itself does not show any effect on insect development; instead, it has antimicrobial activities toward Fusarium verticillioides, an opportunistic fungus that usually occurs after D. saccharalis borer attacks on sugarcane. In this study, we sought to evaluate the specificity of SUGARWIN2 to better understand its mechanism of action against phytopathogens and the associations between fungi and insects that affect plants. We used Colletotrichum falcatum, a fungus that causes red rot disease in sugarcane fields infested by D. saccharalis, and Ceratocystis paradoxa, which causes pineapple disease in sugarcane. We also tested whether SUGARWIN2 is able to cause cell death in Aspergillus nidulans, a fungus that does not infect sugarcane, and in the model yeast Saccharomyces cerevisiae, which is used for bioethanol production. Recombinant SUGARWIN2 altered C. falcatum morphology by increasing vacuolization, points of fractures and a leak of intracellular material, leading to germling apoptosis. In C. paradoxa, SUGARWIN2 showed increased vacuolization in hyphae but did not kill the fungi. Neither the non-pathogenic fungus A. nidulans nor the yeast S. cerevisiae was affected by recombinant SUGARWIN2, suggesting that the protein is specific to sugarcane opportunistic fungal pathogens.

  19. PRM1 and KAR5 function in cell-cell fusion and karyogamy to drive distinct bisexual and unisexual cycles in the Cryptococcus pathogenic species complex.

    Directory of Open Access Journals (Sweden)

    Ci Fu

    2017-11-01

    Full Text Available Sexual reproduction is critical for successful evolution of eukaryotic organisms in adaptation to changing environments. In the opportunistic human fungal pathogens, the Cryptococcus pathogenic species complex, C. neoformans primarily undergoes bisexual reproduction, while C. deneoformans undergoes both unisexual and bisexual reproduction. During both unisexual and bisexual cycles, a common set of genetic circuits regulates a yeast-to-hyphal morphological transition, that produces either monokaryotic or dikaryotic hyphae. As such, both the unisexual and bisexual cycles can generate genotypic and phenotypic diversity de novo. Despite the similarities between these two cycles, genetic and morphological differences exist, such as the absence of an opposite mating-type partner and monokaryotic instead of dikaryotic hyphae during C. deneoformans unisexual cycle. To better understand the similarities and differences between these modes of sexual reproduction, we focused on two cellular processes involved in sexual reproduction: cell-cell fusion and karyogamy. We identified orthologs of the plasma membrane fusion protein Prm1 and the nuclear membrane fusion protein Kar5 in both Cryptococcus species, and demonstrated their conserved roles in cell fusion and karyogamy during C. deneoformans α-α unisexual reproduction and C. deneoformans and C. neoformans a-α bisexual reproduction. Notably, karyogamy occurs inside the basidum during bisexual reproduction in C. neoformans, but often occurs earlier following cell fusion during bisexual reproduction in C. deneoformans. Characterization of these two genes also showed that cell fusion is dispensable for solo unisexual reproduction in C. deneoformans. The blastospores produced along hyphae during C. deneoformans unisexual reproduction are diploid, suggesting that diploidization occurs early during hyphal development, possibly through either an endoreplication pathway or cell fusion-independent karyogamy

  20. Aquaporins facilitate hydrogen peroxide entry into guard cells to mediate ABA- and pathogen-triggered stomatal closure.

    Science.gov (United States)

    Rodrigues, Olivier; Reshetnyak, Ganna; Grondin, Alexandre; Saijo, Yusuke; Leonhardt, Nathalie; Maurel, Christophe; Verdoucq, Lionel

    2017-08-22

    Stomatal movements are crucial for the control of plant water status and protection against pathogens. Assays on epidermal peels revealed that, similar to abscisic acid (ABA), pathogen-associated molecular pattern (PAMP) flg22 requires the At PIP2;1 aquaporin to induce stomatal closure. Flg22 also induced an increase in osmotic water permeability ( P f ) of guard cell protoplasts through activation of At PIP2;1. The use of HyPer, a genetic probe for intracellular hydrogen peroxide (H 2 O 2 ), revealed that both ABA and flg22 triggered an accumulation of H 2 O 2 in wild-type but not pip2;1 guard cells. Pretreatment of guard cells with flg22 or ABA facilitated the influx of exogenous H 2 O 2 Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) and open stomata 1 (OST1)/Snf1-related protein kinase 2.6 (SnRK2.6) were both necessary to flg22-induced P f and both phosphorylated At PIP2;1 on Ser121 in vitro. Accumulation of H 2 O 2 and stomatal closure as induced by flg22 was restored in pip2;1 guard cells by a phosphomimetic form (Ser121Asp) but not by a phosphodeficient form (Ser121Ala) of At PIP2;1. We propose a mechanism whereby phosphorylation of At PIP2;1 Ser121 by BAK1 and/or OST1 is triggered in response to flg22 to activate its water and H 2 O 2 transport activities. This work establishes a signaling role of plasma membrane aquaporins in guard cells and potentially in other cellular context involving H 2 O 2 signaling.

  1. Overcoming antibiotic resistance: Is siderophore Trojan horse conjugation an answer to evolving resistance in microbial pathogens?

    Science.gov (United States)

    Dhusia, Kalyani; Bajpai, Archana; Ramteke, P W

    2018-01-10

    Comparative study of siderophore biosynthesis pathway in pathogens provides potential targets for antibiotics and host drug delivery as a part of computationally feasible microbial therapy. Iron acquisition using siderophore models is an essential and well established model in all microorganisms and microbial infections a known to cause great havoc to both plant and animal. Rapid development of antibiotic resistance in bacterial as well as fungal pathogens has drawn us at a verge where one has to get rid of the traditional way of obstructing pathogen using single or multiple antibiotic/chemical inhibitors or drugs. 'Trojan horse' strategy is an answer to this imperative call where antibiotic are by far sneaked into the pathogenic cell via the siderophore receptors at cell and outer membrane. This antibiotic once gets inside, generates a 'black hole' scenario within the opportunistic pathogens via iron scarcity. For pathogens whose siderophore are not compatible to smuggle drug due to their complex conformation and stiff valence bonds, there is another approach. By means of the siderophore biosynthesis pathways, potential targets for inhibition of these siderophores in pathogenic bacteria could be achieved and thus control pathogenic virulence. Method to design artificial exogenous siderophores for pathogens that would compete and succeed the battle of intake is also covered with this review. These manipulated siderophore would enter pathogenic cell like any other siderophore but will not disperse iron due to which iron inadequacy and hence pathogens control be accomplished. The aim of this review is to offer strategies to overcome the microbial infections/pathogens using siderophore. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Fate of indicator microorganisms under nutrient management plan conditions.

    Science.gov (United States)

    Bradford, Scott A; Segal, Eran

    2009-01-01

    Nutrient management plans (NMPs) for application of wastewater from concentrated animal feeding operations are designed to meet crop water and nutrient requirements, but implicitly assume that pathogenic microorganisms in the wastewater will be retained and die-off in the root zone. A NMP was implemented on a field plot to test this assumption by monitoring the fate of several fecal indicator microorganisms (Enterococcus, fecal coliforms, somatic coliphage, and total Escherichia coli). When well-water and wastewater were applied to meet measured evapotranspiration (ET), little advective transport of the indicator microorganisms occurred below the root zone and the remaining microorganisms rapidly died-off (within 1 mo). Additional experiments were conducted in the laboratory to better quantify microorganism transport and survival in the field soil. Batch survival experiments revealed much more rapid die-off rates for the bacterial indicator microorganisms in native than in sterilized soil, suggesting that biotic factors controlled survival. Saturated column experiments with packed field soil, demonstrated much greater transport potential for somatic coliphage than bacterial indicators (Enterococcus and total E. coli) and that the retention rates for the indicator microorganisms were not log-linear with depth. A worst case transport scenario of ponded infiltration on a large undistributed soil column from the field was also initiated and indicator microorganisms were not detected in the column outflow or in the soil at a depth of 65 cm. All of these observations support the hypothesis that a NMP at this site will protect groundwater supplies from microorganism contamination, especially when applied water and wastewater meet ET.

  3. Biosurfactants Produced by Marine Microorganisms with Therapeutic Applications.

    Science.gov (United States)

    Gudiña, Eduardo J; Teixeira, José A; Rodrigues, Lígia R

    2016-02-18

    Marine microorganisms possess unique metabolic and physiological features and are an important source of new biomolecules, such as biosurfactants. Some of these surface-active compounds synthesized by marine microorganisms exhibit antimicrobial, anti-adhesive and anti-biofilm activity against a broad spectrum of human pathogens (including multi-drug resistant pathogens), and could be used instead of existing drugs to treat infections caused by them. In other cases, these biosurfactants show anti-cancer activity, which could be envisaged as an alternative to conventional therapies. However, marine biosurfactants have not been widely explored, mainly due to the difficulties associated with the isolation and growth of their producing microorganisms. Culture-independent techniques (metagenomics) constitute a promising approach to study the genetic resources of otherwise inaccessible marine microorganisms without the requirement of culturing them, and can contribute to the discovery of novel biosurfactants with significant biological activities. This paper reviews the most relevant biosurfactants produced by marine microorganisms with potential therapeutic applications and discusses future perspectives and opportunities to discover novel molecules from marine environments.

  4. Biosurfactants Produced by Marine Microorganisms with Therapeutic Applications

    Directory of Open Access Journals (Sweden)

    Eduardo J. Gudiña

    2016-02-01

    Full Text Available Marine microorganisms possess unique metabolic and physiological features and are an important source of new biomolecules, such as biosurfactants. Some of these surface-active compounds synthesized by marine microorganisms exhibit antimicrobial, anti-adhesive and anti-biofilm activity against a broad spectrum of human pathogens (including multi-drug resistant pathogens, and could be used instead of existing drugs to treat infections caused by them. In other cases, these biosurfactants show anti-cancer activity, which could be envisaged as an alternative to conventional therapies. However, marine biosurfactants have not been widely explored, mainly due to the difficulties associated with the isolation and growth of their producing microorganisms. Culture-independent techniques (metagenomics constitute a promising approach to study the genetic resources of otherwise inaccessible marine microorganisms without the requirement of culturing them, and can contribute to the discovery of novel biosurfactants with significant biological activities. This paper reviews the most relevant biosurfactants produced by marine microorganisms with potential therapeutic applications and discusses future perspectives and opportunities to discover novel molecules from marine environments.

  5. Laser inactivation of pathogenic viruses in water

    Science.gov (United States)

    Grishkanich, Alexander; Zhevlakov, Alexander; Kascheev, Sergey; Sidorov, Igor; Ruzankina, Julia; Yakovlev, Alexey; Mak, Andrey

    2016-03-01

    Currently there is a situation that makes it difficult to provide the population with quality drinking water for the sanitary-hygienic requirements. One of the urgent problems is the need for water disinfection. Since the emergence of microorganisms that are pathogens transmitted through water such as typhoid, cholera, etc. requires constant cleansing of waters against pathogenic bacteria. In the water treatment process is destroyed up to 98% of germs, but among the remaining can be pathogenic viruses, the destruction of which requires special handling. As a result, the conducted research the following methods have been proposed for combating harmful microorganisms: sterilization of water by laser radiation and using a UV lamp.

  6. Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

    International Nuclear Information System (INIS)

    Lamont-Friedrich, Stephanie J; Michl, Thomas D; Giles, Carla; Griesser, Hans J; Coad, Bryan R

    2016-01-01

    The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata . Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others. (paper)

  7. Cell penetrating peptides to dissect host-pathogen protein-protein interactions in Theileria -transformed leukocytes

    KAUST Repository

    Haidar, Malak; de Laté , Perle Latré ; Kennedy, Eileen J.; Langsley, Gordon

    2017-01-01

    One powerful application of cell penetrating peptides is the delivery into cells of molecules that function as specific competitors or inhibitors of protein-protein interactions. Ablating defined protein-protein interactions is a refined way

  8. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    OpenAIRE

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-01-01

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induce...

  9. Polysaccharides from Extremophilic Microorganisms

    Science.gov (United States)

    Nicolaus, B.; Moriello, V. Schiano; Lama, L.; Poli, A.; Gambacorta, A.

    2004-02-01

    Several marine thermophilic strains were analyzed for exopolysaccharide production. The screening process revealed that a significant number of thermophilic microorganisms were able to produce biopolymers, and some of them also revealed interesting chemical compositions. We have identified four new polysaccharides from thermophilic marine bacteria, with complex primary structures and with different repetitive units: a galacto-mannane type from strain number 4004 and mannane type for the other strains. The thermophilic Bacillus thermantarcticus produces two exocellular polysaccharides (EPS 1, EPS 2) that give the colonies a typical mucous character. The exopolysaccharide fraction was produced with all substrates assayed, although a higher yield 400 mg liter-1 was obtained with mannose as carbon and energy source. NMR spectra confirmed that EPS 1 was a heteropolysaccharide of which the repeating unit was constituted by four different α-D-mannoses and three different β-D-glucoses. It seems to be close to some xantan polymers. EPS 2 was a mannan. Four different α-D-mannoses were found as the repeating unit. Production and chemical studies of biopolymers produced by halophilic archaea, Haloarcula species were also reported.

  10. Proteome data from a host-pathogen interaction study with Staphylococcus aureus and human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kristin Surmann

    2016-06-01

    Full Text Available To simultaneously obtain proteome data of host and pathogen from an internalization experiment, human alveolar epithelial A549 cells were infected with Staphylococcus aureus HG001 which carried a plasmid (pMV158GFP encoding a continuously expressed green fluorescent protein (GFP. Samples were taken hourly between 1.5 h and 6.5 h post infection. By fluorescence activated cell sorting GFP-expressing bacteria could be enriched from host cell debris, but also infected host cells could be separated from those which did not carry bacteria after contact (exposed. Additionally, proteome data of A549 cells which were not exposed to S. aureus but underwent the same sample processing steps are provided as a control. Time-resolved changes in bacterial protein abundance were quantified in a label-free approach. Proteome adaptations of host cells were monitored by comparative analysis to a stable isotope labeled cell culture (SILAC standard. Proteins were extracted from the cells, digested proteolytically, measured by nanoLC–MS/MS, and subsequently identified by database search and then quantified. The data presented here are related to a previously published research article describing the interplay of S. aureus HG001 and human epithelial cells (Surmann et al., 2015 [1]. They have been deposited to the ProteomeXchange platform with the identifiers PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002384 for the S. aureus HG001 proteome dataset and PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002388 for the A549 proteome dataset.

  11. Pathogen inactivation by riboflavin and ultraviolet light illumination accelerates the red blood cell storage lesion and promotes eryptosis.

    Science.gov (United States)

    Qadri, Syed M; Chen, Deborah; Schubert, Peter; Perruzza, Darian L; Bhakta, Varsha; Devine, Dana V; Sheffield, William P

    2017-03-01

    Pathogen reduction treatment using riboflavin and ultraviolet light illumination (Mirasol) effectively reduces the risk of transfusion-transmitted infections. This treatment is currently licensed for only platelets and plasma products, while its application to whole blood (WB) to generate pathogen-inactivated red blood cells (RBCs) is under development. RBC storage lesion, constituting numerous morphologic and biochemical changes, influences RBC quality and limits shelf life. Stored RBCs further show enhanced susceptibility to RBC programmed cell death (eryptosis) characterized by increased cytosolic Ca 2+ -provoked membrane phosphatidylserine (PS) externalization. Using a "pool-and-split" approach, we examined multiple variables of RBC storage lesion and eryptosis in RBC units, derived from Mirasol-treated or untreated WB, after 4 to 42 days of storage, under blood bank conditions. In comparison to untreated RBC units, Mirasol treatment significantly altered membrane microvesiculation, supernatant hemoglobin, osmotic fragility, and intracellular adenosine triphosphate levels but did not influence membrane CD47 expression and 2,3-diphosphoglycerate levels. Mirasol-treated RBCs showed significantly higher PS exposure after 42, but not after not more than 21, days of storage, which was accompanied by enhanced cytosolic Ca 2+ activity, ceramide abundance, and oxidative stress, but not p38 kinase activation. Mirasol treatment significantly augmented PS exposure, Ca 2+ entry, and protein kinase C activation after energy depletion, a pathophysiologic cell stressor. Mirasol-treated RBCs were, however, more resistant to cell shrinkage. Prolonged storage of Mirasol-treated RBCs significantly increases the proportion of eryptotic RBCs, while even short-term storage enhances the susceptibility of RBCs to stress-induced eryptosis, which could reduce posttransfusion RBC recovery in patients. © 2016 AABB.

  12. MOLECULAR-GENETIC BASIS OF PHYSIOLOGY AND PATHOGENICITY OF COXIELLA BURNETII

    Directory of Open Access Journals (Sweden)

    Yu. A. Panpherova

    2012-01-01

    Full Text Available Abstract. The agent of Q-fever Coxiella burnetii is unusual intracellular pathogen which is possessed of biggest transporting and metabolic abilities in compare with microorganisms with similar parasitic strategy. It is supposed that different strains of the pathogen exist in various stages of pathological adaption and have different potential of virulence. The structure of C. burnetii genome, characteristics of metabolic routes, mechanisms of interaction with host cells and possible virulence factors are discussed in the review. The special attention is paid to Coxiella genotyping methods and possible correlations between genomic polymorphism of different strains and their virulence potential.

  13. Pathogen-expanded CD11b+ invariant NKT cells feedback inhibit T cell proliferation via membrane-bound TGF-β1.

    Science.gov (United States)

    Han, Yanmei; Jiang, Zhengping; Chen, Zhubo; Gu, Yan; Liu, Yanfang; Zhang, Xiang; Cao, Xuetao

    2015-04-01

    Natural killer T cells (NKT cells) are effector cells, but also regulator of immune response, which either promote or suppress immune response through production of different cytokines. However, the subsets of NKT cells with definite phenotype and regulatory function need to be further identified. Furthermore, the mechanisms for NKT cells to regulate immune response remain to be fully elucidated. Here we identified CD11b(+) invariant NKT (CD11b(+) iNKT) cells as a new subset of regulatory NKT cells in mouse models with infection. αGalCer:CD1d complex(+)TCRβ(+)NK1.1(+) NKT cells could be categorized to CD11b(+) and CD11b(-) subsets. NKT cells are enriched in liver. During Listeria monocytogenes infection, hepatic CD11b(+) iNKT cells were significantly induced and expanded, with peak expansion on day 8. CD11b(+) iNKT cells were also expanded significantly in spleen and mesenteric lymph nodes. As compared to CD11b(-) iNKT cells, CD11b(+) iNKT cells expressed higher levels of CD27, FasL, B7H1, CD69, and particularly higher level of membrane-bound TGF-β1 (mTGF-β1), but produced less IFN-γ, IL-4, IL-10 and TGF-β1. Hepatic CD11b(+) iNKT cells suppressed antigen-nonspecific and OVA-specific CD4 and CD8 T cell proliferation through mTGF-β1 both in vitro and in vivo, meanwhile, they did not interfere with activation of CD4 T cells and cytotoxicity of the activated CD8 T cells. Thus, we have identified a new subset of pathogen-expanded CD11b(+) invariant NKT cells which can feedback inhibit T cell response through cell-to-cell contact via cell surface (membrane-bound) TGF-β1, especially at the late stage of immune response against infection. CD11b(+) regulatory iNKT cells may contribute to protect host from pathological injure by preventing immune overactivation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Chemosensing in microorganisms to practical biosensors

    OpenAIRE

    Ghosh, Surya K.; Kundu, Tapanendu; Sain, Anirban

    2012-01-01

    Microorganisms like bacteria can sense concentration of chemo-attractants in its medium very accurately. They achieve this through interaction between the receptors on their cell surface and the chemo-attractant molecules (like sugar). But the physical processes like diffusion set some limits on the accuracy of detection which was discussed by Berg and Purcell in the late seventies. We have a re-look at their work in order to assess what insight it may offer towards making efficient, practica...

  15. EPIPOX: Immunoinformatic Characterization of the Shared T-Cell Epitome between Variola Virus and Related Pathogenic Orthopoxviruses

    Directory of Open Access Journals (Sweden)

    Magdalena Molero-Abraham

    2015-01-01

    developing new and safer smallpox vaccines. Variola virus genomes are now widely available, allowing computational characterization of the entire T-cell epitome and the use of such information to develop safe and yet effective vaccines. To this end, we identified 124 proteins shared between various species of pathogenic orthopoxviruses including variola minor and major, monkeypox, cowpox, and vaccinia viruses, and we targeted them for T-cell epitope prediction. We recognized 8,106, and 8,483 unique class I and class II MHC-restricted T-cell epitopes that are shared by all mentioned orthopoxviruses. Subsequently, we developed an immunological resource, EPIPOX, upon the predicted T-cell epitome. EPIPOX is freely available online and it has been designed to facilitate reverse vaccinology. Thus, EPIPOX includes key epitope-focused protein annotations: time point expression, presence of leader and transmembrane signals, and known location on outer membrane structures of the infective viruses. These features can be used to select specific T-cell epitopes suitable for experimental validation restricted by single MHC alleles, as combinations thereof, or by MHC supertypes.

  16. Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

    Science.gov (United States)

    Liechti, George; Kuru, Erkin; Packiam, Mathanraj; Hsu, Yen-Pang; Tekkam, Srinivas; Hall, Edward; Rittichier, Jonathan T; VanNieuwenhze, Michael; Brun, Yves V; Maurelli, Anthony T

    2016-05-01

    The peptidoglycan (PG) cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

  17. Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

    Directory of Open Access Journals (Sweden)

    George Liechti

    2016-05-01

    Full Text Available The peptidoglycan (PG cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

  18. An annotated checklist of pathogenic microorganisms associated with migratory birds

    Czech Academy of Sciences Publication Activity Database

    Hubálek, Zdeněk

    2004-01-01

    Roč. 40, č. 4 (2004), s. 639-659 ISSN 0090-3558 R&D Projects: GA ČR GA206/03/0726 Institutional research plan: CEZ:AV0Z6093917 Keywords : Arboviruses * birds * migration Subject RIV: EE - Microbiology, Virology Impact factor: 0.741, year: 2004 http://www.jwildlifedis.org/cgi/reprint/40/4/639

  19. Rapid Methods for the Laboratory Identification of Pathogenic Microorganisms.

    Science.gov (United States)

    1981-09-01

    activity will be reported elsewhere (Davidson, Doyle, Keller, in preparation). Partially purified Lens culinaris (commercial lentil), Diospyros In...Microbiol. 26:468-474. 2. Baird-Parker, A.C. 1974. Genus II. Staphylococcus Rosenbach 1884, 18 nom. - .* cons., p. 4 8 3- 4 8 9. In R.E. Buchanan...staphylococci from urinary tract isolates. 3. Clin. Microbiol. 8:435-437. 15. Kloos, W.E. 1980. Natural populations of the genus Stanhylococcus. Ann

  20. Rapid Methods for the Laboratory Identification of Pathogenic Microorganisms.

    Science.gov (United States)

    1982-09-01

    coli Hemophilus influenzae Bacillus anthracis Bacillus circulans Bacillus coagulans Bacillus cereus T Candida albicans Cryptococcus neoformans Legionel...reveree aide If neceeeary and Identify by block number) Lectins: Rapid Identification, Bacillus anthracisjCryptococcus " neoformans. Neisseria...field-type kit for the rapid identification of Bacillus anthracis. We have shown that certain lectins will selectively interact with B. anthracis

  1. [Succession of chitinolytic microorganisms in chernozem soil].

    Science.gov (United States)

    Manucharova, N A; Belova, E V; Vorob'ev, A V; Polianskaia, L M; Stepanov, A L

    2005-01-01

    The chitinolytic prokaryotic and eukaryotic microbial complex of chernozem soil has been investigated in the course of a succession initiated by the introduction of chitin and humidification. The dynamics of the cell numbers of chitinolytic microorganisms and of their biomass was assessed by fluorescent microscopy and by inoculation of selective media. Emission of carbon dioxide and nitrous oxide, as well as dinitrogen fixation, was assessed by gas chromatography. It was found that, when the succession was initiated by the introduction of both chitin and humidification, it resulted in greater cell numbers and biomass of chitinolytic microorganisms and higher levels of CO2 and N2O emission and of nitrogen fixation than when the succession was initiated by humidification alone. As compared to the control samples, a significant (twofold) increase in the prokaryote cell number and biomass was found on the fourth day of the succession initiated by humidification and introduction of chitin. One week after the initiation of succession, the fungal biomass and length of mycelium were twice as high as those in the control samples. These results led to the conclusion that chitin utilization in chernozem soil starts during the initial stages of succession and is performed by both prokaryotic and eukaryotic microorganisms.

  2. DMPD: Signaling pathways activated by microorganisms. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17303405 Signaling pathways activated by microorganisms. Takeuchi O, Akira S. Curr ...Opin Cell Biol. 2007 Apr;19(2):185-91. Epub 2007 Feb 15. (.png) (.svg) (.html) (.csml) Show Signaling pathways activated by microorg...anisms. PubmedID 17303405 Title Signaling pathways activated by microorganisms. Auth

  3. Serine/Threonine Protein Phosphatase PstP of Mycobacterium tuberculosis Is Necessary for Accurate Cell Division and Survival of Pathogen*

    Science.gov (United States)

    Sharma, Aditya K.; Arora, Divya; Singh, Lalit K.; Gangwal, Aakriti; Sajid, Andaleeb; Molle, Virginie; Singh, Yogendra; Nandicoori, Vinay Kumar

    2016-01-01

    Protein phosphatases play vital roles in phosphorylation-mediated cellular signaling. Although there are 11 serine/threonine protein kinases in Mycobacterium tuberculosis, only one serine/threonine phosphatase, PstP, has been identified. Although PstP has been biochemically characterized and multiple in vitro substrates have been identified, its physiological role has not yet been elucidated. In this study, we have investigated the impact of PstP on cell growth and survival of the pathogen in the host. Overexpression of PstP led to elongated cells and partially compromised survival. We find that depletion of PstP is detrimental to cell survival, eventually leading to cell death. PstP depletion results in elongated multiseptate cells, suggesting a role for PstP in regulating cell division events. Complementation experiments performed with PstP deletion mutants revealed marginally compromised survival, suggesting that all of the domains, including the extracellular domain, are necessary for complete rescue. On the other hand, the catalytic activity of PstP is absolutely essential for the in vitro growth. Mice infection experiments establish a definitive role for PstP in pathogen survival within the host. Depletion of PstP from established infections causes pathogen clearance, indicating that the continued presence of PstP is necessary for pathogen survival. Taken together, our data suggest an important role for PstP in establishing and maintaining infection, possibly via the modulation of cell division events. PMID:27758870

  4. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development.

    Science.gov (United States)

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-12-10

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK) which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK) that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  5. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Directory of Open Access Journals (Sweden)

    Daniel A. Rappolee

    2012-12-01

    Full Text Available Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  6. Prevention of immunodeficiency virus induced CD4+ T-cell depletion by prior infection with a non-pathogenic virus

    International Nuclear Information System (INIS)

    TerWee, Julie A.; Carlson, Jennifer K.; Sprague, Wendy S.; Sondgeroth, Kerry S.; Shropshire, Sarah B.; Troyer, Jennifer L.; VandeWoude, Sue

    2008-01-01

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIV PCO ) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is not the primary cause of immunodeficiency. Although this approach was analogous to immunization with a modified live vaccine, correlates of immunity such as a serum-neutralizing antibody or virus-specific T-cell proliferative response were not found in protected animals. Differences in cytokine transcription profile, most notably in interferon gamma, were observed between the protected and unprotected groups. These data provide support for the importance of non-adaptive enhancement of the immune response in the prevention of CD4+ T-cell loss

  7. Conserved host response to highly pathogenic avian influenza virus infection in human cell culture, mouse and macaque model systems

    Directory of Open Access Journals (Sweden)

    McDermott Jason E

    2011-11-01

    Full Text Available Abstract Background Understanding host response to influenza virus infection will facilitate development of better diagnoses and therapeutic interventions. Several different experimental models have been used as a proxy for human infection, including cell cultures derived from human cells, mice, and non-human primates. Each of these systems has been studied extensively in isolation, but little effort has been directed toward systematically characterizing the conservation of host response on a global level beyond known immune signaling cascades. Results In the present study, we employed a multivariate modeling approach to characterize and compare the transcriptional regulatory networks between these three model systems after infection with a highly pathogenic avian influenza virus of the H5N1 subtype. Using this approach we identified functions and pathways that display similar behavior and/or regulation including the well-studied impact on the interferon response and the inflammasome. Our results also suggest a primary response role for airway epithelial cells in initiating hypercytokinemia, which is thought to contribute to the pathogenesis of H5N1 viruses. We further demonstrate that we can use a transcriptional regulatory model from the human cell culture data to make highly accurate predictions about the behavior of important components of the innate immune system in tissues from whole organisms. Conclusions This is the first demonstration of a global regulatory network modeling conserved host response between in vitro and in vivo models.

  8. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  9. Interaction of the pathogenic mold Aspergillus fumigatus with lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Nir eOsherov

    2012-09-01

    Full Text Available Aspergillus fumigatus is an opportunistic environmental mold that can cause severe allergic responses in atopic individuals and poses a life-threatening risk for severely immunocompromised patients. Infection is caused by inhalation of fungal spores (conidia into the lungs. The initial point of contact between the fungus and the host is a monolayer of lung epithelial cells. Understanding how these cells react to fungal contact is crucial to elucidating the pathobiology of Aspergillus-related disease states. The experimental systems, both in vitro and in vivo, used to study these interactions, are described. Distinction is made between bronchial and alveolar epithelial cells. The experimental findings suggest that lung epithelial cells are more than just innocent bystanders or a purely physical barrier against infection. They can be better described as an active extension of our innate immune system, operating as a surveillance mechanism that can specifically identify fungal spores and activate an offensive response to block infection. This response includes the internalization of adherent conidia and the release of cytokines, antimicrobial peptides and reactive oxygen species. In the case of allergy, lung epithelial cells can dampen an over-reactive immune response by releasing anti-inflammatory compounds such as kinurenine. This review summarizes our current knowledge regarding the interaction of A. fumigatus with lung epithelial cells. A better understanding of the interactions between A. fumigatus and lung epithelial cells has therapeutic implications, as stimulation or inhibition of the epithelial response may alter disease outcome.

  10. NK Cell-Mediated Regulation of Protective Memory Responses against Intracellular Ehrlichial Pathogens.

    Directory of Open Access Journals (Sweden)

    Samar Habib

    Full Text Available Ehrlichiae are gram-negative obligate intracellular bacteria that cause potentially fatal human monocytic ehrlichiosis. We previously showed that natural killer (NK cells play a critical role in host defense against Ehrlichia during primary infection. However, the contribution of NK cells to the memory response against Ehrlichia remains elusive. Primary infection of C57BL/6 mice with Ehrlichia muris provides long-term protection against a second challenge with the highly virulent Ixodes ovatus Ehrlichia (IOE, which ordinarily causes fatal disease in naïve mice. Here, we show that the depletion of NK cells in E. muris-primed mice abrogates the protective memory response against IOE. Approximately, 80% of NK cell-depleted E. muris-primed mice succumbed to lethal IOE infection on days 8-10 after IOE infection, similar to naïve mice infected with the same dose of IOE. The lack of a recall response in NK cell-depleted mice correlated with an increased bacterial burden, extensive liver injury, decreased frequency of Ehrlichia-specific IFN-γ-producing memory CD4+ and CD8+ T-cells, and a low titer of Ehrlichia-specific antibodies. Intraperitoneal infection of mice with E. muris resulted in the production of IL-15, IL-12, and IFN-γ as well as an expansion of activated NKG2D+ NK cells. The adoptive transfer of purified E. muris-primed hepatic and splenic NK cells into Rag2-/-Il2rg-/- recipient mice provided protective immunity against challenge with E. muris. Together, these data suggest that E. muris-induced memory-like NK cells, which contribute to the protective, recall response against Ehrlichia.

  11. Effects of single- and multi-strain probiotics on biofilm formation and in vitro adhesion to bladder cells by urinary tract pathogens.

    Science.gov (United States)

    Chapman, C M C; Gibson, G R; Rowland, I

    2014-06-01

    There is increasing evidence that probiotic bacteria can inhibit and/or prevent urinary tract infections. Possible mechanisms include prevention of adhesion of pathogens to the bladder epithelium and inhibition of biofilm formation. Currently there is interest in the comparative efficacy of single probiotics vs. strain mixtures. We have therefore tested the inhibitory activity of four single probiotics and four probiotic mixtures towards the urinary tract pathogens Escherichia coli NCTC 9001 and Enterococcus faecalis NCTC 00775. Inhibition of biofilm formation by cell-free supernatants was tested using the Crystal Violet assay, while prevention of pathogen adhesion to host cells was tested by using bladder cancer cells as a model for the human urinary tract. Under pH-controlled conditions, there was no significant inhibition of biofilm formation by any treatment. Without pH control, 5/8 treatments significantly inhibited biofilm production by E. coli, while 5/8 treatments inhibited production by E. faecalis. Using data from all Crystal Violet assays, there was no significant difference in the ability of single- and multi-strain probiotics to inhibit biofilm formation. In the cell culture assays, all treatments were able to significantly reduce numbers of pathogenic cells adhering to host cells by 2.5-3.5 logs. No significant difference was observed between the displacement caused by single strains and mixtures for either pathogen. Inhibition of biofilm seems to be a major mechanism of urinary tract pathogen exclusion, related to, and possibly dependent upon, the probiotic ability to reduce environmental pH. Exclusion via competition of binding sites is a possible in vivo mechanism for these probiotics. If an additive or synergistic effect exists between strains within a mixture, it does not manifest itself in a greater effect through these two inhibitory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Host-pathogen interactions in bovine mammary epithelial cells and HeLa cells by Staphylococcus aureus isolated from subclinical bovine mastitis.

    Science.gov (United States)

    Castilho, Ivana G; Dantas, Stéfani Thais Alves; Langoni, Hélio; Araújo, João P; Fernandes, Ary; Alvarenga, Fernanda C L; Maia, Leandro; Cagnini, Didier Q; Rall, Vera L M

    2017-08-01

    Staphylococcus aureus is a common pathogen that causes subclinical bovine mastitis due to several virulence factors. In this study, we analyzed S. aureus isolates collected from the milk of cows with subclinical mastitis that had 8 possible combinations of bap, icaA, and icaD genes, to determine their capacity to produce biofilm on biotic (bovine primary mammary epithelial cells and HeLa cells) and abiotic (polystyrene microplates) surfaces, and their ability to adhere to and invade these cells. We also characterized isolates for microbial surface components recognizing adhesive matrix molecules (MSCRAMM) and agr genes, and for their susceptibility to cefquinome sulfate in the presence of biofilm. All isolates adhered to and invaded both cell types, but invasion indexes were higher in bovine primary mammary epithelial cells. Using tryptic soy broth + 1% glucose on abiotic surfaces, 5 out of 8 isolates were biofilm producers, but only the bap + icaA + icaD + isolate was positive in Dulbecco's Modified Eagle's medium. The production of biofilm on biotic surfaces occurred only with this isolate and only on HeLa cells, because the invasion index for bovine primary mammary epithelial cells was too high, making it impossible to use these cells in this assay. Of the 5 biofilm producers in tryptic soy broth + 1% glucose, 4 presented with the bap/fnbA/clfA/clfB/eno/fib/ebpS combination, and all were protected from cefquinome sulfate. We found no predominance of any agr group. The high invasive potential of S. aureus made it impossible to observe biofilm in bovine primary mammary epithelial cells, and we concluded that cells with lower invasion rates, such as HeLa cells, were more appropriate for this assay. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Directory of Open Access Journals (Sweden)

    Andrew S Brown

    2016-06-01

    Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  14. Proangiogenic hematopoietic cells of monocytic origin: roles in vascular regeneration and pathogenic processes of systemic sclerosis.

    Science.gov (United States)

    Yamaguchi, Yukie; Kuwana, Masataka

    2013-02-01

    New blood vessel formation is critical, not only for organ development and tissue regeneration, but also for various pathologic processes, such as tumor development and vasculopathy. The maintenance of the postnatal vascular system requires constant remodeling, which occurs through angiogenesis, vasculogenesis, and arteriogenesis. Vasculogenesis is mediated by the de novo differentiation of mature endothelial cells from endothelial progenitor cells (EPCs). Early studies provided evidence that bone marrow-derived CD14⁺ monocytes can serve as a subset of EPCs because of their expression of endothelial markers and ability to promote neovascularization in vitro and in vivo. However, the current consensus is that monocytic cells do not give rise to endothelial cells in vivo, but function as support cells, by promoting vascular formation and repair through their immediate recruitment to the site of vascular injury, secretion of proangiogenic factors, and differentiation into mural cells. These monocytes that function in a supporting role in vascular repair are now termed monocytic pro-angiogenic hematopoietic cells (PHCs). Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by excessive fibrosis and microvasculopathy, along with poor vascular formation and repair. We recently showed that in patients with SSc, circulating monocytic PHCs increase dramatically and have enhanced angiogenic potency. These effects may be induced in response to defective vascular repair machinery. Since CD14⁺ monocytes can also differentiate into fibroblast-like cells that produce extracellular matrix proteins, here we propose a new hypothesis that aberrant monocytic PHCs, once mobilized into circulation, may also contribute to the fibrotic process of SSc.

  15. Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2010-10-01

    1990. Hen egg white lysozyme expressed in, and secreted from, Aspergillus niger is correctly processed and folded. Biotechnology (New York) 8:741–745. 7...in bunyavirus-infected cells. J. Virol. 41:643–648. 18. Garry, C. E., and R. F. Garry. 2004. Proteomics computational analyses suggest that the...2005). Proteomic identification of proteins conjugated to ISG15 in mouse and human cells. Biochem. Biophys. Res. Commun. 336, 496–506. Haas, A.L

  16. CD8 T cell memory to a viral pathogen requires trans cosignaling between HVEM and BTLA.

    Directory of Open Access Journals (Sweden)

    Rachel Flynn

    Full Text Available Defining the molecular interactions required to program activated CD8 T cells to survive and become memory cells may allow us to understand how to augment anti-viral immunity. HVEM (herpes virus entry mediator is a member of the tumor necrosis factor receptor (TNFR family that interacts with ligands in the TNF family, LIGHT and Lymphotoxin-α, and in the Ig family, B and T lymphocyte attenuator (BTLA and CD160. The Ig family members initiate inhibitory signaling when engaged with HVEM, but may also activate survival gene expression. Using a model of vaccinia virus infection, we made the unexpected finding that deficiency in HVEM or BTLA profoundly impaired effector CD8 T cell survival and development of protective immune memory. Mixed adoptive transfer experiments indicated that BTLA expressed in CD8α+ dendritic cells functions as a trans-activating ligand that delivers positive co-signals through HVEM expressed in T cells. Our data demonstrate a critical role of HVEM-BTLA bidirectional cosignaling system in antiviral defenses by driving the differentiation of memory CD8 T cells.

  17. Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens

    NARCIS (Netherlands)

    Kemmeren JM; Mangen MJJ; Duynhoven YTHP van; Havelaar AH; MGB

    2006-01-01

    Toxoplasmosis causes the highest disease burden among seven evaluated foodborne pathogens. This is the preliminary conclusion of a major study of the disease burden and related costs of foodborne pathogens. The other micro-organisms that were studied are Campylobacter spp., Salmonella spp.,

  18. Taxonomy of Probiotic Microorganisms

    Science.gov (United States)

    Felis, Giovanna E.; Dellaglio, Franco; Torriani, Sandra

    When referring to probiotics, one refers to probiotic strains, i.e., the microbial individuals, sub-cultures of billion of almost identical cells ideally derived from the same mother cell. Therefore, beneficial effects attributed to probiotics are ascribed in fact to specific strains. However, these strains have to be, by law, clearly identified at the species level (Pineiro and Stanton, 2007). In fact, probiotics have to be safe for consumption, and the evaluation of QPS - qualified presumption of safety - status by the European Food Safety Authority (EFSA) (Opinion, 2007) is discussed for species, not for single strains.

  19. Use of Probiotic Microorganisms for Bio-Protective Aims

    Directory of Open Access Journals (Sweden)

    Filiz YANGILAR

    2015-03-01

    Full Text Available It was known that some diseases can be treated as the result of the use of antibiotics in certain periods and at certain dosages while inactivating and deteriorating normal microorganisms performing useful activities in human metabolism (in especially intestinal flora. It was occured that after the use of antibiotics, some defects can be seen resulting from antibiotics (such as allergy, diarrhea, gas formation etc. With this aim, nutraceutics and functional food have gained importance over the last years and consumers began to be interested in probiotics, natural antioxidants, dietary fibres, products with low calorie and cholesterol contents, especially the products containing probioticbacteria. Bacteriocins produced by probiotic bacteria can play important roles as food protective and safeguarding since they can compete with unwanted or pathogen microorganisms survive in the media and colonize in intestines. In this review, is aimed to emphasis bioprotective compounds, advantages and disadvantages of biopreservation method and the importance of the mechanisms of probiotic microorganisms.

  20. Cell wall carbohydrates content of pathogenic Candida albicans strain morphological forms.

    Science.gov (United States)

    Staniszewska, Monika; Bondaryk, Małgorzata; Rabczenko, Daniel; Smoleńska-Sym, Gabriela; Kurzatkowski, Wiesław

    2013-01-01

    The study evaluated the cell wall carbohydrates fraction in blastoconidia grown in YEPD medium at 30 degrees C and in the conglomerate of true hyphae grown in human serum at 37 degrees C. The clinical isolate obtained from a child with widespread C. albicans infection was used in the study. The cells were broken with glass beads, centrifuged to harvest the cell wall followed by subjection to TFA hydrolysis and in the result of that released monosaccharides were detected by HPAEC-PAD. Both, serum and temperature conditions (37 degrees C) affected germination process influencing the cell wall carbohydrates content when incubation in serum was prolonged from 1 to 18 h. The mannan content of blastoconidia was almost twofold higher compared to filamentous forms (149.25 +/- 299.24 vs 77.26 +/- 122.07). The glucan content was threefold lower in blastoconidia compared to hyphae (251.86 +/- 243.44 vs 755.81 +/- 1299.30). The chitin level was fourfold lower in blastoconidia compared to filaments (23.86 +/- 54.09 vs 106.29 +/- 170.12). The reason for the differences in the carbohydrates content may be related to type of morphology induced in different environmental conditions. Among tested carbohydrates, glucan appeared to be present in appreciably larger amounts in both tested morphological fractions. The ultrastructure of the blastoconidial cell wall revealed striking differences compared to the hyphae indicating the carbohydrates content alterations for wall assembly during hyphal growth at alkaline pH and temp. 37 degrees C. The study provided evidence for the relationship between morphogenesis, cell-cell adhesion induced by serum and changes in the level of carbohydrates content.

  1. CCR6+ Th cells in the cerebrospinal fluid of persons with multiple sclerosis are dominated by pathogenic non-classic Th1 cells and GM-CSF-only-secreting Th cells.

    Science.gov (United States)

    Restorick, S M; Durant, L; Kalra, S; Hassan-Smith, G; Rathbone, E; Douglas, M R; Curnow, S J

    2017-08-01

    Considerable attention has been given to CCR6 + IL-17-secreting CD4 + T cells (Th17) in the pathology of a number of autoimmune diseases including multiple sclerosis (MS). However, other Th subsets also play important pathogenic roles, including those that secrete IFNγ and GM-CSF. CCR6 expression by Th17 cells allows their migration across the choroid plexus into the cerebrospinal fluid (CSF), where they are involved in the early phase of experimental autoimmune encephalomyelitis (EAE), and in MS these cells are elevated in the CSF during relapses and contain high frequencies of autoreactive cells. However, the relatively low frequency of Th17 cells suggests they cannot by themselves account for the high percentage of CCR6 + cells in MS CSF. Here we identify the dominant CCR6 + T cell subsets in both the blood and CSF as non-classic Th1 cells, including many that secrete GM-CSF, a key encephalitogenic cytokine. In addition, we show that Th cells secreting GM-CSF but not IFNγ or IL-17, a subset termed GM-CSF-only-secreting Th cells, also accumulate in the CSF. Importantly, in MS the proportion of IFNγ- and GM-CSF-secreting T cells expressing CCR6 was significantly enriched in the CSF, and was elevated in MS, suggesting these cells play a pathogenic role in this disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Identification of periodontopathogen microorganisms by PCR technique

    Directory of Open Access Journals (Sweden)

    Milićević Radovan

    2008-01-01

    Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

  3. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    Energy Technology Data Exchange (ETDEWEB)

    Ramadan, Qasem, E-mail: qasem.alramadan@epfl.ch [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore); Christophe, Lay; Teo, William; ShuJun, Li; Hua, Feng Han [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore)

    2010-07-12

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  4. Antibiotic cytotoxic effects of microorganisms isolated from Jachymov uranium mines

    International Nuclear Information System (INIS)

    Fuska, J.; Fuskova, A.

    1982-01-01

    Microorganisms were isolated from old relinquished uranium mines in Jachymov; they had been growing for several decades in darkness in temperatures of 5 to 12 degC and relative humidity from 80 to 100%. The concentration of uranium salts in mine waters varied from 10 -4 to 10 -5 g.l -1 , that of Rn in the atmosphere was from 0.04 to 40 Bq.l -1 . Of 324 cultures, 18.8% inhibited the growth of Bacillus subtilis, Escherichia coli and Candida pseudotropicalis and 16.6% that of HeLa cells. The frequency of microorganisms inhibiting the growth of HeLa or Ehrlich ascites cells was markedly higher in this set of cultures than among microorganisms kept in culture collections or isolated from other natural habitats. About 10% of the isolated cultures were mycelia sterilia. The following antibiotics were isolated from microorganisms obtained from uranium mines: frequentin, vermiculin, vermicillin, vermistatin, cytostipin and duclauxin. (author)

  5. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  6. Method for treating wastewater using microorganisms and vascular aquatic plants

    Science.gov (United States)

    Wolverton, B. C. (Inventor)

    1983-01-01

    A method for treating wastewater compresses subjecting the wastewater to an anaerobic setting step for at least 6 hours and passing the liquid effluent from the anaerobic settling step through a filter cell in an upflow manner. There the effluent is subjected first to the action of anaerobic and facultative microorganisms, and then to the action of aerobic microorganisms and the roots of at least one vascular aquatic plant.

  7. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2014-01-01

    Mucosal-associated invariant T (MAIT) cells express a semi-invariant T cell receptor (TCR) that detects microbial metabolites presented by the nonpolymorphic major histocompatibility complex (MHC)-like molecule MR1. The highly conserved nature of MR1 in conjunction with biased MAIT TCRα chain usa...

  8. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  9. Hypersensitive cell death in plants : its mechanisms and role in plant defense against pathogens

    NARCIS (Netherlands)

    Iakimova, E.T.; Michalczuk, L.; Woltering, E.J.

    2005-01-01

    This review is a recent update in the understanding of the hypersensitive response (HR) of plants with special consideration to the physiological and biochemical determinants in different model systems. Hypersensitive response is reviewed as a form of programmed cell death (PCD) representing one of

  10. AMPK in Pathogens.

    Science.gov (United States)

    Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

    2016-01-01

    During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

  11. Communication between filamentous pathogens and plants at the biotrophic interface.

    Science.gov (United States)

    Yi, Mihwa; Valent, Barbara

    2013-01-01

    Fungi and oomycetes that colonize living plant tissue form extensive interfaces with plant cells in which the cytoplasm of the microorganism is closely aligned with the host cytoplasm for an extended distance. In all cases, specialized biotrophic hyphae function to hijack host cellular processes across an interfacial zone consisting of a hyphal plasma membrane, a specialized interfacial matrix, and a plant-derived membrane. The interface is the site of active secretion by both players. This cross talk at the interface determines the winner in adversarial relationships and establishes the partnership in mutualistic relationships. Fungi and oomycetes secrete many specialized effector proteins for controlling the host, and they can stimulate remarkable cellular reorganization even in distant plant cells. Breakthroughs in live-cell imaging of fungal and oomycete encounter sites, including live-cell imaging of pathogens secreting fluorescently labeled effector proteins, have led to recent progress in understanding communication across the interface.

  12. Lactobacillus delbrueckii ssp. bulgaricus B-30892 can inhibit cytotoxic effects and adhesion of pathogenic Clostridium difficile to Caco-2 cells

    Directory of Open Access Journals (Sweden)

    Banerjee Pratik

    2009-04-01

    Full Text Available Abstract Background Probiotic microorganisms are receiving increasing interest for use in the prevention, treatment, or dietary management of certain diseases, including antibiotic-associated diarrhea (AAD. Clostridium difficile is the most common cause of AAD and the resulting C. difficile – mediated infection (CDI, is potentially deadly. C. difficile associated diarrhea (CDAD is manifested by severe inflammation and colitis, mostly due to the release of two exotoxins by C. difficile causing destruction of epithelial cells in the intestine. The aim of this study was to determine the effect of probiotic bacteria Lactobacillus delbrueckii ssp. bulgaricus B-30892 (LDB B-30892 on C. difficile-mediated cytotoxicity using Caco-2 cells as a model. Methods Experiments were carried out to test if the cytotoxicity induced by C. difficile-conditioned-medium on Caco-2 cells can be altered by cell-free supernatant (CFS from LDB B-30892 in different dilutions (1:2 to 1:2048. In a similar experimental setup, comparative evaluations of other probiotic strains were made by contrasting the results from these strains with the results from LDB B-30892, specifically the ability to affect C. difficile induced cytotoxicity on Caco-2 monolayers. Adhesion assays followed by quantitative analysis by Giemsa staining were conducted to test if the CFSs from LDB B-30892 and other probiotic test strains have the capability to alter the adhesion of C. difficile to the Caco-2 monolayer. Experiments were also performed to evaluate if LDB B-30892 or its released components have any bactericidal effect on C. difficile. Results and discussion Co-culturing of LDB B-30892 with C. difficile inhibited the C. difficile-mediated cytotoxicity on Caco-2 cells. When CFS from LDB B-30892-C. difficile co-culture was administered (up to a dilution of 1:16 on Caco-2 monolayer, there were no signs of cytotoxicity. When CFS from separately grown LDB B-30892 was mixed with the cell-free toxin

  13. Lactobacillus delbrueckii ssp. bulgaricus B-30892 can inhibit cytotoxic effects and adhesion of pathogenic Clostridium difficile to Caco-2 cells

    Science.gov (United States)

    Banerjee, Pratik; Merkel, Glenn J; Bhunia, Arun K

    2009-01-01

    Background Probiotic microorganisms are receiving increasing interest for use in the prevention, treatment, or dietary management of certain diseases, including antibiotic-associated diarrhea (AAD). Clostridium difficile is the most common cause of AAD and the resulting C. difficile – mediated infection (CDI), is potentially deadly. C. difficile associated diarrhea (CDAD) is manifested by severe inflammation and colitis, mostly due to the release of two exotoxins by C. difficile causing destruction of epithelial cells in the intestine. The aim of this study was to determine the effect of probiotic bacteria Lactobacillus delbrueckii ssp. bulgaricus B-30892 (LDB B-30892) on C. difficile-mediated cytotoxicity using Caco-2 cells as a model. Methods Experiments were carried out to test if the cytotoxicity induced by C. difficile-conditioned-medium on Caco-2 cells can be altered by cell-free supernatant (CFS) from LDB B-30892 in different dilutions (1:2 to 1:2048). In a similar experimental setup, comparative evaluations of other probiotic strains were made by contrasting the results from these strains with the results from LDB B-30892, specifically the ability to affect C. difficile induced cytotoxicity on Caco-2 monolayers. Adhesion assays followed by quantitative analysis by Giemsa staining were conducted to test if the CFSs from LDB B-30892 and other probiotic test strains have the capability to alter the adhesion of C. difficile to the Caco-2 monolayer. Experiments were also performed to evaluate if LDB B-30892 or its released components have any bactericidal effect on C. difficile. Results and discussion Co-culturing of LDB B-30892 with C. difficile inhibited the C. difficile-mediated cytotoxicity on Caco-2 cells. When CFS from LDB B-30892-C. difficile co-culture was administered (up to a dilution of 1:16) on Caco-2 monolayer, there were no signs of cytotoxicity. When CFS from separately grown LDB B-30892 was mixed with the cell-free toxin preparation (CFT) of

  14. Nucleic acid probes in the diagnosis of human microbial pathogens

    International Nuclear Information System (INIS)

    Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

    1989-01-01

    The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

  15. An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

    Directory of Open Access Journals (Sweden)

    WANG Hua-cheng

    2013-02-01

    Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

  16. Molecular subtypes of diffuse large B cell lymphoma are associated with distinct pathogenic mechanisms and outcomes.

    Science.gov (United States)

    Chapuy, Bjoern; Stewart, Chip; Dunford, Andrew J; Kim, Jaegil; Kamburov, Atanas; Redd, Robert A; Lawrence, Mike S; Roemer, Margaretha G M; Li, Amy J; Ziepert, Marita; Staiger, Annette M; Wala, Jeremiah A; Ducar, Matthew D; Leshchiner, Ignaty; Rheinbay, Ester; Taylor-Weiner, Amaro; Coughlin, Caroline A; Hess, Julian M; Pedamallu, Chandra S; Livitz, Dimitri; Rosebrock, Daniel; Rosenberg, Mara; Tracy, Adam A; Horn, Heike; van Hummelen, Paul; Feldman, Andrew L; Link, Brian K; Novak, Anne J; Cerhan, James R; Habermann, Thomas M; Siebert, Reiner; Rosenwald, Andreas; Thorner, Aaron R; Meyerson, Matthew L; Golub, Todd R; Beroukhim, Rameen; Wulf, Gerald G; Ott, German; Rodig, Scott J; Monti, Stefano; Neuberg, Donna S; Loeffler, Markus; Pfreundschuh, Michael; Trümper, Lorenz; Getz, Gad; Shipp, Margaret A

    2018-04-30

    Diffuse large B cell lymphoma (DLBCL), the most common lymphoid malignancy in adults, is a clinically and genetically heterogeneous disease that is further classified into transcriptionally defined activated B cell (ABC) and germinal center B cell (GCB) subtypes. We carried out a comprehensive genetic analysis of 304 primary DLBCLs and identified low-frequency alterations, captured recurrent mutations, somatic copy number alterations, and structural variants, and defined coordinate signatures in patients with available outcome data. We integrated these genetic drivers using consensus clustering and identified five robust DLBCL subsets, including a previously unrecognized group of low-risk ABC-DLBCLs of extrafollicular/marginal zone origin; two distinct subsets of GCB-DLBCLs with different outcomes and targetable alterations; and an ABC/GCB-independent group with biallelic inactivation of TP53, CDKN2A loss, and associated genomic instability. The genetic features of the newly characterized subsets, their mutational signatures, and the temporal ordering of identified alterations provide new insights into DLBCL pathogenesis. The coordinate genetic signatures also predict outcome independent of the clinical International Prognostic Index and suggest new combination treatment strategies. More broadly, our results provide a roadmap for an actionable DLBCL classification.

  17. Cell penetrating peptides to dissect host-pathogen protein-protein interactions in Theileria -transformed leukocytes

    KAUST Repository

    Haidar, Malak

    2017-09-08

    One powerful application of cell penetrating peptides is the delivery into cells of molecules that function as specific competitors or inhibitors of protein-protein interactions. Ablating defined protein-protein interactions is a refined way to explore their contribution to a particular cellular phenotype in a given disease context. Cell-penetrating peptides can be synthetically constrained through various chemical modifications that stabilize a given structural fold with the potential to improve competitive binding to specific targets. Theileria-transformed leukocytes display high PKA activity, but PKAis an enzyme that plays key roles in multiple cellular processes; consequently genetic ablation of kinase activity gives rise to a myriad of confounding phenotypes. By contrast, ablation of a specific kinase-substrate interaction has the potential to give more refined information and we illustrate this here by describing how surgically ablating PKA interactions with BAD gives precise information on the type of glycolysis performed by Theileria-transformed leukocytes. In addition, we provide two other examples of how ablating specific protein-protein interactions in Theileria-infected leukocytes leads to precise phenotypes and argue that constrained penetrating peptides have great therapeutic potential to combat infectious diseases in general.

  18. Knowledge to Predict Pathogens: Legionella pneumophila Lifecycle Critical Review Part I Uptake into Host Cells

    Directory of Open Access Journals (Sweden)

    Alexis L. Mraz

    2018-01-01

    Full Text Available Legionella pneumophila (L. pneumophila is an infectious disease agent of increasing concern due to its ability to cause Legionnaires’ Disease, a severe community pneumonia, and the difficulty in controlling it within water systems. L. pneumophila thrives within the biofilm of premise plumbing systems, utilizing protozoan hosts for protection from disinfectants and other environmental stressors. While there is a great deal of information regarding how L. pneumophila interacts with protozoa and human macrophages (host for human infection, the ability to use this data in a model to attempt to predict a concentration of L. pneumophila in a water system is not known. The lifecycle of L. pneumophila within host cells involves three processes: uptake, growth, and egression from the host cell. The complexity of these three processes would risk conflation of the concepts; therefore, this review details the available information regarding how L. pneumophila invades host cells (uptake within the context of data needed to model this process, while a second review will focus on growth and egression. The overall intent of both reviews is to detail how the steps in L. pneumophila’s lifecycle in drinking water systems affect human infectivity, as opposed to detailing just its growth and persistence in drinking water systems.

  19. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Science.gov (United States)

    Reolon, Luciano Antonio; Martello, Carolina Lumertz; Schrank, Irene Silveira; Ferreira, Henrique Bunselmeyer

    2014-01-01

    The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae), the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  20. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Directory of Open Access Journals (Sweden)

    Luciano Antonio Reolon

    Full Text Available The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae, the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  1. Mycoplasma suis infection results endothelial cell damage and activation: new insight into the cell tropism and pathogenicity of hemotrophic mycoplasma

    Directory of Open Access Journals (Sweden)

    Sokoli Albina

    2013-02-01

    Full Text Available Abstract Hemotrophic mycoplasmas (HM are highly specialized red blood cell parasites that cause infectious anemia in a variety of mammals, including humans. To date, no in vitro cultivation systems for HM have been available, resulting in relatively little information about the pathogenesis of HM infection. In pigs, Mycoplasma suis-induced infectious anemia is associated with hemorrhagic diathesis, and coagulation dysfunction. However, intravasal coagulation and subsequent consumption coagulopathy can only partly explain the sequence of events leading to hemorrhagic diathesis manifesting as cyanosis, petechial bleeding, and ecchymosis, and to disseminated coagulation. The involvement of endothelial activation and damage in M. suis-associated pathogenesis was investigated using light and electron microscopy, immunohistochemistry, and cell sorting. M. suis interacted directly with endothelial cells in vitro and in vivo. Endothelial activation, widespread endothelial damage, and adherence of red blood cells to the endothelium were evident in M. suis-infected pigs. These alterations of the endothelium were accompanied by hemorrhage, intravascular coagulation, vascular occlusion, and massive morphological changes within the parenchyma. M. suis biofilm-like microcolonies formed on the surface of endothelial cells, and may represent a putative persistence mechanism of M. suis. In vitro analysis demonstrated that M. suis interacted with the endothelial cytoskeletal protein actin, and induced actin condensation and activation of endothelial cells, as determined by the up-regulation of ICAM, PECAM, E-selectin, and P-selectin. These findings demonstrate an additional cell tropism of HM for endothelial cells and suggest that M. suis interferes with the protective function of the endothelium, resulting in hemorrhagic diathesis.

  2. Pathogen inactivation techniques.

    Science.gov (United States)

    Pelletier, J P R; Transue, S; Snyder, E L

    2006-01-01

    The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

  3. Caspase dependent programmed cell death in developing embryos: a potential target for therapeutic intervention against pathogenic nematodes.

    Directory of Open Access Journals (Sweden)

    Alok Das Mohapatra

    2011-09-01

    Full Text Available BACKGROUND: Successful embryogenesis is a critical rate limiting step for the survival and transmission of parasitic worms as well as pathology mediated by them. Hence, blockage of this important process through therapeutic induction of apoptosis in their embryonic stages offers promise for developing effective anti-parasitic measures against these extra cellular parasites. However, unlike in the case of protozoan parasites, induction of apoptosis as a therapeutic approach is yet to be explored against metazoan helminth parasites. METHODOLOGY/PRINCIPAL FINDINGS: For the first time, here we developed and evaluated flow cytometry based assays to assess several conserved features of apoptosis in developing embryos of a pathogenic filarial nematode Setaria digitata, in-vitro as well as ex-vivo. We validated programmed cell death in developing embryos by using immuno-fluorescence microscopy and scoring expression profile of nematode specific proteins related to apoptosis [e.g. CED-3, CED-4 and CED-9]. Mechanistically, apoptotic death of embryonic stages was found to be a caspase dependent phenomenon mediated primarily through induction of intracellular ROS. The apoptogenicity of some pharmacological compounds viz. DEC, Chloroquine, Primaquine and Curcumin were also evaluated. Curcumin was found to be the most effective pharmacological agent followed by Primaquine while Chloroquine displayed minimal effect and DEC had no demonstrable effect. Further, demonstration of induction of apoptosis in embryonic stages by lipid peroxidation products [molecules commonly associated with inflammatory responses in filarial disease] and demonstration of in-situ apoptosis of developing embryos in adult parasites in a natural bovine model of filariasis have offered a framework to understand anti-fecundity host immunity operational against parasitic helminths. CONCLUSIONS/SIGNIFICANCE: Our observations have revealed for the first time, that induction of apoptosis in

  4. Wall ingrowth deposition in phloem parenchyma transfer cells in Arabidopsis: Heteroblastic variations and a potential role in pathogen defence.

    Science.gov (United States)

    Nguyen, Suong T T; McCurdy, David W

    2017-06-03

    Transfer cell (TCs) develop unique wall ingrowth networks which amplify plasma membrane surface area and thus maximize nutrient transporter density at key anatomic sites for nutrient exchange within plants and their external environment. These sites fall into 4 main groups corresponding to 4 categories of trans-membrane flux: absorption/secretion of solutes from or to the external environment, and absorption/secretion of solutes from or to internal, extra-cytoplasmic compartments. Research on TC biology over recent decades has demonstrated correlations between wall ingrowth deposition in TCs and enhanced transport capacity in many major agricultural species such as pea, fava bean, cotton and maize. Consequently, there is general consensus that the existence of wall ingrowth morphology implies an augmentation in membrane transport capacity. However, this may not be entirely applicable for phloem parenchyma (PP) TCs in Arabidopsis. Our recent survey of PP TC abundance and distribution in Arabidopsis veins indicated that PP TC development reflects heteroblastic status. A consequence of this observation is the suggestion that PP TCs, or at least wall ingrowth deposition in these cells, potentially act as a physical barrier to defend access of invading pathogens to sugar-rich sieve elements rather than solely in facilitating the export of photoassimilate from collection phloem in leaves.

  5. Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

    Science.gov (United States)

    Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

    2018-03-25

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  6. Colony variation of Helicobacter pylori: pathogenic potential is correlated to cell wall lipid composition.

    Science.gov (United States)

    Bukholm, G; Tannaes, T; Nedenskov, P; Esbensen, Y; Grav, H J; Hovig, T; Ariansen, S; Guldvog, I

    1997-05-01

    Differences in expression of disease after infection with Helicobacter pylori have so far been connected with host factors and bacterial interstrain variation. In this study, spontaneous and ecology-mediated intrastrain variation was examined. Four clinical isolates of H. pylori were shown to give rise to two colony forms. Bacterial morphology was examined by electron microscopy. Bacterial fractions were examined for proteins using ion exchange chromatography and SDS-PAGE; for lipids using thin-layer chromatography, lipid anion-exchange chromatography, column chromatography on silica gel, 31P-NMR, gas chromatography and mass spectrometry. Bacterial in vitro invasiveness and adhesiveness were examined in two different systems, and urease and VacA toxin were assayed by Western blot analysis. H. pylori was shown to give rise to two colony forms: at normal pH the population was dominated by L colonies. One strain was chosen for further studies. Bacteria from L colonies retained VacA toxin and urease, did not invade or adhere to epithelial cells, and contained normal quantities of phosphatidylethanolamine. In a small frequency, spontaneous S colonies were formed. Bacteria from these colonies released VacA and urease, adhered to and invaded epithelial cells and contained increased amounts of lysophosphatidyl ethanolamine and phosphatidyl serine. After addition of HCl to the culture medium (pH6), almost only S colonies were formed. The results demonstrate that environmental factors, such as HCl, can change the bacterial cell wall, and thereby enhance expression of virulence factors of H. pylori in vitro. A similar in vivo variation would have implications for our understanding of the interaction between HCl secretion in the gastric mucosa and H. pylori in the development of peptic ulcer disease.

  7. Understanding the behavior of foodborne pathogens in the food chain

    DEFF Research Database (Denmark)

    Rantsiou, Kalliopi; Mataragas, Marios; Jespersen, Lene

    2011-01-01

    In recent years and with the significant advancements in instrumentation for molecular biology methods, the focus of food microbiologists, dealing with pathogenic microorganisms in foods, is shifting. Scientists specifically aim at elucidating the effect that the food composition, as well...

  8. Proteomic Analysis of Pathogenic Fungi Reveals Highly Expressed Conserved Cell Wall Proteins

    Directory of Open Access Journals (Sweden)

    Jackson Champer

    2016-01-01

    Full Text Available We are presenting a quantitative proteomics tally of the most commonly expressed conserved fungal proteins of the cytosol, the cell wall, and the secretome. It was our goal to identify fungi-typical proteins that do not share significant homology with human proteins. Such fungal proteins are of interest to the development of vaccines or drug targets. Protein samples were derived from 13 fungal species, cultured in rich or in minimal media; these included clinical isolates of Aspergillus, Candida, Mucor, Cryptococcus, and Coccidioides species. Proteomes were analyzed by quantitative MSE (Mass Spectrometry—Elevated Collision Energy. Several thousand proteins were identified and quantified in total across all fractions and culture conditions. The 42 most abundant proteins identified in fungal cell walls or supernatants shared no to very little homology with human proteins. In contrast, all but five of the 50 most abundant cytosolic proteins had human homologs with sequence identity averaging 59%. Proteomic comparisons of the secreted or surface localized fungal proteins highlighted conserved homologs of the Aspergillus fumigatus proteins 1,3-β-glucanosyltransferases (Bgt1, Gel1-4, Crf1, Ecm33, EglC, and others. The fact that Crf1 and Gel1 were previously shown to be promising vaccine candidates, underlines the value of the proteomics data presented here.

  9. Tofacitinib attenuates arthritis manifestations and reduces the pathogenic CD4 T cells in adjuvant arthritis rats.

    Science.gov (United States)

    Gertel, Smadar; Mahagna, Hussein; Karmon, Gidi; Watad, Abdulla; Amital, Howard

    2017-11-01

    Rheumatoid arthritis (RA) is an autoimmune disease characterized by pronounced inflammation and leukocyte infiltration in affected joints. Tofacitinib is new agent, a selective inhibitor of Janus kinase (JAK) signaling pathways mediated by JAK1 and JAK3 and inhibits the key transcription factors STAT1 and STAT3. We investigated the action mechanisms of tofacitinib in rats with adjuvant-induced-arthritis (AIA). AIA-rats were treated orally with tofacitinib or with methotrexate. Arthritis severity and serum C-reactive protein (CRP) levels were evaluated, splenic cells were examined by flow cytometry and cytokines were analyzed by real-time PCR. Tofacitinib markedly reduced the clinical status of treated rats in comparison to control group. Reduced joints inflammation and down-regulated serum CRP levels reflected the clinical manifestations of the treated rats. Tofacitinib down-regulated significantly the frequency of CD4 + IFN-γ + T cells and reduced IL-1β mRNA expression levels in the spleen of the treated rats. These results show that tofacitinib attenuated arthritis severity, modified splenic populations and cytokine imbalance. Copyright © 2017. Published by Elsevier Inc.

  10. Land application of sewage sludge: Pathogen issues

    International Nuclear Information System (INIS)

    Chang, A.C.

    1997-01-01

    Diseases transmitted via the faecal-oral exposure route cause severe gastroenteric disorders, and large numbers of causative organisms are discharged with the faecal matter of infected individuals. For this reason, pathogenic bacteria, viruses, protozoa, or helminths, are always found in sewage sludge. If not properly treated for use in agriculture, sludge can be a source of pathogenic contamination. Radiation is an attractive method to reduce the numbers of microorganisms in sewage sludge. Routine examination for pathogens is not practised nor recommended because complicated and costly procedures are involved. Instead, an indicator organism is usually assayed and enumerated. In this paper, methods are discussed for the investigation of pathogens in sewage sludge. (author)

  11. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  12. Test characteristics of milk amyloid A ELISA, somatic cell count, and bacteriological culture for detection of intramammary pathogens that cause subclinical mastitis.

    Science.gov (United States)

    Jaeger, S; Virchow, F; Torgerson, P R; Bischoff, M; Biner, B; Hartnack, S; Rüegg, S R

    2017-09-01

    Bovine mastitis is an important disease in the dairy industry, causing economic losses as a result of withheld milk and treatment costs. Several studies have suggested milk amyloid A (MAA) as a promising biomarker in the diagnosis of mastitis. In the absence of a gold standard for diagnosis of subclinical mastitis, we estimated the diagnostic test accuracy of a commercial MAA-ELISA, somatic cell count (SCC), and bacteriological culture using Bayesian latent class modeling. We divided intramammary infections into 2 classes: those caused by major pathogens (e.g., Escherichia coli, Staphylococcus aureus, streptococci, and lacto-/enterococci) and those caused by all pathogens (major pathogens plus Corynebacterium bovis, coagulase-negative staphylococci, Bacillus spp., Streptomyces spp.). We applied the 3 diagnostic tests to all samples. Of 433 composite milk samples included in this study, 275 (63.5%) contained at least 1 colony of any bacterial species; of those, 56 contained major pathogens and 219 contained minor pathogens. The remaining 158 samples (36.5%) were sterile. We determined 2 different thresholds for the MAA-ELISA using Bayesian latent class modeling: 3.9 µg/mL to detect mastitis caused by major pathogens and 1.6 µg/mL to detect mastitis caused by all pathogens. The optimal SCC threshold for identification of subclinical mastitis was 150,000 cells/mL; this threshold led to higher specificity (Sp) than 100,000 cells/mL. Test accuracy for major-pathogen intramammary infections was as follows: SCC, sensitivity (Se) 92.6% and Sp 72.9%; MAA-ELISA, Se 81.4% and Sp 93.4%; bacteriological culture, Se 23.8% and Sp 95.2%. Test accuracy for all-pathogen intramammary infections was as follows: SCC, sensitivity 90.3% and Sp 71.8%; MAA-ELISA, Se 88.0% and Sp 65.2%; bacteriological culture, Se 83.8% and Sp 54.8%. We suggest the use of SCC and MAA-ELISA as a combined screening procedure for situations such as a Staphylococcus aureus control program. With Bayesian

  13. REMOCIÓN DE MICROORGANISMOS PATÓGENOS PRESENTES EN UN LICOR MIXTO BAJO CONDICIONES DE LABORATORIO EMPLEANDO FILTROS EMPACADOS EN ZEOLITA NATURAL REMOVAL OF PATHOGENIC MICROORGANISMS PRESENT IN MIXED LIQUOUR UNDER LABORATORY CONDITIONS BY USING FILTERS PACKED IN NATURAL ZEOLITE

    Directory of Open Access Journals (Sweden)

    Diana Rocío Acevedo Cifuentes

    2012-12-01

    conducted and zeolite matter was washed and activated at the end of each test before starting the next one. Three samples were taken in each test. It was found that efficiency of filters under specific conditions of design was significantly high when assessed pathogens were removed, and percentage of removal was independent from the concentration value at the filter entry. Besides, efficiency to remove pathogens assessed was not dependent on the type of microorganisms.

  14. MICROORGANISMS IN CONFECTIONERY PRODUCTS

    Directory of Open Access Journals (Sweden)

    Ľubomíra Juhaniaková

    2011-08-01

    Full Text Available The aim of this work was to determine microbiological quality of confectionery products. In confectionery products microbiological parameters: coliforms bacteria, microscopic filamentous fungi and yeasts, Salmonella sp. and staphylococci were observed. The confectionery products were evaluated: Kremes - honey cube, roll Arabica, roll Rona, roll stuffed with apricot cream, honey cube, pinwheel caramel, Sachovnica cut, Zora cut and curd cake. For microbiological tests 18 samples of confectionery products were used. Numbers of coliforms bacteria in confectionery products ranged from <1x101 to 4x102 cfu.g-1, the number of microscopic fungi ranged from 0 to <1x101 cfu.g-1, the number of yeasts from <1x101 to 5.5x102 cfu.g-1, cells of Salmonella sp. were not detected and the number of staphylococci was from 0 to <1x101 cfu.g-1. All investigated samples of confectionary products were in accordance with the Codex Alimentarius of the Slovak Republic.

  15. An in-vitro studies on green synthesis of gold nanoparticles against pathogens and cancer cells

    Directory of Open Access Journals (Sweden)

    V. Ramesh

    2015-11-01

    Full Text Available Nanotechnology is a most promising field for generating new applications in medicine. It is imperative to integrate nanoscience and medicine. The present investigation is highly warranted to through more light upon the gold nanoparticles reduced from gold salt through the active principle of medicinal plant. The special emphasis of investigation is the active principle along with gold nanoparticles against for cancer cells. The 70 - 90 nm sized particles were synthesized by using Diospyros ferrea and this confirmed by SEM. These gold nanoparticles showed a characteristic absorption peak at 540 nm in UV spectra. The possibility of protein as a stabilizing material in gold nanoparticles is revealed by FTIR analysis. Remarkably, as a result of wide screening on the application of newly synthesized gold nanoparticles their anticancer potential has been discovered using MTT assay. The antimicrobial activity of AuNPs showed effective against bacteria than the fungal strains.

  16. Impedance spectroscopy in biodynamics: Detection of specific cells (pathogens using immune coated electrodes

    Directory of Open Access Journals (Sweden)

    Eugen Gheorghiu

    2002-11-01

    Full Text Available We describe the theoretical and experimental approaches for monitoring the interfacial biomolecular reaction between immobilized antibody and the antigen binding partner (the analyte, or the targeted cell using Impedance Spectroscopy, IS. The key idea is to reveal the presence of the analyte by investigating the dynamics of the impedance changes at the interface between transducer and bulk during the process of antibody-antigen binding (coupling of specific compounds to sensor surface. In this work, antibody-antigen (Ab-Ag reaction was directly monitored using an impedance analyzer capable of ~ 1 measurement/second and covalent immobilization chemistry and modified electrodes in the absence of a redox probe. The proposed approach may be applicable to monitoring other surface interfacial reactions such as protein-protein interactions, DNA-DNA interactions, DNA-protein interactions and DNA-small molecule interactions.

  17. In vitro studies on oxidative stress-independent, Ag nanoparticles-induced cell toxicity of Candida albicans, an opportunistic pathogen

    Directory of Open Access Journals (Sweden)

    Radhakrishnan VS

    2018-03-01

    Full Text Available Venkatraman Srinivasan Radhakrishnan,1 Surya Prakash Dwivedi,2 Mohammed Haris Siddiqui,3 Tulika Prasad1 1Advanced Instrumentation Research Facility (AIRF, Jawaharlal Nehru University, New Delhi, 2School of Biotechnology, IFTM University, Moradabad, 3Department of Bioengineering, Integral University, Lucknow, Uttar Pradesh, India Abstract: Silver nanoparticles (AgNps have attracted maximal attention among all metal nanoparticles, and the study of their biological properties has gained impetus for further medical adoption. This study evaluated the cellular and molecular mechanisms associated with the action of AgNps against an opportunistic pathogen, Candida albicans. Spherical, stable AgNp (average size 21.6 nm prepared by a chemical reduction method showed minimum inhibitory concentration (required to inhibit the growth of 90% of organisms at 40 µg/mL. AgNps have been reported to induce oxidative stress-mediated programmed cell death through the accumulation of intracellular reactive oxygen species (ROS. However, this study demonstrated that intracellular levels of AgNp-induced ROS could be reversed by using antioxidant ascorbic acid, but the sensitivity of AgNp-treated Candida cells could not be completely reversed. Moreover, in addition to the generation of ROS, the AgNps were found to affect other cellular targets resulting in altered membrane fluidity, membrane microenvironment, ergosterol content, cellular morphology, and ultrastructure. Thus, the generation of ROS does not seem to be the sole major cause of AgNp-mediated cell toxicity in Candida. Rather, the multitargeted action of AgNps, generation of ROS, alterations in ergosterol content, and membrane fluidity together seem to have potentiated anti-Candida action. Thus, this “nano-based drug therapy” is likely to favor broad-spectrum activity, multiple cellular targets, and minimum host toxicity. AgNps, therefore, appear to have the potential to address the challenges in multidrug

  18. Regulation of T-cell Responses in the Inflamed Intestine

    NARCIS (Netherlands)

    M.A. Van Leeuwen (Marieke)

    2015-01-01

    markdownabstract__Abstract__ The intestinal immune system protects the mucosal surfaces from pathogenic microorganisms. On the other hand it maintains tolerance towards dietary antigens and non-pathogenic microorganisms. The immune system continuously tailors these inflammatory and tolerogenic

  19. ABMA, a small molecule that inhibits intracellular toxins and pathogens by interfering with late endosomal compartments.

    Science.gov (United States)

    Wu, Yu; Pons, Valérie; Goudet, Amélie; Panigai, Laetitia; Fischer, Annette; Herweg, Jo-Ana; Kali, Sabrina; Davey, Robert A; Laporte, Jérôme; Bouclier, Céline; Yousfi, Rahima; Aubenque, Céline; Merer, Goulven; Gobbo, Emilie; Lopez, Roman; Gillet, Cynthia; Cojean, Sandrine; Popoff, Michel R; Clayette, Pascal; Le Grand, Roger; Boulogne, Claire; Tordo, Noël; Lemichez, Emmanuel; Loiseau, Philippe M; Rudel, Thomas; Sauvaire, Didier; Cintrat, Jean-Christophe; Gillet, Daniel; Barbier, Julien

    2017-11-14

    Intracellular pathogenic microorganisms and toxins exploit host cell mechanisms to enter, exert their deleterious effects as well as hijack host nutrition for their development. A potential approach to treat multiple pathogen infections and that should not induce drug resistance is the use of small molecules that target host components. We identified the compound 1-adamantyl (5-bromo-2-methoxybenzyl) amine (ABMA) from a cell-based high throughput screening for its capacity to protect human cells and mice against ricin toxin without toxicity. This compound efficiently protects cells against various toxins and pathogens including viruses, intracellular bacteria and parasite. ABMA provokes Rab7-positive late endosomal compartment accumulation in mammalian cells without affecting other organelles (early endosomes, lysosomes, the Golgi apparatus, the endoplasmic reticulum or the nucleus). As the mechanism of action of ABMA is restricted to host-endosomal compartments, it reduces cell infection by pathogens that depend on this pathway to invade cells. ABMA may represent a novel class of broad-spectrum compounds with therapeutic potential against diverse severe infectious diseases.

  20. Differentiation and detection of microorganisms using Fourier transform infrared photoacoustic spectroscopy

    Science.gov (United States)

    Irudayaraj, Joseph; Yang, Hong; Sakhamuri, Sivakesava

    2002-03-01

    Fourier transform infrared photoacoustic spectroscopy (FTIR-PAS) was used to differentiate and identify microorganisms on a food (apple) surface. Microorganisms considered include bacteria (Lactobacillus casei, Bacillus cereus, and Escherichia coli), yeast (Saccharomyces cerevisiae), and fungi (Aspergillus niger and Fusarium verticilliodes). Discriminant analysis was used to differentiate apples contaminated with the different microorganisms from uncontaminated apple. Mahalanobis distances were calculated to quantify the differences. The higher the value of the Mahalanobis distance metric between different microorganisms, the greater is their difference. Additionally, pathogenic (O157:H7) E. coli was successfully differentiated from non-pathogenic strains. Results demonstrate that FTIR-PAS spectroscopy has the potential to become a non-destructive analysis tool in food safety related research.

  1. Heterologous expression of pathogen-specific genes ligA and ligB in the saprophyte Leptospira biflexa confers enhanced adhesion to cultured cells and fibronectin.

    Science.gov (United States)

    Figueira, Cláudio Pereira; Croda, Julio; Choy, Henry A; Haake, David A; Reis, Mitermayer G; Ko, Albert I; Picardeau, Mathieu

    2011-06-09

    In comparison to other bacterial pathogens, our knowledge of the molecular basis of the pathogenesis of leptospirosis is extremely limited. An improved understanding of leptospiral pathogenetic mechanisms requires reliable tools for functional genetic analysis. Leptospiral immunoglobulin-like (Lig) proteins are surface proteins found in pathogenic Leptospira, but not in saprophytes. Here, we describe a system for heterologous expression of the Leptospira interrogans genes ligA and ligB in the saprophyte Leptospira biflexa serovar Patoc. The genes encoding LigA and LigB under the control of a constitutive spirochaetal promoter were inserted into the L. biflexa replicative plasmid. We were able to demonstrate expression and surface localization of LigA and LigB in L. biflexa. We found that the expression of the lig genes significantly enhanced the ability of transformed L. biflexa to adhere in vitro to extracellular matrix components and cultured cells, suggesting the involvement of Lig proteins in cell adhesion. This work reports a complete description of the system we have developed for heterologous expression of pathogen-specific proteins in the saprophytic L. biflexa. We show that expression of LigA and LigB proteins from the pathogen confers a virulence-associated phenotype on L. biflexa, namely adhesion to eukaryotic cells and fibronectin in vitro. This study indicates that L. biflexa can serve as a surrogate host to characterize the role of key virulence factors of the causative agent of leptospirosis.

  2. Cell walls of the dimorphic fungal pathogens Sporothrix schenckii and Sporothrix brasiliensis exhibit bilaminate structures and sloughing of extensive and intact layers.

    Directory of Open Access Journals (Sweden)

    Leila M Lopes-Bezerra

    2018-03-01

    Full Text Available Sporotrichosis is a subcutaneous mycosis caused by pathogenic species of the Sporothrix genus. A new emerging species, Sporothrix brasiliensis, is related to cat-transmitted sporotrichosis and has severe clinical manifestations. The cell wall of pathogenic fungi is a unique structure and impacts directly on the host immune response. We reveal and compare the cell wall structures of Sporothrix schenckii and S. brasiliensis using high-pressure freezing electron microscopy to study the cell wall organization of both species. To analyze the components of the cell wall, we also used infrared and 13C and 1H NMR spectroscopy and the sugar composition was determined by quantitative high-performance anion-exchange chromatography. Our ultrastructural data revealed a bi-layered cell wall structure for both species, including an external microfibrillar layer and an inner electron-dense layer. The inner and outer layers of the S. brasiliensis cell wall were thicker than those of S. schenckii, correlating with an increase in the chitin and rhamnose contents. Moreover, the outer microfibrillar layer of the S. brasiliensis cell wall had longer microfibrils interconnecting yeast cells. Distinct from those of other dimorphic fungi, the cell wall of Sporothrix spp. lacked α-glucan component. Interestingly, glycogen α-particles were identified in the cytoplasm close to the cell wall and the plasma membrane. The cell wall structure as well as the presence of glycogen α-particles varied over time during cell culture. The structural differences observed in the cell wall of these Sporothrix species seemed to impact its uptake by monocyte-derived human macrophages. The data presented here show a unique cell wall structure of S. brasiliensis and S. schenckii during the yeast parasitic phase. A new cell wall model for Sporothrix spp. is therefore proposed that suggests that these fungi molt sheets of intact cell wall layers. This observation may have significant

  3. Cell walls of the dimorphic fungal pathogens Sporothrix schenckii and Sporothrix brasiliensis exhibit bilaminate structures and sloughing of extensive and intact layers

    Science.gov (United States)

    Walker, Louise A.; Niño-Vega, Gustavo; Mora-Montes, Héctor M.; Neves, Gabriela W. P.; Villalobos-Duno, Hector; Barreto, Laura; Garcia, Karina; Franco, Bernardo; Martínez-Álvarez, José A.; Munro, Carol A.; Gow, Neil A. R.

    2018-01-01

    Sporotrichosis is a subcutaneous mycosis caused by pathogenic species of the Sporothrix genus. A new emerging species, Sporothrix brasiliensis, is related to cat-transmitted sporotrichosis and has severe clinical manifestations. The cell wall of pathogenic fungi is a unique structure and impacts directly on the host immune response. We reveal and compare the cell wall structures of Sporothrix schenckii and S. brasiliensis using high-pressure freezing electron microscopy to study the cell wall organization of both species. To analyze the components of the cell wall, we also used infrared and 13C and 1H NMR spectroscopy and the sugar composition was determined by quantitative high-performance anion-exchange chromatography. Our ultrastructural data revealed a bi-layered cell wall structure for both species, including an external microfibrillar layer and an inner electron-dense layer. The inner and outer layers of the S. brasiliensis cell wall were thicker than those of S. schenckii, correlating with an increase in the chitin and rhamnose contents. Moreover, the outer microfibrillar layer of the S. brasiliensis cell wall had longer microfibrils interconnecting yeast cells. Distinct from those of other dimorphic fungi, the cell wall of Sporothrix spp. lacked α-glucan component. Interestingly, glycogen α-particles were identified in the cytoplasm close to the cell wall and the plasma membrane. The cell wall structure as well as the presence of glycogen α-particles varied over time during cell culture. The structural differences observed in the cell wall of these Sporothrix species seemed to impact its uptake by monocyte-derived human macrophages. The data presented here show a unique cell wall structure of S. brasiliensis and S. schenckii during the yeast parasitic phase. A new cell wall model for Sporothrix spp. is therefore proposed that suggests that these fungi molt sheets of intact cell wall layers. This observation may have significant effects on localized and

  4. A molecular assay for sensitive detection of pathogen-specific T-cells.

    Directory of Open Access Journals (Sweden)

    Victoria O Kasprowicz

    Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.

  5. Divergent pro-inflammatory profile of human dendritic cells in response to commensal and pathogenic bacteria associated with the airway microbiota

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Steen-Jensen, Daniel Bisgaard; Laursen, Janne Marie

    2012-01-01

    of individual bacterial species are unknown. In this study, we compared the immune stimulatory capacity on human monocyte-derived dendritic cells (DCs) of selected airway commensal and pathogenic bacteria predominantly associated with lungs of asthma or COPD patients (pathogenic Haemophillus spp. and Moraxella...... spp.), healthy lungs (commensal Prevotella spp.) or both (commensal Veillonella spp. and Actinomyces spp.). All bacteria were found to induce activation of DCs as demonstrated by similar induction of CD83, CD40 and CD86 surface expression. However, asthma and COPD-associated pathogenic bacteria...... provoked a 3-5 fold higher production of IL-23, IL-12p70 and IL-10 cytokines compared to the commensal bacteria. Based on the differential cytokine production profiles, the studied airway bacteria could be segregated into three groups (Haemophilus spp. and Moraxella spp. vs. Prevotella spp. and Veillonella...

  6. Biofuel production by recombinant microorganisms

    Science.gov (United States)

    Liao, James C.; Atsumi, Shota; Cann, Anthony F.

    2017-07-04

    Provided herein are metabolically-modified microorganisms useful for producing biofuels. More specifically, provided herein are methods of producing high alcohols including isobutanol, 1-butanol, 1-propanol, 2-methyl-1-butanol, 3-methyl-1-butanol and 2-phenylethanol from a suitable substrate.

  7. Airborne microorganisms from waste containers.

    Science.gov (United States)

    Jedlicka, Sabrina S; Stravitz, David M; Lyman, Charles E

    2012-01-01

    In physician's offices and biomedical labs, biological waste is handled every day. This waste is disposed of in waste containers designed for holding red autoclave bags. The containers used in these environments are closed hands-free containers, often with a step pedal. While these containers protect the user from surface-borne microorganisms, the containers may allow airborne microorganisms to escape via the open/close mechanism because of the air current produced upon open/close cycles. In this study, the air current was shown to be sufficient to allow airborne escape of microorganisms held in the container, including Aspergillus niger. However, bacterial cultures, such as Escherichia coli and Lactococcus lactis did not escape. This may be due to the choice of bacterial cultures and the absence of solid waste, such as dust or other particulate matter in the waste containers, that such strains of bacteria could travel on during aerosolization. We compared these results to those obtained using a re-designed receptacle, which mimimizes air currents, and detected no escaping microorganisms. This study highlights one potential source of airborne contamination in labs, hospitals, and other environments that dispose of biological waste.

  8. Engineering of microorganisms towards recovery of rare metal ions

    Energy Technology Data Exchange (ETDEWEB)

    Kuroda, Kouichi; Ueda, Mitsuyoshi [Kyoto Univ. (Japan). Div. of Applied Life Sciences

    2010-06-15

    The bioadsorption of metal ions using microorganisms is an attractive technology for the recovery of rare metal ions as well as removal of toxic heavy metal ions from aqueous solution. In initial attempts, microorganisms with the ability to accumulate metal ions were isolated from nature and intracellular accumulation was enhanced by the overproduction of metal-binding proteins in the cytoplasm. As an alternative, the cell surface design of microorganisms by cell surface engineering is an emerging strategy for bioadsorption and recovery of metal ions. Cell surface engineering was firstly applied to the construction of a bioadsorbent to adsorb heavy metal ions for bioremediation. Cell surface adsorption of metal ions is rapid and reversible. Therefore, adsorbed metal ions can be easily recovered without cell breakage, and the bioadsorbent can be reused or regenerated. These advantages are suitable for the recovery of rare metal ions. Actually, the cell surface display of a molybdate-binding protein on yeast led to the enhanced adsorption of molybdate, one of the rare metal ions. An additional advantage is that the cell surface display system allows high-throughput screening of protein/peptide libraries owing to the direct evaluation of the displayed protein/peptide without purification and concentration. Therefore, the creation of novel metal-binding protein/ peptide and engineering of microorganisms towards the recovery of rare metal ions could be simultaneously achieved. (orig.)

  9. Rapid detection of foodborne microorganisms on food surface using Fourier transform Raman spectroscopy

    Science.gov (United States)

    Yang, Hong; Irudayaraj, Joseph

    2003-02-01

    Fourier transform (FT) Raman spectroscopy was used for non-destructive characterization and differentiation of six different microorganisms including the pathogen Escherichia coli O157:H7 on whole apples. Mahalanobis distance metric was used to evaluate and quantify the statistical differences between the spectra of six different microorganisms. The same procedure was extended to discriminate six different strains of E. coli. The FT-Raman procedure was not only successful in discriminating the different E. coli strain but also accurately differentiated the pathogen from non-pathogens. Results demonstrate that FT-Raman spectroscopy can be an excellent tool for rapid examination of food surfaces for microorganism contamination and for the classification of microbial cultures.

  10. Conjugative type IVb pilus recognizes lipopolysaccharide of recipient cells to initiate PAPI-1 pathogenicity island transfer in Pseudomonas aeruginosa

    Science.gov (United States)

    Pseudomonas aeruginosa pathogenicity island 1 (PAPI-1) is one of the largest genomic islands of this important opportunistic human pathogen. Previous studies have shown that PAPI-1 encodes several putative virulence factors, a major regulator of biofilm formation, and antibiotic-resistance traits, a...

  11. Immune responses of mature chicken bone-marrow-derived dendritic cells infected with Newcastle disease virus strains with differing pathogenicity.

    Science.gov (United States)

    Xiang, Bin; Zhu, Wenxian; Li, Yaling; Gao, Pei; Liang, Jianpeng; Liu, Di; Ding, Chan; Liao, Ming; Kang, Yinfeng; Ren, Tao

    2018-06-01

    Infection of chickens with virulent Newcastle disease virus (NDV) is associated with severe pathology and increased morbidity and mortality. The innate immune response contributes to the pathogenicity of NDV. As professional antigen-presenting cells, dendritic cells (DCs) play a unique role in innate immunity. However, the contribution of DCs to NDV infection has not been investigated in chickens. In this study, we selected two representative NDV strains, i.e., the velogenic NDV strain Chicken/Guangdong/GM/2014 (GM) and the lentogenic NDV strain La Sota, to investigate whether NDVs could infect LPS-activated chicken bone-derived marrow DCs (mature chicken BM-DCs). We compared the viral titres and innate immune responses in mature chicken BM-DCs following infection with those strains. Both NDV strains could infect mature chicken BM-DC, but the GM strain showed stronger replication capacity than the La Sota strain in mature chicken BM-DCs. Gene expression profiling showed that MDA5, LGP2, TLR3, TLR7, IFN-α, IFN-β, IFN-γ, IL-1β, IL-6, IL-18, IL-8, CCL5, IL-10, IL-12, MHC-I, and MHC-II levels were altered in mature DCs after infection with NDVs at all evaluated times postinfection. Notably, the GM strain triggered stronger innate immune responses than the La Sota strain in chicken BM-DCs. However, both strains were able to suppress the expression of some cytokines, such as IL-6 and IFN-α, in mature chicken DCs at 24 hpi. These data provide a foundation for further investigation of the role of chicken DCs in NDV infection.

  12. Eubiotics for Food Security at Farm Level: Yeast Cell Wall Products and Their Antimicrobial Potential Against Pathogenic Bacteria.

    Science.gov (United States)

    Santovito, Elisa; Greco, Donato; Logrieco, Antonio F; Avantaggiato, Giuseppina

    2018-06-06

    The population increase in the last century was the first cause of the industrialization of animal productions, together with the necessity to satisfy the high food demand and the lack of space and land for the husbandry practices. As a consequence, the farmers moved from extensive to intensive agricultural systems and introduced new practices, such as the administration of antimicrobial drugs. Antibiotics were then used as growth promoters and for disease prevention. The uncontrolled and continuous use of antibiotics contributed to the spread of antibiotic resistance in animals, and this had adverse impacts on human health. This emergence led the European Union, in 2003, to ban the marketing and use of antibiotics as growth promoters, and for prophylaxis purposes from January 2006. This ban caused problems in farms, due to the decrease in animal performances (weight gain, feed conversion ratio, reproduction, etc.), and the rise in the incidence of certain diseases, such as those induced by Clostridium perfringens, Salmonella, Escherichia coli, and Listeria monocytogenes. The economic losses due to the ban increased the interest in researching alternative strategies for the prophylaxis of infectious diseases and for health and growth promotion, such as feed additives. Yeast-based materials, such as cell wall extract, represent promising alternatives to antibiotics, on the base of their prebiotic activity and their claimed capacity to bind enteropathogenic bacteria. Several authors reported examples of the effectiveness of yeast cell wall products in adsorbing bacteria, but there is a lack of knowledge on the mechanisms involved in this interaction. The purpose of this review is to provide an overview of the current approaches used for the control of pathogenic bacteria in feed, with a particular focus on the use of yeast-derived materials proposed to control zoonoses at farm level, and on their effect on animal health.

  13. Granulocyte-macrophage colony-stimulating factor amplification of interleukin-1beta and tumor necrosis factor alpha production in THP-1 human monocytic cells stimulated with lipopolysaccharide of oral microorganisms.

    Science.gov (United States)

    Baqui, A A; Meiller, T F; Chon, J J; Turng, B F; Falkler, W A

    1998-05-01

    Cytokines, including granulocyte-macrophage colony-stimulating factor (GM-CSF), are used to assist in bone marrow recovery during cancer chemotherapy. Interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNF-alpha) play important roles in inflammatory processes, including exacerbation of periodontal diseases, one of the most common complications in patients who undergo this therapy. A human monocyte cell line (THP-1) was utilized to investigate IL-1beta and TNF-alpha production following GM-CSF supplementation with lipopolysaccharide (LPS) from two oral microorganisms, Porphyromonas gingivalis and Fusobacterium nucleatum. LPS of P. gingivalis or F. nucleatum was prepared by a phenol-water extraction method and characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and determination of total protein and endotoxin contents. Resting THP-1 cells were treated with LPS of P. gingivalis or F. nucleatum and/or GM-CSF (50 IU/ml) by using different concentrations for various time periods. Production of IL-1beta and TNF-alpha in THP-1 cells was measured by solid-phase enzyme-linked immunosorbent assay. Reverse transcription (RT)-PCR was used to evaluate the gene expression of resting and treated THP-1 cells. IL-1beta was not detected in untreated THP-1 cells. IL-1beta production was, however, stimulated sharply at 4 h. GM-CSF amplified IL-1beta production in THP-1 cells treated with LPS from both oral anaerobes. No IL-1beta-specific mRNA transcript was detected in untreated THP-1 cells. However, IL-1beta mRNA was detected by RT-PCR 2 h after stimulation of THP-1 cells with LPS from both organisms. GM-CSF did not shorten the IL-1beta transcriptional activation time. GM-CSF plus F. nucleatum or P. gingivalis LPS activated THP-1 cells to produce a 1.6-fold increase in TNF-alpha production at 4 h over LPS stimulation alone. These investigations with the in vitro THP-1 model indicate that there may be an increase in the cellular immune response to oral

  14. Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

    Science.gov (United States)

    Cassells, Alan C

    2012-01-01

    The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

  15. A novel Arabidopsis CHITIN ELICITOR RECEPTOR KINASE 1 (CERK1) mutant with enhanced pathogen-induced cell death and altered receptor processing.

    Science.gov (United States)

    Petutschnig, Elena K; Stolze, Marnie; Lipka, Ulrike; Kopischke, Michaela; Horlacher, Juliane; Valerius, Oliver; Rozhon, Wilfried; Gust, Andrea A; Kemmerling, Birgit; Poppenberger, Brigitte; Braus, Gerhard H; Nürnberger, Thorsten; Lipka, Volker

    2014-12-01

    Plants detect pathogens by sensing microbe-associated molecular patterns (MAMPs) through pattern recognition receptors. Pattern recognition receptor complexes also have roles in cell death control, but the underlying mechanisms are poorly understood. Here, we report isolation of cerk1-4, a novel mutant allele of the Arabidopsis chitin receptor CERK1 with enhanced defense responses. We identified cerk1-4 in a forward genetic screen with barley powdery mildew and consequently characterized it by pathogen assays, mutant crosses and analysis of defense pathways. CERK1 and CERK1-4 proteins were analyzed biochemically. The cerk1-4 mutation causes an amino acid exchange in the CERK1 ectodomain. Mutant plants maintain chitin signaling capacity but exhibit hyper-inducible salicylic acid concentrations and deregulated cell death upon pathogen challenge. In contrast to chitin signaling, the cerk1-4 phenotype does not require kinase activity and is conferred by the N-terminal part of the receptor. CERK1 undergoes ectodomain shedding, a well-known process in animal cell surface proteins. Wild-type plants contain the full-length CERK1 receptor protein as well as a soluble form of the CERK1 ectodomain, whereas cerk1-4 plants lack the N-terminal shedding product. Our work suggests that CERK1 may have a chitin-independent role in cell death control and is the first report of ectodomain shedding in plants. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  16. Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.

    Science.gov (United States)

    Dobón, Albor; Canet, Juan Vicente; García-Andrade, Javier; Angulo, Carlos; Neumetzler, Lutz; Persson, Staffan; Vera, Pablo

    2015-04-01

    Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs) from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence) factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.

  17. Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Albor Dobón

    2015-04-01

    Full Text Available Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.

  18. Microorganisms .

    African Journals Online (AJOL)

    ) and heat/pH-shift treatments. This technique resulted in 47% enzyme yield with a purification fac- tor of 12. Technique II which involved two extraction steps by' aqueous two - phase system. (APS) coupled with UF resulted in 62 % enzyme ...

  19. The graphene oxide contradictory effects against human pathogens

    Science.gov (United States)

    Palmieri, Valentina; Carmela Lauriola, Maria; Ciasca, Gabriele; Conti, Claudio; De Spirito, Marco; Papi, Massimiliano

    2017-04-01

    Standing out as the new wonder bidimensional material, graphene oxide (GO) has aroused an exceptional interest in biomedical research by holding promise for being the antibacterial of future. First, GO possesses a specific interaction with microorganisms combined with a mild toxicity for human cells. Additionally, its antibacterial action seems to be directed to multiple targets in pathogens, causing both membranes mechanical injury and oxidative stress. Lastly, compared to other carbon materials, GO has easy and low-cost processing and is environment-friendly. This remarkable specificity and multi-targeting antibacterial activity come at a time when antibiotic resistance represents the major health challenge. Unfortunately, a comprehensive framework to understand how to effectively utilize this material against microorganisms is still lacking. In the last decade, several groups tried to define the mechanisms of interaction between GO flakes and pathogens but conflicting results have been reported. This review is focused on all the contradictions of GO antimicrobial properties in solution. Flake size, incubation protocol, time of exposure and species considered are examples of factors influencing results. These parameters will be summarized and analyzed with the aim of defining the causes of contradictions, to allow fast GO clinical application.

  20. Size-dependent antibacterial activities of silver nanoparticles against oral anaerobic pathogenic bacteria.

    Science.gov (United States)

    Lu, Zhong; Rong, Kaifeng; Li, Ju; Yang, Hao; Chen, Rong

    2013-06-01

    Dental caries and periodontal disease are widespread diseases for which microorganism infections have been identified as the main etiology. Silver nanoparticles (Ag Nps) were considered as potential control oral bacteria infection agent due to its excellent antimicrobial activity and non acute toxic effects on human cells. In this work, stable Ag Nps with different sizes (~5, 15 and 55 nm mean values) were synthesized by using a simple reduction method or hydrothermal method. The Nps were characterized by powder X-ray diffraction, transmission electron microscopy and UV-vis absorption spectroscopy. The antibacterial activities were evaluated by colony counting assay and growth inhibition curve method, and corresponding minimum inhibitory concentration (MIC) against five anaerobic oral pathogenic bacteria and aerobic bacteria E. coli were determined. The results showed that Ag Nps had apparent antibacterial effects against the anaerobic oral pathogenic bacteria and aerobic bacteria. The MIC values of 5-nm Ag against anaerobic oral pathogenic bacteria A. actinomycetemcomitans, F. nuceatum, S. mitis, S. mutans and S. sanguis were 25, 25, 25, 50 and 50 μg/mL, respectively. The aerobic bacteria were more susceptible to Ag NPs than the anaerobic oral pathogenic bacteria. In the mean time, Ag NPs displayed an obvious size-dependent antibacterial activity against the anaerobic bacteria. The 5-nm Ag presents the highest antibacterial activity. The results of this work indicated a potential application of Ag Nps in the inhibition of oral microorganism infections.

  1. Production of gaba (γ - aminobutyric acid by microorganisms: a review

    Directory of Open Access Journals (Sweden)

    Radhika Dhakal

    2012-12-01

    Full Text Available GABA (γ-aminobutyric acid is a four carbon non-protein amino acid that is widely distributed in plants, animals and microorganisms. As a metabolic product of plants and microorganisms produced by the decarboxylation of glutamic acid, GABA functions as an inhibitory neurotransmitter in the brain that directly affects the personality and the stress management. A wide range of traditional foods produced by microbial fermentation contain GABA, in which GABA is safe and eco-friendly, and also has the possibility of providing new health-benefited products enriched with GABA. Synthesis of GABA is catalyzed by glutamate decarboxylase, therefore, the optimal fermentation condition is mainly based on the biochemical properties of the enzyme. Major GABA producing microorganisms are lactic acid bacteria (LAB, which make food spoilage pathogens unable to grow and act as probiotics in the gastrointestinal tract. The major factors affecting the production of GABA by microbial fermentation are temperature, pH, fermentation time and different media additives, therefore, these factors are summarized to provide the most up-dated information for effective GABA synthesis. There has been a huge accumulation of knowledge on GABA application for human health accompanying with a demand on natural GABA supply. Only the GABA production by microorganisms can fulfill the demand with GABA-enriched health beneficial foods.

  2. Production of gaba (γ - Aminobutyric acid) by microorganisms: a review.

    Science.gov (United States)

    Dhakal, Radhika; Bajpai, Vivek K; Baek, Kwang-Hyun

    2012-10-01

    GABA (γ-aminobutyric acid) is a four carbon non-protein amino acid that is widely distributed in plants, animals and microorganisms. As a metabolic product of plants and microorganisms produced by the decarboxylation of glutamic acid, GABA functions as an inhibitory neurotransmitter in the brain that directly affects the personality and the stress management. A wide range of traditional foods produced by microbial fermentation contain GABA, in which GABA is safe and eco-friendly, and also has the possibility of providing new health-benefited products enriched with GABA. Synthesis of GABA is catalyzed by glutamate decarboxylase, therefore, the optimal fermentation condition is mainly based on the biochemical properties of the enzyme. Major GABA producing microorganisms are lactic acid bacteria (LAB), which make food spoilage pathogens unable to grow and act as probiotics in the gastrointestinal tract. The major factors affecting the production of GABA by microbial fermentation are temperature, pH, fermentation time and different media additives, therefore, these factors are summarized to provide the most up-dated information for effective GABA synthesis. There has been a huge accumulation of knowledge on GABA application for human health accompanying with a demand on natural GABA supply. Only the GABA production by microorganisms can fulfill the demand with GABA-enriched health beneficial foods.

  3. [Ants as carriers of microorganisms in hospital environments].

    Science.gov (United States)

    Pereira, Rogério Dos Santos; Ueno, Mariko

    2008-01-01

    Concern exists regarding the real possibility of public health threats caused by pathogenic agents that are carried by urban ants. The present study had the objective of isolating and identifying the microorganisms that are associated with ants in hospital environments. One hundred and twenty-five ants of the same species were collected from different units of a university hospital. Each ant was collected using a swab soaked with physiological solution and was transferred to a tube containing brain heart infusion broth and incubated at 35 degrees C for 24 hours. From each tube, with growth, inoculations were made into specific culturing media, to isolate any microorganisms. The ants presented a high capacity for carrying microorganism groups: spore-producing Gram-positive bacilli 63.5%, Gram-negative bacilli 6.3%, Gram-positive cocci 23.1%, filamentous fungi 6.7% and yeast 0.5%. Thus, it can be inferred that ants may be one of the agents responsible for disseminating microorganisms in hospital environments.

  4. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  5. Heterogeneity in isogenic populations of microorganisms

    DEFF Research Database (Denmark)

    Pedersen, Anne Egholm

    heterogeneity was detected when the culture had been propagated according to the guidelines of the Copenhagen School of Bacterial Growth Physiology. The L. lactis GFP reporter strain was more challenging to analyze. The population profile for this reporter strain was shown to be dependent on the type of medium...... values for quantifiable variables are used. The reproducibility of an experiment could thus be affected by the presence of subpopulations or high levels of phenotypic variations. Ole Maaløe and colleagues did in the late 1950’ties observe that the growth rate, RNA, DNA and protein synthesis and cell...... factor per unit of time. The use of a balanced growing culture is a cornerstone in the Copenhagen School of Bacterial Growth Physiology headed by Ole Maaløe. Due to the size of the microorganism it is challenging to measure a quantifiable variable in a single cell. However, fluorescence, whether being...

  6. Microorganism Utilization for Synthetic Milk

    Science.gov (United States)

    Morford, Megan A.; Khodadad, Christina L.; Caro, Janicce I.; Spencer, LaShelle E.; Richards, Jeffery T.; Strayer, Richard F.; Birmele, Michele N.; Wheeler, Raymond M.

    2014-01-01

    A desired architecture for long duration spaceflight, like aboard the International Space Station or for future missions to Mars, is to provide a supply of fresh food crops for the astronauts. However, some crops can create a high proportion of inedible plant waste. The main goal of the Synthetic Biology project, Cow in a Column, was to produce the components of milk (sugar, lipid, protein) from inedible plant waste by utilizing microorganisms (fungi, yeast, bacteria). Of particular interest was utilizing the valuable polysaccharide, cellulose, found in plant waste, to naturally fuel-through microorganism cellular metabolism- the creation of sugar (glucose), lipid (milk fat), and protein (casein) in order to produce a synthetic edible food product. Environmental conditions such as pH, temperature, carbon source, aeration, and choice microorganisms were optimized in the laboratory and the desired end-products, sugars and lipids, were analyzed. Trichoderma reesei, a known cellulolytic fungus, was utilized to drive the production of glucose, with the intent that the produced glucose would serve as the carbon source for milk fat production and be a substitute for the milk sugar lactose. Lipid production would be carried out by Rhodosporidium toruloides, yeast known to accumulate those lipids that are typically found in milk fat. Results showed that glucose and total lipid content were below what was expected during this phase of experimentation. In addition, individual analysis of six fatty acids revealed that the percentage of each fatty acid was lower than naturally produced bovine milk. Overall, this research indicates that microorganisms could be utilized to breakdown inedible solid waste to produce useable products. For future work, the production of the casein protein for milk would require the development of a genetically modified organism, which was beyond the scope of the original project. Additional trials would be needed to further refine the required

  7. The useful micro-organism

    International Nuclear Information System (INIS)

    1970-01-01

    Can man survive civilization? Academician Ivan Malek, Director of the Institute of Microbiology in Prague, a member of the Agency's Scientific Advisory Committee and for many years an adviser to the Food and Agriculture Organization, the World Health Organization and UNESCO, believes he can, But he also considers that if man is to survive he must study and use all the resources at his disposal - including the micro-organisms of the planet earth. (author)

  8. A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis

    Directory of Open Access Journals (Sweden)

    Bennett Hayley J

    2010-08-01

    Full Text Available Abstract Background Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. Results We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. Conclusion This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases

  9. A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis.

    Science.gov (United States)

    Beresford, Nicola J; Saville, Charis; Bennett, Hayley J; Roberts, Ian S; Tabernero, Lydia

    2010-08-02

    Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR) are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases and they have no homologues in humans. This study provides

  10. Finding the smoking gun: protein tyrosine phosphatases as tools and targets of unicellular microorganisms and viruses.

    Science.gov (United States)

    Heneberg, P

    2012-01-01

    Protein tyrosine phosphatases (PTPs) are increasingly recognized as important effectors of host-pathogen interactions. Since Guan and Dixon reported in 1990 that phosphatase YopH serves as an essential virulence determinant of Yersinia, the field shifted significantly forward, and dozens of PTPs were identified in various microorganisms and even in viruses. The discovery of extensive tyrosine signaling networks in non-metazoan organisms refuted the moth-eaten paradigm claiming that these organisms rely exclusively on phosphoserine/phosphothreonine signaling. Similarly to humans, phosphotyrosine signaling is thought to comprise a small fraction of total protein phosphorylation, but plays a disproportionately important role in cell-cycle control, differentiation, and invasiveness. Here we summarize the state-of-art knowledge on PTPs of important non-metazoan pathogens (Listeria monocytogenes, Staphylococcus aureus, Porphyromonas gingivalis, Caulobacter crescentus, Yersinia, Synechocystis, Leishmania, Plasmodium falciparum, Entamoeba histolytica, etc.), and focus also at the microbial proteins affecting directly or indirectly the PTPs of the host (Mycobacterium tuberculosis MTSA-10, Bacillus anthracis anthrax toxin, streptococcal β protein, Helicobacter pylori CagA and VacA, Leishmania GP63 and EF-1α, Plasmodium hemozoin, etc.). This is the first review summarizing the knowledge on biological activity and pharmacological inhibition of non-metazoan PTPs, with the emphasis of those important in host-pathogen interactions. Targeting of numerous non-metazoan PTPs is simplified by the fact that they act either as ectophosphatases or are secreted outside of the pathogen. Interfering with tyrosine phosphorylation represents a powerful pharmacologic approach, and even though the PTP inhibitors are difficult to develop, lifting the fog of phosphatase inhibition is of the great market potential and further clinical impact.

  11. Control of microorganisms of oral health interest with Arctium lappa L. (burdock) extract non-cytotoxic to cell culture of macrophages (RAW 264.7).

    Science.gov (United States)

    de Oliveira, Jonatas Rafael; de Aguiar Almeida, Rosilene Batista; das Graças Figueiredo Vilela, Polyana; de Oliveira, Felipe Eduardo; da Rocha, Rosilene Fernandes; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

    2014-08-01

    To evaluate the antimicrobial activity of Arctium lappa L. extract on Staphylococcus aureus, S. epidermidis, Streptococcus mutans, Candida albicans, C. tropicalis and C. glabrata. In addition, the cytotoxicity of this extract was analyzed on macrophages (RAW 264.7). By broth microdilution method, different concentrations of the extract (250-0.4 mg/mL) were used in order to determine the minimum microbicidal concentration (MMC) in planktonic cultures and the most effective concentration was used on biofilms on discs made of acrylic resin. The cytotoxicity A. lappa L. extract MMC was evaluated on RAW 264.7 by MTT assay and the quantification of IL-1β and TNF-α by ELISA. The most effective concentration was 250 mg/mL and also promoted significant reduction (log₁₀) in the biofilms of S. aureus (0.438 ± 0.269), S. epidermidis (0.377 ± 0.298), S. mutans (0.244 ± 0.161) and C. albicans (0.746 ± 0.209). Cell viability was similar to 100%. The production of IL-1β was similar to the control group (p>0.05) and there was inhibition of TNF-α (plappa L. extract was microbicidal for all the evaluated strains in planktonic cultures, microbiostatic for biofilms and not cytotoxic to the macrophages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Structural and Functional Insight of Sphingosine 1-Phosphate-Mediated Pathogenic Metabolic Reprogramming in Sickle Cell Disease.

    Science.gov (United States)

    Sun, Kaiqi; D'Alessandro, Angelo; Ahmed, Mostafa H; Zhang, Yujin; Song, Anren; Ko, Tzu-Ping; Nemkov, Travis; Reisz, Julie A; Wu, Hongyu; Adebiyi, Morayo; Peng, Zhangzhe; Gong, Jing; Liu, Hong; Huang, Aji; Wen, Yuan Edward; Wen, Alexander Q; Berka, Vladimir; Bogdanov, Mikhail V; Abdulmalik, Osheiza; Han, Leng; Tsai, Ah-Lim; Idowu, Modupe; Juneja, Harinder S; Kellems, Rodney E; Dowhan, William; Hansen, Kirk C; Safo, Martin K; Xia, Yang

    2017-11-10

    Elevated sphingosine 1-phosphate (S1P) is detrimental in Sickle Cell Disease (SCD), but the mechanistic basis remains obscure. Here, we report that increased erythrocyte S1P binds to deoxygenated sickle Hb (deoxyHbS), facilitates deoxyHbS anchoring to the membrane, induces release of membrane-bound glycolytic enzymes and in turn switches glucose flux towards glycolysis relative to the pentose phosphate pathway (PPP). Suppressed PPP causes compromised glutathione homeostasis and increased oxidative stress, while enhanced glycolysis induces production of 2,3-bisphosphoglycerate (2,3-BPG) and thus increases deoxyHbS polymerization, sickling, hemolysis and disease progression. Functional studies revealed that S1P and 2,3-BPG work synergistically to decrease both HbA and HbS oxygen binding affinity. The crystal structure at 1.9 Å resolution deciphered that S1P binds to the surface of 2,3-BPG-deoxyHbA and causes additional conformation changes to the T-state Hb. Phosphate moiety of the surface bound S1P engages in a highly positive region close to α1-heme while its aliphatic chain snakes along a shallow cavity making hydrophobic interactions in the "switch region", as well as with α2-heme like a molecular "sticky tape" with the last 3-4 carbon atoms sticking out into bulk solvent. Altogether, our findings provide functional and structural bases underlying S1P-mediated pathogenic metabolic reprogramming in SCD and novel therapeutic avenues.

  13. Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam Regulates Phagocytosis via Membrane-Bound Dscam in Crab

    Directory of Open Access Journals (Sweden)

    Xue-Jie Li

    2018-04-01

    Full Text Available The Down syndrome cell adhesion molecule (Dscam gene is an extraordinary example of diversity that can produce thousands of isoforms and has so far been found only in insects and crustaceans. Cumulative evidence indicates that Dscam may contribute to the mechanistic foundations of specific immune responses in insects. However, the mechanism and functions of Dscam in relation to pathogens and immunity remain largely unknown. In this study, we identified the genome organization and alternative Dscam exons from Chinese mitten crab, Eriocheir sinensis. These variants, designated EsDscam, potentially produce 30,600 isoforms due to three alternatively spliced immunoglobulin (Ig domains and a transmembrane domain. EsDscam was significantly upregulated after bacterial challenge at both mRNA and protein levels. Moreover, bacterial specific EsDscam isoforms were found to bind specifically with the original bacteria to facilitate efficient clearance. Furthermore, bacteria-specific binding of soluble EsDscam via the complete Ig1–Ig4 domain significantly enhanced elimination of the original bacteria via phagocytosis by hemocytes; this function was abolished by partial Ig1–Ig4 domain truncation. Further studies showed that knockdown of membrane-bound EsDscam inhibited the ability of EsDscam with the same extracellular region to promote bacterial phagocytosis. Immunocytochemistry indicated colocalization of the soluble and membrane-bound forms of EsDscam at the hemocyte surface. Far-Western and coimmunoprecipitation assays demonstrated homotypic interactions between EsDscam isoforms. This study provides insights into a mechanism by which soluble Dscam regulates hemocyte phagocytosis via bacteria-specific binding and specific interactions with membrane-bound Dscam as a phagocytic receptor.

  14. Secondary metabolites from marine microorganisms.

    Science.gov (United States)

    Kelecom, Alphonse

    2002-03-01

    After 40 years of intensive research, chemistry of marine natural products has become a mature field. Since 1995, there are signals of decreased interest in the search of new metabolites from traditional sources such as macroalgae and octocorals, and the number of annual reports on marine sponges stabilized. On the contrary, metabolites from microorganisms is a rapidly growing field, due, at least in part, to the suspicion that a number of metabolites obtained from algae and invertebrates may be produced by associated microorganisms. Studies are concerned with bacteria and fungi, isolated from seawater, sediments, algae, fish and mainly from marine invertebrates such as sponges, mollusks, tunicates, coelenterates and crustaceans. Although it is still to early to define tendencies, it may be stated that the metabolites from microorganisms are in most cases quite different from those produced by the invertebrate hosts. Nitrogenated metabolites predominate over acetate derivatives, and terpenes are uncommon. Among the latter, sesquiterpenes, diterpenes and carotenes have been isolated; among nitrogenated metabolites, amides, cyclic peptides and indole alkaloids predominate.

  15. Secondary metabolites from marine microorganisms

    Directory of Open Access Journals (Sweden)

    KELECOM ALPHONSE

    2002-01-01

    Full Text Available After 40 years of intensive research, chemistry of marine natural products has become a mature field. Since 1995, there are signals of decreased interest in the search of new metabolites from traditional sources such as macroalgae and octocorals, and the number of annual reports on marine sponges stabilized. On the contrary, metabolites from microorganisms is a rapidly growing field, due, at least in part, to the suspicion that a number of metabolites obtained from algae and invertebrates may be produced by associated microorganisms. Studies are concerned with bacteria and fungi, isolated from seawater, sediments, algae, fish and mainly from marine invertebrates such as sponges, mollusks, tunicates, coelenterates and crustaceans. Although it is still to early to define tendencies, it may be stated that the metabolites from microorganisms are in most cases quite different from those produced by the invertebrate hosts. Nitrogenated metabolites predominate over acetate derivatives, and terpenes are uncommon. Among the latter, sesquiterpenes, diterpenes and carotenes have been isolated; among nitrogenated metabolites, amides, cyclic peptides and indole alkaloids predominate.

  16. PROBIOTICS BASED ON TRANSGENIC MICROORGANISMS

    Directory of Open Access Journals (Sweden)

    S. А. Starovoitova

    2012-02-01

    Full Text Available Modern tendencies of recombinant microorganisms creation for obtaining on their basis a new effective biopreparations (probiotics with wider spectrum of biological and therapeutic properties were considered. A lot of attention was focused on the main genera of perspective bacteria for creation of recombinant probiotics particularly: Lactococcus, Bifidobac terium,Bacillus, Escherichia. The main created Ukrainian and foreign gene-modified strains, that are widely used today in creation of effective recombinant biopreparations were characterized. Some fundamental directions and methods of gene-modified strains obtaining, which are used in getting effective biopreparations that used for therapy and prophylactic illness were reported, under which this group of pharmaceutical drugs were not used earlier. The safety matters of probiotics using on basis of genemodified strains were examined. Medical and veterinary biopreparations on basis of recombinant microorganisms could be used directly and effectively for therapy and prophylaxis of different illness, beginning from disbacteriosis up to cardiovascular diseases. It is related with some probiotic microorganisms ability for lowering of serum cholesterol at the host organism.

  17. Microorganisms as sources of oils

    Directory of Open Access Journals (Sweden)

    Thevenieau France

    2013-11-01

    Full Text Available A number of microorganism belonging to the genera of yeast, fungi, bacteria and microalgae have ability to accumulate substantial amounts of oil, sometimes up to an even in excess of 70% of their biomass weight under specific cultivation conditions. For nearly 100 years, the commercial opportunities of using microorganisms as sources of oils have been continuously examined. Although it was evident that microbial oils could never compete commercially with the major commodity plant oils, there were commercially opportunities for the production of some of the higher valued oils. Today, with the great progress of metabolic and genetic engineering, the developments are focus on the high value oils containing important polyunsaturated or specific fatty acids. Such oils have the potential to be used in different applications area as food, feed and oleochemistry. This review is covering the related researches about different oleaginous microorganisms for lipids production and microbial oils biosynthesis process. In add, the lipid metabolism, metabolic engineering strategies to increase lipid production and the economics of microbial oils production are introduced.

  18. The apolipoprotein L family of programmed cell death and immunity genes rapidly evolved in primates at discrete sites of host-pathogen interactions.

    Science.gov (United States)

    Smith, Eric E; Malik, Harmit S

    2009-05-01

    Apolipoprotein L1 (APOL1) is a human protein that confers immunity to Trypanosoma brucei infections but can be countered by a trypanosome-encoded antagonist SRA. APOL1 belongs to a family of programmed cell death genes whose proteins can initiate host apoptosis or autophagic death. We report here that all six members of the APOL gene family (APOL1-6) present in humans have rapidly evolved in simian primates. APOL6, furthermore, shows evidence of an adaptive sweep during recent human evolution. In each APOL gene tested, we found rapidly evolving codons in or adjacent to the SRA-interacting protein domain (SID), which is the domain of APOL1 that interacts with SRA. In APOL6, we also found a rapidly changing 13-amino-acid cluster in the membrane-addressing domain (MAD), which putatively functions as a pH sensor and regulator of cell death. We predict that APOL genes are antagonized by pathogens by at least two distinct mechanisms: SID antagonists, which include SRA, that interact with the SID of various APOL proteins, and MAD antagonists that interact with the MAD hinge base of APOL6. These antagonists either block or prematurely cause APOL-mediated programmed cell death of host cells to benefit the infecting pathogen. These putative interactions must occur inside host cells, in contrast to secreted APOL1 that trafficks to the trypanosome lysosome. Hence, the dynamic APOL gene family appears to be an important link between programmed cell death of host cells and immunity to pathogens.

  19. Genome sequence of "Candidatus Mycoplasma haemolamae" strain purdue, a red blood cell pathogen of alpacas (Vicugna pacos) and llamas (Lama glama).

    Science.gov (United States)

    Guimaraes, Ana M S; Toth, Balazs; Santos, Andrea P; do Nascimento, Naíla C; Kritchevsky, Janice E; Messick, Joanne B

    2012-11-01

    We report the complete genome sequence of "Candidatus Mycoplasma haemolamae," an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation.

  20. Genome Sequence of “Candidatus Mycoplasma haemolamae” Strain Purdue, a Red Blood Cell Pathogen of Alpacas (Vicugna pacos) and Llamas (Lama glama)

    OpenAIRE

    Guimaraes, Ana M. S.; Toth, Balazs; Santos, Andrea P.; do Nascimento, Naíla C.; Kritchevsky, Janice E.; Messick, Joanne B.

    2012-01-01

    We report the complete genome sequence of “Candidatus Mycoplasma haemolamae,” an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation.

  1. Genome Sequence of “Candidatus Mycoplasma haemolamae” Strain Purdue, a Red Blood Cell Pathogen of Alpacas (Vicugna pacos) and Llamas (Lama glama)

    Science.gov (United States)

    Toth, Balazs; Santos, Andrea P.; do Nascimento, Naíla C.; Kritchevsky, Janice E.

    2012-01-01

    We report the complete genome sequence of “Candidatus Mycoplasma haemolamae,” an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation. PMID:23105057

  2. Transformation of the insecticide teflubenzuron by microorganisms

    NARCIS (Netherlands)

    Finkelstein, Z.I.; Baskunov, B.P.; Rietjens, I.M.C.M.; Boersma, M.G.; Vervoort, J.; Golovleva, L.A.

    2001-01-01

    Transformation of teflubenzuron, the active component in the insecticide commercialized as Nomolt, by soil microorganisms was studied. It was shown that microorganisms, belonging to Bacillus, Alcaligenes, Pseudomonas and Acinetobacter genera are capable to perform the hydrolytic cleavage of the

  3. Role and functions of beneficial microorganisms in sustainable aquaculture.

    Science.gov (United States)

    Zhou, Qunlan; Li, Kangmin; Jun, Xie; Bo, Liu

    2009-08-01

    This paper aims to review the development of scientific concepts of microecology and ecology of microbes and the role and functions of beneficial microorganisms in aquaculture and mariculture. Beneficial microorganisms play a great role in natural and man-made aquatic ecosystems based on the co-evolution theory in living biosphere on earth. Their functions are to adjust algal population in water bodies so as to avoid unwanted algal bloom; to speed up decomposition of organic matter and to reduce CODmn, NH3-N and NO2-N in water and sediments so as to improve water quality; to suppress fish/shrimp diseases and water-borne pathogens; to enhance immune system of cultured aquatic animals and to produce bioactive compounds such as vitamins, hormones and enzymes that stimulate growth, thus to decrease the FCR of feed.

  4. Global expression profile of biofilm resistance to antimicrobial compounds in the plant-pathogenic bacterium Xylella fastidiosa reveals evidence of persister cells.

    Science.gov (United States)

    Muranaka, Lígia S; Takita, Marco A; Olivato, Jacqueline C; Kishi, Luciano T; de Souza, Alessandra A

    2012-09-01

    Investigations of biofilm resistance response rarely focus on plant-pathogenic bacteria. Since Xylella fastidiosa is a multihost plant-pathogenic bacterium that forms biofilm in the xylem, the behavior of its biofilm in response to antimicrobial compounds needs to be better investigated. We analyzed here the transcriptional profile of X. fastidiosa subsp. pauca in response to inhibitory and subinhibitory concentrations of copper and tetracycline. Copper-based products are routinely used to control citrus diseases in the field, while antibiotics are more widely used for bacterial control in mammals. The use of antimicrobial compounds triggers specific responses to each compound, such as biofilm formation and phage activity for copper. Common changes in expression responses comprise the repression of genes associated with metabolic functions and movement and the induction of toxin-antitoxin systems, which have been associated with the formation of persister cells. Our results also show that these cells were found in the population at a ca. 0.05% density under inhibitory conditions for both antimicrobial compounds and that pretreatment with subinhibitory concentration of copper increases this number. No previous report has detected the presence of these cells in X. fastidiosa population, suggesting that this could lead to a multidrug tolerance response in the biofilm under a stressed environment. This is a mechanism that has recently become the focus of studies on resistance of human-pathogenic bacteria to antibiotics and, based on our data, it seems to be more broadly applicable.

  5. Neonatal intensive care unit: Reservoirs of Nosocomial pathogens ...

    African Journals Online (AJOL)

    Improvement in the care and treatment of neonates had contributed to their increased survival. Nosocomial infection remains an important problem in intensive care units. Hospital wards had been shown to act as reservoirs of pathogenic microorganisms associated with infection. To assess the prevalence of pathogenic ...

  6. IPM potentials of microbial pathogens and diseases of mites

    NARCIS (Netherlands)

    van der Geest, L.P.S.; Ciancio, A.; Mukerji, K.G.

    2010-01-01

    An overview is given of diseases in mites, caused by infectious microorganisms. Many pathogens play an important role in the regulation of natural populations of mite populations and are for this reason subject of research on the feasibility to develop such pathogens to biological control agents.

  7. 40 CFR 725.85 - Microorganism identity.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Microorganism identity. 725.85 Section... to Information § 725.85 Microorganism identity. (a) Claims applicable to the period prior to... specific microorganism identity at the time of submission of the information. This claim will apply only to...

  8. Inflammasome and Fas-Mediated IL-1β Contributes to Th17/Th1 Cell Induction in Pathogenic Bacterial Infection In Vivo.

    Science.gov (United States)

    Uchiyama, Ryosuke; Yonehara, Shin; Taniguchi, Shun'ichiro; Ishido, Satoshi; Ishii, Ken J; Tsutsui, Hiroko

    2017-08-01

    CD4 + Th cells play crucial roles in orchestrating immune responses against pathogenic microbes, after differentiating into effector subsets. Recent research has revealed the importance of IFN-γ and IL-17 double-producing CD4 + Th cells, termed Th17/Th1 cells, in the induction of autoimmune and inflammatory diseases. In addition, Th17/Th1 cells are involved in the regulation of infection caused by the intracellular bacterium Mycobacterium tuberculosis in humans. However, the precise mechanism of Th17/Th1 induction during pathogen infection is unclear. In this study, we showed that the inflammasome and Fas-dependent IL-1β induces Th17/Th1 cells in mice, in response to infection with the pathogenic intracellular bacterium Listeria monocytogenes In the spleens of infected wild-type mice, Th17/Th1 cells were induced, and expressed T-bet and Rorγt. In Pycard -/- mice, which lack the adaptor molecule of the inflammasome (apoptosis-associated speck-like protein containing a caspase recruitment domain), Th17/Th1 induction was abolished. In addition, the Fas-mediated IL-1β production was required for Th17/Th1 induction during bacterial infection: Th17/Th1 induction was abolished in Fas -/- mice, whereas supplementation with recombinant IL-1β restored Th17/Th1 induction via IL-1 receptor 1 (IL-1R1), and rescued the mortality of Fas -/- mice infected with Listeria IL-1R1, but not apoptosis-associated speck-like protein containing a caspase recruitment domain or Fas on T cells, was required for Th17/Th1 induction, indicating that IL-1β stimulates IL-1R1 on T cells for Th17/Th1 induction. These results indicate that IL-1β, produced by the inflammasome and Fas-dependent mechanisms, contributes cooperatively to the Th17/Th1 induction during bacterial infection. This study provides a deeper understanding of the molecular mechanisms underlying Th17/Th1 induction during pathogenic microbial infections in vivo. Copyright © 2017 by The American Association of Immunologists

  9. [Long-term storage of obligate anaerobic microorganisms in glycerol].

    Science.gov (United States)

    Briukhanov, A I; Netrusov, A I

    2006-01-01

    We evaluated the possibility of storing the cultures of obligate anaerobic microorganisms (clostridia. acetogenic and sulfate-reducing bacteria, and methanogenic archaea) in 25% glycerol at -70 degrees C for a long time (up to 3 years). This method of storage is adequate to preserve cell viability in most obligate anaerobes.

  10. The oxidant-scavenging abilities in the oral cavity may be regulated by a collaboration among antioxidants in saliva, microorganisms, blood cells and polyphenols: a chemiluminescence-based study.

    Directory of Open Access Journals (Sweden)

    Isaac Ginsburg

    Full Text Available Saliva has become a central research issue in oral physiology and pathology. Over the evolution, the oral cavity has evolved the antioxidants uric acid, ascorbate reduced glutathione, plasma-derived albumin and antioxidants polyphenols from nutrients that are delivered to the oral cavity. However, blood cells extravasated from injured capillaries in gingival pathologies, or following tooth brushing and use of tooth picks, may attenuate the toxic activities of H2O2 generated by oral streptococci and by oxidants generated by activated phagocytes. Employing a highly sensitive luminol-dependent chemiluminescence, the DPPH radical and XTT assays to quantify oxidant-scavenging abilities (OSA, we show that saliva can strongly decompose both oxygen and nitrogen species. However, lipophilic antioxidant polyphenols in plants, which are poorly soluble in water and therefore not fully available as effective antioxidants, can nevertheless be solubilized either by small amounts of ethanol, whole saliva or also by salivary albumin and mucin. Plant-derived polyphenols can also act in collaboration with whole saliva, human red blood cells, platelets, and also with catalase-positive microorganisms to decompose reactive oxygen species (ROS. Furthermore, polyphenols from nutrient can avidly adhere to mucosal surfaces, are retained there for long periods and may function as a "slow-release devises" capable of affecting the redox status in the oral cavity. The OSA of saliva is due to the sum result of low molecular weight antioxidants, albumin, polyphenols from nutrients, blood elements and microbial antioxidants. Taken together, saliva and its antioxidants are considered regulators of the redox status in the oral cavity under physiological and pathological conditions.

  11. The Oxidant-Scavenging Abilities in the Oral Cavity May Be Regulated by a Collaboration among Antioxidants in Saliva, Microorganisms, Blood Cells and Polyphenols: A Chemiluminescence-Based Study

    Science.gov (United States)

    Ginsburg, Isaac; Kohen, Ron; Shalish, Miri; Varon, David; Shai, Ella; Koren, Erez

    2013-01-01

    Saliva has become a central research issue in oral physiology and pathology. Over the evolution, the oral cavity has evolved the antioxidants uric acid, ascorbate reduced glutathione, plasma-derived albumin and antioxidants polyphenols from nutrients that are delivered to the oral cavity. However, blood cells extravasated from injured capillaries in gingival pathologies, or following tooth brushing and use of tooth picks, may attenuate the toxic activities of H2O2 generated by oral streptococci and by oxidants generated by activated phagocytes. Employing a highly sensitive luminol-dependent chemiluminescence, the DPPH radical and XTT assays to quantify oxidant-scavenging abilities (OSA), we show that saliva can strongly decompose both oxygen and nitrogen species. However, lipophilic antioxidant polyphenols in plants, which are poorly soluble in water and therefore not fully available as effective antioxidants, can nevertheless be solubilized either by small amounts of ethanol, whole saliva or also by salivary albumin and mucin. Plant-derived polyphenols can also act in collaboration with whole saliva, human red blood cells, platelets, and also with catalase-positive microorganisms to decompose reactive oxygen species (ROS). Furthermore, polyphenols from nutrient can avidly adhere to mucosal surfaces, are retained there for long periods and may function as a “slow- release devises” capable of affecting the redox status in the oral cavity. The OSA of saliva is due to the sum result of low molecular weight antioxidants, albumin, polyphenols from nutrients, blood elements and microbial antioxidants. Taken together, saliva and its antioxidants are considered regulators of the redox status in the oral cavity under physiological and pathological conditions. PMID:23658797

  12. Expanding the potential of NAI-107 for treating serious ESKAPE pathogens

    DEFF Research Database (Denmark)

    Brunati, Cristina; Thomsen, Thomas T; Gaspari, Eleonora

    2018-01-01

    Objectives: To characterize NAI-107 and related lantibiotics for their in vitro activity against Gram-negative pathogens, alone or in combination with polymyxin, and against non-dividing cells or biofilms of Staphylococcus aureus. NAI-107 was also evaluated for its propensity to select or induce...... showed that NAI-107 and its brominated variant are highly active against Neisseria gonorrhoeae and some other fastidious Gram-negative pathogens. Furthermore, all compounds strongly synergized with polymyxin against Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and Pseudomonas...... self-resistance in Gram-positive bacteria. Methods: We used MIC determinations and chequerboard experiments to establish the antibacterial activity of the examined compounds against target microorganisms. Time-kill assays were used to evaluate killing of exponential and stationary-phase cells...

  13. Pathogen intelligence

    Directory of Open Access Journals (Sweden)

    Michael eSteinert

    2014-01-01

    Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.

  14. Effects of Atrazine on Soil Microorganisms

    Directory of Open Access Journals (Sweden)

    Ljiljana Radivojević

    2006-01-01

    Full Text Available Effects of the herbicide atrazine on soil microorganisms was investigated. Trials were set up in laboratory, on a clay loam soil. Atrazine was applied at 8.0, 40.0 and 80.0 mg/kg soil rates. The abundance of total microorganisms, fungi, actinomycetes, cellulolytic microorganisms and amino-heterotrophs was recorded. Soil samples were collected 1, 7, 14, 21, 30 and 60 days after atrazine treatment for microbiological analyses.The results showed that the intensity of atrazine effect on soil microorganisms depended on treatment rate, exposure time and group of microorganisms. Atrazine had an inhibiting effect on cellulolytic microorganisms and amino-heterotrophs. Initially, it inhibited fungiand actinomycetes but its effect turned into a stimulating one once a population recovered. Atrazine had a stimulating effect on total abundance of microorganisms.

  15. Association of serum Clara cell protein CC16 with respiratory infections and immune response to respiratory pathogens in elite athletes.

    Science.gov (United States)

    Kurowski, Marcin; Jurczyk, Janusz; Jarzębska, Marzanna; Moskwa, Sylwia; Makowska, Joanna S; Krysztofiak, Hubert; Kowalski, Marek L

    2014-04-15

    Respiratory epithelium integrity impairment caused by intensive exercise may lead to exercise-induced bronchoconstriction. Clara cell protein (CC16) has anti-inflammatory properties and its serum level reflects changes in epithelium integrity and airway inflammation. This study aimed to investigate serum CC16 in elite athletes and to seek associations of CC16 with asthma or allergy, respiratory tract infections (RTIs) and immune response to respiratory pathogens. The study was performed in 203 Olympic athletes. Control groups comprised 53 healthy subjects and 49 mild allergic asthmatics. Serum levels of CC16 and IgG against respiratory viruses and Mycoplasma pneumoniae were assessed. Allergy questionnaire for athletes was used to determine symptoms and exercise pattern. Current versions of ARIA and GINA guidelines were used when diagnosing allergic rhinitis and asthma, respectively. Asthma was diagnosed in 13.3% athletes, of whom 55.6% had concomitant allergic rhinitis. Allergic rhinitis without asthma was diagnosed in 14.8% of athletes. Mean CC16 concentration was significantly lower in athletes versus healthy controls and mild asthmatics. Athletes reporting frequent RTIs had significantly lower serum CC16 and the risk of frequent RTIs was more than 2-fold higher in athletes with low serum CC16 (defined as equal to or less than 4.99 ng/ml). Athletes had significantly higher anti-adenovirus IgG than healthy controls while only non-atopic athletes had anti-parainfluenza virus IgG significantly lower than controls. In all athletes weak correlation of serum CC16 and anti-parainfluenza virus IgG was present (R = 0.20, p athletes a weak positive correlations of CC16 with IgG specific for respiratory syncytial virus (R = 0.29, p = 0.009), parainfluenza virus (R = 0.31, p = 0.01) and adenovirus (R = 0.27, p = 0.02) were seen as well. Regular high-load exercise is associated with decrease in serum CC16 levels. Athletes with decreased CC16 are

  16. The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

    Science.gov (United States)

    de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

    2015-11-01

    In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

  17. Removal of triazine herbicides from freshwater systems using photosynthetic microorganisms

    International Nuclear Information System (INIS)

    Gonzalez-Barreiro, O.; Rioboo, C.; Herrero, C.; Cid, A.

    2006-01-01

    The uptake of the triazine herbicides, atrazine and terbutryn, was determined for two freshwater photosynthetic microorganisms, the green microalga Chlorella vulgaris and the cyanobacterium Synechococcus elongatus. An extremely rapid uptake of both pesticides was recorded, although uptake rate was lower for the cyanobacterium, mainly for atrazine. Other parameters related to the herbicide bioconcentration capacity of these microorganisms were also studied. Growth rate, biomass, and cell viability in cultures containing herbicide were clearly affected by herbicide uptake. Herbicide toxicity and microalgae sensitivity were used to determine the effectiveness of the bioconcentration process and the stability of herbicide removal. C. vulgaris showed higher bioconcentration capability for these two triazine herbicides than S. elongatus, especially with regard to terbutryn. This study supports the usefulness of such microorganisms, as a bioremediation technique in freshwater systems polluted with triazine herbicides

  18. Removal of triazine herbicides from freshwater systems using photosynthetic microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Barreiro, O. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Rioboo, C. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Herrero, C. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Cid, A. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain)]. E-mail: cid@udc.es

    2006-11-15

    The uptake of the triazine herbicides, atrazine and terbutryn, was determined for two freshwater photosynthetic microorganisms, the green microalga Chlorella vulgaris and the cyanobacterium Synechococcus elongatus. An extremely rapid uptake of both pesticides was recorded, although uptake rate was lower for the cyanobacterium, mainly for atrazine. Other parameters related to the herbicide bioconcentration capacity of these microorganisms were also studied. Growth rate, biomass, and cell viability in cultures containing herbicide were clearly affected by herbicide uptake. Herbicide toxicity and microalgae sensitivity were used to determine the effectiveness of the bioconcentration process and the stability of herbicide removal. C. vulgaris showed higher bioconcentration capability for these two triazine herbicides than S. elongatus, especially with regard to terbutryn. This study supports the usefulness of such microorganisms, as a bioremediation technique in freshwater systems polluted with triazine herbicides.

  19. Combining nonthermal technologies to control foodborne microorganisms.

    Science.gov (United States)

    Ross, Alexander I V; Griffiths, Mansel W; Mittal, Gauri S; Deeth, Hilton C

    2003-12-31

    Novel nonthermal processes, such as high hydrostatic pressure (HHP), pulsed electric fields (PEFs), ionizing radiation and ultrasonication, are able to inactivate microorganisms at ambient or sublethal temperatures. Many of these processes require very high treatment intensities, however, to achieve adequate microbial destruction in low-acid foods. Combining nonthermal processes with conventional preservation methods enhances their antimicrobial effect so that lower process intensities can be used. Combining two or more nonthermal processes can also enhance microbial inactivation and allow the use of lower individual treatment intensities. For conventional preservation treatments, optimal microbial control is achieved through the hurdle concept, with synergistic effects resulting from different components of the microbial cell being targeted simultaneously. The mechanisms of inactivation by nonthermal processes are still unclear; thus, the bases of synergistic combinations remain speculative. This paper reviews literature on the antimicrobial efficiencies of nonthermal processes combined with conventional and novel nonthermal technologies. Where possible, the proposed mechanisms of synergy is mentioned.

  20. Genetic engineering of microorganisms for biodiesel production

    Science.gov (United States)

    Lin, Hui; Wang, Qun; Shen, Qi; Zhan, Jumei; Zhao, Yuhua

    2013-01-01

    Biodiesel, as one type of renewable energy, is an ideal substitute for petroleum-based diesel fuel and is usually made from triacylglycerides by transesterification with alcohols. Biodiesel production based on microbial fermentation aiming to establish more efficient, less-cost and sustainable biodiesel production strategies is under current investigation by various start-up biotechnology companies and research centers. Genetic engineering plays a key role in the transformation of microbes into the desired cell factories with high efficiency of biodiesel production. Here, we present an overview of principal microorganisms used in the microbial biodiesel production and recent advances in metabolic engineering for the modification required. Overexpression or deletion of the related enzymes for de novo synthesis of biodiesel is highlighted with relevant examples. PMID:23222170

  1. Invasion of vascular cells in vitro by Porphyromonas endodontalis.

    Science.gov (United States)

    Dorn, B R; Harris, L J; Wujick, C T; Vertucci, F J; Progulske-Fox, A

    2002-04-01

    The objective of this study was to determine whether laboratory strains and clinical isolates of microorganisms associated with root canal infections can invade primary cultures of cardiovascular cells. Quantitative levels of bacterial invasion of human coronary artery endothelial cells (HCAEC) and coronary artery smooth muscle cells (CASMC) were measured using a standard antibiotic protection assay. Transmission electron microscopy was used to confirm and visualize internalization within the vascular cells. Of the laboratory and clinical strains tested, only P. endodontalis ATCC 35406 was invasive in an antibiotic protection assay using HCAEC and CASMC. Invasion of P. endodontalis ATCC 35406 was confirmed by transmission electron microscopy. Certain microorganisms associated with endodontic infections are invasive. If bacterial invasion of the vasculature contributes to the pathogenesis of cardiovascular disease, then microorganisms in the pulp chamber represent potential pathogens.

  2. Marine microorganisms. Umi no biseibutsu

    Energy Technology Data Exchange (ETDEWEB)

    Shimizu, U. (Hiroshima University, Hiroshima (Japan). Faculty of Applied Biological Science)

    1992-11-10

    This paper explains properties, interactions, and activities of marine microorganisms. Marine bacteria include bacteria of vibrio family of arteromonas genus, luminous bacteria, and aerobic photosynthetic bacteria. Majority of marine bacteria is halophilic, and many proliferate at 5[degree]C or lower. Some of them can proliferate at 20[degree]C to 30[degree]C, or as high temperature as 80[degree]C and higher. Spongiaria and tumicata have many symbiotic microorganisms, and genes equivalent to luminous bacteria genes were discovered in DNA of light emitting organs in luminous fishes. It was verified that animal groups in upwelling zones are supported by bacteria that assimilate inorganics supplied from ocean bottoms. Marine bacteria decompose almost all of organics brought in from land to sea, and those produced in sea. Marine bacteria engage in complex interrelations with other organisms for competition, antagonism, parasitism, and symbiosis. The bacteria make antibacterial substances, anti-algae bacteria, enzyme inhibitors, toxins, pharmacologically active substances, and such physiologically active substances as deposition promoting substances to undersea structures including shells and barnacles, and deposition blocking substances. 53 refs., 3 figs.

  3. Distributions of microorganisms in foods and their impact on food safety

    NARCIS (Netherlands)

    Jongenburger, I.

    2012-01-01

    The physical distributions of pathogens in foods influence the likelihood that a food product will cause illness, but knowledge about the physical distribution of microorganisms in foods and especially the heterogeneity therein is scarce. This Ph.D. research aims to increase the knowledge of

  4. The utility and limitations of current web-available algorithms to predict peptides recognized by CD4 T cells in response to pathogen infection #

    Science.gov (United States)

    Chaves, Francisco A.; Lee, Alvin H.; Nayak, Jennifer; Richards, Katherine A.; Sant, Andrea J.

    2012-01-01

    The ability to track CD4 T cells elicited in response to pathogen infection or vaccination is critical because of the role these cells play in protective immunity. Coupled with advances in genome sequencing of pathogenic organisms, there is considerable appeal for implementation of computer-based algorithms to predict peptides that bind to the class II molecules, forming the complex recognized by CD4 T cells. Despite recent progress in this area, there is a paucity of data regarding their success in identifying actual pathogen-derived epitopes. In this study, we sought to rigorously evaluate the performance of multiple web-available algorithms by comparing their predictions and our results using purely empirical methods for epitope discovery in influenza that utilized overlapping peptides and cytokine Elispots, for three independent class II molecules. We analyzed the data in different ways, trying to anticipate how an investigator might use these computational tools for epitope discovery. We come to the conclusion that currently available algorithms can indeed facilitate epitope discovery, but all shared a high degree of false positive and false negative predictions. Therefore, efficiencies were low. We also found dramatic disparities among algorithms and between predicted IC50 values and true dissociation rates of peptide:MHC class II complexes. We suggest that improved success of predictive algorithms will depend less on changes in computational methods or increased data sets and more on changes in parameters used to “train” the algorithms that factor in elements of T cell repertoire and peptide acquisition by class II molecules. PMID:22467652

  5. Screening and characterization of useful microorganisms to arsenic removal

    OpenAIRE

    宮武, 宗利; 林, 幸男

    2007-01-01

    Microorganisms were isolated from soil and their arsenic removal abilities were evaluated. Seven out of the 100 isolated strains showed more than 20% arsenic removal. Time courses of arsenic removal and cell growth were investigated in three of these isolated strains. Although the growth rates were different, the dependence of arsenic removal on cell growth was similar in three strains (A-84, 88, 89). Strain A-89 showed highest arsenic removal rate of 63% after first day. Strain A-88 was best...

  6. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  7. The Prenylflavonoid Xanthohumol Reduces Alzheimer-Like Changes and Modulates Multiple Pathogenic Molecular Pathways in the Neuro2a/APPswe