Monitoring of opportunistic and pathogenic microorganisms in surgical departments of Dniprodzerzhynsk

Directory of Open Access Journals (Sweden)

N. N. Donets

2013-03-01

Full Text Available The paper presents monitoring results of the spread of opportunistic and pathogenic microorganisms in patients of surgical departments of the Dniprodzerzhynsk city hospital No 7. 1464 strains of bacteria isolated from biological material of the patients from January to December 2012 were studied. Relevant standard methods of research and data interpretation in accordance with the regulatory guidelines were used. The microorganisms’ sensitivity to antibiotics was determined by the disk diffusion method. Assessment of the resistance of isolated microorganisms to antibiotics was made with the software Whonet 5.1. At the first stage of investigation sampling biological material and inoculation in the culture medium were made. The discharges of wounds, throat, nose, ears, vagina and urethra, and also urine from patients of surgical departments were sampled for bacteriological analysis. The main substratum was 5% blood agar. There may additionally be used the selective growth media (yolk-salt agar, Endo, and Saburo. At the second stage we identify microorganisms with bacterioscopic, bacteriological and biochemical methods. Identifying microorganisms of the genus Staphylococcus was made by the reaction of lecithinase presence, plasma-coagulation reaction and the mannitol oxidation reaction. For the identification of bacteria of the family Streptococcaceae the growth pattern in 0.5% sugar medium was used. It was differentiated from bacteria of the genus Enterococcus by plating onto egg yolk agar base and milk with 0.1% methylene blue. Identification of bacteria of the Enterobacteriaceae family was made by studying their colonies on dense differential diagnostic media. Suspicious colonies were transferred on a combined medium for primary identification (Olkenitsky's medium. Then the biochemical signs of enterobacteria were studied in the minimum number of tests. The third phase of the study included the determination of the sensitivity of

The global dispersion of pathogenic microorganisms by dust storms and its relevance to agriculture: Chapter 1

Science.gov (United States)

Gonzalez-Martin, Cristina; Teigell-Perez, Nuria; Valladares, Basilio; Griffin, Dale W.

2014-01-01

Dust storms move an estimated 500–5000 Tg of soil through Earth’s atmosphere every year. Dust-storm transport of topsoils may have positive effects such as fertilization of aquatic and terrestrial ecosystems and the evolution of soils in proximal and distal environments. Negative effects may include the stripping of nutrient-rich topsoils from source regions, sandblasting of plant life in downwind environments, the fertilization of harmful algal blooms, and the transport of toxins (e.g., metals, pesticides, herbicides, etc.) and pathogenic microorganisms. With respect to the long-range dispersion of microorganisms and more specifically pathogens, research is just beginning to demonstrate the quantity and diversity of organisms that can survive this type of transport. Most studies to date have utilized different assays to identify microorganisms and microbial communities using predominately culture-based, and more recently nonculture-based, methodologies. There is a clear need for international-scale research efforts that apply standardized methods to advance this field of science. Here we present a review of dust-borne microorganisms with a focus on their relevance to agronomy.

Studies on the radiation sensitivity of food microorganism by high dose irradiation

International Nuclear Information System (INIS)

Hwang, Han Joon; Lee, Eun Jung; Yu, Hyun Hee; Lee, Jae Ho

2010-04-01

We investigated the radio resistance of pathogenic microorganisms (Bacillus cereus, Staphylococcus aureus, Methicillin resistant Staphylococcus aureus(MRSA) and Escherichia coli O157) in irradiating environments. Their radiation conditions of pathogenic microorganisms varied with pH(3-10), salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition. In addition, the effect of γ-irradiation on the inactivation of pathogenic microorganisms inoculated into food (saengsik, sliced ham, chopped beef) was investigated. The radiation dose ranged from 0 to 3 kGy. The γ--irradiated B.cereus(γ--BC) St.aureus(γ--SA), MRSA(γ--MRSA) and E.coli O157(γ--EC) were then cultured and the viable cell count on plate count agar and D10-values(dose required to inactivate 90% of a microbial population) were calculated. The number of pathogenic microorganisms at pH(3-10) and salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition decreased by 1 log CFU/ml after irradiation. The D 10 -value of γ--SA in the optimum condition was 0.152 kGy, and these of γ--MRSA and γ--EC were 0.346 and 0.240 kGy, respectively. The initial cell counts of pathogenic microorganisms in culture broth were slightly decreased as the decrease of pH and the increase of salt concentration. However, radiation resistance of pathogenic microorganisms was increased at frozen state. Moreover, D 10 -values of these is test strains in saengsik, sliced ham and chopped beef were 0.597, 0.226 , 0.398 and 0.416 kGy, respectively. These results provide the basic information for the in activation of pathogenic microorganisms in foods by irradiation

Studies on the radiation sensitivity of food microorganism by high dose irradiation

Energy Technology Data Exchange (ETDEWEB)

Hwang, Han Joon; Lee, Eun Jung; Yu, Hyun Hee; Lee, Jae Ho [Korea University, Seoul (Korea, Republic of)

2010-04-15

We investigated the radio resistance of pathogenic microorganisms (Bacillus cereus, Staphylococcus aureus, Methicillin resistant Staphylococcus aureus(MRSA) and Escherichia coli O157) in irradiating environments. Their radiation conditions of pathogenic microorganisms varied with pH(3-10), salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition. In addition, the effect of {gamma}-irradiation on the inactivation of pathogenic microorganisms inoculated into food (saengsik, sliced ham, chopped beef) was investigated. The radiation dose ranged from 0 to 3 kGy. The {gamma}--irradiated B.cereus({gamma}--BC) St.aureus({gamma}--SA), MRSA({gamma}--MRSA) and E.coli O157({gamma}--EC) were then cultured and the viable cell count on plate count agar and D10-values(dose required to inactivate 90% of a microbial population) were calculated. The number of pathogenic microorganisms at pH(3-10) and salt concentration(1-15%), temperature(-20, 4 and 25 .deg. C) and atmospheric condition decreased by 1 log CFU/ml after irradiation. The D{sub 10}-value of {gamma}--SA in the optimum condition was 0.152 kGy, and these of {gamma}--MRSA and {gamma}--EC were 0.346 and 0.240 kGy, respectively. The initial cell counts of pathogenic microorganisms in culture broth were slightly decreased as the decrease of pH and the increase of salt concentration. However, radiation resistance of pathogenic microorganisms was increased at frozen state. Moreover, D{sub 10}-values of these is test strains in saengsik, sliced ham and chopped beef were 0.597, 0.226 , 0.398 and 0.416 kGy, respectively. These results provide the basic information for the in activation of pathogenic microorganisms in foods by irradiation

An Evaluation Method for the Suppression of Pathogenic Fusarium oxysporum by Soil Microorganisms Using the Dilution Plate Technique.

Science.gov (United States)

Mitsuboshi, Masahiro; Kioka, Yuuzou; Noguchi, Katsunori; Asakawa, Susumu

2016-09-29

Soil-borne diseases caused by pathogenic microorganisms are one of the main factors responsible for the decline in crop yields in farmlands. Pathogenic Fusarium oxysporum causes serious damage to various crops, and, thus, a feasible diagnostic method for soil-borne diseases is required. We herein examined a simple method to evaluate the suppressiveness of soil microorganisms against a pathogen by co-cultivating indigenous soil microorganisms and a pathogenic fungus (F. oxysporum f. sp. spinaciae). We inoculated F. oxysporum onto the center of agar medium plates mixed with a dilution series of a suspension of organic fertilizers or soil. After an approximately one-week cultivation, the growth degree of F. oxysporum was estimated based on the size of the colonies that formed on the plates. The growth degree of F. oxysporum significantly differed among the organic fertilizers tested, indicating the usefulness of the method for evaluating suppressiveness by organic fertilizers. Differences in the growth degrees of F. oxysporum were associated with the incidence of disease in spinach on soil treated with organic fertilizers and inoculated with a pathogenic F. oxysporum strain. These results suggested that this method provides some useful information on the suppressiveness of organic fertilizers and soil against Fusarium wilt.

77 FR 45350 - Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With...

Science.gov (United States)

2012-07-31

... ENVIRONMENTAL PROTECTION AGENCY Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With Focus on Food and Water AGENCY: Environmental Protection Agency (EPA). ACTION... risk assessment and also promote consistency in approaches and methods. The MRA Guideline can be...

Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

Science.gov (United States)

García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

2016-01-01

The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

The pathogenic microorganisms in papanicolaou vaginal smears and correlation with inflammation.

Directory of Open Access Journals (Sweden)

Esmat Barouti

2013-03-01

Full Text Available Non-specific cervicitis or inflammatory changes in a smear report are common which are usually unclear for clinical approaches. To investigate the frequency of inflammation and pathogenic vaginal microorganisms in cervical smears among an Iranian population sample.This cross-sectional study was carried out on Pap smear samples of women referred to gynecological clinic of Taleghani Hospital in Tehran, Iran, between October 2008 and March 2009. This study was conducted on 528 conventional Papanicolaou cervical smears. The frequency and severity of inflammation and prevalence of bacterial vaginosis (BV, Trichomonas vaginalis (TV, and vaginal candidiasis (VC was determined in the samples. Also co-infection of the microorganisms in Pap samples was evaluated. percentage, mean±standard deviation of the outcome parameters were calculated. The comparison between data was performed with the Pearson's chi square or Fisher's exact test.The prevalence of BV, VC, and TV in Pap samples was 17%, 11%, and 0.4% respectively. Overall, the prevalence of these microorganisms in women of reproductive age was higher than menopausal women. There was a significant association between VC and the presence of inflammation in our samples.Based on our results, inflammation in the Pap smears can suggest an infection of VC and the patients should be considered for proper VC treatment.

Multiorganismal insects: diversity and function of resident microorganisms.

Science.gov (United States)

Douglas, Angela E

2015-01-07

All insects are colonized by microorganisms on the insect exoskeleton, in the gut and hemocoel, and within insect cells. The insect microbiota is generally different from microorganisms in the external environment, including ingested food. Specifically, certain microbial taxa are favored by the conditions and resources in the insect habitat, by their tolerance of insect immunity, and by specific mechanisms for their transmission. The resident microorganisms can promote insect fitness by contributing to nutrition, especially by providing essential amino acids, B vitamins, and, for fungal partners, sterols. Some microorganisms protect their insect hosts against pathogens, parasitoids, and other parasites by synthesizing specific toxins or modifying the insect immune system. Priorities for future research include elucidation of microbial contributions to detoxification, especially of plant allelochemicals in phytophagous insects, and resistance to pathogens; as well as their role in among-insect communication; and the potential value of manipulation of the microbiota to control insect pests.

Use of Lactobacillus plantarum Strains as a Bio-Control Strategy against Food-Borne Pathogenic Microorganisms

Science.gov (United States)

Arena, Mattia Pia; Silvain, Amandine; Normanno, Giovanni; Grieco, Francesco; Drider, Djamel; Spano, Giuseppe; Fiocco, Daniela

2016-01-01

Lactobacillus plantarum is one of the most versatile species extensively used in the food industry both as microbial starters and probiotic microorganisms. Several L. plantarum strains have been shown to produce different antimicrobial compounds such as organic acids, hydrogen peroxide, diacetyl, and also bacteriocins and antimicrobial peptides, both denoted by a variable spectrum of action. In recent decades, the selection of microbial molecules and/or bacterial strains able to produce antagonistic molecules to be used as antimicrobials and preservatives has been attracting scientific interest, in order to eliminate or reduce chemical additives, because of the growing attention of consumers for healthy and natural food products. The aim of this work was to investigate the antimicrobial activity of several food-isolated L. plantarum strains, analyzed against the pathogenic bacteria Listeria monocytogenes, Salmonella Enteritidis, Escherichia coli O157:H7 and Staphylococcus aureus. Antagonistic activity was assayed by agar spot test and revealed that strain L. plantarum 105 had the strongest ability to contrast the growth of L. monocytogenes, while strains L. plantarum 106 and 107 were the most active microorganisms against E. coli O157:H7. The antimicrobial ability was also screened by well diffusion assay and broth micro-dilution method using cell-free supernatants (CFS) from each Lactobacillus strain. Moreover, the chemical nature of the molecules released in the CFS, and possibly underlying the antagonistic activity, was preliminary characterized by exposure to different constraints such as pH neutralization, heating, catalase, and proteinase treatments. Our data suggest that the ability of L. plantarum cultures to contrast pathogens growth in vitro depends, at least in part, on a pH-lowering effect of supernatants and/or on the presence of organic acids. Cluster analysis was performed in order to group L. plantarum strains according to their antimicrobial effect

Antimicrobial activity of methanolic extracts of selected marine macroalgae against some pathogenic microorganisms

Directory of Open Access Journals (Sweden)

Ehab Omer Abdalla

2016-05-01

Full Text Available Objective: To evaluate the antimicrobial activity of methanolic extracts of six marine macroalgae belonging to green algae (Chlorophyceae, brown algae (Phaeophyceae and the red algae (Rhodophyceae collected from the intertidal area of the Sudanese Red Sea coast near Port Sudan. Methods: Methanol was used for extracting the active principles of the algae and the disc diffusion method was performed to examine the activity and the minimum inhibitory concentration of the samples against four pathogenic bacteria and two fungi. Results: All tested algal extracts exhibited considerable bioactivity and inhibited the growth of all pathogenic microorganisms under investigation. The green alga Caulerpa racemosa produced the maximum inhibition zone (21 mm against Candida albicans while the red alga Laurencia papillosa showed low antimicrobial activity with the minimum inhibition zone of 10 mm against Pseudomonas aeruginosa. The tested algal extracts did not show any special antimicrobial influence on the selected microorganisms when they were considered as Grampositive and Gram-negative bacteria and fungi but the most efficient methanolic extracts in inhibiting microbial growth were those of green macroalgae followed by the brown and the red macroalgae respectively. Conclusions: The study demonstrated that the tested marine macroalgae from Sudanese Red Sea coast may represent a potential and alternative source for secondary metabolites with antimicrobial activity.

Probiotic Microorganisms Inhibit Epithelial Cell Internalization of Botulinum Neurotoxin Serotype A

Science.gov (United States)

Lam, Tina I.; Tam, Christina C.; Stanker, Larry H.; Cheng, Luisa W.

2016-01-01

Botulinum neurotoxins (BoNTs) are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that both BoNT serotype A complex and holotoxin can bind and transit through the intestinal epithelia to disseminate in the blood. The timing of BoNT/A toxin internalization was shown to be comparable in both the Caco-2 in vitro cell culture and in the oral mouse intoxication models. Probiotic microorganisms have been extensively studied for their beneficial effects in not only maintaining the normal gut mucosa but also protection from allergens, pathogens, and toxins. In this study, we evaluate whether probiotic microorganisms will block BoNT/A uptake in the in vitro cell culture system using Caco-2 cells. Several probiotics tested (Saccharomyces boulardii, Lactobacillus acidophilus, Lactobacillus rhamnosus LGG, and Lactobacillus reuteri) blocked BoNT/A uptake in a dose-dependent manner whereas a non-probiotic strain of Escherichia coli did not. We also showed that inhibition of BoNT/A uptake was not due to the degradation of BoNT/A nor by sequestration of toxin via binding to probiotics. These results show for the first time that probiotic treatment can inhibit BoNT/A binding and internalization in vitro and may lead to the development of new therapies. PMID:27999281

Probiotic Microorganisms Inhibit Epithelial Cell Internalization of Botulinum Neurotoxin Serotype A

Directory of Open Access Journals (Sweden)

Tina I. Lam

2016-12-01

Full Text Available Botulinum neurotoxins (BoNTs are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that both BoNT serotype A complex and holotoxin can bind and transit through the intestinal epithelia to disseminate in the blood. The timing of BoNT/A toxin internalization was shown to be comparable in both the Caco-2 in vitro cell culture and in the oral mouse intoxication models. Probiotic microorganisms have been extensively studied for their beneficial effects in not only maintaining the normal gut mucosa but also protection from allergens, pathogens, and toxins. In this study, we evaluate whether probiotic microorganisms will block BoNT/A uptake in the in vitro cell culture system using Caco-2 cells. Several probiotics tested (Saccharomyces boulardii, Lactobacillus acidophilus, Lactobacillus rhamnosus LGG, and Lactobacillus reuteri blocked BoNT/A uptake in a dose-dependent manner whereas a non-probiotic strain of Escherichia coli did not. We also showed that inhibition of BoNT/A uptake was not due to the degradation of BoNT/A nor by sequestration of toxin via binding to probiotics. These results show for the first time that probiotic treatment can inhibit BoNT/A binding and internalization in vitro and may lead to the development of new therapies.

The construction and evaluation of reference spectra for the identification of human pathogenic microorganisms by MALDI-TOF MS.

Directory of Open Access Journals (Sweden)

Di Xiao

Full Text Available Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS is an emerging technique for the rapid and high-throughput identification of microorganisms. There remains a dearth of studies in which a large number of pathogenic microorganisms from a particular country or region are utilized for systematic analyses. In this study, peptide mass reference spectra (PMRS were constructed and evaluated from numerous human pathogens (a total of 1019 strains from 94 species, including enteric (46 species, respiratory (21 species, zoonotic (17 species, and nosocomial pathogens (10 species, using a MALDI-TOF MS Biotyper system (MBS. The PMRS for 380 strains of 52 species were new contributions to the original reference database (ORD. Compared with the ORD, the new reference database (NRD allowed for 28.2% (from 71.5% to 99.7% and 42.3% (from 51.3% to 93.6% improvements in identification at the genus and species levels, respectively. Misidentification rates were 91.7% and 57.1% lower with the NRD than with the ORD for genus and species identification, respectively. Eight genera and 25 species were misidentified. For genera and species that are challenging to accurately identify, identification results must be manually determined and adjusted in accordance with the database parameters. Through augmentation, the MBS demonstrated a high identification accuracy and specificity for human pathogenic microorganisms. This study sought to provide theoretical guidance for using PMRS databases in various fields, such as clinical diagnosis and treatment, disease control, quality assurance, and food safety inspection.

Selected medicinal plants used in herbal industries; their toxicity against pathogenic microorganisms

International Nuclear Information System (INIS)

Fazal, H.; Ahmad, M.; Abbasi, B.H.

2012-01-01

Multi-drug resistant strains of fungi and bacteria are imposing the need for new drugs. Reliable natural sources with minor side effects are needed to control anti-human pathogenic invaders specially bacteria. Given the demands for natural products that are inherently safe and environmentally compatible, the advancement in antimicrobial potential has provided a better alternative to synthetic resistance antibiotics. In the present investigation such types of medicinal plants were selected for analyses that are used by local herbal practioners for multiple diseases. Thirty three extracts of Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina and Vetiveria zizanioides in chloroform, ethanol and hexane were investigated for their antimicrobial potential. These extracts were tested against eight microorganisms including four gram negative bacterial strains viz., Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Salmonella typhi, three gram positive bacterial strains Staphylococcus aureus, Bacillus subtilis and Bacillus cereus and a fungal strain viz., Candida albicans. Majority of the extracts showed marked antimicrobial potential against the tested microorganisms. (author)

Efferocytosis of Pathogen-Infected Cells

Directory of Open Access Journals (Sweden)

Niloofar Karaji

2017-12-01

Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

Particularities of pathogenic microorganism development at anthropogenic influence and estimate of their adaptation potential by means of radiobiological method

International Nuclear Information System (INIS)

Shilina, Yu.V.; Gushcha, N.I.; Dyachenko, A.I.; Dmitriev, A.P.; Molozhava, O.S.; Romashko, V.M.

2008-01-01

Influence of anthropogenic factors on ecosystems causes their structure disturbance and reduction of species variety. Some resistance nonspecific forms of pathogenic microorganisms, which have high adaptation potential, become dominant. Thus their aggressiveness can increase. (authors)

Pathogenic microorganisms survival in ambrosiaSobrevivência de micro-organismos patogênicos em ambrósia

Directory of Open Access Journals (Sweden)

Cláudio Dias Timm

2013-09-01

Full Text Available Ambrosia is a kind of dulce de leche homemade with milk, eggs and sugar. It is usually sold in free markets and it is largely consumed in South America. Food contamination by pathogenic microorganisms can occur during the food processing, in distribution centers, in retail markets or in the consumer’s homes. The aim of this study was to evaluate the survival in ambrosia of main pathogenic microorganisms eventually transmitted by dairy products. Ambrosia fractions were experimentally contaminated with Salmonella enterica subsp. enterica serotype Typhimurium, Escherichia coli O157:H7, Listeria monocytogenes and Staphylococcus aureus. Analysis to evaluate the microorganisms’ viability were made after storage for 0, 1, 2, 3, 5, 10, 20 and 30 days. Salmonella and L. monocytogenes were recovered from all samples during the 30 days of study. E. coli O157:H7 was isolated until the tenth day and S. aureus until the third day. It was demonstrated that important pathogenic microorganisms are able to survive up to 30 days in ambrosia, which makes this product a potential carrier of food-borne diseases. This work is the first study about the possibility of ambrosia transmitting relevant public-health danger pathogenic microorganisms. Ambrosia é um tipo de doce de leite preparado artesanalmente com leite, ovos e açúcar, comumente comercializado em feiras livres e muito consumido na América do Sul. A contaminação de alimentos por microrganismos patogênicos pode ocorrer durante as etapas de processamento, nos centros de distribuição, no mercado varejista ou na casa do consumidor. O trabalho teve como objetivo avaliar a sobrevivência em ambrosia dos principais microrganismos patogênicos eventualmente transmitidos por leite e derivados. Alíquotas de ambrosia foram experimentalmente contaminadas com Salmonella enterica subsp. enterica sorotipo Typhimurium, Escherichia coli O157:H7, Listeria monocytogenes e Staphylococcus aureus. Foram realizadas

Prevalence of the pathogen microorganisms in raw cow milk

Directory of Open Access Journals (Sweden)

Angelovski Ljupco

2009-11-01

Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

A model of the transmission of micro-organisms in a public setting and its correlation to pathogen infection risks.

Science.gov (United States)

Gerhardts, A; Hammer, T R; Balluff, C; Mucha, H; Hoefer, D

2012-03-01

Gastro-intestinal infections are widespread in the community and have considerable economic consequences. In this study, we followed chains of infection from a public toilet scenario, looking at infection risks by correlating the transmission of bacteria, fungi and viruses to our current knowledge of infectious doses. Transmission of Escherichia coli, Bacillus atrophaeus spores, Candida albicans and bacteriophage MS2 from hands to surfaces was examined in a transmission model, that is toilet brush, door handle to water tap. The load of viable pathogens was significantly reduced during transfer from hands to objects. Nevertheless, it was shown that pathogens were successfully transferred to other people in contagious doses by contact with contaminated surfaces. Our results suggest that infection risks are mainly dependent on current infectious doses of pathogens. For enteritic viruses or bacteria, for example Norovirus or EHEC, only a few particles or cells are sufficient for infection in public lavatories, thus bearing a high risk of infection for other persons. However, there seems to be only a low probability of becoming infected with pathogens that have a high infectious dose whilst sharing the same bathroom. The transmission model for micro-organisms enables a risk assessment of gastro-intestinal infections on the basis of a practical approach. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

Directory of Open Access Journals (Sweden)

Beatriz García

2016-11-01

Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

New Approach to Inactivation of Harmful and Pathogenic Microorganisms by Photosensitization

Directory of Open Access Journals (Sweden)

Živile Lukšiene

2005-01-01

Full Text Available Photosensitization is a treatment involving the administration of a photoactive compound that selectively accumulates in the target cells or microorganisms and is followed by irradiation with visible light. The combination of the two absolutely nontoxic elements, drug and light, in the presence of oxygen results in the selective destruction of target microorganism. It is important to note that truly major advances have been made in photosensitized antimicrobial chemotherapy, in particular disinfection of the blood and blood products, or treating local infections. By no means, prevention of any disease by microbial control of environment, including food manufacturing, is of greatest importance. Thus, development of new antimicrobial methods is necessary. In this context, photosensitization has been shown to be really effective: different microorganisms such as drug-resistant bacteria, yeasts, viruses and parasites can be inactivated by this method. So far, a photosensitization phenomenon can open new and interesting avenues for the development of novel, effective and ecologically friendly antimicrobial treatment, which might be applied to increase food safety.

PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

Energy Technology Data Exchange (ETDEWEB)

Cramariuc, R [Competence Center in Electrostatics and Electrotechnologies, Bucharest (Romania); Popa, M; Mitelut, A; Geicu, M [University of Agronomic Science and Veterinary Medicine, Bucharest (Romania); Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L [Research and Development Institute in Viticulture and Vinification Valea Calugareasca (Romania); Cramariuc, B [IT Center for Science and Technology, Bucharest (Romania); Nisiparu, L, E-mail: raducramariuc@yahoo.com [Carol Davila University of Medicine and Pharmacy, Bucharest (Romania)

2011-06-23

Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

Science.gov (United States)

Cramariuc, R.; Popa, M.; Tudorache, A.; Brînduşe, E.; Kontek, A.; Mitelut, A.; Fotescu, L.; Cramariuc, B.; Geicu, M.; Nisiparu, L.

2011-06-01

Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

International Nuclear Information System (INIS)

Cramariuc, R; Popa, M; Mitelut, A; Geicu, M; Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L; Cramariuc, B; Nisiparu, L

2011-01-01

Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

Micro-Organ Device

Science.gov (United States)

Gonda, Steve R. (Inventor); Chang, Robert C. (Inventor); Starly, Binil (Inventor); Culbertson, Christopher (Inventor); Holtorf, Heidi L. (Inventor); Sun, Wei (Inventor); Leslie, Julia (Inventor)

2013-01-01

A method for fabricating a micro-organ device comprises providing a microscale support having one or more microfluidic channels and one or more micro-chambers for housing a micro-organ and printing a micro-organ on the microscale support using a cell suspension in a syringe controlled by a computer-aided tissue engineering system, wherein the cell suspension comprises cells suspended in a solution containing a material that functions as a three-dimensional scaffold. The printing is performed with the computer-aided tissue engineering system according to a particular pattern. The micro-organ device comprises at least one micro-chamber each housing a micro-organ; and at least one microfluidic channel connected to the micro-chamber, wherein the micro-organ comprises cells arranged in a configuration that includes microscale spacing between portions of the cells to facilitate diffusion exchange between the cells and a medium supplied from the at least one microfluidic channel.

Microbial genome-enabled insights into plant-microorganism interactions.

Science.gov (United States)

Guttman, David S; McHardy, Alice C; Schulze-Lefert, Paul

2014-12-01

Advances in genome-based studies on plant-associated microorganisms have transformed our understanding of many plant pathogens and are beginning to greatly widen our knowledge of plant interactions with mutualistic and commensal microorganisms. Pathogenomics has revealed how pathogenic microorganisms adapt to particular hosts, subvert innate immune responses and change host range, as well as how new pathogen species emerge. Similarly, culture-independent community profiling methods, coupled with metagenomic and metatranscriptomic studies, have provided the first insights into the emerging field of research on plant-associated microbial communities. Together, these approaches have the potential to bridge the gap between plant microbial ecology and plant pathology, which have traditionally been two distinct research fields.

TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

Directory of Open Access Journals (Sweden)

Paola eMassari

2014-08-01

Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

Assessment of survival of food-borne microorganisms in the food chain by fluorescence ratio imaging microscopy

DEFF Research Database (Denmark)

Siegumfeldt, Henrik; Arneborg, Nils

2011-01-01

Traditionally, many data on food–borne microorganisms are obtained as an average of a whole population, under the assumption that the individual cells are clonal and therefore identical. However, it is now acknowledged that there may be a large heterogeneity within an isogenic population......, and consequently new methods focus on the individual cells. This mini-review will give an overview of the response of food-borne microorganisms; i.e. pathogenic bacteria, lactic acid bacteria, and yeasts, at a single-cell level to various food-related stress conditions, comprising acid-, disinfection-, salt...

Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

Energy Technology Data Exchange (ETDEWEB)

Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fatima, E-mail: nfsoares1@gmail.com [Department of Food Technology, Federal University of Vicosa (Brazil); Teofilo, Reinaldo F. [Federal University of Vicosa, Department of Chemistry (Brazil); Vitor, Debora M.; Reis Coimbra, Jane Selia dos; Andrade, Nelio Jose de [Department of Food Technology, Federal University of Vicosa (Brazil); Sousa, Frederico B. de; Sinisterra, Ruben D. [Federal University of Minas Gerais, Department of Chemistry (Brazil); Medeiros, Eber Antonio Alves [Department of Food Technology, Federal University of Vicosa (Brazil)

2013-01-15

Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na{sub 4}P{sub 2}O{sub 7}), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

International Nuclear Information System (INIS)

Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fátima; Teófilo, Reinaldo F.; Vitor, Débora M.; Reis Coimbra, Jane Sélia dos; Andrade, Nélio José de; Sousa, Frederico B. de; Sinisterra, Rubén D.; Medeiros, Eber Antonio Alves

2013-01-01

Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na 4 P 2 O 7 ), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

Psidium guajava L., from ethnobiology to scientific evaluation: Elucidating bioactivity against pathogenic microorganisms.

Science.gov (United States)

Morais-Braga, Maria Flaviana B; Carneiro, Joara Nalyda P; Machado, Antonio Júdson T; Dos Santos, Antonia Thassya L; Sales, Débora L; Lima, Luciene F; Figueredo, Fernando G; Coutinho, Henrique Douglas M

2016-12-24

The use of popular plants has guided pharmaceutical research aimed at combating pathogenic microorganisms. Psidium guajava L. is a plant of great versatility and it has been used both as food and as a therapeutic agent. Root, bark, leaves, fruits, flowers and seeds are used for medicinal purposes, especially in infusions and decoctions for oral and topical use. P. guajava is utilized in symptomatology treatment related to organ malfunction and of diseases caused by the action of pathogenic and/or opportunistic microorganisms. Many pharmacological studies have been conducted to scientifically assess its therapeutic potential. The aim of the current study is to relate the popular use of this plant and its bioscientific assessment as a therapeutic agent in the treatment of diseases and symptoms caused by the action of protozoa, fungi, bacteria and viruses, and also evaluate the safety for the usage and the interaction with drugs. A bibliographic database the ethnobiology of Psidium guajava (2005-2015) and the pharmacological infections and parasitic diseases (2010-2015). Searches were done in scientific disclosure databases such as PubMed, Web of Science, and Scopus. P. guajava leaf extracts were scientifically investigated for the treatment of diseases caused by protozoa (leishmaniasis, malaria, giardiasis, amoebiasis and trichomoniasis), fungi (dermatosis, systemic and mucocutaneous diseases), bacteria (respiratory, mucocutaneous and gastrointestinal infections, cholera, gastritis and stomach ulcers, oral and periodontal infections, venereal diseases and urinary infections) and viruses (herpes, influenza, rotavirus disease and AIDS). The toxicity assays indicates the safet for usage. Highlight and elucidate the therapeutic potential and versatility of P. guajava. They also justify using ethnobiology efficiency to guide pharmacological studies. Some limitations can be observed in this kind of study, as the lack for ethnobiological informations and the absence of some

Role of Proteolytic Enzymes in the Interaction of Phytopathogenic Microorganisms with Plants.

Science.gov (United States)

Valueva, T A; Zaichik, B Ts; Kudryavtseva, N N

2016-12-01

Various forms of participation of proteolytic enzymes in pathogenesis and defense in plants are reviewed. Along with extracellular proteinases, phytopathogenic microorganisms produce specific effectors having proteolytic activity and capable of acting on proteins inside plant cells. In turn, for defense against pathogens, plants use both extracellular and intracellular proteinases.

Autophagic clearance of bacterial pathogens: molecular recognition of intracellular microorganisms.

Science.gov (United States)

Pareja, Maria Eugenia Mansilla; Colombo, Maria I

2013-01-01

Autophagy is involved in several physiological and pathological processes. One of the key roles of the autophagic pathway is to participate in the first line of defense against the invasion of pathogens, as part of the innate immune response. Targeting of intracellular bacteria by the autophagic machinery, either in the cytoplasm or within vacuolar compartments, helps to control bacterial proliferation in the host cell, controlling also the spreading of the infection. In this review we will describe the means used by diverse bacterial pathogens to survive intracellularly and how they are recognized by the autophagic molecular machinery, as well as the mechanisms used to avoid autophagic clearance.

Ecophysiology of microorganisms in microbial elctrolysis cells

NARCIS (Netherlands)

Croese, E.

2012-01-01

One of the main challenges for improvement of the microbial electrolysis cell (MEC) has been the reduction of the cost of the cathode catalyst. As catalyst at the cathode, microorganisms offer great possibilities. Previous research has shown the principle possibilities for the biocathode for H2

Vaccines based on the cell surface carbohydrates of pathogenic bacteria

Directory of Open Access Journals (Sweden)

Jones Christopher

2005-01-01

Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

DEFF Research Database (Denmark)

Søndergaard, Jonas Nørskov

for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

of gastro-intestinal discomfort (ID 2946, 2951, 2974), decreasing potentially pathogenic gastro-intestinal microorganisms (ID 2946, 2951, 2974), improved lactose digestion (ID 2946, 2951, 2974), and reduction in numbers of circulating CD34+ cells (ID 2947, 2952, 2975) (further assessment) pursuant

DEFF Research Database (Denmark)

Tetens, Inge

of Lactobacillus acidophilus BCCM/LMG P-18806, Lactobacillus delbrueckii BCCM/LMG P-18805 and Streptococcus thermophilus BCCM/LMG P-18807 and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, improved lactose digestion, and reduction in numbers......, might be a beneficial physiological effect for the general population. The claimed effect, improved lactose digestion, is a beneficial physiological effect for individuals with lactose maldigestion. No human intervention studies were provided from which conclusions could be drawn for the scientific...... and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, and improved lactose digestion....

The hybrid methylene blue-zeolite system: a higher efficient photo catalyst for photo inactivation of pathogenic microorganisms

International Nuclear Information System (INIS)

Smolinska, M.; Cik, G.; Sersen, F.; Caplovicova, M.; Takacova, A.; Kopani, M.

2015-01-01

The composite system can be prepared by incorporation of methylene blue into the channels of zeolite and by adsorption on the surface of the crystals. The composite photo sensitizer effectively absorbs the red light (kmax = 648 nm) and upon illumination with light-emitting diode at a fluence rate of 1.02 mW cm-2 generates effectively reactive singlet oxygen in aqueous solution, which was proved by EPR spectroscopy. To test efficiency for inactivation of pathogenic microorganisms, we measured photo killing of bacteria Escherichia coli and Staphylococcus aureus and yeasts Candida albicans. We found out that after the microorganisms have been adsorbed at the surface of such modified zeolite, the photo generated singlet oxygen quickly penetrates their cell walls, bringing about their effective photo inactivation. The growth inhibition reached almost 50 % at 200 and 400 mg modified zeolite in 1 ml of medium in E. coli and C. albicans, respectively. On the other hand, the growth inhibition of S. aureus reached 50 % at far smaller amount of photo catalyst (30 lg per 1 ml of medium). These results demonstrate differences in sensitivities of bacteria and yeast growth. The comparison revealed that concentration required for IC50 was in case of C. albicans several orders of magnitude lower for a zeolite-immobilized dye than it was for a freely dissolved dye. In S. aureus, this concentration was even lower by four orders of magnitude. Thus, our work suggested a new possibility to exploitation of zeolite and methylene blue in the protection of biologically contaminated environment, and in photodynamic therapy.

UV inactivation of pathogenic and indicator microorganisms

International Nuclear Information System (INIS)

Chang, J.C.; Ossoff, S.F.; Lobe, D.C.; Dorfman, M.H.; Dumais, C.M.; Qualls, R.G.; Johnson, J.D.

1985-01-01

Survival was measured as a function of the dose of germicidal UV light for the bacteria Escherichia coli, Salmonella typhi, Shigella sonnei, Streptococcus faecalis, Staphylococcus aureus, and Bacillus subtilis spores, the enteric viruses poliovirus type 1 and simian rotavirus SA11, the cysts of the protozoan Acanthamoeba castellanii, as well as for total coliforms and standard plate count microorganisms from secondary effluent. The doses of UV light necessary for a 99.9% inactivation of the cultured vegetative bacteria, total coliforms, and standard plate count microorganisms were comparable. However, the viruses, the bacterial spores, and the amoebic cysts required about 3 to 4 times, 9 times, and 15 times, respectively, the dose required for E. coli. These ratios covered a narrower relative dose range than that previously reported for chlorine disinfection of E. coli, viruses, spores, and cysts

UV inactivation of pathogenic and indicator microorganisms

Energy Technology Data Exchange (ETDEWEB)

Chang, J.C.; Ossoff, S.F.; Lobe, D.C.; Dorfman, M.H.; Dumais, C.M.; Qualls, R.G.; Johnson, J.D.

1985-06-01

Survival was measured as a function of the dose of germicidal UV light for the bacteria Escherichia coli, Salmonella typhi, Shigella sonnei, Streptococcus faecalis, Staphylococcus aureus, and Bacillus subtilis spores, the enteric viruses poliovirus type 1 and simian rotavirus SA11, the cysts of the protozoan Acanthamoeba castellanii, as well as for total coliforms and standard plate count microorganisms from secondary effluent. The doses of UV light necessary for a 99.9% inactivation of the cultured vegetative bacteria, total coliforms, and standard plate count microorganisms were comparable. However, the viruses, the bacterial spores, and the amoebic cysts required about 3 to 4 times, 9 times, and 15 times, respectively, the dose required for E. coli. These ratios covered a narrower relative dose range than that previously reported for chlorine disinfection of E. coli, viruses, spores, and cysts.

Quantification of pathogenic microorganisms and microbial indicators in three wastewater reclamation and managed aquifer recharge facilities in Europe.

Science.gov (United States)

Levantesi, Caterina; La Mantia, Rosanna; Masciopinto, Costantino; Böckelmann, Uta; Ayuso-Gabella, M Neus; Salgot, Miquel; Tandoi, Valter; Van Houtte, Emmanuel; Wintgens, Thomas; Grohmann, Elisabeth

2010-10-01

Managed Aquifer Recharge (MAR) is becoming an attractive option for water storage in water reuse processes as it provides an additional treatment barrier to improve recharged water quality and buffers seasonal variations of water supply and demand. To achieve a better understanding about the level of pathogenic microorganisms and their relation with microbial indicators in these systems, five waterborne pathogens and four microbial indicators were monitored over one year in three European MAR sites operated with reclaimed wastewater. Giardia and Cryptosporidium (oo)cysts were found in 63.2 and 36.7% of the samples respectively. Salmonella spp. and helminth eggs were more rarely detected (16.3% and 12.5% of the samples respectively) and Campylobacter cells were only found in 2% of samples. At the Belgian site advanced tertiary treatment technology prior to soil aquifer treatment (SAT) produced effluent of drinking water quality, with no presence of the analysed pathogens. At the Spanish and Italian sites amelioration of microbiological water quality was observed between the MAR injectant and the recovered water. In particular Giardia levels decreased from 0.24-6.14 cysts/L to 0-0.01 cysts/L and from 0.4-6.2 cysts/L to 0-0.07 cysts/L in the Spanish and Italian sites respectively. Salmonella gene copies and Giardia cysts were however found in the water for final use and/or the recovered groundwater water at the two sites. Significant positive Spearman correlations (p<0.05, r(s) range: 0.45-0.95) were obtained, in all the three sites, between Giardia cysts and the most resistant microbial markers, Clostridium spores and bacteriophages. Copyright 2010 Elsevier B.V. All rights reserved.

Modelling and application of the inactivation of microorganism

International Nuclear Information System (INIS)

Oğuzhan, P.; Yangılar, F.

2013-01-01

Prevention of consuming contaminated food with toxic microorganisms causing infections and consideration of food protection and new microbial inactivation methods are obligatory situations. Food microbiology is mainly related with unwanted microorganisms spoiling foods during processing and transporting stages and causing diseases. Determination of pathogen microorganisms is important for human health to define and prevent dangers and elongate shelf life. Inactivation of pathogen microorganisms can provide food security and reduce nutrient losses. Microbial inactivation which is using methods of food protection such as food safety and fresh. With this aim, various methods are used such as classical thermal processes (pasteurisation, sterilisation), pressured electrical field (PEF), ionised radiation, high pressure, ultrasonic waves and plasma sterilisation. Microbial inactivation modelling is a secure and effective method in food production. A new microbiological application can give useful results for risk assessment in food, inactivation of microorganisms and improvement of shelf life. Application and control methods should be developed and supported by scientific research and industrial applications

Chemical Composition of Mentha spicata L. subsp. tomentosa and M. pulegium L., and their Antimicrobial Activity on Strong Pathogen Microorganisms

Directory of Open Access Journals (Sweden)

Emre SEVİNDİK

2017-03-01

Full Text Available Mentha L., recognized as a medical and aromatic plant, is a general name affiliated to mint species and belongs to Labiatae family. Some species are used as fresh vegetables in the Turkish kitchen and they can also be used in salads. In addition, some species have been used as a spice in food. In this study, chemical composition and antimicrobial activity towards some pathogenics (gram + and gram - microorganisms of the essential oils Mentha spicata L. subsp. tomentosa (Briq. Harley, Mentha pulegium L. grown under West Anatolian ecological conditions were investigated. Extractions were carried out with Clevenger apparatus and essential oil composition was determined by Gas Chromatography-Mass Spectrometry (GC-MS. Microorganisms used for the antimicrobial studies were Methicillin-resistant Staphylococcus aureus (MRSA, Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa, Enterecoccus faecium DSM 13590, Escherichia coli Q157:H7 and Bacillus cereus CCM99.  As a result, M. pulegium and M. spicata subsp. tomentosa were found to be rich in piperitenone oxide: 72.77% and 28.84%, respectively. Each of the oils was found to possess antimicrobial properties against test microorganisms. Essential oils obtained from Mentha species give positive effect on all microorganisms.

Analyzing indicator microorganisms, antibiotic resistant Escherichia coli, and regrowth potential of foodborne pathogens in various organic fertilizers.

Science.gov (United States)

Miller, Cortney; Heringa, Spencer; Kim, Jinkyung; Jiang, Xiuping

2013-06-01

This study analyzed various organic fertilizers for indicator microorganisms, pathogens, and antibiotic-resistant Escherichia coli, and evaluated the growth potential of E. coli O157:H7 and Salmonella in fertilizers. A microbiological survey was conducted on 103 organic fertilizers from across the United States. Moisture content ranged from approximately 1% to 86.4%, and the average pH was 7.77. The total aerobic mesophiles ranged from approximately 3 to 9 log colony-forming units (CFU)/g. Enterobacteriaceae populations were in the range of fertilizer, respectively, whereas E. coli O157:H7 grew approximately 4.6, 4.0, 4.0, and 4.8 log CFU/g, respectively. Our results revealed that the microbiological quality of organic fertilizers varies greatly, with some fertilizers containing antibiotic resistant E. coli and a few supporting the growth of foodborne pathogens after reintroduction into the fertilizer.

Regulatory T cells and immunity to pathogens.

Science.gov (United States)

Rouse, Barry T; Suvas, Susmit

2007-09-01

Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

Viability of probiotic micro-organism Lactobacillus acidophilus in dairy chocolate dessert and its action against foodborne pathogens

Directory of Open Access Journals (Sweden)

Luciana Justo Beserra Rosa

2015-01-01

Full Text Available ABSTRACT:The ability to produce antimicrobial factors is considered an important feature of probiotic microorganisms. Bacteriocins, hydrogen peroxide, acetic acid and lactic acid are examples of these substances. The present research aimed to develop probiotic dairy desserts (DD with Lactobacillus acidophilusand evaluate the viability of this strain, as well as its action on food pathogens. Treatments with and without interactions between L. acidophilusand pathogenic Gram-negative bacteria (Salmonellasp. andEscherichiacoli O157:H7 and Gram positive (Bacillus cereusand Staphylococcus aureus were produced. The products were stored at a temperature of 8°C and analyzed at the times 24, 48, 72 hours, 7 days and 28 days (at 28 days, only T1 was analyzed because the other products were deteriorated. In an analysis of the potential for development of new products, the dairy dessert with L. acidophiluswas considered a probiotic product. Assessment of the counts of pathogens in dairy desserts with or without L. acidophilusshowed different behaviors of these products in response to pathogens, which could be justified by a possible action of bacteriocins or microbial competition, but there has been no overall reduction or reduction up to a safe level. It is concluded that the probiotic products developed reduced significant food pathogens, but not up to safe levels. Thus, we emphasize the importance of the use of quality tools in the development and monitoring of dairy desserts.

Biosurfactants Produced by Marine Microorganisms with Therapeutic Applications.

Science.gov (United States)

Gudiña, Eduardo J; Teixeira, José A; Rodrigues, Lígia R

2016-02-18

Marine microorganisms possess unique metabolic and physiological features and are an important source of new biomolecules, such as biosurfactants. Some of these surface-active compounds synthesized by marine microorganisms exhibit antimicrobial, anti-adhesive and anti-biofilm activity against a broad spectrum of human pathogens (including multi-drug resistant pathogens), and could be used instead of existing drugs to treat infections caused by them. In other cases, these biosurfactants show anti-cancer activity, which could be envisaged as an alternative to conventional therapies. However, marine biosurfactants have not been widely explored, mainly due to the difficulties associated with the isolation and growth of their producing microorganisms. Culture-independent techniques (metagenomics) constitute a promising approach to study the genetic resources of otherwise inaccessible marine microorganisms without the requirement of culturing them, and can contribute to the discovery of novel biosurfactants with significant biological activities. This paper reviews the most relevant biosurfactants produced by marine microorganisms with potential therapeutic applications and discusses future perspectives and opportunities to discover novel molecules from marine environments.

Biosurfactants Produced by Marine Microorganisms with Therapeutic Applications

Directory of Open Access Journals (Sweden)

Eduardo J. Gudiña

2016-02-01

Full Text Available Marine microorganisms possess unique metabolic and physiological features and are an important source of new biomolecules, such as biosurfactants. Some of these surface-active compounds synthesized by marine microorganisms exhibit antimicrobial, anti-adhesive and anti-biofilm activity against a broad spectrum of human pathogens (including multi-drug resistant pathogens, and could be used instead of existing drugs to treat infections caused by them. In other cases, these biosurfactants show anti-cancer activity, which could be envisaged as an alternative to conventional therapies. However, marine biosurfactants have not been widely explored, mainly due to the difficulties associated with the isolation and growth of their producing microorganisms. Culture-independent techniques (metagenomics constitute a promising approach to study the genetic resources of otherwise inaccessible marine microorganisms without the requirement of culturing them, and can contribute to the discovery of novel biosurfactants with significant biological activities. This paper reviews the most relevant biosurfactants produced by marine microorganisms with potential therapeutic applications and discusses future perspectives and opportunities to discover novel molecules from marine environments.

Scientific Opinion on the substantiation of health claims related to Saccharomyces cerevisiae var. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms (ID 913, further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms. The food constituent that is the subject of the health claim, Saccharomyces cerevisiae var. boulardii CNCM I-1079, is sufficiently characterised. The claimed effect, defence against pathogenic gastro......-intestinal microorganisms, is a beneficial physiological effect. The proposed target population is the general population. The Panel notes that the evidence provided is not sufficient to establish that the strains Saccharomyces cerevisiae var. boulardii CNCM I-1079 and Saccharomyces cerevisiae var. boulardii Hansen CBS...... relationship has not been established between the consumption of Saccharomyces cerevisiae var. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms....

Soil eukaryotic microorganism succession as affected by continuous cropping of peanut--pathogenic and beneficial fungi were selected.

Directory of Open Access Journals (Sweden)

Mingna Chen

Full Text Available Peanut is an important oil crop worldwide and shows considerable adaptability but growth and yield are negatively affected by continuous cropping. Soil micro-organisms are efficient bio-indicators of soil quality and plant health and are critical to the sustainability of soil-based ecosystem function and to successful plant growth. In this study, 18S rRNA gene clone library analyses were employed to study the succession progress of soil eukaryotic micro-organisms under continuous peanut cultivation. Eight libraries were constructed for peanut over three continuous cropping cycles and its representative growth stages. Cluster analyses indicated that soil micro-eukaryotic assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. Six eukaryotic groups were found and fungi predominated in all libraries. The fungal populations showed significant dynamic change and overall diversity increased over time under continuous peanut cropping. The abundance and/or diversity of clones affiliated with Eurotiales, Hypocreales, Glomerales, Orbiliales, Mucorales and Tremellales showed an increasing trend with continuous cropping but clones affiliated with Agaricales, Cantharellales, Pezizales and Pyxidiophorales decreased in abundance and/or diversity over time. The current data, along with data from previous studies, demonstrated that the soil microbial community was affected by continuous cropping, in particular, the pathogenic and beneficial fungi that were positively selected over time, which is commonplace in agro-ecosystems. The trend towards an increase in fungal pathogens and simplification of the beneficial fungal community could be important factors contributing to the decline in peanut growth and yield over many years of continuous cropping.

Differentiation and detection of microorganisms using Fourier transform infrared photoacoustic spectroscopy

Science.gov (United States)

Irudayaraj, Joseph; Yang, Hong; Sakhamuri, Sivakesava

2002-03-01

Fourier transform infrared photoacoustic spectroscopy (FTIR-PAS) was used to differentiate and identify microorganisms on a food (apple) surface. Microorganisms considered include bacteria (Lactobacillus casei, Bacillus cereus, and Escherichia coli), yeast (Saccharomyces cerevisiae), and fungi (Aspergillus niger and Fusarium verticilliodes). Discriminant analysis was used to differentiate apples contaminated with the different microorganisms from uncontaminated apple. Mahalanobis distances were calculated to quantify the differences. The higher the value of the Mahalanobis distance metric between different microorganisms, the greater is their difference. Additionally, pathogenic (O157:H7) E. coli was successfully differentiated from non-pathogenic strains. Results demonstrate that FTIR-PAS spectroscopy has the potential to become a non-destructive analysis tool in food safety related research.

Cell surface hydrophobicity of dental plaque microorganisms in situ.

OpenAIRE

Rosenberg, M; Judes, H; Weiss, E

1983-01-01

The cell surface hydrophobicity of bacteria obtained directly from human tooth surfaces was assayed by measuring their adherence to liquid hydrocarbons. Fresh samples of supragingival dental plaque were washed and dispersed in buffer. Adherence of the plaque microorganisms to hexadecane, octane, and xylene was tested turbidimetrically and by direct microscopic observation. The results clearly show that the vast majority of bacteria comprising dental plaque exhibit pronounced cell surface hydr...

Viruses, Other Pathogenic Microorganisms and Esophageal Cancer.

Science.gov (United States)

Xu, Wenji; Liu, Zhongshu; Bao, Quncha; Qian, Zhikan

2015-05-01

Esophageal cancer (EC) is the eighth most prevalent malignant tumor and the sixth leading cause of cancer mortality throughout the world. Despite the technical developments in diagnosis and treatment, the 5-year survival rate is still low. The etiology of EC remains poorly understood; multiple risk factors may be involved and account for the great variation in EC incidence in different geographic regions. Infection with carcinogenetic pathogens has been proposed as a risk factor for EC. This review explores the recent studies on the association of human papillomavirus (HPV), Epstein-Barr virus (EBV), Helicobacter pylori and esophageal bacterial biota with EC. Among the above-mentioned pathogens, HPV most likely contributes to esophageal squamous cell carcinoma (ESCC) in high-risk populations. New techniques are being applied to studies on the role of infection in EC, which will inevitably bring novel ideas to the field in the near future. Multiple meta-analyses support the finding of a higher HPV detection rate in regions associated with high risk for ESCC compared to low-risk areas. A potential role of HPV in the rise of esophageal adenocarcinoma (EAC) was proposed recently. However, further studies are required before a firm conclusion can be drawn. Less work has been done in studying the association between EBV and ESCC, and the results are quite controversial. H. pylori infection is found to be inversely related to EC, which is probably due to the reduced incidence of gastroesophageal reflux disease. Analysis of the esophageal bacterial biota revealed distinct clusters of bacteria in normal and diseased esophagi. A type II microbiome rich in Gram-negative bacteria potentially contributes to EAC by inducing chronic inflammation. Novel findings from such studies as these may benefit public health by justifying anti-infection measures to prevent EC.

Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

OpenAIRE

Taborda, Carlos P.; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

2008-01-01

Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

Lipids in host-pathogen interactions: pathogens exploit the complexity of the host cell lipidome.

Science.gov (United States)

van der Meer-Janssen, Ynske P M; van Galen, Josse; Batenburg, Joseph J; Helms, J Bernd

2010-01-01

Lipids were long believed to have a structural role in biomembranes and a role in energy storage utilizing cellular lipid droplets and plasma lipoproteins. Research over the last decades has identified an additional role of lipids in cellular signaling, membrane microdomain organization and dynamics, and membrane trafficking. These properties make lipids an attractive target for pathogens to modulate host cell processes in order to allow their survival and replication. In this review we will summarize the often ingenious strategies of pathogens to modify the lipid homeostasis of host cells, allowing them to divert cellular processes. To this end pathogens take full advantage of the complexity of the lipidome. The examples are categorized in generalized and emerging principles describing the involvement of lipids in host-pathogen interactions. Several pathogens are described that simultaneously induce multiple changes in the host cell signaling and trafficking mechanisms. Elucidation of these pathogen-induced changes may have important implications for drug development. The emergence of high-throughput lipidomic techniques will allow the description of changes of the host cell lipidome at the level of individual molecular lipid species and the identification of lipid biomarkers.

Rapid detection of foodborne microorganisms on food surface using Fourier transform Raman spectroscopy

Science.gov (United States)

Yang, Hong; Irudayaraj, Joseph

2003-02-01

Fourier transform (FT) Raman spectroscopy was used for non-destructive characterization and differentiation of six different microorganisms including the pathogen Escherichia coli O157:H7 on whole apples. Mahalanobis distance metric was used to evaluate and quantify the statistical differences between the spectra of six different microorganisms. The same procedure was extended to discriminate six different strains of E. coli. The FT-Raman procedure was not only successful in discriminating the different E. coli strain but also accurately differentiated the pathogen from non-pathogens. Results demonstrate that FT-Raman spectroscopy can be an excellent tool for rapid examination of food surfaces for microorganism contamination and for the classification of microbial cultures.

Pulsed electric field processing of different fruit juices: impact of pH and temperature on inactivation of spoilage and pathogenic micro-organisms.

Science.gov (United States)

Timmermans, R A H; Nierop Groot, M N; Nederhoff, A L; van Boekel, M A J S; Matser, A M; Mastwijk, H C

2014-03-03

Pulsed electrical field (PEF) technology can be used for the inactivation of micro-organisms and therefore for preservation of food products. It is a mild technology compared to thermal pasteurization because a lower temperature is used during processing, leading to a better retention of the quality. In this study, pathogenic and spoilage micro-organisms relevant in refrigerated fruit juices were studied to determine the impact of process parameters and juice composition on the effectiveness of the PEF process to inactivate the micro-organisms. Experiments were performed using a continuous-flow PEF system at an electrical field strength of 20 kV/cm with variable frequencies to evaluate the inactivation of Salmonella Panama, Escherichia coli, Listeria monocytogenes and Saccharomyces cerevisiae in apple, orange and watermelon juices. Kinetic data showed that under the same conditions, S. cerevisiae was the most sensitive micro-organism, followed by S. Panama and E. coli, which displayed comparable inactivation kinetics. L. monocytogenes was the most resistant micro-organism towards the treatment conditions tested. A synergistic effect between temperature and electric pulses was observed at inlet temperatures above 35 °C, hence less energy for inactivation was required at higher temperatures. Different juice matrices resulted in a different degree of inactivation, predominantly determined by pH. The survival curves were nonlinear and could satisfactorily be modeled with the Weibull model. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.

Science.gov (United States)

Ireton, Keith

2013-07-17

Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.

Novel Micro-organisms controlling plant pathogens

NARCIS (Netherlands)

Köhl, J.

2009-01-01

The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

Novel Micro-organisms controlling plant pathogens

NARCIS (Netherlands)

Köhl, J.

2010-01-01

The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens

NARCIS (Netherlands)

Kemmeren JM; Mangen MJJ; Duynhoven YTHP van; Havelaar AH; MGB

2006-01-01

Toxoplasmosis causes the highest disease burden among seven evaluated foodborne pathogens. This is the preliminary conclusion of a major study of the disease burden and related costs of foodborne pathogens. The other micro-organisms that were studied are Campylobacter spp., Salmonella spp.,

Survival of microorganisms representing the three Domains of life inside the International Space Station

Science.gov (United States)

Francesco, Canganella; Giovanna, Bianconi

2007-09-01

The present work was mainly focused to study the response of representative non pathogenic microorganisms to the environment inside the space vehicle at different mission stages (10, 56, and 226 days) within the frame of the Italian ENEIDE mission, from Feb to Oct 2005. Microorganisms were chosen according to their phylogenetic position and cell structures; they were representatives of the three taxonomic domains and belonged to different ecosystems (food, soil, intestinal tract, plants, deep-sea). They were the followings: Thermococcus guaymasensis (Domain Archaea); Saccharomyces cerevisiae (Domain Eucarya); Escherichia coli, Bacillus subtilis, Lactobacillus acidophilus, Enterococcus faecium, Pseudomonas fluorescens, and Rhizobium tropici (Domain Bacteria). As main environmental parameters we were interested in: a) space radiations; b) microgravity; c) temperature. The response of microorganisms was investigated in terms of survival rates, cell structure modifications, and genomic damages. The survival of cells was affected by both radiation doses and intrinsec cell features. As expected, only samples kept on the ISS for 226 days showed significant levels of mortality. Asfar as regard the effect on cell structures, these samples showed also remarkable morphological changes, particularly for Escherichia coli, Enterococcus faecium, and Saccharomyces cerevisiae. The data collected allowed to get new insights into the biological traits of microorganisms exposed to space environment during the flight on a spacecraft. Moreover, the result obtained may be important for the improvement of human conditions aboard space vehicles (nutraceuticals for astronauts and disinfections of ISS modules) and also for the potential development of closed systems devoted to vegetable productions and organic recycling.

Cell surface engineering of industrial microorganisms for biorefining applications.

Science.gov (United States)

Tanaka, Tsutomu; Kondo, Akihiko

2015-11-15

In order to decrease carbon emissions and negative environmental impacts of various pollutants, biofuel/biochemical production should be promoted for replacing fossil-based industrial processes. Utilization of abundant lignocellulosic biomass as a feedstock has recently become an attractive option. In this review, we focus on recent efforts of cell surface display using industrial microorganisms such as Escherichia coli and yeast. Cell surface display is used primarily for endowing cellulolytic activity on the host cells, and enables direct fermentation to generate useful fuels and chemicals from lignocellulosic biomass. Cell surface display systems are systematically summarized, and the drawbacks/perspectives as well as successful application of surface display for industrial biotechnology are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

Assets of the non-pathogenic microorganism Dictyostelium discoideum as a model for the study of eukaryotic extracellular vesicles [v1; ref status: indexed, http://f1000r.es/pa

Directory of Open Access Journals (Sweden)

Irène Tatischeff

2013-03-01

Full Text Available Dictyostelium discoideum microvesicles have recently been presented as a valuable model for eukaryotic extracellular vesicles. Here, the advantages of D. discoideum for unraveling important biological functions of extracellular vesicles in general are detailed. D. discoideum, a non-pathogenic eukaryotic microorganism, belongs to a billion-year-old Amoeboza lineage, which diverged from the animal-fungal lineage after the plant animal-split. During growth and early starvation-induced development, it presents analogies with lymphocytes and macrophages with regard to motility and phagocytosis capability, respectively. Its 6-chromosome genome codes for about 12,500 genes, some showing analogies with human genes. The presence of extracellular vesicles during cell growth has been evidenced as a detoxification mechanism of various structurally unrelated drugs. Controls led to the discovery of constitutive extracellular vesicle secretion in this microorganism, which was an important point. It means that the secretion of extracellular vesicles occurs, in the absence of any drug, during both cell growth and early development. This constitutive secretion of D. discoideum cells is very likely to play a role in intercellular communication. The detoxifying secreted vesicles, which can transport drugs outside the cells, can also act as "Trojan horses", capable of transferring these drugs not only into naïve D. discoideum cells, but into human cells as well. Therefore, these extracellular vesicles were proposed as a new biological drug delivery tool. Moreover, Dictyostelium, chosen by the NIH (USA as a new model organism for biomedical research, has already been used for studying some human diseases. These cells, which are much easier to manipulate than human cells, can be easily designed in simple conditioned medium experiments. Owing to the increasing consensus that extracellular vesicles are probably important mediators of intercellular communication, D

Potential of MALDI-TOF mass spectrometry as a rapid detection technique in plant pathology: identification of plant-associated microorganisms.

Science.gov (United States)

Ahmad, Faheem; Babalola, Olubukola O; Tak, Hamid I

2012-09-01

Plant diseases caused by plant pathogens substantially reduce crop production every year, resulting in massive economic losses throughout the world. Accurate detection and identification of plant pathogens is fundamental to plant pathogen diagnostics and, thus, plant disease management. Diagnostics and disease-management strategies require techniques to enable simultaneous detection and quantification of a wide range of pathogenic and non-pathogenic microorganisms. Over the past decade, rapid development of matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) techniques for characterization of microorganisms has enabled substantially improved detection and identification of microorganisms. In the biological sciences, MALDI-TOF MS is used to analyze specific peptides or proteins directly desorbed from intact bacteria, fungal spores, nematodes, and other microorganisms. The ability to record biomarker ions, in a broad m/z range, which are unique to and representative of individual microorganisms, forms the basis of taxonomic identification of microorganisms by MALDI-TOF MS. Recent advances in mass spectrometry have initiated new research, i.e. analysis of more complex microbial communities. Such studies are just beginning but have great potential for elucidation not only of the interactions between microorganisms and their host plants but also those among different microbial taxa living in association with plants. There has been a recent effort by the mass spectrometry community to make data from large scale mass spectrometry experiments publicly available in the form of a centralized repository. Such a resource could enable the use of MALDI-TOF MS as a universal technique for detection of plant pathogens and non-pathogens. The effects of experimental conditions are sufficiently understood, reproducible spectra can be obtained from computational database search, and microorganisms can be rapidly characterized by genus, species

Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.

Science.gov (United States)

Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel

2011-09-01

The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.

Elimination of the risk resulting from pathogenic microorganisms in dried and smoked fish by gamma irradiation

International Nuclear Information System (INIS)

Gonzalez, O.N.

1981-01-01

The usefulness of irradiation in improving the microbiological quality and storage life of agricultural and fishery products was tried in a special study which had the following objectives: to determine the incidence of pathogenic organisms in dried, smoked and steamed fish; to determine the physico-chemical properties of these fish products; to determine the radiation dose necessary to eliminate the said pathogens at various levels of infections under practical conditions prevailing in the Philippines; to determine the organoleptic properties of the irradiated products. Staphylococcus aureus seemed to be the most radiation resistant among the test organisms used. For the purpose of the study the fish products were subjected to a radiation dose of 500 Kr. No significant difference of organoleptic properties at 0.05% level of significance existed between the irradiated and unirradiated counterparts. It was concluded that the use of low dose irradiation could be advantageously applied in combination with salting, drying and smoking and steaming not only to prolong the storage life of the fishery product but to eliminate the risk resulting from Salmonella, E. coli and Staphylococcus aureus pathogens - it appears that radiation could be most promising in smoked and steamed fish products where the low salt and high moisture contents provide less protection relative to dried fish against the growth of these microorganisms. Further the process would destroy much of the spoilage agents like the bacteria, insects, parasites, molds and yeasts which are known to be the main causes of losses in dried and smoked fishery products being experienced in developing countries like the Philippines

Artificial inorganic Biohybrids: the functional combination of microorganisms and cells with inorganic materials.

Science.gov (United States)

Holzmeister, Ib; Schamel, Martha; Groll, Jürgen; Gbureck, Uwe; Vorndran, Elke

2018-04-23

Biohybrids can be defined as the functional combination of proteins, viable cells or microorganisms with non-biological materials. This article reviews recent findings on the encapsulation of microorganisms and eukaryotic cells in inorganic matrices such as silica gels or cements. The entrapment of biological entities into a support material is of great benefit for processing since the encapsulation matrix protects sensitive cells from shear forces, unfavourable pH changes, or cytotoxic solvents, avoids culture-washout, and simplifies the separation of formed products. After reflecting general aspects of such an immobilization as well as the chemistry of the inorganic matrices, we focused on manufacturing aspects and the application of such biohybrids in biotechnology, medicine as well as in environmental science and for civil engineering purpose. The encapsulation of living cells and microorganisms became an intensively studied and rapidly expanding research field with manifold applications in medicine, bio- and environmental technology, or civil engineering. Here, the use of silica or cements as encapsulation matrices have the advantage of a higher chemical and mechanical resistance towards harsh environmental conditions during processing compared to their polymeric counterparts. In this perspective, the article gives an overview about the inorganic material systems used for cell encapsulation, followed by reviewing the most important applications. The future may lay in a combination of the currently achieved biohybrid systems with additive manufacturing techniques. In a longer perspective, this would enable the direct printing of cell loaded bioreactor components. Copyright © 2018. Published by Elsevier Ltd.

Synthetic biology expands chemical control of microorganisms.

Science.gov (United States)

Ford, Tyler J; Silver, Pamela A

2015-10-01

The tools of synthetic biology allow researchers to change the ways engineered organisms respond to chemical stimuli. Decades of basic biology research and new efforts in computational protein and RNA design have led to the development of small molecule sensors that can be used to alter organism function. These new functions leap beyond the natural propensities of the engineered organisms. They can range from simple fluorescence or growth reporting to pathogen killing, and can involve metabolic coordination among multiple cells or organisms. Herein, we discuss how synthetic biology alters microorganisms' responses to chemical stimuli resulting in the development of microbes as toxicity sensors, disease treatments, and chemical factories. Copyright © 2015 Elsevier Ltd. All rights reserved.

potentially pathogenic gastrointestinal microorganisms (ID 2972), improved lactose digestion (ID 2972) and increasing IL-10 production (ID 2973) (further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

of Lactobacillus paracasei CNCM I-1688 and Lactobacillus salivarius CNCM I-1794 and reduction of gastro-intestinal discomfort, decreasing potentially pathogenic gastro-intestinal microorganisms, improved lactose digestion and increasing IL-10 production. The food constituent that is the subject of the health......-intestinal discomfort, is a beneficial physiological effect for the general population. The claimed effect, decreasing potentially pathogenic gastro-intestinal microorganisms, might be a beneficial physiological effect for the general population. The claimed effect, improved lactose digestion, is a beneficial...... physiological effect for individuals with lactose maldigestion. No human intervention studies were provided from which conclusions could be drawn for the scientific substantiation of the above-mentioned claims. On the basis of the data provided, the Panel concludes that a cause and effect relationship has...

Effect of γ-irradiation on the occurrence of pathogenic microorganisms and nutritive value of four principal cereal grains

International Nuclear Information System (INIS)

Aziz, N.H.; Souzan, R.M.; Shahin Azza, A.

2006-01-01

The effects of 60 Co γ-photon-irradiation on the natural occurrence of pathogenic microorganisms in four principal cereal grains and on amino acids and vitamins in these cereals were investigated. The total numbers of aerobic bacteria were reduced by three logarithmic decades when grains were given a dose of 10 kGy. Coliforms and 'coagulase- positive' staphylococci were inhibited by a dose of 1 kGy, whereas fungi were inhibited by a dose of 5 kGy. The 15 kGy dose eliminated viable microorganisms in cereal grains, and about 10-30 colony-forming units of Clostridium sp. per gram of grain survived after this dose. The dose of 10 kGy did not cause any measurable destruction of total amino acids. Thiamin was reduced by 22-33% and riboflavin by 10-16% after a dose of 10 kGy. Irradiation did not increase the acid values significantly, but did increase the peroxide values, which was not accompanied by the off-odors of cereals. We conclude that the overall dose of 10 kGy is very effective for microbial decontamination of cereal grains, and does not adversely affect the nutritional quality of cereal grains

Evaluation of Suppressiveness of Soils Exhibiting Soil-Borne Disease Suppression after Long-Term Application of Organic Amendments by the Co-cultivation Method of Pathogenic Fusarium oxysporum and Indigenous Soil Microorganisms.

Science.gov (United States)

Mitsuboshi, Masahiro; Kioka, Yuuzou; Noguchi, Katsunori; Asakawa, Susumu

2018-03-29

Preventive measures against soil-borne diseases need to be implemented before cultivation because very few countermeasures are available after the development of diseases. Some soils suppress soil-borne diseases despite the presence of a high population density of pathogens. If the suppressiveness of soil against soil-borne diseases may be predicted and diagnosed for crop fields, it may be possible to reduce the labor and cost associated with excessive disinfection practices. We herein evaluated the suppressiveness of soils in fields with the long-term application of organic amendments by examining the growth of pathogenic Fusarium oxysporum co-cultivated with indigenous soil microorganisms on agar plates. Soils treated with coffee residue compost or rapeseed meal showed suppressiveness against spinach wilt disease by F. oxysporum f. sp. spinaciae or spinach wilt and lettuce root rot diseases by F. oxysporum f. sp. spinaciae and F. oxysporum f. sp. lactucae, respectively, and the growth of pathogenic Fusarium spp. on agar plates was suppressed when co-cultured with microorganisms in a suspension from these soils before crop cultivation. These results indicate the potential of the growth degree of pathogenic F. oxysporum estimated by this method as a diagnostic indicator of the suppressiveness of soil associated with the inhabiting microorganisms. A correlation was found between the incidence of spinach wilt disease in spinach and the growth degree of F. oxysporum f. sp. spinaciae by this co-cultivation method, indicating that suppressiveness induced by organic amendment applications against F. oxysporum f. sp. spinaciae is evaluable by this method. The co-cultivation method may be useful for predicting and diagnosing suppressiveness against soil-borne diseases.

The Effect of High Hydrostatic Pressure on Microorganisms in Food Preservation

OpenAIRE

M. Arici

2006-01-01

High hydrostatic pressure is a new food preservation technology known for its capacity to inactivate spoilage and pathogenic microorganisms. High-pressure treatments are receiving a great deal of attention for the inactivation of microorganisms in food processing, pressure instead of temperature is used as stabilizing factor. High hydrostatic pressure treatment is the most studied alternative process, many works reported successful results in inactivating a wide range of microorganisms under ...

Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

Directory of Open Access Journals (Sweden)

Caitlin O'Mahony

Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

The effect of antagonistic micro-organisms on the brood of honeybees (Apis mellifera) and bumblebees (Bombus terrestris) 2003

NARCIS (Netherlands)

Steen, van der J.J.M.; Dik, A.J.

2002-01-01

Several plant pathogenic fungi enter the plant trough open flowers. Spores of antagonistic micro-organisms present on the flowers can successfully compete with the possible pathogens. Honeybees and bumblebees can be used for transporting these antagonistic micro-organisms from the hive into flowers

A Quantitative Assessment of the Morphofunctional Activity of the Population of Mast Cells Exposed to Biotechnological Strains of Microorganisms

Directory of Open Access Journals (Sweden)

Natalia Sheina

2018-06-01

Full Text Available In order to assess the sensitizing properties of bacteria, micromycetes and actinomycetes, the morphofunctional activity of the population of mast cells was tested in rats exposed to biotechnological microorganisms. The result showed the high informative value of the test of peritoneal must cell degranulation. Both the result and the intensity of the response of mast cells to the exposure to the tested strains depend on the taxonomy of microorganisms, their concentration and the mode of inoculation. The test of peritoneal must cell degranulation can be recommended for assessing the biological safety of industrial microorganisms.

Direct cell writing of 3D microorgan for in vitro pharmacokinetic model.

Science.gov (United States)

Chang, Robert; Nam, Jae; Sun, Wei

2008-06-01

A novel targeted application of tissue engineering is the development of an in vitro pharmacokinetic model for drug screening and toxicology. An in vitro pharmacokinetic model is needed to realistically and reliably predict in vivo human response to drug administrations and potential toxic exposures. This paper details the fabrication process development and adaptation of microfluidic devices for the creation of such a physiologically relevant pharmacokinetic model. First, an automated syringe-based, layered direct cell writing (DCW) bioprinting process creates a 3D microorgan that biomimics the cell's natural microenvironment with enhanced functionality. Next, soft lithographic micropatterning techniques are used to fabricate a microscale in vitro device to house the 3D microorgan. This paper demonstrates the feasibility of the DCW process for freeform biofabrication of 3D cell-encapsulated hydrogel-based tissue constructs with defined reproducible patterns, direct integration of 3D constructs onto a microfluidic device for continuous perfusion drug flow, and characterization of 3D tissue constructs with predictable cell viability/proliferation outcomes and enhanced functionality over traditional culture methods.

Main Concerns of Pathogenic Microorganisms in Meat

Science.gov (United States)

Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

Pathogenic microorganisms of medicinal herbal drugs

Directory of Open Access Journals (Sweden)

Stević Tatjana

2012-01-01

Full Text Available All the parts of plants (root, leaf, flower naturally have a high level of microorganisms, bacteria and fungi, especially molds. Microbial contamination could be a result of inappropriate harvesting, cleaning of the raw plant material, unhygienic processing of the plants, unsuitable transport and storage. After examination of over 40 dried medicinal plant species, the lowest microbial quality was determined for Maydis stigma, Mentha leaf and herb, Equisetum herb, Calendula flower, Urtica leaf, Melissa leaf, Serpylli herb, Chamomilla flower etc. Although mixed infections are recorded with different types of fungus, Fusarium was observed as the most dominant genus in most of the tested drugs, followed by Aspergillus and Alternaria. In addition to these fungi species from the following genera were identified: Phoma, Cephalosporium, Nigrospora, Cladosporium, Epicoccum, Gliocladium, Myrothecium, Cercospora, Phomopsis, Verticillium, Dreschlera (=Bipolaris, Rhizoctonia, Septoria, Trichoderma, Curvularia, Stachybotrys, Trichothecium, Puccinia, Botrytis, Mucor and Rhizopus sp., depending on plant species.

Genetic reprogramming of host cells by bacterial pathogens.

Science.gov (United States)

Tran Van Nhieu, Guy; Arbibe, Laurence

2009-10-29

During the course of infection, pathogens often induce changes in gene expression in host cells and these changes can be long lasting and global or transient and of limited amplitude. Defining how, when, and why bacterial pathogens reprogram host cells represents an exciting challenge that opens up the opportunity to grasp the essence of pathogenesis and its molecular details.

Titanium photocatalyst against human pathogenic microorganisms

International Nuclear Information System (INIS)

Kussovski, V.; Stefchev, P.; Kirilov, R.

2011-01-01

The conventional methods of disinfection are not effective in the longer term. They are time and staff intensive and use aggressive chemicals. Photocatalytic oxidation on surfaces coated with titanium dioxide (TiO 2 ) might offer a possible alternative. The antimicrobial activity of TiO 2 powder P25 and thin films of TiO 2 on glass slides against representative strains of microorganisms associated with hospital-acquired infections (Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans) was investigated in vitro. High efficiency has been found in the case of the studied bacterial strains, particularly for the P. aeruginosa. It was shown that it is possible to disinfect surfaces coated with TiO 2 and stimulated by UV-A light. The reduction efficiencies for P. aeruginosa, S. aureus and C. albicans were 3.19, 2.32 and 1.22. In all cases sublethal UV-A doses provoked an important lethality in the presence of TiO 2 . (authors)

Laser inactivation of pathogenic viruses in water

Science.gov (United States)

Grishkanich, Alexander; Zhevlakov, Alexander; Kascheev, Sergey; Sidorov, Igor; Ruzankina, Julia; Yakovlev, Alexey; Mak, Andrey

2016-03-01

Currently there is a situation that makes it difficult to provide the population with quality drinking water for the sanitary-hygienic requirements. One of the urgent problems is the need for water disinfection. Since the emergence of microorganisms that are pathogens transmitted through water such as typhoid, cholera, etc. requires constant cleansing of waters against pathogenic bacteria. In the water treatment process is destroyed up to 98% of germs, but among the remaining can be pathogenic viruses, the destruction of which requires special handling. As a result, the conducted research the following methods have been proposed for combating harmful microorganisms: sterilization of water by laser radiation and using a UV lamp.

Mycoplasma fermentans glycolipid-antigen as a pathogen of rheumatoid arthritis

International Nuclear Information System (INIS)

Kawahito, Yutaka; Ichinose, Sizuko; Sano, Hajime; Tsubouchi, Yasunori; Kohno, Masataka; Yoshikawa, Toshikazu; Tokunaga, Daisaku; Hojo, Tatsuya; Harasawa, Ryo; Nakano, Teruaki; Matsuda, Kazuhiro

2008-01-01

Mycoplasma fermentans has been suspected as one of the causative pathogenic microorganisms of rheumatoid arthritis (RA) however, the pathogenic mechanism is still unclear. We, previously, reported that glycolipid-antigens (GGPL-I and III) are the major antigens of M. fermentans. Monoclonal antibody against the GGPL-III could detect the existence of the GGPL-III antigens in synovial tissues from RA patients. GGPL-III antigens were detected in 38.1% (32/84) of RA patient's tissues, but not in osteoarthritis (OA) and normal synovial tissues. Immunoelectron microscopy revealed that a part of GGPL-III antigens are located at endoplasmic reticulum. GGPL-III significantly induced TNF-α and IL-6 production from peripheral blood mononulear cells, and also proliferation of synovial fibroblasts. Further study is necessary to prove that M. fermentans is a causative microorganism of RA; however, the new mechanisms of disease pathogenesis provides hope for the development of effective and safe immunotherapeutic strategies based on the lipid-antigen, GGPL-III, in the near future

MOLECULAR-GENETIC BASIS OF PHYSIOLOGY AND PATHOGENICITY OF COXIELLA BURNETII

Directory of Open Access Journals (Sweden)

Yu. A. Panpherova

2012-01-01

Full Text Available Abstract. The agent of Q-fever Coxiella burnetii is unusual intracellular pathogen which is possessed of biggest transporting and metabolic abilities in compare with microorganisms with similar parasitic strategy. It is supposed that different strains of the pathogen exist in various stages of pathological adaption and have different potential of virulence. The structure of C. burnetii genome, characteristics of metabolic routes, mechanisms of interaction with host cells and possible virulence factors are discussed in the review. The special attention is paid to Coxiella genotyping methods and possible correlations between genomic polymorphism of different strains and their virulence potential.

ABMA, a small molecule that inhibits intracellular toxins and pathogens by interfering with late endosomal compartments.

Science.gov (United States)

Wu, Yu; Pons, Valérie; Goudet, Amélie; Panigai, Laetitia; Fischer, Annette; Herweg, Jo-Ana; Kali, Sabrina; Davey, Robert A; Laporte, Jérôme; Bouclier, Céline; Yousfi, Rahima; Aubenque, Céline; Merer, Goulven; Gobbo, Emilie; Lopez, Roman; Gillet, Cynthia; Cojean, Sandrine; Popoff, Michel R; Clayette, Pascal; Le Grand, Roger; Boulogne, Claire; Tordo, Noël; Lemichez, Emmanuel; Loiseau, Philippe M; Rudel, Thomas; Sauvaire, Didier; Cintrat, Jean-Christophe; Gillet, Daniel; Barbier, Julien

2017-11-14

Intracellular pathogenic microorganisms and toxins exploit host cell mechanisms to enter, exert their deleterious effects as well as hijack host nutrition for their development. A potential approach to treat multiple pathogen infections and that should not induce drug resistance is the use of small molecules that target host components. We identified the compound 1-adamantyl (5-bromo-2-methoxybenzyl) amine (ABMA) from a cell-based high throughput screening for its capacity to protect human cells and mice against ricin toxin without toxicity. This compound efficiently protects cells against various toxins and pathogens including viruses, intracellular bacteria and parasite. ABMA provokes Rab7-positive late endosomal compartment accumulation in mammalian cells without affecting other organelles (early endosomes, lysosomes, the Golgi apparatus, the endoplasmic reticulum or the nucleus). As the mechanism of action of ABMA is restricted to host-endosomal compartments, it reduces cell infection by pathogens that depend on this pathway to invade cells. ABMA may represent a novel class of broad-spectrum compounds with therapeutic potential against diverse severe infectious diseases.

Effect of certain medicinal plants extracts on some pathogenic microorganisms

International Nuclear Information System (INIS)

Attia, S.H.

2002-01-01

A queous, alcoholic and active ingredients extracts of karkatde, tamarind and licorice showed different inhibitory effects on the growth of some pathogenic srains. Active ingredients wwere the most effective on bacterial strains than alcoholic and aqueous extracts. Extracts of karkade and tamarind were more effective on diplococcus sp. and pseudomonas aeruginosa, respectively than other bacterial strains under investigation and the minimum inhibitory concentration (MIC) were 2 mu1/6 mm diameter disc. The extracts of karkade, tamarind and licorice increased the mycelial dry weight of aspergillus flavus by increasing the concentration of extracts in the media. Effect of extracted substances of tested plants on the ultra-structure of diplococcus sp. and p. aeruginosa and the changes in the morphological changes of A. flovus aflatoxin producer strain were studied by using electron and light microscopes, respectively. The treatment of p. aeruginosa with MIC (2 mu 1 ) of tamarined extract induced rupture of cell wall lysis of cytoplasmic ocntent. However, treatment of diplococcus sp. with 2 mu 1 of karkade extract caused patial rupture of cell wall while cell content still keeping its normal pattern. On the other hand, licorice extract stimulated germination of spores of A. Flavus.Total protein and carbohydrate contents of diplococcus sp., and p. aeruginosa decreased as a result of inhibition effect of active substance on bacterial cells. While, in A. flavus, it increased as a result of the stimulation effect of licorice extract on fungal spores

Electrical resistivity and dielectric properties of helical microorganism cells coated with silver by electroless plating

Energy Technology Data Exchange (ETDEWEB)

Cai, Jun, E-mail: jun_cai@buaa.edu.cn [Bionic and Micro/Nano/Bio Manufacturing Technology Research Center, School of Mechanical Engineering and Automation, Beihang University, Beijing 100191 (China); Lan, Mingming; Zhang, Deyuan; Zhang, Wenqiang [Bionic and Micro/Nano/Bio Manufacturing Technology Research Center, School of Mechanical Engineering and Automation, Beihang University, Beijing 100191 (China)

2012-09-01

Highlights: Black-Right-Pointing-Pointer We use the microorganism cells as forming templates to fabricate the bio-based conductive particles. Black-Right-Pointing-Pointer The microorganism cells selected as forming templates are Spirulina platens, which are of natural helical shape and high aspect ratio. Black-Right-Pointing-Pointer The sliver-coated Spirulina cells are a kind of lightweight conductive particles. Black-Right-Pointing-Pointer The composites containing sliver-coated Spirulina cells exhibit a lower percolation value. - Abstract: In this paper, microorganism cells (Spirulina platens) were used as forming templates for the fabrication of the helical functional particles by electroless silver plating process. The morphologies and ingredients of the coated Spirulina cells were analyzed with scanning electron microscopy and energy dispersive spectrometer. The crystal structures were characterized by employing the X-ray diffraction. The electrical resistivity and dielectric properties of samples containing different volume faction of sliver-coated Spirulina cells were measured and investigated by four-probe meter and vector network analyzer. The results showed that the Spirulina cells were successfully coated with a uniform silver coating and their initial helical shapes were perfectly kept. The electrical resistivity and dielectric properties of the samples had a strong dependence on the volume content of sliver-coated Spirulina cells and the samples could achieve a low percolation value owing to high aspect ratio and preferable helical shape of Spirulina cells. Furthermore, the conductive mechanism was analyzed with the classic percolation theory, and the values of {phi}{sub c} and t were obtained.

The presence of biofilm forming microorganisms on hydrotherapy equipment and facilities.

Science.gov (United States)

Jarząb, Natalia; Walczak, Maciej

2017-10-01

Hydrotherapy equipment provides a perfect environment for the formation and growth of microbial biofilms. Biofilms may reduce the microbiological cleanliness of hydrotherapy equipment and harbour opportunistic pathogens and pathogenic bacteria. The aims of this study were to investigate the ability of microorganisms that colonize hydrotherapy equipment to form biofilms, and to assess the influence of temperature and nutrients on the rate of biofilm formation. Surface swab samples were collected from the whirlpool baths, inhalation equipment and submerged surfaces of a brine pool at the spa center in Ciechocinek, Poland. We isolated and identified microorganisms from the swab samples and measured their ability to form biofilms. Biofilm formation was observed at a range of temperatures, in both nutrient-deficient and nutrient-rich environments. We isolated and identified microorganisms which are known to form biofilms on medical devices (e.g. Stenotrophomonas maltophilia). All isolates were classified as opportunistic pathogens, which can cause infections in humans with weakened immunity systems. All isolates showed the ability to form biofilms in the laboratory conditions. The potential for biofilm formation was higher in the presence of added nutrients. In addition, the hydrolytic activity of the biofilm was connected with the presence of nutrients.

Rapid methods: the detection of foodborne pathogens

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2009-01-01

Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

Inactivation of certain insect pathogens by ultraviolet radiation

Energy Technology Data Exchange (ETDEWEB)

Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

1981-01-01

The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV.

Pathogen-Reactive T Helper Cell Analysis in the Pig

Directory of Open Access Journals (Sweden)

Friederike Ebner

2017-05-01

Full Text Available There is growing interest in studying host–pathogen interactions in human-relevant large animal models such as the pig. Despite the progress in developing immunological reagents for porcine T cell research, there is an urgent need to directly assess pathogen-specific T cells—an extremely rare population of cells, but of upmost importance in orchestrating the host immune response to a given pathogen. Here, we established that the activation marker CD154 (CD40L, known from human and mouse studies, identifies also porcine antigen-reactive CD4+ T lymphocytes. CD154 expression was upregulated early after antigen encounter and CD4+CD154+ antigen-reactive T cells coexpressed cytokines. Antigen-induced expansion and autologous restimulation enabled a time- and dose-resolved analysis of CD154 regulation and a significantly increased resolution in phenotypic profiling of antigen-responsive cells. CD154 expression identified T cells responding to staphylococcal Enterotoxin B superantigen stimulation as well as T cells responding to the fungus Candida albicans and T cells specific for a highly prevalent intestinal parasite, the nematode Ascaris suum during acute and trickle infection. Antigen-reactive T cells were further detected after immunization of pigs with a single recombinant bacterial antigen of Streptococcus suis only. Thus, our study offers new ways to study antigen-specific T lymphocytes in the pig and their contribution to host–pathogen interactions.

Expanding the potential of NAI-107 for treating serious ESKAPE pathogens

DEFF Research Database (Denmark)

Brunati, Cristina; Thomsen, Thomas T; Gaspari, Eleonora

2018-01-01

Objectives: To characterize NAI-107 and related lantibiotics for their in vitro activity against Gram-negative pathogens, alone or in combination with polymyxin, and against non-dividing cells or biofilms of Staphylococcus aureus. NAI-107 was also evaluated for its propensity to select or induce...... showed that NAI-107 and its brominated variant are highly active against Neisseria gonorrhoeae and some other fastidious Gram-negative pathogens. Furthermore, all compounds strongly synergized with polymyxin against Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and Pseudomonas...... self-resistance in Gram-positive bacteria. Methods: We used MIC determinations and chequerboard experiments to establish the antibacterial activity of the examined compounds against target microorganisms. Time-kill assays were used to evaluate killing of exponential and stationary-phase cells...

Bioactivity of glycolipopeptide cell-bound biosurfactants against skin pathogens.

Science.gov (United States)

Vecino, X; Rodríguez-López, L; Ferreira, D; Cruz, J M; Moldes, A B; Rodrigues, L R

2018-04-01

The antimicrobial and anti-adhesive activities of the cell-bound biosurfactants, produced by Lactobacillus pentosus (PEB), characterized as glycolipopeptide macromolecules, were evaluated against several microorganisms present in the skin microflora, envisaging its potential use as a "natural" ingredient in cosmetic and personal care formulations. Their performance was compared with another cell-bound biosurfactants also characterized as glycolipopeptides produced by Lactobacillus paracasei (PAB). At concentrations of 50mg/mL, the PEB showed an important antimicrobial activity against Pseudomonas aeruginosa (85% when extracted with phosphate buffer (PB) and 100% when extracted with phosphate buffer saline (PBS)), Streptococcus agalactiae (100% for both extracts), Staphylococcus aureus (67% when extracted with PBS and 100% when extracted with PB), Escherichia coli (72% when extracted with PB and 89% when extracted with PBS), Streptococcus pyogenes (about 85% for both extracts) and Candida albicans (around 70% for both extracts), comparable with that obtained for the PAB. However, at lower concentrations the PAB exhibited in general higher antimicrobial activities. Biosurfactants produced by both microorganisms also showed significant anti-adhesive properties against all the microorganisms under study, except for E. coli and C. albicans (less than 30%). Overall, these cell-bound biosurfactants could be used as potential antimicrobial and anti-adhesive agents in cosmetic and pharmaceutical formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

Indicators for waterborne pathogens

National Research Council Canada - National Science Library

Committee on Indicators for Waterborne Pathogens, National Research Council

2004-01-01

... not practical or feasible to monitor for the complete spectrum of microorganisms that may occur in water, and many known pathogens are difficult to detect directly and reliably in water samples.Â...

Photodynamic action on some pathogenic microorganisms of oral cavity

Science.gov (United States)

Ovchinnikov, Ilya S.; Tuchin, Valery V.

2001-10-01

The work is devoted to an analysis of pre-clinical and clinical experiments on photodynamic action of HeNe laser radiation in aggregate with a cation thiazinium dye Methylene Blue (MB) on a mix of pathogenic and conditionally pathogenic aerobic bacteria being activators of pyoinflammatory diseases of oral cavity. Concentration of photosensitizes at which there is no own bactericidal influence on dying microflora, and parameters of influence at which the efficiency of irradiated microflora defeat reaches 99 % are determined.

Nanoscale organization of the pathogen receptor DC-SIGN mapped by single-molecule high-resolution fluorescence microscopy.

NARCIS (Netherlands)

Bakker, B.I. de; Lange, F. de; Cambi, A.; Korterik, J.P.; Dijk, E.M. van; Hulst, N.F. van; Figdor, C.G.; Garcia-Parajo, M.F.

2007-01-01

DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor

Nanoscale organization of the pathogen receptor DC-SIGN mapped by single-molecule high-resolution flourescence microscopy

NARCIS (Netherlands)

de Bakker, B.I.; de Lange, Frank; Cambi, Alessandra; Cambi, A.; Korterik, Jeroen P.; van Dijk, E.M.H.P.; van Hulst, N.F.; Figdor, Carl; Garcia Parajo, M.F.

2007-01-01

DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against pathogenic gastro-intestinal microorganisms (ID 939

DEFF Research Database (Denmark)

Tetens, Inge

Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a health claim related to a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against...... pathogenic gastro-intestinal microorganisms. The food constituent that is the subject of the health claim, a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722, is sufficiently characterised. The claimed effect, defence against pathogenic gastro...... and effect relationship has not been established between the consumption of a combination of Lactobacillus rhamnosus CNCM I-1720 and Lactobacillus helveticus CNCM I-1722 and defence against pathogenic gastro-intestinal microorganisms....

Doppler speedometer for micro-organisms

International Nuclear Information System (INIS)

Penkov, F.; Tuleushev, A.; Lisitsyn, V.; Kim, S.; Tuleushev, Yu.

1996-01-01

Objective of Investigations: Development and creation of the Doppler speedometer for micro-organisms which allows to evaluate, in a real temporal scale, variations in the state of water suspension of micro-organisms under the effect of chemical, physical and other external actions. Statement of the Problem The main problem is absence of reliable, accessible for users and simple, in view of application, Doppler speedometers for micro-organisms. Nevertheless, correlation Doppler spectrometry in the regime of heterodyning the supporting and cell-scattered laser radiation is welt known. The main idea is that the correlation function of photo-current pulses bears an information on the averages over the assembly of cell velocities. For solving the biological problems, construction of auto-correlation function in the real-time regime with the delay time values comprising, function in the real-time regime with the delay time values comprising, nearly, 100 me (10 khz) or higher is needed. Computers of high class manage this problem using but the program software. Due to this, one can simplify applications of the proposed techniques provided he creates the Doppler speedometer for micro-organism on a base of the P entium . Expected Result Manufactured operable mock-up of the Doppler speedometer for micro-organisms in a form of the auxiliary computer block which allows to receive an information, in the real time scale, on the results of external effects of various nature on the cell assembly in transparent medium with a small volume of the studied cell suspension

The graphene oxide contradictory effects against human pathogens

Science.gov (United States)

Palmieri, Valentina; Carmela Lauriola, Maria; Ciasca, Gabriele; Conti, Claudio; De Spirito, Marco; Papi, Massimiliano

2017-04-01

Standing out as the new wonder bidimensional material, graphene oxide (GO) has aroused an exceptional interest in biomedical research by holding promise for being the antibacterial of future. First, GO possesses a specific interaction with microorganisms combined with a mild toxicity for human cells. Additionally, its antibacterial action seems to be directed to multiple targets in pathogens, causing both membranes mechanical injury and oxidative stress. Lastly, compared to other carbon materials, GO has easy and low-cost processing and is environment-friendly. This remarkable specificity and multi-targeting antibacterial activity come at a time when antibiotic resistance represents the major health challenge. Unfortunately, a comprehensive framework to understand how to effectively utilize this material against microorganisms is still lacking. In the last decade, several groups tried to define the mechanisms of interaction between GO flakes and pathogens but conflicting results have been reported. This review is focused on all the contradictions of GO antimicrobial properties in solution. Flake size, incubation protocol, time of exposure and species considered are examples of factors influencing results. These parameters will be summarized and analyzed with the aim of defining the causes of contradictions, to allow fast GO clinical application.

Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

Directory of Open Access Journals (Sweden)

Chotiah S

2013-06-01

Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

[Ants as carriers of microorganisms in hospital environments].

Science.gov (United States)

Pereira, Rogério Dos Santos; Ueno, Mariko

2008-01-01

Concern exists regarding the real possibility of public health threats caused by pathogenic agents that are carried by urban ants. The present study had the objective of isolating and identifying the microorganisms that are associated with ants in hospital environments. One hundred and twenty-five ants of the same species were collected from different units of a university hospital. Each ant was collected using a swab soaked with physiological solution and was transferred to a tube containing brain heart infusion broth and incubated at 35 degrees C for 24 hours. From each tube, with growth, inoculations were made into specific culturing media, to isolate any microorganisms. The ants presented a high capacity for carrying microorganism groups: spore-producing Gram-positive bacilli 63.5%, Gram-negative bacilli 6.3%, Gram-positive cocci 23.1%, filamentous fungi 6.7% and yeast 0.5%. Thus, it can be inferred that ants may be one of the agents responsible for disseminating microorganisms in hospital environments.

Inactivation of certain insect pathogens by ultraviolet radiation

International Nuclear Information System (INIS)

Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

1981-01-01

The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV. (orig.) [de

Esterase screening using whole cells of Brazilian soil microorganisms

Energy Technology Data Exchange (ETDEWEB)

Mantovani, Simone M.; Oliveira, Luciana G. de; Marsaioli, Anita J., E-mail: anita@iqm.unicamp.b [Universidade Estadual de Campinas (IQ/UNICAMP), SP (Brazil). Inst. de Quimica

2010-07-01

A miniaturized enzymatic assay using fluorescent probes to reveal esterase producing microorganisms was optimized and applied to screen 64 soil bacterial strains. The best results were validated using traditional non-fluorogenic assays with acetyl and propanoyl phenylethanol to confirm the miniaturized results. The most active microorganisms belong to the genus Bacillus showing esterase activity and good enantiomeric ratios for the resolution of phenylethanol derivatives (E > 30). Part of the microorganisms are kept in our laboratory in glycerol or freezedried and the best microorganisms will be deposited in the CBMAI/CPQBA/UNICAMP culture collection. (author)

Biological activities of Rosmarinus officinalis L. (rosemary) extract as analyzed in microorganisms and cells

Science.gov (United States)

de Jesus, Daiane; Figueira, Leandro Wagner; de Oliveira, Felipe Eduardo; Pacheco Soares, Cristina; Camargo, Samira Estves Afonso; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

2017-01-01

��≤ 50 mg/mL), showed anti-inflammatory effect, and was not genotoxic. Impact statement Rosmarinus officinalis L. extract effectively contributed to in vitro control of important species of microorganisms such as Candida albicans, Staphylococcus aureus, Enterococcus faecalis, Streptococcus mutans, and Pseudomonas aeruginosa in mono- and polymicrobial biofilms that are responsible for several infections in oral cavity as in other regions of the body. Furthermore, this extract promoted also cell viability above 50% at concentrations ≤ 50 mg/mL, excellent anti-inflammatory effect, showing inhibition or reduction of the synthesis of proinflammatory cytokines, being also non-genotoxic to cell lines studied. Thus, this extract may be a promising therapeutic agent that can be added in some medical and dental formulations such as toothpastes, mouthwashes, irrigating root canals, ointments, soaps, in order to control pathogenic microorganisms and biofilms, with anti-inflammatory effect and absence of cytotoxic and genotoxic. PMID:28093936

Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

NARCIS (Netherlands)

Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

2014-01-01

Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles

Genome-Wide Analysis of Host Responses to Four Different Types of Microorganisms in Bombyx Mori (Lepidoptera: Bombycidae).

Science.gov (United States)

Cheng, Tingcai; Lin, Ping; Huang, Lulin; Wu, Yuqian; Jin, Shengkai; Liu, Chun; Xia, Qingyou

2016-01-01

Several pathogenic microorganisms have been used to investigate the genome-wide transcriptional responses of Bombyx mori to infection. However, studies have so far each focused on one microorganism, and systematic genome-wide comparison of transcriptional responses to different pathogenic microorganisms has not been undertaken. Here, we surveyed transcriptional responses of B. mori to its natural bacterial, viral, and fungal pathogens, Bacillus bombyseptieus, B. mori nucleopolyhedrovirus (BmNPV), and Beauveria bassiana, respectively, and to nonpathogenic Escherichia coli, by microarray analysis. In total, the expression of 2,436, 1,804, 1,743, and 912 B. mori genes was modulated by infection with B. bombyseptieus, BmNPV, B. bassiana, and E. coli, respectively. Notably, the expression of 620, 400, 177, or 165 of these genes was only modulated by infection with B. bombyseptieus, BmNPV, B. bassiana, or E. coli, respectively. In contrast to the expression of genes related to juvenile hormone synthesis and metabolism, that of genes encoding juvenile hormone binding proteins was microorganism-specific. Three basal metabolic pathways were modulated by infection with any of the four microorganisms, and 3, 14, 5, and 2 metabolic pathways were specifically modulated by infection with B. bombyseptieus, BmNPV, B. bassiana, and E. coli, respectively. Interestingly, BmNPV infection modulated the JAK/STAT signaling pathway, whereas both the Imd and Toll signaling pathways were modulated by infection with B. bombyseptieus, B. bassiana, or E. coli These results elucidate potential molecular mechanisms of the host response to different microorganisms, and provide a foundation for further work on host-pathogen interaction. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

Czech Academy of Sciences Publication Activity Database

Pálková, Z.; Váchová, Libuše

2016-01-01

Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

Study of molasses / vinasse waste ratio for single cell protein and total microorganisms

Directory of Open Access Journals (Sweden)

Marcia Luciana Cazetta

2006-02-01

Full Text Available Different molasses/ vinasse ratio were used as substrate to investigate single cell protein and total lipids production by five microorganisms: four yeasts strains: Candida lipolytica, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, a yeast isolated from vinasse lake (denominated LLV98 and a bacterium strain, Corynebacterium glutamicum. The media utilized were: a 50% molasses and 50% vinasse; b 25% molasses and 75% vinasse and c 75% molasses and 25% vinasse. The objective of this work was to study the growth of microorganisms and also evaluate protein and lipids content in the biomass obtained from these by-products. The highest single cell protein production was obtained by S. cerevisiae, 50.35%, followed by R. mucilaginosa, 41.96%. The lowest productions were obtained by C. glutamicum. The higher total lipids productions, more than 26%, were founded in molasses plus vinasse at 50%/50% by S. cerevisiae and C. glutamicum.

Dendritic cells and immuno-modulation in autoimmune arthritis

NARCIS (Netherlands)

Spiering, R.|info:eu-repo/dai/nl/313939020

2013-01-01

The immune system consists of a broad array of immune cells to protect the body against invasive pathogenic microorganisms. Immune responses should however, be tightly controlled to ensure tolerance to the body’s own cells and proteins in order to limit damage to the host own cells and tissue.

Microorganisms from hands of traditional Chinese medical doctors ...

African Journals Online (AJOL)

Background: In a central hospital, the heavy clinical workload makes one to overlook its hazard to health and can to a large extent promote the transmission of pathogenic microorganisms. It is not uncommon however, to observe practices that deviate from normal standards of hygiene. Hand contact between doctors of TCM ...

Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce

Directory of Open Access Journals (Sweden)

Sujata A. Sirsat

2013-11-01

Full Text Available Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce. Following this, an intervention study was performed to combat foodborne pathogen surrogates (Salmonella and E. coli, spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid significantly reduced Salmonella, E. coli, coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless, it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce.

Science.gov (United States)

Sirsat, Sujata A; Neal, Jack A

2013-11-11

Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens) production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce). Following this, an intervention study was performed to combat foodborne pathogen surrogates ( Salmonella and E. coli ), spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid) significantly reduced Salmonella , E. coli , coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless), it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

Directory of Open Access Journals (Sweden)

Martin S Davey

2011-05-01

Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

Science.gov (United States)

Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

2011-01-01

Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

[DIFFERENTIAL SENSITIVITY OF MICROORGANISMS TO POLYHEXAMETHYLENEGUANIDINE].

Science.gov (United States)

Lysytsya, A V; Mandygra, Y M; Bojko, O P; Romanishyna, O O; Mandygra, M S

2015-01-01

Factors identified that affect the sensitivity of microorganisms to polyhexamethyleneguanidine (PHMG). Salts of PHMG chloride, valerate, maleate, succinate was to use. Test strains of Esherichia coli, Staphylococcus aureus, Bacillus cereus, Leptospira interrogans, Paenibacillus larvae, Mycobacterium bovis, M. avium, M. fortuitum, Aspergillus niger and some strains of viruses are taken as objects of research. We have determined that the cytoplasm membrane phospholipids is main "target" for the polycation molecules of PHMG. A differential sensitivity of the microorganisms to this drug is primarily determined by relative amount of lipids in membrane and their accessibility. Such trends exist: increase the relative contents of anionic lipids and more negative surface electric potential of membrane, and reduction of the sizes fat acid remainder of lipids bring to increase of microorganism sensitivity. Types of anion salt PHMG just have a certain value. Biocide activity of PHMG chloride is more, than its salts with organic acid. Feasibility of combining PHMG with other biocides in the multicomponent disinfectants studied and analyzed. This combination does not lead to a significant increase in the sensitivity of microorganisms tested in most cases. Most species of pathogenic bacteria can be quickly neutralized by aqueous solutions of PHMG in less than 1% concentrations.

[Detection of biofilm formation by selected pathogens relevant to the food industry].

Science.gov (United States)

Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

2015-09-01

Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

Science.gov (United States)

Cassells, Alan C

2012-01-01

The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

Electrochemical Methodologies for the Detection of Pathogens.

Science.gov (United States)

Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

2018-05-25

electrochemical-based microorganism recognition approaches and putting them into context of other sensing devices for pathogens such as culturing the microorganism on agar plates and the polymer chain reaction (PCR) method, able to identify the DNA of the microorganism. Recent breakthroughs will be highlighted, including the utilization of microfluidic devices and immunomagnetic separation for multiple pathogen analysis in a single device. We will conclude with some perspectives and outlooks to better understand shortcomings. Indeed, there is currently no adequate solution that allows the selective and sensitive binding to a specific microorganism, that is fast in detection and screening, cheap to implement, and able to be conceptualized for a wide range of biologically relevant targets.

Neonatal intensive care unit: Reservoirs of Nosocomial pathogens ...

African Journals Online (AJOL)

Improvement in the care and treatment of neonates had contributed to their increased survival. Nosocomial infection remains an important problem in intensive care units. Hospital wards had been shown to act as reservoirs of pathogenic microorganisms associated with infection. To assess the prevalence of pathogenic ...

Properties of thermophilic microorganisms

International Nuclear Information System (INIS)

Ljungdahl, L.G.

1984-01-01

Microorganisms are called thermophilic or extreme thermophilic (caldo-active) if they grow and reproduce over 47 0 C and 70 0 C, respectively. A survey of growth characteristics of thermophiles is presented and it includes those which also live at extreme pH. The prevalent but not completely emcompassing theory of the ability of thermophiles to grow at high temperatures is that they have macromolecules and cell organelles with high thermostability. Work on some proteins and cell organelles from thermophiles is reviewed. The thermostabilities of these components are compared with those of the living cells, and factors which may govern optimum as well as minimum growth temperatures of microorganisms are discussed. Examples are from the literature but also include enzymes involved in tetrahydrofolate metabolism and other proteins of acetogenic therhmophilic bacteria which are presently studied in the author's laboratory

Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

Science.gov (United States)

Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

2017-05-01

We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fate of indicator microorganisms under nutrient management plan conditions.

Science.gov (United States)

Bradford, Scott A; Segal, Eran

2009-01-01

Nutrient management plans (NMPs) for application of wastewater from concentrated animal feeding operations are designed to meet crop water and nutrient requirements, but implicitly assume that pathogenic microorganisms in the wastewater will be retained and die-off in the root zone. A NMP was implemented on a field plot to test this assumption by monitoring the fate of several fecal indicator microorganisms (Enterococcus, fecal coliforms, somatic coliphage, and total Escherichia coli). When well-water and wastewater were applied to meet measured evapotranspiration (ET), little advective transport of the indicator microorganisms occurred below the root zone and the remaining microorganisms rapidly died-off (within 1 mo). Additional experiments were conducted in the laboratory to better quantify microorganism transport and survival in the field soil. Batch survival experiments revealed much more rapid die-off rates for the bacterial indicator microorganisms in native than in sterilized soil, suggesting that biotic factors controlled survival. Saturated column experiments with packed field soil, demonstrated much greater transport potential for somatic coliphage than bacterial indicators (Enterococcus and total E. coli) and that the retention rates for the indicator microorganisms were not log-linear with depth. A worst case transport scenario of ponded infiltration on a large undistributed soil column from the field was also initiated and indicator microorganisms were not detected in the column outflow or in the soil at a depth of 65 cm. All of these observations support the hypothesis that a NMP at this site will protect groundwater supplies from microorganism contamination, especially when applied water and wastewater meet ET.

Invasion of vascular cells in vitro by Porphyromonas endodontalis.

Science.gov (United States)

Dorn, B R; Harris, L J; Wujick, C T; Vertucci, F J; Progulske-Fox, A

2002-04-01

The objective of this study was to determine whether laboratory strains and clinical isolates of microorganisms associated with root canal infections can invade primary cultures of cardiovascular cells. Quantitative levels of bacterial invasion of human coronary artery endothelial cells (HCAEC) and coronary artery smooth muscle cells (CASMC) were measured using a standard antibiotic protection assay. Transmission electron microscopy was used to confirm and visualize internalization within the vascular cells. Of the laboratory and clinical strains tested, only P. endodontalis ATCC 35406 was invasive in an antibiotic protection assay using HCAEC and CASMC. Invasion of P. endodontalis ATCC 35406 was confirmed by transmission electron microscopy. Certain microorganisms associated with endodontic infections are invasive. If bacterial invasion of the vasculature contributes to the pathogenesis of cardiovascular disease, then microorganisms in the pulp chamber represent potential pathogens.

Fate and control of pathogenic and spoilage micro-organisms in orange blossom (Citrus aurantium) and rose flower (Rosa centifolia) hydrosols.

Science.gov (United States)

Labadie, C; Cerutti, C; Carlin, F

2016-12-01

Hydrosols are hydrodistillation products used in food and cosmetic industries, perfumery, pharmacy and aromatherapy. The ability of preservatives to control previously reported bacterial proliferation and spoilage was evaluated. All tested preservatives were authorized for food and cosmetic application. Major pathogens of concern for foods and cosmetics were poorly able to grow in rose and orange blossom hydrosols when inoculated and incubated at 30°C. Commercial antimicrobials, such as isothiazolinone, chlorphenesin and paraben solutions, benzyl alcohol and sodium benzoate at pH = 5·0, controlled the growth of Pseudomonas and Burkholderia sp. strains representative of the natural microbiota of both hydrosols for >90 days at 30°C, only at concentrations close to the authorized limits. Concentrations of some of the tested preservatives that controlled growth at 5°C were lower than at 30°C. Pathogenic micro-organisms likely represent a low risk in rose flower and orange blossom hydrosol. However, the oligotrophic character of hydrosols and the antimicrobial properties of their essential oils do not prevent microbiological spoilage by the naturally present microbiota. In the absence of aseptic conditions and microbial inactivation process, only preservatives can stabilize hydrosols for a several-month storage. Several effective preservatives have been identified. © 2016 The Society for Applied Microbiology.

Size-dependent antibacterial activities of silver nanoparticles against oral anaerobic pathogenic bacteria.

Science.gov (United States)

Lu, Zhong; Rong, Kaifeng; Li, Ju; Yang, Hao; Chen, Rong

2013-06-01

Dental caries and periodontal disease are widespread diseases for which microorganism infections have been identified as the main etiology. Silver nanoparticles (Ag Nps) were considered as potential control oral bacteria infection agent due to its excellent antimicrobial activity and non acute toxic effects on human cells. In this work, stable Ag Nps with different sizes (~5, 15 and 55 nm mean values) were synthesized by using a simple reduction method or hydrothermal method. The Nps were characterized by powder X-ray diffraction, transmission electron microscopy and UV-vis absorption spectroscopy. The antibacterial activities were evaluated by colony counting assay and growth inhibition curve method, and corresponding minimum inhibitory concentration (MIC) against five anaerobic oral pathogenic bacteria and aerobic bacteria E. coli were determined. The results showed that Ag Nps had apparent antibacterial effects against the anaerobic oral pathogenic bacteria and aerobic bacteria. The MIC values of 5-nm Ag against anaerobic oral pathogenic bacteria A. actinomycetemcomitans, F. nuceatum, S. mitis, S. mutans and S. sanguis were 25, 25, 25, 50 and 50 μg/mL, respectively. The aerobic bacteria were more susceptible to Ag NPs than the anaerobic oral pathogenic bacteria. In the mean time, Ag NPs displayed an obvious size-dependent antibacterial activity against the anaerobic bacteria. The 5-nm Ag presents the highest antibacterial activity. The results of this work indicated a potential application of Ag Nps in the inhibition of oral microorganism infections.

Long-Term Live Cell Imaging of Cell Migration: Effects of Pathogenic Fungi on Human Epithelial Cell Migration.

Science.gov (United States)

Wöllert, Torsten; Langford, George M

2016-01-01

Long-term live cell imaging was used in this study to determine the responses of human epithelial cells to pathogenic biofilms formed by Candida albicans. Epithelial cells of the skin represent the front line of defense against invasive pathogens such as C. albicans but under certain circumstances, especially when the host's immune system is compromised, the skin barrier is breached. The mechanisms by which the fungal pathogen penetrates the skin and invade the deeper layers are not fully understood. In this study we used keratinocytes grown in culture as an in vitro model system to determine changes in host cell migration and the actin cytoskeleton in response to virulence factors produced by biofilms of pathogenic C. albicans. It is clear that changes in epithelial cell migration are part of the response to virulence factors secreted by biofilms of C. albicans and the actin cytoskeleton is the downstream effector that mediates cell migration. Our goal is to understand the mechanism by which virulence factors hijack the signaling pathways of the actin cytoskeleton to alter cell migration and thereby invade host tissues. To understand the dynamic changes of the actin cytoskeleton during infection, we used long-term live cell imaging to obtain spatial and temporal information of actin filament dynamics and to identify signal transduction pathways that regulate the actin cytoskeleton and its associated proteins. Long-term live cell imaging was achieved using a high resolution, multi-mode epifluorescence microscope equipped with specialized light sources, high-speed cameras with high sensitivity detectors, and specific biocompatible fluorescent markers. In addition to the multi-mode epifluorescence microscope, a spinning disk confocal long-term live cell imaging system (Olympus CV1000) equipped with a stage incubator to create a stable in vitro environment for long-term real-time and time-lapse microscopy was used. Detailed descriptions of these two long-term live

Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.

Science.gov (United States)

Dobón, Albor; Canet, Juan Vicente; García-Andrade, Javier; Angulo, Carlos; Neumetzler, Lutz; Persson, Staffan; Vera, Pablo

2015-04-01

Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs) from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence) factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.

Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.

Directory of Open Access Journals (Sweden)

Albor Dobón

2015-04-01

Full Text Available Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.

Use of Probiotic Microorganisms for Bio-Protective Aims

Directory of Open Access Journals (Sweden)

Filiz YANGILAR

2015-03-01

Full Text Available It was known that some diseases can be treated as the result of the use of antibiotics in certain periods and at certain dosages while inactivating and deteriorating normal microorganisms performing useful activities in human metabolism (in especially intestinal flora. It was occured that after the use of antibiotics, some defects can be seen resulting from antibiotics (such as allergy, diarrhea, gas formation etc. With this aim, nutraceutics and functional food have gained importance over the last years and consumers began to be interested in probiotics, natural antioxidants, dietary fibres, products with low calorie and cholesterol contents, especially the products containing probioticbacteria. Bacteriocins produced by probiotic bacteria can play important roles as food protective and safeguarding since they can compete with unwanted or pathogen microorganisms survive in the media and colonize in intestines. In this review, is aimed to emphasis bioprotective compounds, advantages and disadvantages of biopreservation method and the importance of the mechanisms of probiotic microorganisms.

Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

Science.gov (United States)

Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

IPM potentials of microbial pathogens and diseases of mites

NARCIS (Netherlands)

van der Geest, L.P.S.; Ciancio, A.; Mukerji, K.G.

2010-01-01

An overview is given of diseases in mites, caused by infectious microorganisms. Many pathogens play an important role in the regulation of natural populations of mite populations and are for this reason subject of research on the feasibility to develop such pathogens to biological control agents.

The functional micro-organization of grid cells revealed by cellular-resolution imaging.

Science.gov (United States)

Heys, James G; Rangarajan, Krsna V; Dombeck, Daniel A

2014-12-03

Establishing how grid cells are anatomically arranged, on a microscopic scale, in relation to their firing patterns in the environment would facilitate a greater microcircuit-level understanding of the brain's representation of space. However, all previous grid cell recordings used electrode techniques that provide limited descriptions of fine-scale organization. We therefore developed a technique for cellular-resolution functional imaging of medial entorhinal cortex (MEC) neurons in mice navigating a virtual linear track, enabling a new experimental approach to study MEC. Using these methods, we show that grid cells are physically clustered in MEC compared to nongrid cells. Additionally, we demonstrate that grid cells are functionally micro-organized: the similarity between the environment firing locations of grid cell pairs varies as a function of the distance between them according to a "Mexican hat"-shaped profile. This suggests that, on average, nearby grid cells have more similar spatial firing phases than those further apart. Copyright © 2014 Elsevier Inc. All rights reserved.

Altered T-cell responses by the periodontal pathogen Porphyromonas gingivalis.

Directory of Open Access Journals (Sweden)

Hazem Khalaf

Full Text Available Several studies support an association between the chronic inflammatory diseases periodontitis and atherosclerosis with a crucial role for the periodontal pathogen Porphyromonas gingivalis. However, the interplay between this pathogen and the adaptive immune system, including T-cells, is sparsely investigated. Here we used Jurkat T-cells to determine the effects of P. gingivalis on T-cell-mediated adaptive immune responses. We show that viable P. gingivalis targets IL-2 expression at the protein level. Initial cellular events, including ROS production and [Ca(2+](i, were elevated in response to P. gingivalis, but AP-1 and NF-κB activity dropped below basal levels and T-cells were unable to sustain stable IL-2 accumulation. IL-2 was partially restored by Leupeptin, but not by Cathepsin B Inhibitor, indicating an involvement of Rgp proteinases in the suppression of IL-2 accumulation. This was further confirmed by purified Rgp that caused a dose-dependent decrease in IL-2 levels. These results provide new insights of how this periodontal pathogen evades the host adaptive immune system by inhibiting IL-2 accumulation and thus attenuating T-cell proliferation and cellular communication.

Extracellular electron transfer mechanisms between microorganisms and minerals

Energy Technology Data Exchange (ETDEWEB)

Shi, Liang; Dong, Hailiang; Reguera, Gemma; Beyenal, Haluk; Lu, Anhuai; Liu, Juan; Yu, Han-Qing; Fredrickson, James K.

2016-08-30

Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels and nanomaterials.

Genomewide analyses of pathogenic and regulatory T cells of NOD ...

Indian Academy of Sciences (India)

DANG SUN

Two regulatory T cell clones (Tregs) were used in this study. Treg1 cells were clone-derived from the previously described. Keywords. methylation; cDNA microarray; type 1 diabetes; pathogenic T cells; .... Gender-specific differences in.

Resistance of pathogenic and spoilage microorganisms to disinfectants in the presence of organic matter and their residual effect on stainless steel and polypropylene.

Science.gov (United States)

Iñiguez-Moreno, Maricarmen

2018-04-23

The effectiveness of disinfectants can vary according to the microorganism, type of residues and surface. Hence, the aim of this study was to determine the effectiveness of four disinfectants in the presence of organic matter and their residual effect on stainless steel grade 304 (SS) and polypropylene B (PP-B). The disinfectant effectiveness in the presence of meat extract, yolk egg and whole milk was determined according to AOAC and UNE-EN 1040:2015; the residual effect was realized according to UNE-EN 13697:2015, using approved strains. The disinfectant effectiveness was affect at different grades depending on the organic matter present; disinfectant A (400μgmL -1 , fifth generation quaternary ammonium compound, QAC) was most effective in the presence of 10% meat extract, while the disinfectant C (200μgmL -1 , peracetic acid) had better activity in the presence of 10% egg yolk and whole milk. In the evaluation of residual effect onto SS and PP-B, the QAC had the better effect, reducing 6 Log 10 CFU mL -1 of Listeria monocytogenes ATCC 19111 24h after their application. Conversely, the disinfectants had no residual effect against Pseudomonas aeruginosa ATCC 15442. The antimicrobial activity of disinfectants tested against pathogenic and spoilage microorganisms was affected according to the type of organic matter. Disinfectant A had a more residual effect than the other disinfectants evaluated. Moreover, the residual effect of a disinfectant is greater on SS than on PP-B and dependent on the microorganism tested. Copyright © 2018. Published by Elsevier Ltd.

Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

Science.gov (United States)

Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

2014-06-01

The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.

Inactivation of microorganisms for high pressures in the wine industry

International Nuclear Information System (INIS)

Montana B, Jaime Nelson; Ortegon T, Sandra Patricia

2000-01-01

In order to evaluate experimentally the capacity of N 2 and CO 2 under pressure to inactivate wild yeasts, which remain in the Puntalarga vineyard grape, musts were exposed to hyperbaric treatment with these gases. At the end of the pascalization (after 2 hours), CO 2 at 15 degrades Celsius under pressures from 1 to 5 MPa, reached high inactivation percentages of yeast cells (> 90%). Contrary to CO 2 treatment the use of N 2 at 15 degrades Celsius at 4 and 10 MPa failed to exert microbicide effect in a same treatment time. While CO 2 gas with high solubility in water has the potential to reduce microbial loads in musts, N 2 gas with low solubility in water have not effect on the survival of the pathogenic microorganisms in these juices

Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

International Nuclear Information System (INIS)

Kord, M.; Khafagi, I.; Dewedar, A.

2003-01-01

The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

IgG antibodies against microorganisms and atopic disease in Danish adults

DEFF Research Database (Denmark)

Linneberg, Allan; Ostergaard, Christian; Tvede, Michael

2003-01-01

BACKGROUND: Seropositivity to food-borne and orofecal microorganisms (hepatitis A virus, Helicobacter pylori, and Toxoplasma gondii ), which are considered to be markers of poor hygiene, has been reported to be associated with a lower prevalence of atopy. In contrast, colonization of the gut...... with Clostridium difficile, a potential intestinal bacterial pathogen, in early childhood may be associated with a higher prevalence of atopy. OBJECTIVE: The objective of this study was to investigate the association between atopy and exposure to 2 groups of food-borne and orofecal microorganisms: (1) markers...... to microorganisms was assessed as IgG seropositivity to microorganisms. RESULTS: Seropositivity to 2 or 3 markers of poor hygiene (hepatitis A virus, H pylori, and T gondii ) was associated with a lower prevalence of atopy (adjusted odds ratio, 0.5; 95% CI, 0.3 to 0.8). In contrast, seropositivity to 2 or 3...

Final technical report for project titled Quantitative Characterization of Cell Aggregation/Adhesion as Predictor for Distribution and Transport of Microorganisms in Subsurface Environment

Energy Technology Data Exchange (ETDEWEB)

Gu, April Z. [Northeastern Univ., Boston, MA (United States); Wan, Kai-tak [Northeastern Univ., Boston, MA (United States)

2014-09-02

This project aims to explore and develop enabling methodology and techniques for nano-scale characterization of microbe cell surface contact mechanics, interactions and adhesion quantities that allow for identification and quantification of indicative properties related to microorganism migration and transport behavior in porous media and in subsurface environments. Microbe transport has wide impact and therefore is of great interest in various environmental applications such as in situ or enhanced subsurface bioremediation,filtration processes for water and wastewater treatments and protection of drinking water supplies. Although great progress has been made towards understanding the identities and activities of these microorganisms in the subsurface, to date, little is known of the mechanisms that govern the mobility and transport of microorganisms in DOE’s contaminated sites, making the outcomes of in situ natural attenuation or contaminant stability enhancement unpredictable. Conventionally, movement of microorganisms was believed to follows the rules governing solute (particle) transport. However, recent studies revealed that cell surface properties, especially those pertaining to cell attachment/adhesion and aggregation behavior, can cause the microbe behavior to deviate from non-viable particles and hence greatly influence the mobility and distribution of microorganisms in porous media.This complexity highlights the need to obtain detailed information of cell-cell and cell-surface interactions in order to improve and refine the conceptual and quantitative model development for fate and transport of microorganisms and contaminant in subsurface. Traditional cell surface characterization methods are not sufficient to fully predict the deposition rates and transport behaviors of microorganism observed. A breakthrough of methodology that would allow for quantitative and molecular-level description of intrinsic cell surface properties indicative for cell

Mucosal immunity to pathogenic intestinal bacteria.

Science.gov (United States)

Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

2016-03-01

The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

Overcoming antibiotic resistance: Is siderophore Trojan horse conjugation an answer to evolving resistance in microbial pathogens?

Science.gov (United States)

Dhusia, Kalyani; Bajpai, Archana; Ramteke, P W

2018-01-10

Comparative study of siderophore biosynthesis pathway in pathogens provides potential targets for antibiotics and host drug delivery as a part of computationally feasible microbial therapy. Iron acquisition using siderophore models is an essential and well established model in all microorganisms and microbial infections a known to cause great havoc to both plant and animal. Rapid development of antibiotic resistance in bacterial as well as fungal pathogens has drawn us at a verge where one has to get rid of the traditional way of obstructing pathogen using single or multiple antibiotic/chemical inhibitors or drugs. 'Trojan horse' strategy is an answer to this imperative call where antibiotic are by far sneaked into the pathogenic cell via the siderophore receptors at cell and outer membrane. This antibiotic once gets inside, generates a 'black hole' scenario within the opportunistic pathogens via iron scarcity. For pathogens whose siderophore are not compatible to smuggle drug due to their complex conformation and stiff valence bonds, there is another approach. By means of the siderophore biosynthesis pathways, potential targets for inhibition of these siderophores in pathogenic bacteria could be achieved and thus control pathogenic virulence. Method to design artificial exogenous siderophores for pathogens that would compete and succeed the battle of intake is also covered with this review. These manipulated siderophore would enter pathogenic cell like any other siderophore but will not disperse iron due to which iron inadequacy and hence pathogens control be accomplished. The aim of this review is to offer strategies to overcome the microbial infections/pathogens using siderophore. Copyright © 2017 Elsevier B.V. All rights reserved.

Intervention strategies for control of foodborne pathogens

Science.gov (United States)

Juneja, Vijay K.

2004-03-01

The increasing numbers of illnesses associated with foodborne pathogens such as Listeria monocytogenes and Escherichia coli O157:H7, has renewed concerns about food safety because of consumer preferences for minimally processed foods that offer convenience in availability and preparation. Accordingly, the need for better control of foodborne pathogens has been paramount in recent years. Mechanical removal of microorganisms from food can be accomplished by centrifugation, filtration, trimming and washing. Cleaning and sanitation strategies can be used for minimizing the access of microorganisms in foods from various sources. Other strategies for control of foodborne pathogens include established physical microbiocidal treatments such as ionizing radiation and heating. Research has continued to demonstrate that food irradiation is a suitable process to control and possibly eliminate foodborne pathogens, for example Listeria monocytogenes and Escherichia coli O157:H7, from a number of raw and cooked meat and poultry products. Heat treatment is the most common method in use today for the inactivation of microorganisms. Microorganisms can also be destroyed by nonthermal treatments, such as application of high hydrostatic pressure, pulsed electric fields, oscillating magnetic fields or a combination of physical processes such as heat-irradiation, or heat-high hydrostatic pressure, etc. Each of the non-thermal technologies has specific applications in terms of the types of food that can be processed. Both conventional and newly developed physical treatments can be used in combination for controlling foodborne pathogens and enhancing the safety and shelf life of foods. Recent research has focused on combining traditional preservation factors with emerging intervention technologies. However, many key issues still need to be addressed for combination preservation factors or technologies to be useful in the food industry to meet public demands for foods with enhanced safety

MICROORGANISMS: A MARVELOUS SOURCE OF SINGLE CELL PROTEINS

Directory of Open Access Journals (Sweden)

Agam Nangul

2013-08-01

Full Text Available The increasing global population living below the poverty line is driving the scientific community to search for non-conventional protein sources that can replace conventional expensive ones. Microbial proteins, or single-cell protein (SCP, represent a potential future nutrient source for human food and animal feed. These microbial proteins can be grown rapidly on substrates with minimum dependence on soil, water and climate conditions. They can be produced from algae, fungi and bacteria the chief sources of SCP. It is convenient to use microorganisms for production of SCP as they grow rapidly and have high protein content. Industrially, they can be produced from algal biomass, yeast, fungi. There are several other ways of getting SCP as well. Despite numerous advantages of SCP, they have disadvantages and toxic effects too, especially related to mycotoxins and bacterial toxins.

Distributions of microorganisms in foods and their impact on food safety

NARCIS (Netherlands)

Jongenburger, I.

2012-01-01

The physical distributions of pathogens in foods influence the likelihood that a food product will cause illness, but knowledge about the physical distribution of microorganisms in foods and especially the heterogeneity therein is scarce. This Ph.D. research aims to increase the knowledge of

Always one step ahead: How pathogenic bacteria use the type III secretion system to manipulate the intestinal mucosal immune system

Directory of Open Access Journals (Sweden)

Marchès Olivier

2011-05-01

Full Text Available Abstract The intestinal immune system and the epithelium are the first line of defense in the gut. Constantly exposed to microorganisms from the environment, the gut has complex defense mechanisms to prevent infections, as well as regulatory pathways to tolerate commensal bacteria and food antigens. Intestinal pathogens have developed strategies to regulate intestinal immunity and inflammation in order to establish or prolong infection. The organisms that employ a type III secretion system use a molecular syringe to deliver effector proteins into the cytoplasm of host cells. These effectors target the host cell cytoskeleton, cell organelles and signaling pathways. This review addresses the multiple mechanisms by which the type III secretion system targets the intestinal immune response, with a special focus on pathogenic E. coli.

Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

Science.gov (United States)

Palková, Zdena; Váchová, Libuše

2016-09-01

Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

Eukaryotic cell encystation and cancer cell dormancy: is a greater devil veiled in the details of a lesser evil?

Science.gov (United States)

Baig, Abdul Mannan; Khan, Naveed Ahmed; Abbas, Farhat

2015-03-01

Cancer cell dormancy is the main cause of cancer recurrence and failure of therapy as dormant cells evade not only the anticancer drugs but also the host immune system. These dormant cells veil themselves from detection by imaging and/or using biomarkers, which imposes an additional problem in targeting such cells. A similar form of hibernation process known as encystation is studied in detail for pathogenic unicellular eukaryotic microorganisms. By examination using microarray gene expression profiles, immunocytochemistry tools, and siRNAs during the process of encystation, understanding the covert features of cancer cell dormancy as proposed could be possible. This knowledge can be extended to dormant cancer cells to uncover the mechanisms that underlie this ghost, yet dangerous state of human cancers. We propose a strategy to induce dormancy and exit this state by application of knowledge gained from the encystation induction and retrieval processes in pathogenic eukaryotic microorganisms. Given that early detection and characterization of dormant malignant tumor cells is important as a general strategy to monitor and prevent the development of overt metastatic disease, this homology may enable the design of therapies that could either awake the dormant cell from dormancy to make it available for therapies or prolong such a phase to make cancer appear as a chronic disease.

Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

OpenAIRE

Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

2013-01-01

Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms

International Nuclear Information System (INIS)

Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z.; Gillow, J.B.; Francis, A.J.

2004-01-01

We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K d ) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N H 2 O ) and the degree of strength of ligand field (R E/M ) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K d of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K d , indicating that an exchange with Na + on the functional groups was involved in their sorption. The ΔN H 2 O (= 9 - N H 2 O ) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R E/M for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)

Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms

Energy Technology Data Exchange (ETDEWEB)

Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z. [Advanced Science Research Center, Japan Atomic Energy Research Inst., Ibaraki (Japan); Gillow, J.B.; Francis, A.J. [Environmental Sciences Dept., Brookhaven National Lab., Upton, NY (United States)

2004-07-01

We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K{sub d}) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N{sub H{sub 2}O}) and the degree of strength of ligand field (R{sub E/M}) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K{sub d} of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K{sub d}, indicating that an exchange with Na{sup +} on the functional groups was involved in their sorption. The {delta}N{sub H{sub 2}O} (= 9 - N{sub H{sub 2}O}) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R{sub E/M} for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)

Engineering of microorganisms towards recovery of rare metal ions

Energy Technology Data Exchange (ETDEWEB)

Kuroda, Kouichi; Ueda, Mitsuyoshi [Kyoto Univ. (Japan). Div. of Applied Life Sciences

2010-06-15

The bioadsorption of metal ions using microorganisms is an attractive technology for the recovery of rare metal ions as well as removal of toxic heavy metal ions from aqueous solution. In initial attempts, microorganisms with the ability to accumulate metal ions were isolated from nature and intracellular accumulation was enhanced by the overproduction of metal-binding proteins in the cytoplasm. As an alternative, the cell surface design of microorganisms by cell surface engineering is an emerging strategy for bioadsorption and recovery of metal ions. Cell surface engineering was firstly applied to the construction of a bioadsorbent to adsorb heavy metal ions for bioremediation. Cell surface adsorption of metal ions is rapid and reversible. Therefore, adsorbed metal ions can be easily recovered without cell breakage, and the bioadsorbent can be reused or regenerated. These advantages are suitable for the recovery of rare metal ions. Actually, the cell surface display of a molybdate-binding protein on yeast led to the enhanced adsorption of molybdate, one of the rare metal ions. An additional advantage is that the cell surface display system allows high-throughput screening of protein/peptide libraries owing to the direct evaluation of the displayed protein/peptide without purification and concentration. Therefore, the creation of novel metal-binding protein/ peptide and engineering of microorganisms towards the recovery of rare metal ions could be simultaneously achieved. (orig.)

[Increasing incidence of community-acquired pneumonia caused by atypical microorganisms].

Science.gov (United States)

Tazón-Varela, M A; Alonso-Valle, H; Muñoz-Cacho, P; Gallo-Terán, J; Piris-García, X; Pérez-Mier, L A

2017-09-01

Knowing the most common microorganisms in our environment can help us to make proper empirical treatment decisions. The aim is to identify those microorganisms causing community-acquired pneumonia. An observational, descriptive and prospective study was conducted, including patients over 14 years with a clinical and radiographic diagnosis of community-acquired pneumonia during a 383 consecutive day period. A record was made of sociodemographic variables, personal history, prognostic severity scales, progress, and pathogenic agents. The aetiological diagnosis was made using blood cultures, detection of Streptococcus pneumoniae and Legionella pneumophila urinary antigens, sputum culture, influenza virus and Streptococcus pyogenes detection. Categorical variables are presented as absolute values and percentages, and continuous variables as their means and standard deviations. Of the 287 patients included in the study (42% women, mean age 66±22 years), 10.45% died and 70% required hospital admission. An aetiological diagnosis was achieved in 43 patients (14.98%), with 16 microorganisms found in 59 positive samples. The most frequently isolated pathogen was Streptococcus pneumonia (24/59, 41%), followed by gram-negative enteric bacilli, Klebsiella pneumonia, Escherichia coli, Serratia marcescens and Enterobacter cloacae isolated in 20% of the samples (12/59), influenza virus (5/59, 9%), methicillin-resistant Staphylococcus aureus (3/59, 5%), Pseudomonas aeruginosa (2/59, 3%), Moraxella catarrhalis (2/59, 3%), Legionella pneumophila (2/59, 3%), and Haemophilus influenza (2/59, 3%). Polymicrobial infections accounted for 14% (8/59). A high percentage of atypical microorganisms causing community-acquired pneumonia were found. Copyright © 2016 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

Gut Microorganisms Found Necessary for Successful Cancer Therapy | Poster

Science.gov (United States)

By Nancy Parrish, Staff Writer Humans play host to trillions of microorganisms that help our bodies perform basic functions, like digestion, growth, and fighting disease. In fact, bacterial cells outnumber the human cells in our bodies by 10 to 1.1 The tens of trillions of microorganisms thriving in our intestines are known as gut microbiota, and those that are not harmful to

Associations between pathogen-specific clinical mastitis and somatic cell count patterns

NARCIS (Netherlands)

Haas, de Y.; Veerkamp, R.F.; Barkema, H.W.; Gröhn, Y.T.; Schukken, Y.H.

2004-01-01

Associations were estimated between pathogen-specific cases of clinical mastitis (CM) and somatic cell count (SCC) patterns based on deviations from the typical curve for SCC during lactation and compared with associations between pathogen-specific CM and lactation average SCC. Data from 274 Dutch

Recovery Estimation of Dried Foodborne Pathogens Is Directly Related to Rehydration Kinetics

Science.gov (United States)

Lang, Emilie; Zoz, Fiona; Iaconelli, Cyril; Guyot, Stéphane; Alvarez-Martin, Pablo; Beney, Laurent; Perrier-Cornet, Jean-Marie; Gervais, Patrick

2016-01-01

Drying is a common process which is used to preserve food products and technological microorganisms, but which is deleterious for the cells. The aim of this study is to differentiate the effects of drying alone from the effects of the successive and necessary rehydration. Rehydration of dried bacteria is a critical step already studied in starter culture but not for different kinetics and not for pathogens. In the present study, the influence of rehydration kinetics was investigated for three foodborne pathogens involved in neonatal diseases caused by the consumption of rehydrated milk powder: Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Senftenberg and Cronobacter sakazakii. Bacteria were dried in controlled relative humidity atmospheres and then rehydrated using different methods. Our results showed that the survival of the three pathogens was strongly related to rehydration kinetics. Consequently, rehydration is an important step to consider during food safety assessment or during studies of dried foodborne pathogens. Also, it has to be considered with more attention in consumers’ homes during the preparation of food, like powdered infant formula, to avoid pathogens recovery. PMID:27494169

Recovery Estimation of Dried Foodborne Pathogens Is Directly Related to Rehydration Kinetics.

Directory of Open Access Journals (Sweden)

Emilie Lang

Full Text Available Drying is a common process which is used to preserve food products and technological microorganisms, but which is deleterious for the cells. The aim of this study is to differentiate the effects of drying alone from the effects of the successive and necessary rehydration. Rehydration of dried bacteria is a critical step already studied in starter culture but not for different kinetics and not for pathogens. In the present study, the influence of rehydration kinetics was investigated for three foodborne pathogens involved in neonatal diseases caused by the consumption of rehydrated milk powder: Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Senftenberg and Cronobacter sakazakii. Bacteria were dried in controlled relative humidity atmospheres and then rehydrated using different methods. Our results showed that the survival of the three pathogens was strongly related to rehydration kinetics. Consequently, rehydration is an important step to consider during food safety assessment or during studies of dried foodborne pathogens. Also, it has to be considered with more attention in consumers' homes during the preparation of food, like powdered infant formula, to avoid pathogens recovery.

Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

Science.gov (United States)

Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

2017-12-22

Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

Pursuing Intracellular Pathogens with Hyaluronan. From a 'Pro-Infection' Polymer to a Biomaterial for 'Trojan Horse' Systems.

Science.gov (United States)

Montanari, Elita; Di Meo, Chiara; Oates, Angela; Coviello, Tommasina; Matricardi, Pietro

2018-04-18

Hyaluronan (HA) is among the most important bioactive polymers in mammals, playing a key role in a number of biological functions. In the last decades, it has been increasingly studied as a biomaterial for drug delivery systems, thanks to its physico-chemical features and ability to target and enter certain cells. The most important receptor of HA is ‘Cluster of Differentiation 44’ (CD44), a cell surface glycoprotein over-expressed by a number of cancers and heavily involved in HA endocytosis. Moreover, CD44 is highly expressed by keratinocytes, activated macrophages and fibroblasts, all of which can act as ‘reservoirs’ for intracellular pathogens. Interestingly, both CD44 and HA appear to play a key role for the invasion and persistence of such microorganisms within the cells. As such, HA is increasingly recognised as a potential target for nano-carriers development, to pursuit and target intracellular pathogens, acting as a ‘Trojan Horse’. This review describes the biological relationship between HA, CD44 and the entry and survival of a number of pathogens within the cells and the subsequent development of HA-based nano-carriers for enhancing the intracellular activity of antimicrobials.

Land application of sewage sludge: Pathogen issues

International Nuclear Information System (INIS)

Chang, A.C.

1997-01-01

Diseases transmitted via the faecal-oral exposure route cause severe gastroenteric disorders, and large numbers of causative organisms are discharged with the faecal matter of infected individuals. For this reason, pathogenic bacteria, viruses, protozoa, or helminths, are always found in sewage sludge. If not properly treated for use in agriculture, sludge can be a source of pathogenic contamination. Radiation is an attractive method to reduce the numbers of microorganisms in sewage sludge. Routine examination for pathogens is not practised nor recommended because complicated and costly procedures are involved. Instead, an indicator organism is usually assayed and enumerated. In this paper, methods are discussed for the investigation of pathogens in sewage sludge. (author)

Land application of sewage sludge: Pathogen issues

Energy Technology Data Exchange (ETDEWEB)

Chang, A C [Department of Soil and Environmental Sciences, Univ. of California at Riverside, Riverside, CA (United States)

1997-10-01

Diseases transmitted via the faecal-oral exposure route cause severe gastroenteric disorders, and large numbers of causative organisms are discharged with the faecal matter of infected individuals. For this reason, pathogenic bacteria, viruses, protozoa, or helminths, are always found in sewage sludge. If not properly treated for use in agriculture, sludge can be a source of pathogenic contamination. Radiation is an attractive method to reduce the numbers of microorganisms in sewage sludge. Routine examination for pathogens is not practised nor recommended because complicated and costly procedures are involved. Instead, an indicator organism is usually assayed and enumerated. In this paper, methods are discussed for the investigation of pathogens in sewage sludge. (author). 8 refs, 3 tabs.

Fierce competition between Toxoplasma and Chlamydia for host cell structures in dually infected cells.

Science.gov (United States)

Romano, Julia D; de Beaumont, Catherine; Carrasco, Jose A; Ehrenman, Karen; Bavoil, Patrik M; Coppens, Isabelle

2013-02-01

The prokaryote Chlamydia trachomatis and the protozoan Toxoplasma gondii, two obligate intracellular pathogens of humans, have evolved a similar modus operandi to colonize their host cell and salvage nutrients from organelles. In order to gain fundamental knowledge on the pathogenicity of these microorganisms, we have established a cell culture model whereby single fibroblasts are coinfected by C. trachomatis and T. gondii. We previously reported that the two pathogens compete for the same nutrient pools in coinfected cells and that Toxoplasma holds a significant competitive advantage over Chlamydia. Here we have expanded our coinfection studies by examining the respective abilities of Chlamydia and Toxoplasma to co-opt the host cytoskeleton and recruit organelles. We demonstrate that the two pathogen-containing vacuoles migrate independently to the host perinuclear region and rearrange the host microtubular network around each vacuole. However, Toxoplasma outcompetes Chlamydia to the host microtubule-organizing center to the detriment of the bacterium, which then shifts to a stress-induced persistent state. Solely in cells preinfected with Chlamydia, the centrosomes become associated with the chlamydial inclusion, while the Toxoplasma parasitophorous vacuole displays growth defects. Both pathogens fragment the host Golgi apparatus and recruit Golgi elements to retrieve sphingolipids. This study demonstrates that the productive infection by both Chlamydia and Toxoplasma depends on the capability of each pathogen to successfully adhere to a finely tuned developmental program that aims to remodel the host cell for the pathogen's benefit. In particular, this investigation emphasizes the essentiality of host organelle interception by intravacuolar pathogens to facilitate access to nutrients.

Variation of microorganism concentrations in urban stormwater runoff with land use and seasons.

Science.gov (United States)

Selvakumar, Ariamalar; Borst, Michael

2006-03-01

Stormwater runoff samples were collected from outfalls draining small municipal separate storm sewer systems. The samples were collected from three different land use areas based on local designation (high-density residential, low-density residential and landscaped commercial). The concentrations of microorganisms in the stormwater runoff were found to be similar in magnitude to, but less variable than, those reported in the stormwater National Pollutant Discharge Elimination System (NPDES) database. Microorganism concentrations from high-density residential areas were higher than those associated with low-density residential and landscaped commercial areas. Since the outfalls were free of sanitary wastewater cross-connections, the major sources of microorganisms to the stormwater runoff were most likely from the feces of domestic animals and wildlife. Concentrations of microorganisms were significantly affected by the season during which the samples were collected. The lowest concentrations were observed during winter except for Staphylococcus aureus. The Pearson correlation coefficients among different indicators showed weak linear relationships and the relationships were statistically significant. However, the relationships between indicators and pathogens were poorly correlated and were not statistically significant, suggesting the use of indicators as evidence of the presence of pathogens is not appropriate. Further, the correlation between the concentration of the traditionally monitored indicators (total coliforms and fecal coliforms) and the suggested substitutes (enterococci and E. coli) is weak, but statistically significant, suggesting that historical time series will be only a qualitative indicator of impaired waters under the revised criteria for recreational water quality by the US EPA.

Communication between filamentous pathogens and plants at the biotrophic interface.

Science.gov (United States)

Yi, Mihwa; Valent, Barbara

2013-01-01

Fungi and oomycetes that colonize living plant tissue form extensive interfaces with plant cells in which the cytoplasm of the microorganism is closely aligned with the host cytoplasm for an extended distance. In all cases, specialized biotrophic hyphae function to hijack host cellular processes across an interfacial zone consisting of a hyphal plasma membrane, a specialized interfacial matrix, and a plant-derived membrane. The interface is the site of active secretion by both players. This cross talk at the interface determines the winner in adversarial relationships and establishes the partnership in mutualistic relationships. Fungi and oomycetes secrete many specialized effector proteins for controlling the host, and they can stimulate remarkable cellular reorganization even in distant plant cells. Breakthroughs in live-cell imaging of fungal and oomycete encounter sites, including live-cell imaging of pathogens secreting fluorescently labeled effector proteins, have led to recent progress in understanding communication across the interface.

Microorganism immobilization

Science.gov (United States)

Compere, Alicia L.; Griffith, William L.

1981-01-01

Live metabolically active microorganisms are immobilized on a solid support by contacting particles of aggregate material with a water dispersible polyelectrolyte such as gelatin, crosslinking the polyelectrolyte by reacting it with a crosslinking agent such as glutaraldehyde to provide a crosslinked coating on the particles of aggregate material, contacting the coated particles with live microorganisms and incubating the microorganisms in contact with the crosslinked coating to provide a coating of metabolically active microorganisms. The immobilized microorganisms have continued growth and reproduction functions.

Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

Directory of Open Access Journals (Sweden)

Francesco Marras

2011-01-01

Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

Lignite microorganisms

Energy Technology Data Exchange (ETDEWEB)

Bulankina, M.A.; Lysak, L.V.; Zvyagintsev, D.G. [Moscow MV Lomonosov State University, Moscow (Russian Federation). Faculty of Soil Science

2007-03-15

The first demonstration that samples of lignite at a depth of 10 m are considerably enriched in bacteria is reported. According to direct microscopy, the abundance of bacteria was about 10{sup 7} cells/g. About 70% of cells had intact cell membranes and small size, which points to their anabiotic state. The fungal mycelium length was no more than 1 m. Lignite inoculation onto solid glucose-yeast-peptone medium allowed us to isolate bacteria of the genera Bacillus, Rhodococcus, Arthrobacter, Micrococcus, Spirillum, and Cytophaga. Representatives of the genera Penicillium and Trichoderma were identified on Czapek medium. Moistening of lignite powder increased the microbial respiration rate and microbial and fungal abundance but did not increase their generic diversity. This finding suggests that the studied microorganisms are autochthonous to lignite.

Radiation sensitivity of foodborne pathogens in meat byproducts with different packaging

International Nuclear Information System (INIS)

Yong, Hae In; Kim, Hyun-Joo; Nam, Ki Chang; Kwon, Joong Ho; Jo, Cheorun

2015-01-01

The aim of this study was to determine radiation sensitivity of Escherichia coli O157:H7 and Listeria monocytogenes in edible meat byproducts. Seven beef byproducts (heart, liver, lung, lumen, omasum, large intestine, and small intestine) and four pork byproducts (heart, large intestine, liver, and small intestine) were used. Electron beam irradiation significantly reduced the numbers of pathogenic microorganisms in meat byproducts and no viable cells were detected in both aerobically- and vacuum-packaged samples irradiated at 4 kGy. Meat byproducts packed under vacuum had higher D 10 value than the ones packed aerobically. No significant difference was observed between the D 10 values of E. coli O157:H7 and L. monocytogenes inoculated in either aerobically or vacuum packaged samples. These results suggest that low-dose electron beam irradiation can significantly decrease microbial numbers and reduce the risk of meat byproduct contamination by the foodborne pathogens. - Highlights: • Radiation sensitivities of pathogens in meat byproduct were tested. • Electron beam irradiation of 3 or 4 kGy reduced pathogens by> 9 log • The D 10 values were lower in the aerobic-packaging than under vacuum condition

Nucleic acid probes in the diagnosis of human microbial pathogens

International Nuclear Information System (INIS)

Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

1989-01-01

The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

DMPD: Signaling pathways activated by microorganisms. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 17303405 Signaling pathways activated by microorganisms. Takeuchi O, Akira S. Curr ...Opin Cell Biol. 2007 Apr;19(2):185-91. Epub 2007 Feb 15. (.png) (.svg) (.html) (.csml) Show Signaling pathways activated by microorg...anisms. PubmedID 17303405 Title Signaling pathways activated by microorganisms. Auth

Genomewide analyses of pathogenic and regulatory T cells of NOD ...

Indian Academy of Sciences (India)

Reestablishing a well-balanced population of regulatory T cells (Tregs) and pathogenic T cells (Tpaths) is necessary for diabetic patients to regain glucose control. However, the molecular mechanisms modulating functional differentiation of Tpaths and Tregs remain unclear. In this study, we anal- ysed the gene expression ...

Combating Pathogenic Microorganisms Using Plant-Derived Antimicrobials: A Minireview of the Mechanistic Basis

Directory of Open Access Journals (Sweden)

Abhinav Upadhyay

2014-01-01

Full Text Available The emergence of antibiotic resistance in pathogenic bacteria has led to renewed interest in exploring the potential of plant-derived antimicrobials (PDAs as an alternative therapeutic strategy to combat microbial infections. Historically, plant extracts have been used as a safe, effective, and natural remedy for ailments and diseases in traditional medicine. Extensive research in the last two decades has identified a plethora of PDAs with a wide spectrum of activity against a variety of fungal and bacterial pathogens causing infections in humans and animals. Active components of many plant extracts have been characterized and are commercially available; however, research delineating the mechanistic basis of their antimicrobial action is scanty. This review highlights the potential of various plant-derived compounds to control pathogenic bacteria, especially the diverse effects exerted by plant compounds on various virulence factors that are critical for pathogenicity inside the host. In addition, the potential effect of PDAs on gut microbiota is discussed.

Role and functions of beneficial microorganisms in sustainable aquaculture.

Science.gov (United States)

Zhou, Qunlan; Li, Kangmin; Jun, Xie; Bo, Liu

2009-08-01

This paper aims to review the development of scientific concepts of microecology and ecology of microbes and the role and functions of beneficial microorganisms in aquaculture and mariculture. Beneficial microorganisms play a great role in natural and man-made aquatic ecosystems based on the co-evolution theory in living biosphere on earth. Their functions are to adjust algal population in water bodies so as to avoid unwanted algal bloom; to speed up decomposition of organic matter and to reduce CODmn, NH3-N and NO2-N in water and sediments so as to improve water quality; to suppress fish/shrimp diseases and water-borne pathogens; to enhance immune system of cultured aquatic animals and to produce bioactive compounds such as vitamins, hormones and enzymes that stimulate growth, thus to decrease the FCR of feed.

An immunomagnetic separator for concentration of pathogenic micro-organisms from large volume samples

International Nuclear Information System (INIS)

Rotariu, Ovidiu; Ogden, Iain D.; MacRae, Marion; Badescu, Vasile; Strachan, Norval J.C.

2005-01-01

The standard method of immunomagnetic separation of pathogenic bacteria from food and environmental matrices processes 1 ml volumes. Pathogens present at low levels ( 50 ml). Preliminary results show that between 70 and 113 times more Escherchia coli O157 are recovered compared with the standard 1 ml method

Microorganisms in human milk: lights and shadows.

Science.gov (United States)

Civardi, Elisa; Garofoli, Francesca; Tzialla, Chryssoula; Paolillo, Piermichele; Bollani, Lina; Stronati, Mauro

2013-10-01

Human milk has been traditionally considered germ free, however, recent studies have shown that it represents a continuous supply of commensal and potentially probiotic bacteria to the infant gut. Mammary microbioma may exercise anti-infective, anti-inflammatory, immunomodulatory and metabolic properties. Moreover human milk may be a source of pathogenic microorganism during maternal infection, if contaminated during expression or in case of vaccination of the mother. The non-sterility of breast milk can, thus, be seen as a protective factor, or rarely, as a risk factor for the newborn.

CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

Science.gov (United States)

Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

2017-07-21

Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

Pathogens associated with bovine mastitis in dairy herds in the south region of Brazil

Directory of Open Access Journals (Sweden)

Marta Bañolas Jobim

2010-02-01

Full Text Available In this work, through microbiological examinations, the etiology of bovine mastitis in 628 milk samples coming from dairy farms from Paraná, Santa Catarina and Rio Grande do Sul along the year of 2007 were evaluated. Out of this total 1,382 microorganisms were isolated. By taking into account the total of isolations, the following microorganisms and their percentage, respectively were found: Staphylococcus spp. (30.53%, Escherichia coli (21.64%, Streptococcus bovis (17.08%, Streptococcus agalactiae (11.07%, Enterobacter spp. (7.53%, Pseudomonas spp. (4.12% and others (8.03%. The microorganisms grouped into the others are: Streptococcus spp., Proteus spp., gram negative rods, Shigella spp., Alcaligenes spp., Klebsiella spp., Edwarsiella spp., Citrobacter spp., Serratia spp., Salmonella spp. e Corynebacterium spp. The environmental pathogens predominated among the isolated microorganisms; 33.13% of the cultures presented more than three pathogens, suggesting contamination of the samples; in the mounts of November and December, there was an increase of the samples sent.

A combined microscopic and macroscopic approach to modeling the transport of pathogenic microorganisms from nonpoint sources of pollution

DEFF Research Database (Denmark)

Yeghiazarian, L.L.; Walker, M.J.; Binning, Philip John

2006-01-01

is important for accurate risk assessment and prediction of water contamination events. This paper presents a stochastic Markov model of microorganism transport, with distinct states of microorganism behavior capturing the microbial partitioning between solid and aqueous phases in runoff and soil surface...

Ecology and Genomic Insights into Plant-Pathogenic and Plant-Nonpathogenic Endophytes.

Science.gov (United States)

Brader, Günter; Compant, Stéphane; Vescio, Kathryn; Mitter, Birgit; Trognitz, Friederike; Ma, Li-Jun; Sessitsch, Angela

2017-08-04

Plants are colonized on their surfaces and in the rhizosphere and phyllosphere by a multitude of different microorganisms and are inhabited internally by endophytes. Most endophytes act as commensals without any known effect on their plant host, but multiple bacteria and fungi establish a mutualistic relationship with plants, and some act as pathogens. The outcome of these plant-microbe interactions depends on biotic and abiotic environmental factors and on the genotype of the host and the interacting microorganism. In addition, endophytic microbiota and the manifold interactions between members, including pathogens, have a profound influence on the function of the system plant and the development of pathobiomes. In this review, we elaborate on the differences and similarities between nonpathogenic and pathogenic endophytes in terms of host plant response, colonization strategy, and genome content. We furthermore discuss environmental effects and biotic interactions within plant microbiota that influence pathogenesis and the pathobiome.

Translocation of cell-penetrating peptides into Candida fungal pathogens.

Science.gov (United States)

Gong, Zifan; Karlsson, Amy J

2017-09-01

Cell-penetrating peptides (CPPs) are small peptides capable of crossing cellular membranes while carrying molecular cargo. Although they have been widely studied for their ability to translocate nucleic acids, small molecules, and proteins into mammalian cells, studies of their interaction with fungal cells are limited. In this work, we evaluated the translocation of eleven fluorescently labeled peptides into the important human fungal pathogens Candida albicans and C. glabrata and explored the mechanisms of translocation. Seven of these peptides (cecropin B, penetratin, pVEC, MAP, SynB, (KFF) 3 K, and MPG) exhibited substantial translocation (>80% of cells) into both species in a concentration-dependent manner, and an additional peptide (TP-10) exhibiting strong translocation into only C. glabrata. Vacuoles were involved in translocation and intracellular trafficking of the peptides in the fungal cells and, for some peptides, escape from the vacuoles and localization in the cytosol were correlated to toxicity toward the fungal cells. Endocytosis was involved in the translocation of cecropin B, MAP, SynB, MPG, (KFF) 3 K, and TP-10, and cecropin B, penetratin, pVEC, and MAP caused membrane permeabilization during translocation. These results indicate the involvement of multiple translocation mechanisms for some CPPs. Although high levels of translocation were typically associated with toxicity of the peptides toward the fungal cells, SynB was translocated efficiently into Candida cells at concentrations that led to minimal toxicity. Our work highlights the potential of CPPs in delivering antifungal molecules and other bioactive cargo to Candida pathogens. © 2017 The Protein Society.

[Sorption of microorganisms by fiber materials].

Science.gov (United States)

Nikovskaia, G N; Gordienko, A S; Globa, L I

1986-01-01

Candida guilliermondii and Escherichia coli cells were adsorbed on glass and basalt fibres with a similar specific surface, but with a different charge. The quantity of adsorbed microorganisms did not depend on the type and charge of a fibre surface. However, cells were adsorbed faster and more firmly on positively charged and uncharged fibres than on negatively charged fibres.

Microorganisms' mediated reduction of β-ketoesters

African Journals Online (AJOL)

STORAGESEVER

2008-10-20

Oct 20, 2008 ... Whole cells usually express a multitude of enzymatic activities; therefore an ... Each microorganism was cultivated for the biomass development on specific medium ..... Ketoester reductase for conversion of keto acid esters to ...

Production of gaba (γ - aminobutyric acid by microorganisms: a review

Directory of Open Access Journals (Sweden)

Radhika Dhakal

2012-12-01

Full Text Available GABA (γ-aminobutyric acid is a four carbon non-protein amino acid that is widely distributed in plants, animals and microorganisms. As a metabolic product of plants and microorganisms produced by the decarboxylation of glutamic acid, GABA functions as an inhibitory neurotransmitter in the brain that directly affects the personality and the stress management. A wide range of traditional foods produced by microbial fermentation contain GABA, in which GABA is safe and eco-friendly, and also has the possibility of providing new health-benefited products enriched with GABA. Synthesis of GABA is catalyzed by glutamate decarboxylase, therefore, the optimal fermentation condition is mainly based on the biochemical properties of the enzyme. Major GABA producing microorganisms are lactic acid bacteria (LAB, which make food spoilage pathogens unable to grow and act as probiotics in the gastrointestinal tract. The major factors affecting the production of GABA by microbial fermentation are temperature, pH, fermentation time and different media additives, therefore, these factors are summarized to provide the most up-dated information for effective GABA synthesis. There has been a huge accumulation of knowledge on GABA application for human health accompanying with a demand on natural GABA supply. Only the GABA production by microorganisms can fulfill the demand with GABA-enriched health beneficial foods.

Production of gaba (γ - Aminobutyric acid) by microorganisms: a review.

Science.gov (United States)

Dhakal, Radhika; Bajpai, Vivek K; Baek, Kwang-Hyun

2012-10-01

GABA (γ-aminobutyric acid) is a four carbon non-protein amino acid that is widely distributed in plants, animals and microorganisms. As a metabolic product of plants and microorganisms produced by the decarboxylation of glutamic acid, GABA functions as an inhibitory neurotransmitter in the brain that directly affects the personality and the stress management. A wide range of traditional foods produced by microbial fermentation contain GABA, in which GABA is safe and eco-friendly, and also has the possibility of providing new health-benefited products enriched with GABA. Synthesis of GABA is catalyzed by glutamate decarboxylase, therefore, the optimal fermentation condition is mainly based on the biochemical properties of the enzyme. Major GABA producing microorganisms are lactic acid bacteria (LAB), which make food spoilage pathogens unable to grow and act as probiotics in the gastrointestinal tract. The major factors affecting the production of GABA by microbial fermentation are temperature, pH, fermentation time and different media additives, therefore, these factors are summarized to provide the most up-dated information for effective GABA synthesis. There has been a huge accumulation of knowledge on GABA application for human health accompanying with a demand on natural GABA supply. Only the GABA production by microorganisms can fulfill the demand with GABA-enriched health beneficial foods.

Rapid Identification of Microorganisms from Positive Blood Culture by MALDI-TOF MS After Short-Term Incubation on Solid Medium.

Science.gov (United States)

Curtoni, Antonio; Cipriani, Raffaella; Marra, Elisa Simona; Barbui, Anna Maria; Cavallo, Rossana; Costa, Cristina

2017-01-01

Matrix-assisted laser-desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) is a useful tool for rapid identification of microorganisms. Unfortunately, its direct application to positive blood culture is still lacking standardized procedures. In this study, we evaluated an easy- and rapid-to-perform protocol for MALDI-TOF MS direct identification of microorganisms from positive blood culture after a short-term incubation on solid medium. This protocol was used to evaluate direct identification of microorganisms from 162 positive monomicrobial blood cultures; at different incubation times (3, 5, 24 h), MALDI-TOF MS assay was performed from the growing microorganism patina. Overall, MALDI-TOF MS concordance with conventional methods at species level was 60.5, 80.2, and 93.8% at 3, 5, and 24 h, respectively. Considering only bacteria, the identification performances at species level were 64.1, 85.0, and 94.1% at 3, 5, and 24 h, respectively. This protocol applied to a commercially available MS typing system may represent, a fast and powerful diagnostic tool for pathogen direct identification and for a promptly and pathogen-driven antimicrobial therapy in selected cases.

AMPK in Pathogens

OpenAIRE

Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

2016-01-01

During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

[Succession of chitinolytic microorganisms in chernozem soil].

Science.gov (United States)

Manucharova, N A; Belova, E V; Vorob'ev, A V; Polianskaia, L M; Stepanov, A L

2005-01-01

The chitinolytic prokaryotic and eukaryotic microbial complex of chernozem soil has been investigated in the course of a succession initiated by the introduction of chitin and humidification. The dynamics of the cell numbers of chitinolytic microorganisms and of their biomass was assessed by fluorescent microscopy and by inoculation of selective media. Emission of carbon dioxide and nitrous oxide, as well as dinitrogen fixation, was assessed by gas chromatography. It was found that, when the succession was initiated by the introduction of both chitin and humidification, it resulted in greater cell numbers and biomass of chitinolytic microorganisms and higher levels of CO2 and N2O emission and of nitrogen fixation than when the succession was initiated by humidification alone. As compared to the control samples, a significant (twofold) increase in the prokaryote cell number and biomass was found on the fourth day of the succession initiated by humidification and introduction of chitin. One week after the initiation of succession, the fungal biomass and length of mycelium were twice as high as those in the control samples. These results led to the conclusion that chitin utilization in chernozem soil starts during the initial stages of succession and is performed by both prokaryotic and eukaryotic microorganisms.

KR-12-a5 is a non-cytotoxic agent with potent antimicrobial effects against oral pathogens.

Science.gov (United States)

Caiaffa, Karina Sampaio; Massunari, Loiane; Danelon, Marcelle; Abuna, Gabriel Flores; Bedran, Telma Blanca Lombardo; Santos-Filho, Norival Alves; Spolidorio, Denise Madalena Palomari; Vizoto, Natalia Leal; Cilli, Eduardo Maffud; Duque, Cristiane

2017-11-01

This study evaluated the cytotoxicity and antimicrobial activity of analogs of cationic peptides against microorganisms associated with endodontic infections. L-929 fibroblasts were exposed to LL-37, KR-12-a5 and hBD-3-1C V and chlorhexidine (CHX, control), and cell metabolism was evaluated with MTT. The minimal inhibitory concentration (MIC) and the minimal bactericidal/fungicidal concentration (MBC/MFC) of the peptides and CHX were determined against oral pathogens associated with endodontic infections. Enterococcus faecalis and Streptococcus mutans biofilms were cultivated in bovine dentin blocks, exposed to different concentrations of the most efficient antimicrobial peptide and analyzed by confocal laser scanning microscopy. CHX and peptides affected the metabolism of L-929 at concentrations > 31.25 and 500 μg ml -1 , respectively. Among the peptides, KR-12-a5 inhibited growth of both the microorganisms tested with the lowest MIC/MBC/MFC values. In addition, KR-12-a5 significantly reduced E. faecalis and S. mutans biofilms inside dentin tubules. In conclusion, KR-12-a5 is a non-cytotoxic agent with potent antimicrobial and anti-biofilm activity against oral pathogens associated with endodontic infections.

Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation.

Science.gov (United States)

Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

2016-01-01

In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation

Science.gov (United States)

Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

2016-01-01

In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

COMPARATIVE RESISTANCE OF BACTERIAL FOODBORNE PATHOGENS TO NON-THERMAL TECHNOLOGIES FOR FOOD PRESERVATION

Directory of Open Access Journals (Sweden)

Guillermo eCebrián

2016-05-01

Full Text Available In this paper the resistance of bacterial foodborne pathogens to manosonication (MS, pulsed electric fields (PEF, high hydrostatic pressure (HHP and UV-light (UV is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could

Regulation of T-cell Responses in the Inflamed Intestine

NARCIS (Netherlands)

M.A. Van Leeuwen (Marieke)

2015-01-01

markdownabstract__Abstract__ The intestinal immune system protects the mucosal surfaces from pathogenic microorganisms. On the other hand it maintains tolerance towards dietary antigens and non-pathogenic microorganisms. The immune system continuously tailors these inflammatory and tolerogenic

Rapid Detection of Microorganisms Based on Active and Passive Modes of QCM

Directory of Open Access Journals (Sweden)

Zdeněk Farka

2014-12-01

Full Text Available Label-free immunosensors are well suited for detection of microorganisms because of their fast response and reasonable sensitivity comparable to infection doses of common pathogens. Active (lever oscillator and frequency counter and passive (impedance analyzer modes of quartz crystal microbalance (QCM were used and compared for rapid detection of three strains of E. coli. Different approaches for antibody immobilization were compared, the immobilization of reduced antibody using Sulfo‑SMCC was most effective achieving the limit of detection (LOD 8 × 104 CFU·mL−1 in 10 min. For the passive mode, software evaluating impedance characteristics in real-time was developed and used. Almost the same results were achieved using both active and passive modes confirming that the sensor properties are not limited by the frequency evaluation method but mainly by affinity of the antibody. Furthermore, reference measurements were done using surface plasmon resonance. Effect of condition of cells on signal was observed showing that cells ruptured by ultrasonication provided slightly higher signal changes than intact microbes.

DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

Directory of Open Access Journals (Sweden)

Urszula Wachowska

2017-12-01

Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

Cloning, overexpression, purification of bacteriocin enterocin-B and structural analysis, interaction determination of enterocin-A, B against pathogenic bacteria and human cancer cells.

Science.gov (United States)

Ankaiah, Dasari; Palanichamy, Esakkiraj; Antonyraj, Christian Bharathi; Ayyanna, Repally; Perumal, Venkatesh; Ahamed, Syed Ibrahim Basheer; Arul, Venkatesan

2018-05-02

In this present study, a gene (ent-B) encoding the bacteriocin enterocin-B was cloned, overexpressed and purified from Enterococcus faecium por1. The molecular weight of the bacteriocin enterocin-B was observed around 7.2 kDa and exhibited antimicrobial activity against several human pathogenic bacteria. The antimicrobial activity of cloned enterocin-B was increased effectively by combining with another bacteriocin enterocin-A from the same microorganism. Protein-protein docking and molecular dynamics simulation studies revealed that the bacteriocin enterocin-B is interacting with enterocin-A and formation of a heterodimer (enterocin A + B). The heterodimer of bacteriocin enterocin-A + B exhibited potential anti-bacterial, anti-biofilm activity against Staphylococcus aureus, Acinetobacter baumannii, Listeria monocytogenes and Escherichia coli. The bacteriocin enterocin-B, A and heterodimer of bacteriocin enterocin A + B showed no haemolysis on human RBC cells. This is the first report that the cell growth inhibitory activity of the bacteriocin enterocin B against HeLa, HT-29 and AGS human cancer cells and this cell growth inhibitory activity was significantly increased when cancer cells treated with the heterodimer of bacteriocins enterocin-A + B. The cell growth inhibitory activity of the bacteriocin enterocin-B and the heterodimer of bacteriocin enterocin-A + B were not observed in non-cancerous INT-407 cells (intestinal epithelial cells). Copyright © 2018. Published by Elsevier B.V.

Antibiotic cytotoxic effects of microorganisms isolated from Jachymov uranium mines

International Nuclear Information System (INIS)

Fuska, J.; Fuskova, A.

1982-01-01

Microorganisms were isolated from old relinquished uranium mines in Jachymov; they had been growing for several decades in darkness in temperatures of 5 to 12 degC and relative humidity from 80 to 100%. The concentration of uranium salts in mine waters varied from 10 -4 to 10 -5 g.l -1 , that of Rn in the atmosphere was from 0.04 to 40 Bq.l -1 . Of 324 cultures, 18.8% inhibited the growth of Bacillus subtilis, Escherichia coli and Candida pseudotropicalis and 16.6% that of HeLa cells. The frequency of microorganisms inhibiting the growth of HeLa or Ehrlich ascites cells was markedly higher in this set of cultures than among microorganisms kept in culture collections or isolated from other natural habitats. About 10% of the isolated cultures were mycelia sterilia. The following antibiotics were isolated from microorganisms obtained from uranium mines: frequentin, vermiculin, vermicillin, vermistatin, cytostipin and duclauxin. (author)

Antibiotic cytotoxic effects of microorganisms isolated from Jachymov uranium mines

Energy Technology Data Exchange (ETDEWEB)

Fuska, J.; Fuskova, A. (Slovenska Vysoka Skola Technicka, Bratislava (Czechoslovakia). Chemickotechnologicka Fakulta); Jilek, R. (Vyzkumny Ustav Veterinarniho Lekarstvi, Brno-Medlanky (Czechoslovakia))

1982-01-01

Microorganisms were isolated from old relinquished uranium mines in Jachymov; they had been growing for several decades in darkness in temperatures of 5 to 12 degC and relative humidity from 80 to 100%. The concentration of uranium salts in mine waters varied from 10/sup -4/ to 10/sup -5/ g.l/sup -1/, that of Rn in the atmosphere was from 0.04 to 40 Bq.l/sup -1/. Of 324 cultures, 18.8% inhibited the growth of Bacillus subtilis, Escherichia coli and Candida pseudotropicalis and 16.6% that of HeLa cells. The frequency of microorganisms inhibiting the growth of HeLa or Ehrlich ascites cells was markedly higher in this set of cultures than among microorganisms kept in culture collections or isolated from other natural habitats. About 10% of the isolated cultures were mycelia sterilia. The following antibiotics were isolated from microorganisms obtained from uranium mines: frequentin, vermiculin, vermicillin, vermistatin, cytostipin and duclauxin.

Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

Directory of Open Access Journals (Sweden)

Sophie Coudeyras

2008-01-01

Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

Functional microorganisms for functional food quality.

Science.gov (United States)

Gobbetti, M; Cagno, R Di; De Angelis, M

2010-09-01

Functional microorganisms and health benefits represent a binomial with great potential for fermented functional foods. The health benefits of fermented functional foods are expressed either directly through the interactions of ingested live microorganisms with the host (probiotic effect) or indirectly as the result of the ingestion of microbial metabolites synthesized during fermentation (biogenic effect). Since the importance of high viability for probiotic effect, two major options are currently pursued for improving it--to enhance bacterial stress response and to use alternative products for incorporating probiotics (e.g., ice cream, cheeses, cereals, fruit juices, vegetables, and soy beans). Further, it seems that quorum sensing signal molecules released by probiotics may interact with human epithelial cells from intestine thus modulating several physiological functions. Under optimal processing conditions, functional microorganisms contribute to food functionality through their enzyme portfolio and the release of metabolites. Overproduction of free amino acids and vitamins are two classical examples. Besides, bioactive compounds (e.g., peptides, γ-amino butyric acid, and conjugated linoleic acid) may be released during food processing above the physiological threshold and they may exert various in vivo health benefits. Functional microorganisms are even more used in novel strategies for decreasing phenomenon of food intolerance (e.g., gluten intolerance) and allergy. By a critical approach, this review will aim at showing the potential of functional microorganisms for the quality of functional foods.

Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

Directory of Open Access Journals (Sweden)

Raees Khan

Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis

Science.gov (United States)

Khan, Raees; Roy, Nazish; Choi, Kihyuck

2018-01-01

The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed

The modular nature of dendritic cell responses to commensal and pathogenic fungi.

Directory of Open Access Journals (Sweden)

Lisa Rizzetto

Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

Production of gaba (γ – Aminobutyric acid) by microorganisms: a review

Science.gov (United States)

Dhakal, Radhika; Bajpai, Vivek K.; Baek, Kwang-Hyun

2012-01-01

GABA (γ-aminobutyric acid) is a four carbon non-protein amino acid that is widely distributed in plants, animals and microorganisms. As a metabolic product of plants and microorganisms produced by the decarboxylation of glutamic acid, GABA functions as an inhibitory neurotransmitter in the brain that directly affects the personality and the stress management. A wide range of traditional foods produced by microbial fermentation contain GABA, in which GABA is safe and eco-friendly, and also has the possibility of providing new health-benefited products enriched with GABA. Synthesis of GABA is catalyzed by glutamate decarboxylase, therefore, the optimal fermentation condition is mainly based on the biochemical properties of the enzyme. Major GABA producing microorganisms are lactic acid bacteria (LAB), which make food spoilage pathogens unable to grow and act as probiotics in the gastrointestinal tract. The major factors affecting the production of GABA by microbial fermentation are temperature, pH, fermentation time and different media additives, therefore, these factors are summarized to provide the most up-dated information for effective GABA synthesis. There has been a huge accumulation of knowledge on GABA application for human health accompanying with a demand on natural GABA supply. Only the GABA production by microorganisms can fulfill the demand with GABA-enriched health beneficial foods. PMID:24031948

Human pathogens in plant biofilms: Formation, physiology, and detection.

Science.gov (United States)

Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

2017-07-01

Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

Science.gov (United States)

Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

2017-08-01

Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

Microbiome studies in the biological control of plant pathogens

Science.gov (United States)

Biological control of plant pathogens, although it has been a successful alternative that has allowed to select microorganisms for the generation of bioproducts and to understand multiple biological mechanisms, cannot be considered as a strategy defined only from the selection of a range of cultiva...

Statistics of sampling for microbiological testing of foodborne pathogens

Science.gov (United States)

Despite the many recent advances in protocols for testing for pathogens in foods, a number of challenges still exist. For example, the microbiological safety of food cannot be completely ensured by testing because microorganisms are not evenly distributed throughout the food. Therefore, since it i...

Extraction of Active Enzymes from "Hard-to-Break-Cells"

DEFF Research Database (Denmark)

Ottaviani, Alessio; Tesauro, Cinzia; Fjelstrup, S

We present the utilization of a rolling circle amplification (RCA) based assay to investigate the extraction efficiency of active enzymes from a class of “hard-to-break” cells, yeast Saccaramyces cerevisiae. Current analyses of microorganisms, such as pathogenic bacteria, parasites or particular...... life stages of microorganisms (e.g. spores from bacteria or fungi) is hampered by the lack of efficient lysis protocols that preserve the activity and integrity of the cellular content. Presented herein is a flexible scheme to screen lysis protocols for active enzyme extraction. We also report a gentle...... yet effective approach for extraction of active enzymes by entrapping cells in microdroplets. Combined effort of optimized extraction protocols and effective analytical approaches is expected to generate impact in future disease diagnosis and environmental safety....

Waterborne Pathogens: Detection Methods and Challenges

Directory of Open Access Journals (Sweden)

Flor Yazmín Ramírez-Castillo

2015-05-01

Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.

Understanding the behavior of foodborne pathogens in the food chain

DEFF Research Database (Denmark)

Rantsiou, Kalliopi; Mataragas, Marios; Jespersen, Lene

2011-01-01

In recent years and with the significant advancements in instrumentation for molecular biology methods, the focus of food microbiologists, dealing with pathogenic microorganisms in foods, is shifting. Scientists specifically aim at elucidating the effect that the food composition, as well...

Expanding the potential of NAI-107 for treating serious ESKAPE pathogens: synergistic combinations against Gram-negatives and bactericidal activity against non-dividing cells.

Science.gov (United States)

Brunati, Cristina; Thomsen, Thomas T; Gaspari, Eleonora; Maffioli, Sonia; Sosio, Margherita; Jabes, Daniela; Løbner-Olesen, Anders; Donadio, Stefano

2018-02-01

To characterize NAI-107 and related lantibiotics for their in vitro activity against Gram-negative pathogens, alone or in combination with polymyxin, and against non-dividing cells or biofilms of Staphylococcus aureus. NAI-107 was also evaluated for its propensity to select or induce self-resistance in Gram-positive bacteria. We used MIC determinations and chequerboard experiments to establish the antibacterial activity of the examined compounds against target microorganisms. Time-kill assays were used to evaluate killing of exponential and stationary-phase cells. The effects on biofilms (growth inhibition and biofilm eradication) were evaluated using biofilm-coated pegs. The frequency of spontaneous resistant mutants was evaluated by either direct plating or by continuous sub-culturing at 0.5 × MIC levels, followed by population analysis profiles. The results showed that NAI-107 and its brominated variant are highly active against Neisseria gonorrhoeae and some other fastidious Gram-negative pathogens. Furthermore, all compounds strongly synergized with polymyxin against Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, and showed bactericidal activity. Surprisingly, NAI-107 alone was bactericidal against non-dividing A. baumannii cells. Against S. aureus, NAI-107 and related lantibiotics showed strong bactericidal activity against dividing and non-dividing cells. Activity was also observed against S. aureus biofilms. As expected for a lipid II binder, no significant resistance to NAI-107 was observed by direct plating or serial passages. Overall, the results of the current work, along with previously published results on the efficacy of NAI-107 in experimental models of infection, indicate that this lantibiotic represents a promising option in addressing the serious threat of antibiotic resistance. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial

Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

OpenAIRE

Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.

2016-01-01

Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...

Detection of pathogenic micro-organisms on children's hands and toys during play.

Science.gov (United States)

Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C

2014-06-01

This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.

MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

DEFF Research Database (Denmark)

Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

2015-01-01

with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

Early identification of microorganisms in blood culture prior to the detection of a positive signal in the BACTEC FX system using matrix-assisted laser desorption/ionization-time of flight mass spectrometry.

Science.gov (United States)

Wang, Ming-Cheng; Lin, Wei-Hung; Yan, Jing-Jou; Fang, Hsin-Yi; Kuo, Te-Hui; Tseng, Chin-Chung; Wu, Jiunn-Jong

2015-08-01

Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) is a valuable method for rapid identification of blood stream infection (BSI) pathogens. Integration of MALDI-TOF MS and blood culture system can speed the identification of causative BSI microorganisms. We investigated the minimal microorganism concentrations of common BSI pathogens required for positive blood culture using BACTEC FX and for positive identification using MALDI-TOF MS. The time to detection with positive BACTEC FX and minimal incubation time with positive MALDI-TOF MS identification were determined for earlier identification of common BSI pathogens. The minimal microorganism concentrations required for positive blood culture using BACTEC FX were >10(7)-10(8) colony forming units/mL for most of the BSI pathogens. The minimal microorganism concentrations required for identification using MALDI-TOF MS were > 10(7) colony forming units/mL. Using simulated BSI models, one can obtain enough bacterial concentration from blood culture bottles for successful identification of five common Gram-positive and Gram-negative bacteria using MALDI-TOF MS 1.7-2.3 hours earlier than the usual time to detection in blood culture systems. This study provides an approach to earlier identification of BSI pathogens prior to the detection of a positive signal in the blood culture system using MALDI-TOF MS, compared to current methods. It can speed the time for identification of BSI pathogens and may have benefits of earlier therapy choice and on patient outcome. Copyright © 2013. Published by Elsevier B.V.

A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis

Directory of Open Access Journals (Sweden)

Bennett Hayley J

2010-08-01

Full Text Available Abstract Background Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. Results We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. Conclusion This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases

A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis.

Science.gov (United States)

Beresford, Nicola J; Saville, Charis; Bennett, Hayley J; Roberts, Ian S; Tabernero, Lydia

2010-08-02

Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR) are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases and they have no homologues in humans. This study provides

Inhalable microorganisms in Beijing's PM2.5 and PM10 pollutants during a severe smog event.

Science.gov (United States)

Cao, Chen; Jiang, Wenjun; Wang, Buying; Fang, Jianhuo; Lang, Jidong; Tian, Geng; Jiang, Jingkun; Zhu, Ting F

2014-01-01

Particulate matter (PM) air pollution poses a formidable public health threat to the city of Beijing. Among the various hazards of PM pollutants, microorganisms in PM2.5 and PM10 are thought to be responsible for various allergies and for the spread of respiratory diseases. While the physical and chemical properties of PM pollutants have been extensively studied, much less is known about the inhalable microorganisms. Most existing data on airborne microbial communities using 16S or 18S rRNA gene sequencing to categorize bacteria or fungi into the family or genus levels do not provide information on their allergenic and pathogenic potentials. Here we employed metagenomic methods to analyze the microbial composition of Beijing's PM pollutants during a severe January smog event. We show that with sufficient sequencing depth, airborne microbes including bacteria, archaea, fungi, and dsDNA viruses can be identified at the species level. Our results suggested that the majority of the inhalable microorganisms were soil-associated and nonpathogenic to human. Nevertheless, the sequences of several respiratory microbial allergens and pathogens were identified and their relative abundance appeared to have increased with increased concentrations of PM pollution. Our findings may serve as an important reference for environmental scientists, health workers, and city planners.

Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells

Science.gov (United States)

2017-05-01

intestinal inflammation by reducing TH17 cells and preserving group 3 innate lymphoid cells . Nat Med, 2016. 22(3): p. 319-23.   ...stable population of YFP+  cells  similar  to  innate  IL‐17–producing  cells  (e.g., γδ T  cells ) during acute infection (Fig.2) , which is in sharp contrast...AWARD NUMBER: W81XWH-16-1-0100 TITLE: Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells PRINCIPAL INVESTIGATOR: Seon Hee

Plumbing of hospital premises is a reservoir for opportunistically pathogenic microorganisms: a review.

Science.gov (United States)

Williams, Margaret M; Armbruster, Catherine R; Arduino, Matthew J

2013-01-01

Several bacterial species that are natural inhabitants of potable water distribution system biofilms are opportunistic pathogens important to sensitive patients in healthcare facilities. Waterborne healthcare-associated infections (HAI) may occur during the many uses of potable water in the healthcare environment. Prevention of infection is made more challenging by lack of data on infection rate and gaps in understanding of the ecology, virulence, and infectious dose of these opportunistic pathogens. Some healthcare facilities have been successful in reducing infections by following current water safety guidelines. This review describes several infections, and remediation steps that have been implemented to reduce waterborne HAIs.

[Analysis of Pathogenic Bacteria in Reclaimed Water and Impact of UV Disinfection on the Removal of Pathogenic Bacteria].

Science.gov (United States)

Jing, Ming; Wang, Lei

2016-02-15

In the study, 454-pyrosequencing technology was employed to investigate the species of pathogenic bacteria and the proportion of each pathogen in secondary effluent. Culture-based, qPCR and Q-RT-PCR methods were employed to analyze the removal of indicator (E. coli) and pathogen (Salmonella and Mycobacterium) by ultraviolet (UV) disinfection at a dose of 60 mJ x Cm(-2). The results showed that 11 kinds of pathogenic bacteria were found and the most abundant potentially pathogenic bacteria in the secondary effluent were affiliated with the genera of Clostridium (2.96%), Arcobacter (0.82%) and Mycobacterium (0.36%). 99.9% of culturable E. coli and Salmonella were removed by UV disinfection (60 mJ x cm(-2), however, less than 90% of culturable Mycobacterium were removed. The removal efficiencies of viable E. coli, Salmonella and Mycobacterium were low. Q-RT-PCR seemed to be a promising method for evaluating viable microorganisms in samples. Besides, pathogenic bacteria entered into VBNC state at a UV dose of 60 mJ x cm(-2). Other advanced treatment processes were needed to ensure safe utilization of reclaimed water.

Challenges and Strategies for Proteome Analysis of the Interaction of Human Pathogenic Fungi with Host Immune Cells.

Science.gov (United States)

Krüger, Thomas; Luo, Ting; Schmidt, Hella; Shopova, Iordana; Kniemeyer, Olaf

2015-12-14

Opportunistic human pathogenic fungi including the saprotrophic mold Aspergillus fumigatus and the human commensal Candida albicans can cause severe fungal infections in immunocompromised or critically ill patients. The first line of defense against opportunistic fungal pathogens is the innate immune system. Phagocytes such as macrophages, neutrophils and dendritic cells are an important pillar of the innate immune response and have evolved versatile defense strategies against microbial pathogens. On the other hand, human-pathogenic fungi have sophisticated virulence strategies to counteract the innate immune defense. In this context, proteomic approaches can provide deeper insights into the molecular mechanisms of the interaction of host immune cells with fungal pathogens. This is crucial for the identification of both diagnostic biomarkers for fungal infections and therapeutic targets. Studying host-fungal interactions at the protein level is a challenging endeavor, yet there are few studies that have been undertaken. This review draws attention to proteomic techniques and their application to fungal pathogens and to challenges, difficulties, and limitations that may arise in the course of simultaneous dual proteome analysis of host immune cells interacting with diverse morphotypes of fungal pathogens. On this basis, we discuss strategies to overcome these multifaceted experimental and analytical challenges including the viability of immune cells during co-cultivation, the increased and heterogeneous protein complexity of the host proteome dynamically interacting with the fungal proteome, and the demands on normalization strategies in terms of relative quantitative proteome analysis.

Biofilms in drinking water and their role as reservoir for pathogens.

Science.gov (United States)

Wingender, Jost; Flemming, Hans-Curt

2011-11-01

Most microorganisms on Earth live in various aggregates which are generally termed "biofilms". They are ubiquitous and represent the most successful form of life. They are the active agent in biofiltration and the carriers of the self-cleaning potential in soils, sediments and water. They are also common on surfaces in technical systems where they sometimes cause biofouling. In recent years it has become evident that biofilms in drinking water distribution networks can become transient or long-term habitats for hygienically relevant microorganisms. Important categories of these organisms include faecal indicator bacteria (e.g., Escherichia coli), obligate bacterial pathogens of faecal origin (e.g., Campylobacter spp.) opportunistic bacteria of environmental origin (e.g., Legionella spp., Pseudomonas aeruginosa), enteric viruses (e.g., adenoviruses, rotaviruses, noroviruses) and parasitic protozoa (e.g., Cryptosporidium parvum). These organisms can attach to preexisting biofilms, where they become integrated and survive for days to weeks or even longer, depending on the biology and ecology of the organism and the environmental conditions. There are indications that at least a part of the biofilm populations of pathogenic bacteria persists in a viable but non-culturable (VBNC) state and remains unnoticed by the methods appointed to their detection. Thus, biofilms in drinking water systems can serve as an environmental reservoir for pathogenic microorganisms and represent a potential source of water contamination, resulting in a potential health risk for humans if left unnoticed. Copyright © 2011 Elsevier GmbH. All rights reserved.

B cells promote obesity-associated periodontitis and oral pathogen-associated inflammation.

Science.gov (United States)

Zhu, Min; Belkina, Anna C; DeFuria, Jason; Carr, Jordan D; Van Dyke, Thomas E; Gyurko, Robert; Nikolajczyk, Barbara S

2014-08-01

Individuals with T2D and PD suffer significantly from the ability of one disease to intensify the other. Disease-associated inflammation is one mechanism thought to fuel this pathogenic feed-forward loop. Several lines of evidence indicate that proinflammatory B cells promote T2D and PD; thus, B cells are top candidates for a cell type that predisposes PD in T2D. To test directly the role of B cells in T2D-associated PD, we compared outcomes from oral Porphyromonas gingivalis challenge of lean WT or B cell-null mice with outcomes from mice that were obese and insulin-resistant before challenge. Obese WT mice responded to oral P. gingivalis challenge with significant periodontal bone loss, whereas obese B cell-null mice were protected completely from PD. By contrast, lean WT and B cell-null mice suffer similar periodontal bone loss in response to oral pathogen. B cells from obese/insulin-resistant hosts also support oral osteoclastogenesis and both oral and systemic production of inflammatory cytokines, including pro-osteoclastogenic TNF-α and MIP-2, an ortholog of human IL-8. B cells furthermore impact AT inflammation in obese, P. gingivalis-infected hosts. Taken together, these data show that fundamentally different mechanisms regulate PD in lean and obese hosts, with B cells able to promote PD only if the hosts are "primed" by obesity. These results justify more intense analysis of obesity-associated changes in B cells that predispose PD in human T2D. © 2014 Society for Leukocyte Biology.

Hotspot autoimmune T cell receptor binding underlies pathogen and insulin peptide cross-reactivity

Science.gov (United States)

Cole, David K.; Bulek, Anna M.; Dolton, Garry; Schauenberg, Andrea J.; Szomolay, Barbara; Trimby, Andrew; Jothikumar, Prithiviraj; Fuller, Anna; Skowera, Ania; Rossjohn, Jamie; Zhu, Cheng; Miles, John J.; Wooldridge, Linda; Rizkallah, Pierre J.; Sewell, Andrew K.

2016-01-01

The cross-reactivity of T cells with pathogen- and self-derived peptides has been implicated as a pathway involved in the development of autoimmunity. However, the mechanisms that allow the clonal T cell antigen receptor (TCR) to functionally engage multiple peptide–major histocompatibility complexes (pMHC) are unclear. Here, we studied multiligand discrimination by a human, preproinsulin reactive, MHC class-I–restricted CD8+ T cell clone (1E6) that can recognize over 1 million different peptides. We generated high-resolution structures of the 1E6 TCR bound to 7 altered peptide ligands, including a pathogen-derived peptide that was an order of magnitude more potent than the natural self-peptide. Evaluation of these structures demonstrated that binding was stabilized through a conserved lock-and-key–like minimal binding footprint that enables 1E6 TCR to tolerate vast numbers of substitutions outside of this so-called hotspot. Highly potent antigens of the 1E6 TCR engaged with a strong antipathogen-like binding affinity; this engagement was governed though an energetic switch from an enthalpically to entropically driven interaction compared with the natural autoimmune ligand. Together, these data highlight how T cell cross-reactivity with pathogen-derived antigens might break self-tolerance to induce autoimmune disease. PMID:27183389

Microorganisms of Grape Berries

Directory of Open Access Journals (Sweden)

Kántor Attila

2017-12-01

Full Text Available Grape surface is an unstable habitat that changes greatly according to the stage of grape ripening. Different bacteria and yeasts can colonise the surface of grape berry and the diversity of microorganisms depends on the stage of ripening, pesticide application and health condition. The aim of this study was to study the microflora of the surface of grape berries. Altogether, 19 grape samples from Slovakia were collected. The spread plate method was applied and a 100 μL inoculum of each dilution (10−2, 10−3 was plated on TSA, MEA, and MRS agar for isolation of microorganisms from grapes. Proteins were extracted from cells by ethanol/formic acid extraction procedure. MALDI-TOF Mass Spectrometry was used for identification of microorganisms. In total, 11 genera of Gram-negative bacteria, 11 of Gram-positive bacteria and nine of yeasts were identified. Among 200 isolates, Gram-negative, Gram-positive bacteria and yeasts represented 11%, 27% and 62% of the total number of isolates studied. The most common genera of isolated yeasts were Hanseniaspora (37%, Metschnikowia (31%, and Rhodotorula (10%. The most frequently isolated among Gram-negative bacteria were Acinetobacter (22%, Pseudomonas (22% and Sphingomonas (13%. The most common genera of Gram-positive bacteria were Bacillus (20%, Lactobacillus (19%, Leuconostoc and Staphylococcus (11%, respectively.

Lateral gene exchanges shape the genomes of amoeba-resisting microorganisms

Directory of Open Access Journals (Sweden)

Claire eBertelli

2012-08-01

Full Text Available Based on Darwin’s concept of the tree of life, vertical inheritance was thought to be dominant, and mutations, deletions and duplication were streaming the genomes of living organisms. In the current genomic era, increasing data indicated that both vertical and lateral gene inheritance interact in space and time to trigger genome evolution, particularly among microorganisms sharing a given ecological niche. As a paradigm to their diversity and their survival in a variety of cell types, intracellular microorganisms, and notably intracellular bacteria, were considered as less prone to lateral genetic exchanges. Such specialized microorganisms generally have a smaller gene repertoire because they do rely on their host’s factors for some basic regulatory and metabolic functions. Here we review events of lateral gene transfer (LGT that illustrate the genetic exchanges among intra-amoebal microorganisms or between the microorganism and its amoebal host. We tentatively investigate the functions of laterally transferred genes in the light of the interaction with their host as they should confer a selective advantage and success to the amoeba-resisting microorganisms.

AMPK in Pathogens.

Science.gov (United States)

Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

2016-01-01

During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

[Ultrastructure and molecular biochemistry on pathogenic fungal cells: the architecture of septal cell walls of dermatophytes].

Science.gov (United States)

Kitajima, Y

2001-01-01

This review provides abstracts of our research for which the year 2000 prize of The Japanese Society for Medical Mycology was awarded. The study consists of 4 fields: 1)Ultrastructure and biochemistry of the cell walls of dermatophytes. 2) Freeze-fracture electron microscopic study on the membrane systems of pathogenic fungi. 3) Action mechanisms of antifungal agents in terms of membrane structure and functions. 4) Dimorphism and virulence of pathogenic fungi in terms of molecular biology of membrane lipids. Since the detailed contents of these studies were reported in my previous review article (Jpn J Med Mycol 41: 211-217, 2000), I would like to mention these studies only briefly here, together with a detailed review of the septal cell wall architecture of dermatophytes, which I did not cover in my earlier articles.

Aggregative adherent strains of Corynebacterium pseudodiphtheriticum enter and survive within HEp-2 epithelial cells

Directory of Open Access Journals (Sweden)

Monica Cristina de Souza

2012-06-01

Full Text Available Corynebacterium pseudodiphtheriticum is a well-known human pathogen that mainly causes respiratory disease and is associated with high mortality in compromised hosts. Little is known about the virulence factors and pathogenesis of C. pseudodiphtheriticum. In this study, cultured human epithelial (HEp-2 cells were used to analyse the adherence pattern, internalisation and intracellular survival of the ATCC 10700 type strain and two additional clinical isolates. These microorganisms exhibited an aggregative adherence-like pattern to HEp-2 cells characterised by clumps of bacteria with a "stacked-brick" appearance. The differences in the ability of these microorganisms to invade and survive within HEp-2 cells and replicate in the extracellular environment up to 24 h post infection were evaluated. The fluorescent actin staining test demonstrated that actin polymerisation is involved in the internalisation of the C. pseudodiphtheriticum strains. The depolymerisation of microfilaments by cytochalasin E significantly reduced the internalisation of C. pseudodiphtheriticum by HEp-2 cells. Bacterial internalisation and cytoskeletal rearrangement seemed to be partially triggered by the activation of tyrosine kinase activity. Although C. pseudodiphtheriticum strains did not demonstrate an ability to replicate intracellularly, HEp-2 cells were unable to fully clear the pathogen within 24 h. These characteristics may explain how some C. pseudodiphtheriticum strains cause severe infection in human patients.

Inhalable Microorganisms in Beijing’s PM2.5 and PM10 Pollutants during a Severe Smog Event

Science.gov (United States)

2014-01-01

Particulate matter (PM) air pollution poses a formidable public health threat to the city of Beijing. Among the various hazards of PM pollutants, microorganisms in PM2.5 and PM10 are thought to be responsible for various allergies and for the spread of respiratory diseases. While the physical and chemical properties of PM pollutants have been extensively studied, much less is known about the inhalable microorganisms. Most existing data on airborne microbial communities using 16S or 18S rRNA gene sequencing to categorize bacteria or fungi into the family or genus levels do not provide information on their allergenic and pathogenic potentials. Here we employed metagenomic methods to analyze the microbial composition of Beijing’s PM pollutants during a severe January smog event. We show that with sufficient sequencing depth, airborne microbes including bacteria, archaea, fungi, and dsDNA viruses can be identified at the species level. Our results suggested that the majority of the inhalable microorganisms were soil-associated and nonpathogenic to human. Nevertheless, the sequences of several respiratory microbial allergens and pathogens were identified and their relative abundance appeared to have increased with increased concentrations of PM pollution. Our findings may serve as an important reference for environmental scientists, health workers, and city planners. PMID:24456276

Ultra-violet radiation for the inactivation of microorganisms in hydroponics

International Nuclear Information System (INIS)

Buyanosvsky, G.; Gale, J.; Degani, N.

1981-01-01

The growth of microorganisms in the nutrient solution of a circulating hydroponic system was suppressed by ultra-violet radiation. Applied for three hours daily (572 Jm -2 h -1 ) throughout experiments in which tomato and corn were grown, it was effective in reducing the population of microorganisms from between 500-800 x 10 3 to 10-50 x 10 3 cells per ml. (orig.)

Ultra-violet radiation for the inactivation of microorganisms in hydroponics

Energy Technology Data Exchange (ETDEWEB)

Buyanosvsky, G; Gale, J [Ben-Gurion Univ. of the Negev, Beersheva (Israel). Jacob Blaustein Inst. for Desert Research; Degani, N [Israel Atomic Energy Commission, Beersheba. Nuclear Research Center-Negev

1981-01-01

The growth of microorganisms in the nutrient solution of a circulating hydroponic system was suppressed by ultra-violet radiation. Applied for three hours daily (572 Jm/sup -2/h/sup -1/) throughout experiments in which tomato and corn were grown, it was effective in reducing the population of microorganisms from between 500-800 x 10/sup 3/ to 10-50 x 10/sup 3/ cells per ml.

Dissecting HIV Virulence: Heritability of Setpoint Viral Load, CD4+ T-Cell Decline, and Per-Parasite Pathogenicity.

Science.gov (United States)

Bertels, Frederic; Marzel, Alex; Leventhal, Gabriel; Mitov, Venelin; Fellay, Jacques; Günthard, Huldrych F; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Battegay, Manuel; Rauch, Andri; Cavassini, Matthias; Calmy, Alexandra; Bernasconi, Enos; Schmid, Patrick; Scherrer, Alexandra U; Müller, Viktor; Bonhoeffer, Sebastian; Kouyos, Roger; Regoes, Roland R

2018-01-01

Pathogen strains may differ in virulence because they attain different loads in their hosts, or because they induce different disease-causing mechanisms independent of their load. In evolutionary ecology, the latter is referred to as "per-parasite pathogenicity". Using viral load and CD4+ T-cell measures from 2014 HIV-1 subtype B-infected individuals enrolled in the Swiss HIV Cohort Study, we investigated if virulence-measured as the rate of decline of CD4+ T cells-and per-parasite pathogenicity are heritable from donor to recipient. We estimated heritability by donor-recipient regressions applied to 196 previously identified transmission pairs, and by phylogenetic mixed models applied to a phylogenetic tree inferred from HIV pol sequences. Regressing the CD4+ T-cell declines and per-parasite pathogenicities of the transmission pairs did not yield heritability estimates significantly different from zero. With the phylogenetic mixed model, however, our best estimate for the heritability of the CD4+ T-cell decline is 17% (5-30%), and that of the per-parasite pathogenicity is 17% (4-29%). Further, we confirm that the set-point viral load is heritable, and estimate a heritability of 29% (12-46%). Interestingly, the pattern of evolution of all these traits differs significantly from neutrality, and is most consistent with stabilizing selection for the set-point viral load, and with directional selection for the CD4+ T-cell decline and the per-parasite pathogenicity. Our analysis shows that the viral genotype affects virulence mainly by modulating the per-parasite pathogenicity, while the indirect effect via the set-point viral load is minor. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Fluorescent light irradiation and its mutagenic potential in microorganisms and cultured mammalian cells

International Nuclear Information System (INIS)

Thilagar, A.; Kumaraoo, P.V.; Ku, J.

1994-01-01

The photobiological effect of light is characterized by its energy emission at different wave lengths. Therefore by studying the energy emission spectra at different light sources and their photobiological activities, one can relate wavelength range(s) of the spectra to a particular photobiological effect. We studied the mutagenic and clastogenic potentials of light irradiation from standard fluorescent bulbs used in offices and laboratories. The energy emission spectrum of the bulbs was determined at every 10 nanometers from 300nM to 700nM. Salmonella typhimurium (strain TA100) and Escherichia coli (strain WP2uvrA) were used to study the induction of mutations in microorganisms. Chinese hamster ovary (CHO) cells were used to study the induction of chromosome aberrations. The microorganisms were plated under minimum light conditions ( 2 ) and exposed to the light source at 0.35mw/cm 2 for durations ranging from 0 to 40 minutes. The plates were incubated in darkness and the colonies were counted to determine the reversion frequencies. Similarly, the CHO cells are cultured in tissue culture flasks in minimum light conditions except for the light irradiations. The cultures were then evaluated for chromosome aberrations. The results of these studies indicated that irradiation from fluorescent lights induced a clear dose dependent increase in the reversion frequency in TA100. However the reversion frequencies in E. coli strain WP2uvrA were not substantially elevated at the maximum light irradiation condition. A significant increase in the chromosome aberrations frequency was not observed even at the maximum light irradiation dose used in this study. These results were compared to data obtained from similar experiments conducted with fluorescent bulbs with different energy emission spectra. The results of these studies are presented in this paper

[Research progress in root rot diseases of Chinese herbal medicine and control strategy by antagonistic microorganisms].

Science.gov (United States)

Gao, Fen; Ren, Xiao-xia; Wang, Meng-liang; Qin, Xue-mei

2015-11-01

In recent years, root rot diseases of Chinese herbal medicine have been posing grave threat to the development of the traditional Chinese medicine industry. This article presents a review on the occurring situation of the root rot disease, including the occurrence of the disease, the diversity of the pathogens, the regional difference in dominant pathogens,and the complexity of symptoms and a survey of the progress in bio-control of the disease using antagonistic microorganisms. The paper also discusses the existing problems and future prospects in the research.

Antimicrobial activity of Aegiphila sellowiana Cham., Lamiaceae, against oral pathogens

Directory of Open Access Journals (Sweden)

Marcele A. Ferreira

Full Text Available The antimicrobial activity of Aegiphila sellowiana Cham., Lamiaceae, against oral pathogens is reported. The Minimal Inhibitory Concentrations (MICs for inhibiting the microorganisms growth were determined using the broth microdilution method from the CLSI M7-A7 protocol. Chlorhexidine was used as the positive control. The ethanol crude extract of the aerial parts of A. sellowiana exhibited activity against the microorganisms tested in this work; however, the activity decreased after partition with n-hexane, dichloromethane, and ethyl acetate. Among the tested fractions, the n-hexane fraction was found to be the most effective against the evaluated oral pathogens. GC-MS analysis of this latter fraction revealed that fatty acids esters, steroids, and aliphatic sesquiterpene hydrocarbons are its major constituents. These compounds may be responsible for the activity of the n-hexane fraction, but other chemical constituents of the dichloromethane, ethyl acetate, and hydroalcoholic fraction may potentialize their activities in the crude extract.

Kocuria kristinae: a true pathogen in pediatric patients.

Science.gov (United States)

Chen, Hsin-Mao; Chi, Hsin; Chiu, Nan-Chang; Huang, Fu-Yuan

2015-02-01

Kocuria kristinae is a Gram-positive microorganism, which has rarely been reported as a pathogen that causes infection in humans. Recently, a few studies had concluded that this pathogen can indeed cause infection in immunocompromised hosts. However, the number of reports on K. kristinae infection in pediatric patients is still relatively limited. Clinical data on pediatric patients who had K. kristinae cells isolated from their blood specimens during the period from January 2008 to May 2012 in a tertiary-care hospital in northern Taiwan were gathered and analyzed. Among 12 patients with K. kristinae cells isolated from their blood specimens, laboratory test results confirmed seven to have K. kristinae bloodstream infection. Six of them were premature babies, and one had acute leukemia. The infections were all healthcare associated. All the six premature babies had clinical presentation of sepsis and were inserted with percutaneous central venous catheters. One patient had two sets of blood culture positive for K. kristinae infection, and two premature patients had two sets of K. kristinae isolated, one from blood culture and the other from catheter tip culture, both of which were done at the same time. The leukemic child was inserted with a Broviac catheter and had K. kristinae isolated from both blood specimen and Broviac catheter. In the remaining five patients, K. kristinae infection was considered to be contaminant because they had only one set of positive blood culture and had other recognized infections. K. kristinae can cause infections in premature babies and immunocompromised pediatric patients using long-term intravenous catheters. Therefore, K. kristinae should be considered as a true pathogen and proper treatment should be provided to all susceptible pediatric patients. Copyright © 2013. Published by Elsevier B.V.

Tick-borne pathogen – Reversed and conventional discovery of disease

Directory of Open Access Journals (Sweden)

Ellen eTijsse Klasen

2014-07-01

Full Text Available Molecular methods have increased the number of known microorganisms associated with ticks significantly. Some of these newly identified microorganisms are readily linked to human disease while others are yet unknown to cause human disease. The face of tick-borne disease discovery has changed with more diseases now being discovered in a ‘reversed way’, detecting disease cases only years after the tick-borne microorganism was first discovered. Compared to the conventional discovery of infectious diseases, this order of discoveries presents researchers with new challenges. Especially estimating public health risks of such agents is challenging, as case definitions and diagnostic procedures may initially be missing. We discuss the advantages and shortcomings of molecular methods, serology, epidemiological studies that might be used to study some fundamental questions regarding newly identified tick-borne diseases. With increased tick-exposure and improved detection methods, more tick-borne microorganisms will be added to the list of pathogens causing disease in humans in future.

Waterborne microorganisms and biofilms related to hospital infections: strategies for prevention and control in healthcare facilities.

Science.gov (United States)

Capelletti, Raquel Vannucci; Moraes, Ângela Maria

2016-02-01

Water is the main stimulus for the development of microorganisms, and its flow has an important role in the spreading of contaminants. In hospitals, the water distribution system requires special attention since it can be a source of pathogens, including those in the form of biofilms often correlated with resistance of microorganisms to various treatments. In this paper, information relevant to cases of nosocomial infections involving water circuits as a source of contaminants is compiled, with emphasis on the importance of microbiological control strategies to prevent the installation, spreading and growth of microorganisms in hospitals. An overview of the worldwide situation is provided, with emphasis on Brazilian hospitals. Different approaches normally used to control the occurrence of nosocomial infections due to waterborne contaminants are analyzed, and the use of the polysaccharide chitosan for this specific application is briefly discussed.

Nanomaterials-based biosensors for detection of microorganisms and microbial toxins.

Science.gov (United States)

Sutarlie, Laura; Ow, Sian Yang; Su, Xiaodi

2017-04-01

Detection of microorganisms and microbial toxins is important for health and safety. Due to their unique physical and chemical properties, nanomaterials have been extensively used to develop biosensors for rapid detection of microorganisms with microbial cells and toxins as target analytes. In this paper, the design principles of nanomaterials-based biosensors for four selected analyte categories (bacteria cells, toxins, mycotoxins, and protozoa cells), closely associated with the target analytes' properties is reviewed. Five signal transducing methods that are less equipment intensive (colorimetric, fluorimetric, surface enhanced Raman scattering, electrochemical, and magnetic relaxometry methods) is described and compared for their sensory performance (in term oflimit of detection, dynamic range, and response time) for all analyte categories. In the end, the suitability of these five sensing principles for on-site or field applications is discussed. With a comprehensive coverage of nanomaterials, design principles, sensing principles, and assessment on the sensory performance and suitability for on-site application, this review offers valuable insight and perspective for designing suitable nanomaterials-based microorganism biosensors for a given application. Copyright © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Method for treating wastewater using microorganisms and vascular aquatic plants

Science.gov (United States)

Wolverton, B. C. (Inventor)

1983-01-01

A method for treating wastewater compresses subjecting the wastewater to an anaerobic setting step for at least 6 hours and passing the liquid effluent from the anaerobic settling step through a filter cell in an upflow manner. There the effluent is subjected first to the action of anaerobic and facultative microorganisms, and then to the action of aerobic microorganisms and the roots of at least one vascular aquatic plant.

How microorganisms use hydrophobicity and what does this mean for human needs?

Directory of Open Access Journals (Sweden)

Anna eKrasowska

2014-08-01

Full Text Available Cell surface hydrophobicity (CSH plays a crucial role in the attachment to, or detachment from the surfaces. The influence of CSH on adhesion of microorganisms to biotic and abiotic surfaces in medicine as well as in bioremediation and fermentation industry has both negative and positive aspects. Hydrophobic microorganisms cause the damage of surfaces by biofilm formation; on the other hand, they can readily accumulate on organic pollutants and decompose them. Hydrophilic microorganisms also play a considerable role in removing organic wastes from the environment because of their high resistance to hydrophobic chemicals. Despite the many studies on the environmental and metabolic factors affecting cell surface hydrophobicity (CSH, the knowledge of this subject is still scanty and is in most cases limited to observing the impact of hydrophobicity on adhesion, aggregation or flocculation. The future of research seems to lie in finding a way to managing the microbial adhesion process, perhaps by steering cell hydrophobicity.

The varieties of immunological experience: of pathogens, stress, and dendritic cells.

Science.gov (United States)

Pulendran, Bali

2015-01-01

In the 40 years since their discovery, dendritic cells (DCs) have been recognized as central players in immune regulation. DCs sense microbial stimuli through pathogen-recognition receptors (PRRs) and decode, integrate, and present information derived from such stimuli to T cells, thus stimulating immune responses. DCs can also regulate the quality of immune responses. Several functionally specialized subsets of DCs exist, but DCs also display functional plasticity in response to diverse stimuli. In addition to sensing pathogens via PRRs, emerging evidence suggests that DCs can also sense stress signals, such as amino acid starvation, through ancient stress and nutrient sensing pathways, to stimulate adaptive immunity. Here, I discuss these exciting advances in the context of a historic perspective on the discovery of DCs and their role in immune regulation. I conclude with a discussion of emerging areas in DC biology in the systems immunology era and suggest that the impact of DCs on immunity can be usefully contextualized in a hierarchy-of-organization model in which DCs, their receptors and signaling networks, cell-cell interactions, tissue microenvironment, and the host macroenvironment represent different levels of the hierarchy. Immunity or tolerance can then be represented as a complex function of each of these hierarchies.

Distribution of pathogenic microorganisms isolated from dental hospital workers in Korea

Directory of Open Access Journals (Sweden)

Su Jung Kim

2013-04-01

Full Text Available With the significant rise in hospital infection management in dental hospitals as well as in hospitals, and in order to identify the distribution of pathogenic bacteria on hands and nasal cavity of workers in a dental hospital, bacteria from the hands and nasal cavities of six dentists and 44 dental hygienists from four dental hospitals were investigated. The results showed Staphylococcus aureus (13, Staphylococcus capitis (1, Staphylococcus epidermidis (12, Staphylococcus hominis (4, Staphylococcus warneri (3, Staphylococcus xylosus (14, Staphylococcus. Lugdunensis (1, and Neisseria spp. (2 were isolated from the nasal cavity and Staphylococcus aureus (9, Staphylococcus capitis (4, Staphylococcus epidermidis (16, Staphylococcus hominis (8, Staphylococcus warneri (5, Staphylococcus xylosus (22, Staphylococcus leutus (3, Micrococcus spp. (4, Staphylococcus cohnii (1, Serratia marcescens (2, Pseudomonas aeruginosa (3, Klebsiella pneumonia (2 and Pseudomonas pneumotropica (1 from the hands. An antimicrobial disk diffusion test was conducted on Staphylococcus aureus isolated from the hands and nasal cavity to detect MRSA by means of oxacillin. Two strains were detected. When the genes of penicillin binding protein 2 (mecA were detected from the 2 strains, MRSA was found from both strains. The results of this investigation on the distribution of various pathogenic bacteria and MRSA on hands and nasal cavity of workers of a dental hospital, will contribute to the basic data for the future infection management in a dental hospital.

Microorganism and filamentous fungi drive evolution of plant synapses.

Science.gov (United States)

Baluška, František; Mancuso, Stefano

2013-01-01

In the course of plant evolution, there is an obvious trend toward an increased complexity of plant bodies, as well as an increased sophistication of plant behavior and communication. Phenotypic plasticity of plants is based on the polar auxin transport machinery that is directly linked with plant sensory systems impinging on plant behavior and adaptive responses. Similar to the emergence and evolution of eukaryotic cells, evolution of land plants was also shaped and driven by infective and symbiotic microorganisms. These microorganisms are the driving force behind the evolution of plant synapses and other neuronal aspects of higher plants; this is especially pronounced in the root apices. Plant synapses allow synaptic cell-cell communication and coordination in plants, as well as sensory-motor integration in root apices searching for water and mineral nutrition. These neuronal aspects of higher plants are closely linked with their unique ability to adapt to environmental changes.

Cyanide utilization and degradation by microorganisms.

Science.gov (United States)

Knowles, C J

1988-01-01

Various microorganisms can produce (cyanogenesis) or degrade cyanide. They degrade cyanide either to detoxify it, or to use it as a source of nitrogen for growth. Significant amounts of cyanide are formed as a secondary metabolite by a wide range of fungi and a few bacteria by decarboxylation of glycine. When cyanide has been formed by the snow mould fungus it is degraded by conversion to carbon dioxide and ammonia via an unknown pathway. In contrast, cyanogenic bacteria either do not further catabolize cyanide or they convert it into beta-cyanoalanine by addition to cysteine or O-acetylserine. Several non-cyanogenic fungi that are pathogens of cyanogenic plants are known to degrade cyanide by hydration to formamide by the enzyme cyanide hydratase. Such fungi can be immobilized and used in packed-cell columns to continuously detoxify cyanide. ICI Biological Products Business market a preparation of spray-dried fungal mycelia, 'CYCLEAR', to detoxify industrial wastes. Novo Industri have also introduced a cyanidase preparation to convert cyanide directly into formate and ammonia. Bacteria have been isolated that use cyanide as a source of nitrogen for growth. Because cyanide, as KCN or NaCN, is toxic for growth, the bacteria (Pseudomonas fluorescens) have to be grown in fed-batch culture with cyanide as the limiting nutrient. Cyanide is converted to carbon dioxide and ammonia (which is then assimilated) by an NADH-linked cyanide oxygenase system.

. boulardii CNCM I-1079 and defence against pathogenic gastro-intestinal microorganisms (ID 3017, further assessment) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

, a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079, is sufficiently characterised. The claimed effect which is proposed for further assessment, defence against pathogenic gastro-intestinal microorganisms......, is a beneficial physiological effect. The proposed target population is the general population. No human intervention studies which investigated the effect of a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079 were...... provided. On the basis of the data presented, the Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of L. rhamnosus CNCM I-1720, L. helveticus CNCM I-1722, B. longum subsp. longum CNCM I-3470 and S. cerevisiae var. boulardii CNCM I-1079...

Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

Science.gov (United States)

Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

2014-11-01

The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

Community ecology of fungal pathogens on Bromus tectorum [Chapter 7

Science.gov (United States)

Susan E. Meyer; Julie Beckstead; JanaLynn Pearce

2016-01-01

Bromus tectorum L. (cheatgrass or downy brome) presents a rich resource for soil microorganisms because of its abundant production of biomass, seeds, and surface litter. Many of these organisms are opportunistic saprophytes, but several fungal species regularly found in B. tectorum stands function as facultative or obligate pathogens. These organisms interact...

Antimicrobial activity of Arctium lappa constituents against microorganisms commonly found in endodontic infections.

Science.gov (United States)

Pereira, Juliana Vianna; Bergamo, Débora Cristina Baldoqui; Pereira, José Odair; França, Suzelei de Castro; Pietro, Rosemeire Cristina Linhares Rodrigues; Silva-Sousa, Yara T Corrêa

2005-01-01

This study evaluated in vitro the antimicrobial activity of rough extracts from leaves of Arctium lappa and their phases. The following microorganisms, commonly found in the oral cavity, specifically in endodontic infections, were used: Enterococcus faecalis, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis and Candida albicans. The agar-diffusion method allowed detection of the hexanic phase as an inhibitor of microbial growth. Bioautographic assays identified antimicrobial substances in the extract. The results showed the existence, in the rough hexanic phase and in its fractions, of constituents that have retention factors (Rf) in three distinct zones, thereby suggesting the presence of active constituents with chemical structures of different polarities that exhibited specificity against the target microorganisms. It may be concluded that the Arctium lappa constituents exhibited a great microbial inhibition potential against the tested endodontic pathogens.

Surfactant producing TNT-degrading microorganisms for bioremediation

Energy Technology Data Exchange (ETDEWEB)

Vorobyov, A.; Marchenko, A.; Rudneva, O.; Borovick, R. [Research Center for Toxicology and Hygienic Regulation of Biopreparations, Serpukhov, Moscow region (Russian Federation); Radosevich, M. [Univ. of Delaware, Newark (United States). Dept. of Plant and Soil Sciences

2003-07-01

In general the biodegradation of nitroaromatic hydrocarbons is influenced by their bioavailability. 2,4,6-trinitrotoluene is very poorly soluble in water. TNT is easily adsorbed to clay or humus fractions in the soil, and pass very slowly to the aqueous phase, where microorganisms metabolize it. Biosurfactants that increase TNT solubility and improve its bioavailability can thereby accelerate degradation. Pure cultures of microorganisms-TNT degraders were isolated by the method of enrichment cultures from samples of different-type soil contaminated by TNT (soddy-podzol, black earth, and gray forest ones). From 28 soil samples 35 isolates of microorganisms degrading TNT were taken. The isolated soil samples had been tested for availability of microbial activity towards TNT. By10 g of air-dried soil, 10 ml of distilled water, and 2 mg of TNT were placed into 750 ml shaken flasks. The flasks were incubated at 150 rev/min and 24 C. Glucose, sodium succinate or sodium acetate had been used as co-substrates. The ability of the strains to produce surfactants was studied by drop collapsing test and direct measuring of surface tension of cultural liquid after cultivation with TNT. Cells of the strains were cultivated on solid and liquid nutrient media. For drop collapsing test the cells were cultivated on solid nutrient media; the separated colonies were suspended in distilled water. Drop sustainability test ws conducted on a standard 96-well plates coated with a thin layer of vaseline oil. Surface tension of cultural liquid ws measured after cultivation of strains in the presence of TNT with the use of a ring tensiometer. Before measuring of surface tension microbial cells were collected from liquid culture by centrifugation. (orig.)

Elimination of pathogenic microorganisms contained in sewage sludge by different anaerobic digestion technologies

International Nuclear Information System (INIS)

Rodriguez Morales, J. A.; Hernandez Lehmann, A.; Herandez Munoz, A. F.

2010-01-01

sewage sludge should be treated to facilitate handling and avoid possible problems like the smell of pathogens. These treatments modify the properties of the sludge making them more suitable for reuse or disposal. (Author) 5 refs.

Two is better than one: advances in pathogen-boosted immunotherapy and adoptive T-cell therapy.

Science.gov (United States)

Xin, Gang; Schauder, David M; Zander, Ryan; Cui, Weiguo

2017-09-01

The recent tremendous successes in clinical trials take cancer immunotherapy into a new era and have attracted major attention from both academia and industry. Among the variety of immunotherapy strategies developed to boost patients' own immune systems to fight against malignant cells, the pathogen-based and adoptive cell transfer therapies have shown the most promise for treating multiple types of cancer. Pathogen-based therapies could either break the immune tolerance to enhance the effectiveness of cancer vaccines or directly infect and kill cancer cells. Adoptive cell transfer can induce a strong durable antitumor response, with recent advances including engineering dual specificity into T cells to recognize multiple antigens and improving the metabolic fitness of transferred cells. In this review, we focus on the recent prospects in these two areas and summarize some ongoing studies that represent potential advancements for anticancer immunotherapy, including testing combinations of these two strategies.

Survival of pathogenic and lactobacilli species of fermented olives during simulated human digestion.

Science.gov (United States)

Arroyo-López, Francisco N; Blanquet-Diot, Stéphanie; Denis, Sylvain; Thévenot, Jonathan; Chalancon, Sandrine; Alric, Monique; Rodríguez-Gómez, Francisco; Romero-Gil, Verónica; Jiménez-Díaz, Rufino; Garrido-Fernández, Antonio

2014-01-01

The present survey uses a dynamic gastric and small intestinal model to assess the survival of one pathogenic (Escherichia coli O157:H7 EDL 933) and three lactobacilli bacteria with probiotic potential (Lactobacillus rhamnosus GG, L. pentosus TOMC-LAB2, and L. pentosus TOMC-LAB4) during their passage through the human gastrointestinal tract using fermented olives as the food matrix. The data showed that the survival of the E. coli strain in the stomach and duodenum was very low, while its transit through the distal parts (jejunum and ileum) resulted in an increase in the pathogen population. The production of Shiga toxins by this enterohemorrhagic microorganism in the ileal effluents of the in vitro system was too low to be detected by ELISA assays. On the contrary, the three lactobacilli species assayed showed a considerable resistance to the gastric digestion, but not to the intestinal one, which affected their survival, and was especially evident in the case of both L. pentosus strains. In spite of this, high population levels for all assayed microorganisms were recovered at the end of the gastrointestinal passage. The results obtained in the present study show the potential use of table olives as a vehicle of beneficial microorganisms to the human body, as well as the need for good hygienic practices on the part of olive manufacturers in order to avoid the possibility of contamination by food-borne pathogens.

Survival of pathogenic and lactobacilli species of fermented olives during simulated human digestion

Directory of Open Access Journals (Sweden)

Francisco Noé eArroyo López

2014-10-01

Full Text Available The present survey uses a dynamic gastric and small intestinal model to assess the survival of one pathogenic (Escherichia coli O157:H7 EDL 933 and three lactobacilli bacteria with probiotic potential (Lactobacillus rhamnosus GG, Lactobacillus pentosus TOMC-LAB2 and Lactobacillus pentosus TOMC-LAB4 during their passage through the human gastrointestinal tract using fermented olives as the food matrix. The data showed that the survival of the E. coli strain in the stomach and duodenum was very low, while its transit through the distal parts (jejunum and ileum resulted in an increase in the pathogen population. The production of Shiga toxins by this enterohemorrhagic microorganism in the ileal effluents of the in vitro system was too low to be detected by ELISA assays. On the contrary, the three lactobacilli species assayed showed a considerable resistance to the gastric digestion, but not to the intestinal one, which affected their survival, and was especially evident in the case of both L. pentosus strains. In spite of this, high population levels for all assayed microorganisms were recovered at the end of the gastrointestinal passage. The results obtained in the present study show the potential use of table olives as a vehicle of beneficial microorganisms to the human body, as well as the need for good hygienic practices on the part of olive manufacturers in order to avoid the possibility of contamination by food-borne pathogens.

Modeling fate and transport of fecally-derived microorganisms at the watershed scale: state of the science and future opportunities

Science.gov (United States)

Natural waters provide habitats for various groups of fecal indicator organisms (FIOs) and pathogenic microorganisms originating from animal manures and animal waste. A number of watershed modeling works have been carried out to have a better understanding to the fate and transport of fecal indicato...

Uncovering plant-pathogen crosstalk through apoplastic proteomic studies.

Science.gov (United States)

Delaunois, Bertrand; Jeandet, Philippe; Clément, Christophe; Baillieul, Fabienne; Dorey, Stéphan; Cordelier, Sylvain

2014-01-01

Plant pathogens have evolved by developing different strategies to infect their host, which in turn have elaborated immune responses to counter the pathogen invasion. The apoplast, including the cell wall and extracellular space outside the plasma membrane, is one of the first compartments where pathogen-host interaction occurs. The plant cell wall is composed of a complex network of polysaccharides polymers and glycoproteins and serves as a natural physical barrier against pathogen invasion. The apoplastic fluid, circulating through the cell wall and intercellular spaces, provides a means for delivering molecules and facilitating intercellular communications. Some plant-pathogen interactions lead to plant cell wall degradation allowing pathogens to penetrate into the cells. In turn, the plant immune system recognizes microbial- or damage-associated molecular patterns (MAMPs or DAMPs) and initiates a set of basal immune responses, including the strengthening of the plant cell wall. The establishment of defense requires the regulation of a wide variety of proteins that are involved at different levels, from receptor perception of the pathogen via signaling mechanisms to the strengthening of the cell wall or degradation of the pathogen itself. A fine regulation of apoplastic proteins is therefore essential for rapid and effective pathogen perception and for maintaining cell wall integrity. This review aims to provide insight into analyses using proteomic approaches of the apoplast to highlight the modulation of the apoplastic protein patterns during pathogen infection and to unravel the key players involved in plant-pathogen interaction.

Use of an optical trap for study of host-pathogen interactions for dynamic live cell imaging.

Science.gov (United States)

Tam, Jenny M; Castro, Carlos E; Heath, Robert J W; Mansour, Michael K; Cardenas, Michael L; Xavier, Ramnik J; Lang, Matthew J; Vyas, Jatin M

2011-07-28

Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system(1, 2); however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis(3) have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous intercellular contacts at the appropriate stage of interaction. The stochastic nature of these events renders this process tedious, and it is difficult to observe early or fleeting events in cell-cell contact by this approach. This method requires finding cell pairs that are on the verge of contact, and observing them until they consummate their contact, or do not. To address these limitations, we use optical trapping as a non-invasive, non-destructive, but fast and effective method to position cells in culture. Optical traps, or optical tweezers, are increasingly utilized in biological research to capture and physically manipulate cells and other micron-sized particles in three dimensions(4). Radiation pressure was first observed and applied to optical tweezer systems in 1970(5, 6), and was first used to control biological specimens in 1987(7). Since then, optical tweezers have matured into a technology to probe a variety of biological phenomena(8-13). We describe a method(14) that advances live cell imaging by integrating an optical trap with spinning disk confocal microscopy with temperature and humidity control to provide exquisite spatial and temporal control of pathogenic organisms in a physiological environment to facilitate interactions with host cells, as determined by the operator. Live, pathogenic organisms like Candida albicans and Aspergillus fumigatus, which can cause potentially lethal, invasive infections in immunocompromised individuals(15, 16) (e.g. AIDS

Large-scale production of diesel-like biofuels - process design as an inherent part of microorganism development.

Science.gov (United States)

Cuellar, Maria C; Heijnen, Joseph J; van der Wielen, Luuk A M

2013-06-01

Industrial biotechnology is playing an important role in the transition to a bio-based economy. Currently, however, industrial implementation is still modest, despite the advances made in microorganism development. Given that the fuels and commodity chemicals sectors are characterized by tight economic margins, we propose to address overall process design and efficiency at the start of bioprocess development. While current microorganism development is targeted at product formation and product yield, addressing process design at the start of bioprocess development means that microorganism selection can also be extended to other critical targets for process technology and process scale implementation, such as enhancing cell separation or increasing cell robustness at operating conditions that favor the overall process. In this paper we follow this approach for the microbial production of diesel-like biofuels. We review current microbial routes with both oleaginous and engineered microorganisms. For the routes leading to extracellular production, we identify the process conditions for large scale operation. The process conditions identified are finally translated to microorganism development targets. We show that microorganism development should be directed at anaerobic production, increasing robustness at extreme process conditions and tailoring cell surface properties. All the same time, novel process configurations integrating fermentation and product recovery, cell reuse and low-cost technologies for product separation are mandatory. This review provides a state-of-the-art summary of the latest challenges in large-scale production of diesel-like biofuels. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Short communication: quantification of the transmission of microorganisms to milk via dirt attached to the exterior of teats

NARCIS (Netherlands)

Vissers, M.M.M.; Driehuis, F.; Giffel, M.C.T.; Jong, de P.; Lankveld, J.M.G.

2007-01-01

Pathogens and spoilage microorganisms can be transmitted to milk via dirt (e.g., feces, bedding material, soil, or a combination of these) attached to the exterior of the cows¿ teats. To determine the relevance of this pathway and to perform quantitative microbial risk analysis of the microbial

Molecular techniques for detection and identification of pathogens in food: advantages and limitations

OpenAIRE

Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

2014-01-01

Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

Occurrence of mastitis pathogens in relation to somatic cells

Directory of Open Access Journals (Sweden)

Marcela Vyletělová Klimešová

2013-01-01

Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.

Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

Directory of Open Access Journals (Sweden)

Katja Kriebel

Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

The hair follicle mites (Demodex spp.). Could they be vectors of pathogenic microorganisms?

Science.gov (United States)

Wolf, R; Ophir, J; Avigad, J; Lengy, J; Krakowski, A

1988-01-01

The hair follicle mites Demodex folliculorum and D. brevis are the most common permanent ectoparasites of Man. Ordinarily they are harmless to their human host and appear to be of no medical significance. We present, however, an unusual finding regarding this mite, namely, that in a potassium hydroxide mount of a skin scraping from a mycotic plaque we found numerous Demodex mites containing inside them spores of Microsporum canis. This could mean that the putatively inoffensive Demodex has the potential to ingest various microorganisms that are found in its niche and transport them to other areas of the skin or possibly to other individuals.

Biosensors for plant pathogen detection.

Science.gov (United States)

Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

2017-07-15

Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

Proteolysis in hyperthermophilic microorganisms

Directory of Open Access Journals (Sweden)

Donald E. Ward

2002-01-01

Full Text Available Proteases are found in every cell, where they recognize and break down unneeded or abnormal polypeptides or peptide-based nutrients within or outside the cell. Genome sequence data can be used to compare proteolytic enzyme inventories of different organisms as they relate to physiological needs for protein modification and hydrolysis. In this review, we exploit genome sequence data to compare hyperthermophilic microorganisms from the euryarchaeotal genus Pyrococcus, the crenarchaeote Sulfolobus solfataricus, and the bacterium Thermotoga maritima. An overview of the proteases in these organisms is given based on those proteases that have been characterized and on putative proteases that have been identified from genomic sequences, but have yet to be characterized. The analysis revealed both similarities and differences in the mechanisms utilized for proteolysis by each of these hyperthermophiles and indicated how these mechanisms relate to proteolysis in less thermophilic cells and organisms.

A proteomic approach provides new insights into the control of soil-borne plant pathogens by Bacillus species.

Directory of Open Access Journals (Sweden)

Omür Baysal

Full Text Available Beneficial microorganisms (also known as biopesticides are considered to be one of the most promising methods for more rational and safe crop management practices. We used Bacillus strains EU07, QST713 and FZB24, and investigated their inhibitory effect on Fusarium. Bacterial cell cultures, cell-free supernatants and volatiles displayed varying degrees of suppressive effect. Proteomic analysis of secreted proteins from EU07 and FZB24 revealed the presence of lytic enzymes, cellulases, proteases, 1,4-β-glucanase and hydrolases, all of which contribute to degradation of the pathogen cell wall. Further proteomic investigations showed that proteins involved in metabolism, protein folding, protein degradation, translation, recognition and signal transduction cascade play an important role in the control of Fusarium oxysporum. Our findings provide new knowledge on the mechanism of action of Bacillus species and insight into biocontrol mechanisms.

Pathogen inactivation techniques.

Science.gov (United States)

Pelletier, J P R; Transue, S; Snyder, E L

2006-01-01

The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

Antimicrobial Sensitivity Pattern of Microorganisms Isolated from Vaginal Infections at a Tertiary Hospital in Bangalore, India

Directory of Open Access Journals (Sweden)

Nagalakshmi Narayana-Swamy

2015-03-01

Full Text Available Background: The vagina contains dozens of microbiological species in variable quantities and is, therefore, considered a complex environment. Among the microorganisms, bacteria have important repercussions on women’s health. The present study was conducted especially to elucidate this type of vaginal isolates and their sensitivity towards currently used antibiotics. Methods: This was a retrospective study conducted at the Department of Obstetrics and Gynaecology, Sapthagiri Hospital, Bangalore, India from January 2012 to December 2013. All symptomatic women who had a high vaginal swab taken for culture and sensitivity testing were included in this study. Antibiotic susceptibility was tested using disc diffusion method (modified Kirby-Bauer method. The antibiotic sensitivity patterns of isolated microorganisms were studied. Results: Out of 200 patients, 95% had positive vaginal cultures. Fifteen types of microorganisms were isolated. The highest frequency of infection was observed at the age of 20-30 years, followed by 41-50 years and 31-40 years, and a low frequency of infection was observed above 50 years of age. The most prevalent pathogen was Escherichia coli, followed by Streptococcus agalactiae and diphtheroids with equal incidence. Among the antibiotics tested, isolated pathogens were completely resistant to nalidixic acid and highly sensitive to meropenem and imepenem. Conclusion: The high prevalence of gynaecological infections demands that patients with symptoms undergo thorough investigation with cultures and sensitivity essays. Changes in treatment protocols are required to treat vaginal infections effectively.

The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections

Science.gov (United States)

García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula

2017-01-01

Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host–bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored. PMID:28446911

Antibacterial effect of grapefruit seed extract (GSE) on Makgeolli-brewing microorganisms and its application in the preservation of fresh Makgeolli.

Science.gov (United States)

Choi, Jae-Suk; Lee, Yu-Ri; Ha, Yu-Mi; Seo, Hyo Ju; Kim, Young Hun; Park, Sun-Mee; Sohn, Jae Hak

2014-06-01

To develop a new preservation method, the antimicrobial activity of grapefruit seed extract (GSE) against Makgeolli-brewing microorganisms and food-borne pathogens was assessed, and a general analysis and sensory evaluation of fresh Makgeolli with added GSE was made. The minimum inhibitory concentration (MIC) values of GSE against 10 strains of Makgeolli-brewing microorganism were 0.0122 to 1.5625 μL/mL. The MIC values against 6 strains of food-borne pathogens were 0.0061 to 0.7813 μL/mL. On addition of 0.1% (v/v) and 0.2% GSE in bottled fresh Makgeolli, no significant difference in the pH, or the contents of total acids, ethanol, or methanol in the Makgeolli, were observed compared with control Makgeolli (with no GSE), during the preservation period (8 weeks) at 10 °C. In the Makgeolli with 0.1% and 0.2% GSE, the total bacterial counts decreased significantly by 4.9% (P grapefruit seed extract (GSE) was developed. As fresh Makgeolli contains live microorganisms, the preservation period is 1 wk, which is relatively short. GSE controls the growth of Makgeolli-brewing and Makgeolli-spoiling microorganisms. 0.1% to 0.2% GSE is optimum for prolonging the shelf life (2 wk) of bottled fresh Makgeolli, and has no adverse effect on overall acceptability. We demonstrated that GSE is an effective natural additive that prolongs the shelf life of fresh Makgeolli with no significant loss in quality. © 2014 Institute of Food Technologists®

Inactivation of high concentration of pathogens in land-applied food ...

African Journals Online (AJOL)

In Mexico, as in other developing countries, the most important pollution and management problems of food-processing sludge are the high levels of pathogen microorganisms within the sludge and the lack of sites for its disposal. The aims of this study were to evaluate the effect of calcium oxide in the inactivation of ...

Finding the smoking gun: protein tyrosine phosphatases as tools and targets of unicellular microorganisms and viruses.

Science.gov (United States)

Heneberg, P

2012-01-01

Protein tyrosine phosphatases (PTPs) are increasingly recognized as important effectors of host-pathogen interactions. Since Guan and Dixon reported in 1990 that phosphatase YopH serves as an essential virulence determinant of Yersinia, the field shifted significantly forward, and dozens of PTPs were identified in various microorganisms and even in viruses. The discovery of extensive tyrosine signaling networks in non-metazoan organisms refuted the moth-eaten paradigm claiming that these organisms rely exclusively on phosphoserine/phosphothreonine signaling. Similarly to humans, phosphotyrosine signaling is thought to comprise a small fraction of total protein phosphorylation, but plays a disproportionately important role in cell-cycle control, differentiation, and invasiveness. Here we summarize the state-of-art knowledge on PTPs of important non-metazoan pathogens (Listeria monocytogenes, Staphylococcus aureus, Porphyromonas gingivalis, Caulobacter crescentus, Yersinia, Synechocystis, Leishmania, Plasmodium falciparum, Entamoeba histolytica, etc.), and focus also at the microbial proteins affecting directly or indirectly the PTPs of the host (Mycobacterium tuberculosis MTSA-10, Bacillus anthracis anthrax toxin, streptococcal β protein, Helicobacter pylori CagA and VacA, Leishmania GP63 and EF-1α, Plasmodium hemozoin, etc.). This is the first review summarizing the knowledge on biological activity and pharmacological inhibition of non-metazoan PTPs, with the emphasis of those important in host-pathogen interactions. Targeting of numerous non-metazoan PTPs is simplified by the fact that they act either as ectophosphatases or are secreted outside of the pathogen. Interfering with tyrosine phosphorylation represents a powerful pharmacologic approach, and even though the PTP inhibitors are difficult to develop, lifting the fog of phosphatase inhibition is of the great market potential and further clinical impact.

Meat products: main pathogens and non-thermal control strategies

Directory of Open Access Journals (Sweden)

Norma Heredia

2014-12-01

Full Text Available Meat is a rich nutrient matrix that allows the proper environment for diverse microorganisms’ proliferation, deteriorative and pathogen. E. coli O157 and non-O157, Salmonella spp. and Listeria monocytogenes are among the pathogen ones. On other hand, the growing demand for “fresh-like” products with high sanitary, organoleptic and nutritional quality had drive the development of alternative technologies to traditional or thermal, to satisfy consumers’ demand. In the last decades new food preservation techniques with no effect on nutritional or organoleptic characteristics had been developed, maintaining or improving microbiological stability and quality. This work is review of the most common pathogen microorganisms in meat and meat products, and the emerging technologies like high hydrostatic pressure, radiation, intelligent and active packages, and the use of natutal compounds for their control.

The response of CD1d-restricted invariant NKT cells to microbial pathogens and their products

Directory of Open Access Journals (Sweden)

Luc eVan Kaer

2015-05-01

Full Text Available Invariant natural killer T (iNKT cells become activated during a wide variety of infections. This includes organisms lacking cognate CD1d-binding glycolipid antigens recognized by the semi-invariant T cell receptor of iNKT cells. Additional studies have shown that iNKT cells also become activated in vivo in response to microbial products such as bacterial lipopolysaccharide, a potent inducer of cytokine production in antigen-presenting cells (APCs. Other studies have shown that iNKT cells are highly responsive to stimulation by cytokines such as interleukin-12. These findings have led to the concept that microbial pathogens can activate iNKT cells either directly via glycolipids, or indirectly by inducing cytokine production in APCs. iNKT cells activated in this manner produce multiple cytokines that can influence the outcome of infection, usually in favor of the host, although potent iNKT cell activation may contribute to an uncontrolled cytokine storm and sepsis. One aspect of the response of iNKT cells to microbial pathogens is that it is short-lived and followed by an extended time period of unresponsiveness to reactivation. This refractory period may represent a means to avoid chronic activation and cytokine production by iNKT cells, thus protecting the host against some of the negative effects of iNKT cell activation, but potentially putting the host at risk for secondary infections. These effects of microbial pathogens and their products on iNKT cells are not only important for understanding the role of these cells in immune responses against infections but also for the development of iNKT cell-based therapies.

The sensitivity of the most common microorganisms of pig liquid manure to the effect of 60Co irradiation

International Nuclear Information System (INIS)

Szemeredy, Gy.; Simon, J.

1979-01-01

In model experiments the most common representatives of pathogens and facultative pathogens of pig liquid manure contaminating bacterial flora were examined for their sensitivity to different doses of 60 Co, using liquid medium supplemented with 1% glucose, as well as Korthof-medium and different kinds of selective media. Erysipelothrix rhusiopathiea, Brucella suis, Mycoplasma hyorhinis and Pasteurella haemolytica proved to be the most senstive ones to irradiation, as they did not survive 100 krad dose. The highest resistances were observed in the cases of the following microorganisms: the spore containing Bacillus anthracis, killed by 700 krad irradiation dose, the saprophytic and pathogenic Mycobacteria and the spore containing Clostridium perfringens, killed by 1000-1500 krad irradiation. (author)

Fluorescence in situ hybridization investigation of potentially pathogenic bacteria involved in neonatal porcine diarrhea

DEFF Research Database (Denmark)

Jonach, Beata Renata; Boye, Mette; Stockmarr, Anders

2014-01-01

pathogens. The microorganisms that for decades have been associated with enteritis and diarrhea in suckling piglets are: rotavirus A, coronavirus, enterotoxigenic Escherichia coli (ETEC), Clostridium perfringens type C, Cryptosporidium spp., Giardia spp., Cystoisospora suis and Strongyloides ransomi...

Differential Microbial Diversity in Drosophila melanogaster: Are Fruit Flies Potential Vectors of Opportunistic Pathogens?

Directory of Open Access Journals (Sweden)

Luis A. Ramírez-Camejo

2017-01-01

Full Text Available Drosophila melanogaster has become a model system to study interactions between innate immunity and microbial pathogens, yet many aspects regarding its microbial community and interactions with pathogens remain unclear. In this study wild D. melanogaster were collected from tropical fruits in Puerto Rico to test how the microbiota is distributed and to compare the culturable diversity of fungi and bacteria. Additionally, we investigated whether flies are potential vectors of human and plant pathogens. Eighteen species of fungi and twelve species of bacteria were isolated from wild flies. The most abundant microorganisms identified were the yeast Candida inconspicua and the bacterium Klebsiella sp. The yeast Issatchenkia hanoiensis was significantly more common internally than externally in flies. Species richness was higher in fungi than in bacteria, but diversity was lower in fungi than in bacteria. The microbial composition of flies was similar internally and externally. We identified a variety of opportunistic human and plant pathogens in flies such as Alcaligenes faecalis, Aspergillus flavus, A. fumigatus, A. niger, Fusarium equiseti/oxysporum, Geotrichum candidum, Klebsiella oxytoca, Microbacterium oxydans, and Stenotrophomonas maltophilia. Despite its utility as a model system, D. melanogaster can be a vector of microorganisms that represent a potential risk to plant and public health.

Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

Directory of Open Access Journals (Sweden)

Barhoom Sima

2008-02-01

Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

Biotransformation of terpenoids by mammals, microorganisms, and plant-cultured cells.

Science.gov (United States)

Ishida, Takashi

2005-05-01

This review article summarizes our knowledge of the metabolism of mono- and sesquiterpenoids in mammals, microorganisms, cloned-insect enzymes, and plant-cultured cells. A number of unusual enzymatic reactions and products are reported such as the stereoselective formation of primary alcohols from sterically congested Me2C groups. Such enzymatic processes, including unknown chemical transformations under abiotic conditions, could lead to the discovery of new chemical reactions and might be helpful in the design of new drugs. The transformations of the following mono- and sesquiterpenoids (in alphabetical order) are discussed: (+)-(1R)-aromadendrene (61), (-)-allo-aromadendrene (62), (+/-)-camphene (21), (-)-cis-carane (20), (+)-3-carene (17), (+/-)-carvone (27), (-)-beta-caryophyllene (43), (+)-cedrol (35), cuminaldehyde (25), (+)-curdione (69), (-)-cyclocolorenone (60), (-)-elemol (51), (2E,6E)-farnesol (31), germacrone (67), ginsenol (40), (-)-globulol (63), isoprobotryan-9alpha-ol (82a), juvenile hormone III (33), (+)-ledol (65), (+)-longifolene (46), myrcene (3), (-)-myrtenal (23), (+)-nootkatone (48), patchouli alcohol (37), (-)-perillaldehyde (24), (-)-alpha- and beta-pinene (8 and 9), alpha-santalol (28), (-)-6beta-santonin (83a), 6beta-tetrahydrosantonin (83b), beta-selinene (57), alpha-thujone (26a), beta-thujone (26b), T-2 toxin (87), and valerianol (53).

An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

Directory of Open Access Journals (Sweden)

WANG Hua-cheng

2013-02-01

Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

Mechanisms of quorum sensing and strategies for quorum sensing disruption in aquaculture pathogens.

Science.gov (United States)

Zhao, J; Chen, M; Quan, C S; Fan, S D

2015-09-01

In many countries, infectious diseases are a considerable threat to aquaculture. The pathogenicity of micro-organisms that infect aquaculture systems is closely related to the release of virulence factors and the formation of biofilms, both of which are regulated by quorum sensing (QS). Thus, QS disruption is a potential strategy for preventing disease in aquaculture systems. QS inhibitors (QSIs) not only inhibit the expression of virulence-associated genes but also attenuate the virulence of aquaculture pathogens. In this review, we discuss QS systems in important aquaculture pathogens and focus on the relationship between QS mechanisms and bacterial virulence in aquaculture. We further elucidate QS disruption strategies for targeting aquaculture pathogens. Four main types of QSIs that target aquaculture pathogens are discussed based on their mechanisms of action. © 2014 John Wiley & Sons Ltd.

How pathogens use linear motifs to perturb host cell networks

KAUST Repository

Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

2015-01-01

Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

In vitro antimicrobial activity of plant extracts of Avicennia alba against some important pathogens

Directory of Open Access Journals (Sweden)

Varahalarao Vadlapudi

2012-05-01

Full Text Available Objective: In this present study antimicrobial activity of aerial parts of Avicennia alba were evaluated against the resistant pathogens belong to aquatic, human and plant origin. Methods: Soxhlet extraction method was used to get the corresponding extracts of hexane, chloroform and methanol. The antimicrobial activities of the organic solvent extracts on the various test microorganisms, including bacteria and fungi investigated using agar well diffusion technique. The length of inhibition zone was measured in millimeters from the edge of the well to the edge of the inhibition zone. Methanol and chloroform extracts exhibited promising antimicrobial activity than hexane extracts. Results: The zone of inhibition of chloroform varies from (9 to 17 mm where as with methanol (11 to 28 mm at 100 mg/ml concentration. Among all microorganisms studied Erwinia caratovara and Pseudomonas syringae showed the considerable growth inhibition with chloroform and methanolic extracts. Conclusions: A. alba can be used in the treatment of infectious diseases caused by resistant pathogenic microorganisms. Further studies are being carried out in order to separate the individual components that are present in plant extracts of A. alba using column chromatography.

Impact on Human Health of Microorganisms Present in Fermented Dairy Products: An Overview

Directory of Open Access Journals (Sweden)

María Fernández

2015-01-01

Full Text Available Fermented dairy products provide nutrients in our diet, some of which are produced by the action of microorganisms during fermentation. These products can be populated by a diverse microbiota that impacts the organoleptic and physicochemical characteristics foods as well as human health. Acidification is carried out by starter lactic acid bacteria (LAB whereas other LAB, moulds, and yeasts become dominant during ripening and contribute to the development of aroma and texture in dairy products. Probiotics are generally part of the nonstarter microbiota, and their use has been extended in recent years. Fermented dairy products can contain beneficial compounds, which are produced by the metabolic activity of their microbiota (vitamins, conjugated linoleic acid, bioactive peptides, and gamma-aminobutyric acid, among others. Some microorganisms can also release toxic compounds, the most notorious being biogenic amines and aflatoxins. Though generally considered safe, fermented dairy products can be contaminated by pathogens. If proliferation occurs during manufacture or storage, they can cause sporadic cases or outbreaks of disease. This paper provides an overview on the current state of different aspects of the research on microorganisms present in dairy products in the light of their positive or negative impact on human health.

Impact on human health of microorganisms present in fermented dairy products: an overview.

Science.gov (United States)

Fernández, María; Hudson, John Andrew; Korpela, Riitta; de los Reyes-Gavilán, Clara G

2015-01-01

Fermented dairy products provide nutrients in our diet, some of which are produced by the action of microorganisms during fermentation. These products can be populated by a diverse microbiota that impacts the organoleptic and physicochemical characteristics foods as well as human health. Acidification is carried out by starter lactic acid bacteria (LAB) whereas other LAB, moulds, and yeasts become dominant during ripening and contribute to the development of aroma and texture in dairy products. Probiotics are generally part of the nonstarter microbiota, and their use has been extended in recent years. Fermented dairy products can contain beneficial compounds, which are produced by the metabolic activity of their microbiota (vitamins, conjugated linoleic acid, bioactive peptides, and gamma-aminobutyric acid, among others). Some microorganisms can also release toxic compounds, the most notorious being biogenic amines and aflatoxins. Though generally considered safe, fermented dairy products can be contaminated by pathogens. If proliferation occurs during manufacture or storage, they can cause sporadic cases or outbreaks of disease. This paper provides an overview on the current state of different aspects of the research on microorganisms present in dairy products in the light of their positive or negative impact on human health.

Phytochemical profiles and antimicrobial activity of aromatic Malaysian herb extracts against food-borne pathogenic and food spoilage microorganisms.

Science.gov (United States)

Aziman, Nurain; Abdullah, Noriham; Noor, Zainon Mohd; Kamarudin, Wan Saidatul Syida Wan; Zulkifli, Khairusy Syakirah

2014-04-01

Preliminary phytochemical and flavonoid compounds of aqueous and ethanolic extracts of 6 aromatic Malaysian herbs were screened and quantified using Reverse-Phase High Performance Liquid Chromatography (RP-HPLC). The herbal extracts were tested for their antimicrobial activity against 10 food-borne pathogenic and food spoilage microorganisms using disk diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)/minimum fungicidal concentration (MFC) of herbal extracts were determined. In the phytochemical screening process, both aqueous and ethanolic extracts of P. hydropiper exhibited presence of all 7 tested phytochemical compounds. Among all herbal extracts, the aqueous P. hydropiper and E. elatior extracts demonstrated the highest antibacterial activity against 7 tested Gram-positive and Gram-negative bacteria with diameter ranging from 7.0 to 18.5 mm and 6.5 to 19 mm, respectively. The MIC values for aqueous and ethanolic extracts ranged from 18.75 to 175 mg/mL and 0.391 to 200 mg/mL, respectively while the MBC/MFC values for aqueous and ethanolic extracts ranged from 25 to 200 mg/mL and 3.125 to 50 mg/mL, respectively. Major types of bioactive compounds in aqueous P. hydropiper and E. elatior extracts were identified using RP-HPLC instrument. Flavonoids found in these plants were epi-catechin, quercetin, and kaempferol. The ability of aqueous Persicaria hydropiper (L.) H. Gross and Etlingera elatior (Jack) R.M. Sm. extracts to inhibit the growth of bacteria is an indication of its broad spectrum antimicrobial potential. Hence these herbal extracts may be used as natural preservative to improve the safety and shelf-life of food and pharmaceutical products. © 2014 Institute of Food Technologists®

Behavioral study of selected microorganisms in an aqueous electrohydrodynamic liquid bridge.

Science.gov (United States)

Paulitsch-Fuchs, Astrid H; Zsohár, Andrea; Wexler, Adam D; Zauner, Andrea; Kittinger, Clemens; de Valença, Joeri; Fuchs, Elmar C

2017-07-01

An aqueous electrohydrodynamic (EHD) floating liquid bridge is a unique environment for studying the influence of protonic currents (mA cm -2 ) in strong DC electric fields (kV cm -1 ) on the behavior of microorganisms. It forms in between two beakers filled with water when high-voltage is applied to these beakers. We recently discovered that exposure to this bridge has a stimulating effect on Escherichia coli. . In this work we show that the survival is due to a natural Faraday cage effect of the cell wall of these microorganisms using a simple 2D model. We further confirm this hypothesis by measuring and simulating the behavior of Bacillus subtilis subtilis , Neochloris oleoabundans, Saccharomyces cerevisiae and THP-1 monocytes. Their behavior matches the predictions of the model: cells without a natural Faraday cage like algae and monocytes are mostly killed and weakened, whereas yeast and Bacillus subtilis subtilis survive. The effect of the natural Faraday cage is twofold: First, it diverts the current from passing through the cell (and thereby killing it); secondly, because it is protonic it maintains the osmotic pressure in the cell wall, thereby mitigating cytolysis which would normally occur due to the low osmotic pressure of the surrounding medium. The method presented provides the basis for selective disinfection of solutions containing different microorganisms.

Behavioral study of selected microorganisms in an aqueous electrohydrodynamic liquid bridge

Directory of Open Access Journals (Sweden)

Astrid H. Paulitsch-Fuchs

2017-07-01

Full Text Available An aqueous electrohydrodynamic (EHD floating liquid bridge is a unique environment for studying the influence of protonic currents (mA cm−2 in strong DC electric fields (kV cm−1 on the behavior of microorganisms. It forms in between two beakers filled with water when high-voltage is applied to these beakers. We recently discovered that exposure to this bridge has a stimulating effect on Escherichia coli.. In this work we show that the survival is due to a natural Faraday cage effect of the cell wall of these microorganisms using a simple 2D model. We further confirm this hypothesis by measuring and simulating the behavior of Bacillus subtilis subtilis, Neochloris oleoabundans, Saccharomyces cerevisiae and THP-1 monocytes. Their behavior matches the predictions of the model: cells without a natural Faraday cage like algae and monocytes are mostly killed and weakened, whereas yeast and Bacillus subtilis subtilis survive. The effect of the natural Faraday cage is twofold: First, it diverts the current from passing through the cell (and thereby killing it; secondly, because it is protonic it maintains the osmotic pressure in the cell wall, thereby mitigating cytolysis which would normally occur due to the low osmotic pressure of the surrounding medium. The method presented provides the basis for selective disinfection of solutions containing different microorganisms.

Effects of Hangeshashinto on Growth of Oral Microorganisms

Directory of Open Access Journals (Sweden)

Haruka Fukamachi

2015-01-01

Full Text Available Oral mucositis (OM in cancer patients induced by chemotherapy or radiotherapy has a significant impact on quality of life, and causes considerable morbidity. Oral microorganisms are likely to intensify the inflammatory process and aggravate the formation of ulcers. Hangeshashinto (HST, a Japanese kampo medicine, has been reported to be effective when used as a gargle for the treatment of OM. To clarify the effects of HST on oral microorganisms, we assessed its antimicrobial activity against 27 microbial species, including 19 oral bacteria and one fungus. HST extract inhibited the growth of Gram-negative bacteria, including Fusobacterium nucleatum, Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia, Prevotella melaninogenica, Tannerella forsythia, Treponema denticola, and Porphyromonas asaccharolytica, though inhibitory effects were less pronounced for Gram-positive bacteria and the fungal strain. We then investigated the effects of antibacterial activities on 15 purified ingredients of HST and determined that baicalein, berberine, coptisine, [6]-shogaol, and homogentisic acid actively inhibited the growth of these bacteria. These findings showed that HST inhibits the growth of specific Gram-negative periodontopathogenic bacteria, which are significant pathogens in OM, without disturbing the normal oral flora. Our data suggest that HST may be a useful treatment for OM in patients undergoing anticancer treatment.

Is arsenic biotransformation a detoxification mechanism for microorganisms?

International Nuclear Information System (INIS)

Rahman, M. Azizur; Hassler, Christel

2014-01-01

Arsenic (As) is extremely toxic to living organisms at high concentration. In aquatic systems, As exists in different chemical forms. The two major inorganic As (iAs) species are As V , which is thermodynamically stable in oxic waters, and As III , which is predominant in anoxic conditions. Photosynthetic microorganisms (e.g., phytoplankton and cyanobacteria) take up As V , biotransform it to As III , then biomethylate it to methylarsenic (MetAs) forms. Although As III is more toxic than As V , As III is much more easily excreted from the cells than As V . Therefore, majority of researchers consider the reduction of As V to As III as a detoxification process. The biomethylation process results in the conversion of toxic iAs to the less toxic pentavalent MetAs forms (monomethylarsonate; MMA V , dimethylarsonate; DMA V , and trimethylarsenic oxide; TMAO V ) and trimethylarsine (TMAO III ). However, biomethylation by microorganisms also produces monomethylarsenite (MMA III ) and dimethylarsenite (DMA III ), which are more toxic than iAs, as a result of biomethylation by the microorganisms, demonstrates the need to reconsider to what extent As biomethylation contributes to a detoxification process. In this review, we focused on the discussion of whether the biotransformation of As species in microorganisms is really a detoxification process with recent data

Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria

OpenAIRE

Denoncourt, Alix M.; Paquet, Valérie E.; Charette, Steve J.

2014-01-01

Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging...

Microrganismos patogênicos, celularidade e resíduos de antimicrobianos no leite bovino produzido no sistema orgânico Pathogenic microorganisms, somatic cell count and drug residues evaluation in organic bovine milk

Directory of Open Access Journals (Sweden)

Márcio Garcia Ribeiro

2009-01-01

antimicrobianos em fazendas de leite orgânico.In last years increase the importance of milk quality and conditions of bovine milking. Simultaneously, increase the interest about organic milk and derivates. The aim of present study was investigate the milk pathogens, sensitivity and multiple drug resistance of isolates, somatic cell count and residues of drugs in milk, from cattle with and without mastitis, come from four little organic dairy farms in State of São Paulo, Brazil. Were used 148 cattle on the middle period of lactation. From these, two showed clinical mastitis, 72 subclinical mastitis and 74 without signs of mammary inflammation (controls. Staphylococcusaureus (25.7%, Streptococcus spp. (21.4%, Corynebacterium bovis (12.9%, Streptococcus agalactiae (4.3% and Staphylococcus spp. (4.3% were the more-frequent microorganisms isolated from animals with mastitis. Aspergillus spp. was isolated from one animal. Ceftiofur (95.2%, oxacillin (84.2%, gentamicin (76.3% and cefoperazone (70.3% were the more effective drugs. High resistance of isolates were found to penicillin (53.5%, ampicillin (41.6% and neomycin (38.6%. Multiple drug resistance to three or more drugs was observed in 40 (39.6% isolates. Media of somatic cell count encountered in animals with mastitis and controls were 175,742.67cs/mL and 58,227.6 cs/mL, respectively. Antimicrobials residues in milk were detected in four (2.7% animals. The present findings showed the low somatic cell count of animals, indicative of good quality of milk. However, pointed the need of control measures for contagious pathogens of bovine mastitis and more attention for prohibition of antimicrobial use in organic dairy farms.

Tropism and pathogenicity of rickettsiae

Directory of Open Access Journals (Sweden)

Tsuneo eUchiyama

2012-06-01

Full Text Available Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group and typhus group rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism towards cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and nonpathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and nonpathogenic species of spotted fever group rickettsiae in mammalian cells. The growth of nonpathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of nonpathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the nonpathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.

A strain of Serratia marcescens pathogenic for larvae of Lymantria dispar: Characterization

Science.gov (United States)

J.D. Podgwaite; B.J. Cosenza

1976-01-01

A gram-negative bacillus, pathogenic for gypsy moth larvae, was characterized culturally, morphologically, and physiologically as a member of the Serratia group of the family Enterobacteriaceae. The microorganism lacked the pigmentation characteristic of the group but was generally distinguished from closely related members of the family by its...

Commensal–dendritic-cell interaction specifies a unique protective skin immune signature

Science.gov (United States)

Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine

2015-01-01

The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086

Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

NARCIS (Netherlands)

Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

2015-01-01

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

NARCIS (Netherlands)

Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

De novo identification of viral pathogens from cell culture hologenomes

Directory of Open Access Journals (Sweden)

Patowary Ashok

2012-01-01

Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

Temperature-dependent inhibition of opportunistic Vibrio pathogens by native coral commensal bacteria.

Science.gov (United States)

Frydenborg, Beck R; Krediet, Cory J; Teplitski, Max; Ritchie, Kim B

2014-02-01

Bacteria living within the surface mucus layer of corals compete for nutrients and space. A number of stresses affect the outcome of this competition. The interactions between native microorganisms and opportunistic pathogens largely determine the coral holobiont's overall health and fitness. In this study, we tested the hypothesis that commensal bacteria isolated from the mucus layer of a healthy elkhorn coral, Acropora palmata, are capable of inhibition of opportunistic pathogens, Vibrio shiloi AK1 and Vibrio coralliilyticus. These vibrios are known to cause disease in corals and their virulence is temperature dependent. Elevated temperature (30 °C) increased the cell numbers of one commensal and both Vibrio pathogens in monocultures. We further tested the hypothesis that elevated temperature favors pathogenic organisms by simultaneously increasing the fitness of vibrios and decreasing the fitness of commensals by measuring growth of each species within a co-culture over the course of 1 week. In competition experiments between vibrios and commensals, the proportion of Vibrio spp. increased significantly under elevated temperature. We finished by investigating several temperature-dependent mechanisms that could influence co-culture differences via changes in competitive fitness. The ability of Vibrio spp. to utilize glycoproteins found in A. palmata mucus increased or remained stable when exposed to elevated temperature, while commensals' tended to decrease utilization. In both vibrios and commensals, protease activity increased at 30 °C, while chiA expression increased under elevated temperatures for Vibrio spp. These results provide insight into potential mechanisms through which elevated temperature may select for pathogenic bacterial dominance and lead to disease or a decrease in coral fitness.

Removal of triazine herbicides from freshwater systems using photosynthetic microorganisms

International Nuclear Information System (INIS)

Gonzalez-Barreiro, O.; Rioboo, C.; Herrero, C.; Cid, A.

2006-01-01

The uptake of the triazine herbicides, atrazine and terbutryn, was determined for two freshwater photosynthetic microorganisms, the green microalga Chlorella vulgaris and the cyanobacterium Synechococcus elongatus. An extremely rapid uptake of both pesticides was recorded, although uptake rate was lower for the cyanobacterium, mainly for atrazine. Other parameters related to the herbicide bioconcentration capacity of these microorganisms were also studied. Growth rate, biomass, and cell viability in cultures containing herbicide were clearly affected by herbicide uptake. Herbicide toxicity and microalgae sensitivity were used to determine the effectiveness of the bioconcentration process and the stability of herbicide removal. C. vulgaris showed higher bioconcentration capability for these two triazine herbicides than S. elongatus, especially with regard to terbutryn. This study supports the usefulness of such microorganisms, as a bioremediation technique in freshwater systems polluted with triazine herbicides

Removal of triazine herbicides from freshwater systems using photosynthetic microorganisms

Energy Technology Data Exchange (ETDEWEB)

Gonzalez-Barreiro, O. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Rioboo, C. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Herrero, C. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain); Cid, A. [Laboratorio de Microbiologia, Facultad de Ciencias, Universidad de A Coruna, Campus da Zapateira s/n. 15071 A Coruna (Spain)]. E-mail: cid@udc.es

2006-11-15

The uptake of the triazine herbicides, atrazine and terbutryn, was determined for two freshwater photosynthetic microorganisms, the green microalga Chlorella vulgaris and the cyanobacterium Synechococcus elongatus. An extremely rapid uptake of both pesticides was recorded, although uptake rate was lower for the cyanobacterium, mainly for atrazine. Other parameters related to the herbicide bioconcentration capacity of these microorganisms were also studied. Growth rate, biomass, and cell viability in cultures containing herbicide were clearly affected by herbicide uptake. Herbicide toxicity and microalgae sensitivity were used to determine the effectiveness of the bioconcentration process and the stability of herbicide removal. C. vulgaris showed higher bioconcentration capability for these two triazine herbicides than S. elongatus, especially with regard to terbutryn. This study supports the usefulness of such microorganisms, as a bioremediation technique in freshwater systems polluted with triazine herbicides.

Interaction of legionella pneumophila and helicobacter pylori with bacterial species isolated from drinking water biofilms

Directory of Open Access Journals (Sweden)

Azevedo Nuno F

2011-03-01

Full Text Available Abstract Background It is well established that Legionella pneumophila is a waterborne pathogen; by contrast, the mode of Helicobacter pylori transmission remains unknown but water seems to play an important role. This work aims to study the influence of five microorganisms isolated from drinking water biofilms on the survival and integration of both of these pathogens into biofilms. Results Firstly, both pathogens were studied for auto- and co-aggregation with the species isolated from drinking water; subsequently the formation of mono and dual-species biofilms by L. pneumophila or H. pylori with the same microorganisms was investigated. Neither auto- nor co-aggregation was observed between the microorganisms tested. For biofilm studies, sessile cells were quantified in terms of total cells by SYTO 9 staining, viable L. pneumophila or H. pylori cells were quantified using 16 S rRNA-specific peptide nucleic acid (PNA probes and cultivable cells by standard culture techniques. Acidovorax sp. and Sphingomonas sp. appeared to have an antagonistic effect on L. pneumophila cultivability but not on the viability (as assessed by rRNA content using the PNA probe, possibly leading to the formation of viable but noncultivable (VBNC cells, whereas Mycobacterium chelonae increased the cultivability of this pathogen. The results obtained for H. pylori showed that M. chelonae and Sphingomonas sp. help this pathogen to maintain cultivability for at least 24 hours. Conclusions It appears that M. chelonae may have an important role in the survival of both pathogens in drinking water. This work also suggests that the presence of some microorganisms can decrease the cultivability of L. pneumophila but not the viability which indicates that the presence of autochthonous microorganisms can lead to misleading results when the safety of water is assessed by cultivable methods alone.

Nanoparticles: Alternatives Against Drug-Resistant Pathogenic Microbes

Directory of Open Access Journals (Sweden)

Gudepalya Renukaiah Rudramurthy

2016-06-01

Full Text Available Antimicrobial substances may be synthetic, semisynthetic, or of natural origin (i.e., from plants and animals. Antimicrobials are considered “miracle drugs” and can determine if an infected patient/animal recovers or dies. However, the misuse of antimicrobials has led to the development of multi-drug-resistant bacteria, which is one of the greatest challenges for healthcare practitioners and is a significant global threat. The major concern with the development of antimicrobial resistance is the spread of resistant organisms. The replacement of conventional antimicrobials by new technology to counteract antimicrobial resistance is ongoing. Nanotechnology-driven innovations provide hope for patients and practitioners in overcoming the problem of drug resistance. Nanomaterials have tremendous potential in both the medical and veterinary fields. Several nanostructures comprising metallic particles have been developed to counteract microbial pathogens. The effectiveness of nanoparticles (NPs depends on the interaction between the microorganism and the NPs. The development of effective nanomaterials requires in-depth knowledge of the physicochemical properties of NPs and the biological aspects of microorganisms. However, the risks associated with using NPs in healthcare need to be addressed. The present review highlights the antimicrobial effects of various nanomaterials and their potential advantages, drawbacks, or side effects. In addition, this comprehensive information may be useful in the discovery of broad-spectrum antimicrobial drugs for use against multi-drug-resistant microbial pathogens in the near future.

Pathogen inactivation of Dengue virus in red blood cells using amustaline and glutathione.

Science.gov (United States)

Aubry, Maite; Laughhunn, Andrew; Santa Maria, Felicia; Lanteri, Marion C; Stassinopoulos, Adonis; Musso, Didier

2017-12-01

Dengue virus (DENV) is an arbovirus primarily transmitted through mosquito bite; however, DENV transfusion-transmitted infections (TTIs) have been reported and asymptomatic DENV RNA-positive blood donors have been identified in endemic countries. DENV is considered a high-risk pathogen for blood safety. One of the mitigation strategies to prevent arbovirus TTIs is pathogen inactivation. In this study we demonstrate that the amustaline and glutathione (S-303/GSH) treatment previously found effective against Zika virus in red blood cells (RBCs) is also effective in inactivating DENV. Red blood cells were spiked with high levels of DENV. Viral RNA loads and infectious titers were measured in the untreated control and before and after pathogen inactivation treatment of RBC samples. DENV infectivity was also assessed over five successive cell culture passages to detect any potential residual replicative virus. The mean ± SD DENV titer in RBCs before inactivation was 6.61 ± 0.19 log 50% tissue culture infectious dose (TCID 50 )/mL and the mean viral RNA load was 8.42 log genome equivalents/mL. No replicative DENV was detected either immediately after completion of treatment using S-303/GSH or after cell culture passages. Treatment using S-303/GSH inactivated high levels of DENV in RBCs to the limit of detection. In combination with previous studies showing the effective inactivation of DENV in plasma and platelets using the licensed amotosalen/UVA system, this study demonstrates that high levels of DENV can be inactivated in all blood components. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

Inhibition of in vitro growth of soil-borne pathogens by compost-inhabiting indigenous bacteria and fungi

International Nuclear Information System (INIS)

Ramzan, N.; Noreen, N.; Shahzad, S.

2014-01-01

During the present studies, compost-inhabiting microorganisms including 44 fungi and 15 bacteria isolated from different compost samples were evaluated for their in vitro efficacy against soil-borne pathogens viz., Fusarium solani, Macrophomina phaseolina, Pythium aphanidermatum, Rhizoctonia solani, and Sclerotium rolfsii. Compost inhabiting microbes like Trichoderma harzianum, T. virens, Bacillus cereus, B. pumilus, B. subtilis, Micrococcus varians and Pseudomonas fluorescens were found to inhibit all the test pathogens. Acrophialophora fusispora and Penicillium citrinum reduced the mycelial growth of all the test pathogens except Sclerotium rolfsii. Bacillus licheniformis and Bacillus megaterium showed biocontrol activity against all the pathogens except Rhizoctonia solani. Trichoderma harzianum parasitized mycelia of all the tested pathogens and produced coiling around the mycelium. (author)

Efficacy of Sakacin on Selected Food Pathogenic Microorganisms ...

African Journals Online (AJOL)

USER

technique and was characterized based on it colony, cell morphology and some ... De Man Rogosa Sharpe (MRS) broth for bacteriocin (sakacin) production. ... tremendous attention as potential bio preservatives in the food and dairy industries. .... positive result,-: Negative result, A : Acid production ,G :Gas production,.

Microgravity as a biological tool to examine host-pathogen interactions and to guide development of therapeutics and preventatives that target pathogenic bacteria.

Science.gov (United States)

Higginson, Ellen E; Galen, James E; Levine, Myron M; Tennant, Sharon M

2016-11-01

Space exploration programs have long been interested in the effects of spaceflight on biology. This research is important not only in its relevance to future deep space exploration, but also because it has allowed investigators to ask questions about how gravity impacts cell behavior here on Earth. In the 1980s, scientists designed and built the first rotating wall vessel, capable of mimicking the low shear environment found in space. This vessel has since been used to investigate growth of both microorganisms and human tissue cells in low shear modeled microgravity conditions. Bacterial behavior has been shown to be altered both in space and under simulated microgravity conditions. In some cases, bacteria appear attenuated, whereas in others virulence is enhanced. This has consequences not only for manned spaceflight, but poses larger questions about the ability of bacteria to sense the world around them. By using the microgravity environment as a tool, we can exploit this phenomenon in the search for new therapeutics and preventatives against pathogenic bacteria for use both in space and on Earth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

NARCIS (Netherlands)

Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

2003-01-01

Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

Insight of Genus Corynebacterium: Ascertaining the Role of Pathogenic and Non-pathogenic Species.

Science.gov (United States)

Oliveira, Alberto; Oliveira, Leticia C; Aburjaile, Flavia; Benevides, Leandro; Tiwari, Sandeep; Jamal, Syed B; Silva, Arthur; Figueiredo, Henrique C P; Ghosh, Preetam; Portela, Ricardo W; De Carvalho Azevedo, Vasco A; Wattam, Alice R

2017-01-01

This review gathers recent information about genomic and transcriptomic studies in the Corynebacterium genus, exploring, for example, prediction of pathogenicity islands and stress response in different pathogenic and non-pathogenic species. In addition, is described several phylogeny studies to Corynebacterium , exploring since the identification of species until biological speciation in one species belonging to the genus Corynebacterium . Important concepts associated with virulence highlighting the role of Pld protein and Tox gene. The adhesion, characteristic of virulence factor, was described using the sortase mechanism that is associated to anchorage to the cell wall. In addition, survival inside the host cell and some diseases, were too addressed for pathogenic corynebacteria, while important biochemical pathways and biotechnological applications retain the focus of this review for non-pathogenic corynebacteria. Concluding, this review broadly explores characteristics in genus Corynebacterium showing to have strong relevance inside the medical, veterinary, and biotechnology field.

Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

Science.gov (United States)

Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

2014-01-01

Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed. PMID:25332721

Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

Directory of Open Access Journals (Sweden)

Kamal Rai Aneja

2014-01-01

Full Text Available Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

Emerging preservation techniques for controlling spoilage and pathogenic microorganisms in fruit juices.

Science.gov (United States)

Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

2014-01-01

Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

Including pathogen risk in life cycle assessment of wastewater management. 2. Quantitative comparison of pathogen risk to other impacts on human health.

Science.gov (United States)

Heimersson, Sara; Harder, Robin; Peters, Gregory M; Svanström, Magdalena

2014-08-19

Resource recovery from sewage sludge has the potential to save natural resources, but the potential risks connected to human exposure to heavy metals, organic micropollutants, and pathogenic microorganisms attract stakeholder concern. The purpose of the presented study was to include pathogen risks to human health in life cycle assessment (LCA) of wastewater and sludge management systems, as this is commonly omitted from LCAs due to methodological limitations. Part 1 of this article series estimated the overall pathogen risk for such a system with agricultural use of the sludge, in a way that enables the results to be integrated in LCA. This article (part 2) presents a full LCA for two model systems (with agricultural utilization or incineration of sludge) to reveal the relative importance of pathogen risk in relation to other potential impacts on human health. The study showed that, for both model systems, pathogen risk can constitute an important part (in this study up to 20%) of the total life cycle impacts on human health (expressed in disability adjusted life years) which include other important impacts such as human toxicity potential, global warming potential, and photochemical oxidant formation potential.

The survival of pathogens in soil treated with wastewater sludge and in potatoes grown in such soil.

Science.gov (United States)

Chale-Matsau, J R B; Snyman, H G

2006-01-01

The prevalence of pathogens on potatoes (Solanum tuberosum) grown in soil amended with a pathogen rich wastewater sludge was investigated. Bacteria of the family Enterobacteriaceae are important pathogens causing intestinal and systemic illness of humans and other animals. Type B sludge was used. Sludges investigated are the high metal and the low metal sludges. Microorganisms in the sludge-amended soil were using culture-based technique. Salmonella and E. coli were observed in tested soil samples. No microorganisms were isolated from control samples taken throughout the process of the experiment. At harvest time, some of the potato samples from LMS soil were contaminated. These potatoes were subjected to further investigation using molecular techniques (polymerase chain reaction) with fD1 and rP2 as primers. Organisms identified from the sequenced potato peel samples with the BLAST search tool included Enterobacter agglomerans (Pantoea agglomerans), several Buttiauxella spp., Pectobacterium spp., Erwinia spp. and a few Pantoea spp. Other than the E. agglomerans, which is commonly found in the gut and upper respiratory tract of humans and in the environment, all the other species identified were found to be mainly either plant or soil pathogens. The E. agglomerans are not primary pathogens but secondary opportunistic pathogens particularly in immunocompromised individuals. These results suggest that growing high risk crops using wastewater sludge contaminated soil may lead to limited infestation of produce with primary pathogens. It appears that the use of HMS due to early pathogen die-off provides less risk of infection than the LMS. However, proper treatment of wastewater sludge to reduce pathogen load is essential prior to its use as soil conditioner.

Antimicrobial activity of the essential oil from Lippia sidoides, carvacrol and thymol against oral pathogens

OpenAIRE

M.A. Botelho; N.A.P. Nogueira; G.M. Bastos; S.G.C. Fonseca; T.L.G. Lemos; F.J.A. Matos; D. Montenegro; J. Heukelbach; V.S. Rao; G.A.C. Brito

2007-01-01

Dental caries and periodontal disease are associated with oral pathogens. Several plant derivatives have been evaluated with respect to their antimicrobial effects against such pathogenic microorganisms. Lippia sidoides Cham (Verbenaceae), popularly known as "Alecrim-pimenta" is a typical shrub commonly found in the Northeast of Brazil. Many plant species belonging to the genus Lippia yield very fragrant essential oils of potential economic value which are used by the industry for the commerc...

A Multi-Omic View of Host-Pathogen-Commensal Interplay in Salmonella-Mediated Intestinal Infection

Energy Technology Data Exchange (ETDEWEB)

Kaiser, Brooke LD; Li, Jie; Sanford, James A.; Kim, Young-Mo; Kronewitter, Scott R.; Jones, Marcus B.; Peterson, Christine; Peterson, Scott N.; Frank, Bryan C.; Purvine, Samuel O.; Brown, Joseph N.; Metz, Thomas O.; Smith, Richard D.; Heffron, Fred; Adkins, Joshua N.

2013-06-26

The potential for commensal microorganisms indigenous to a host (the ‘microbiome’ or ‘microbiota’) to alter infection outcome by influencing host-pathogen interplay is largely unknown. We used a multi-omics “systems” approach, incorporating proteomics, metabolomics, glycomics, and metagenomics, to explore the molecular interplay between the murine host, the pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium), and commensal gut microorganisms during intestinal infection with S. Typhimurium. We find proteomic evidence that S. Typhimurium thrives within the infected 129/SvJ mouse gut without antibiotic pre-treatment, inducing inflammation and disrupting the intestinal microbiome (e.g., suppressing Bacteroidetes and Firmicutes while promoting growth of Salmonella and Enterococcus). Alteration of the host microbiome population structure was highly correlated with gut environmental changes, including the accumulation of metabolites normally consumed by commensal microbiota. Finally, the less characterized phase of S. Typhimurium’s lifecycle was investigated, and both proteomic and glycomic evidence suggests S. Typhimurium may take advantage of increased fucose moieties to metabolize fucose while growing in the gut. The application of multiple omics measurements to Salmonella-induced intestinal inflammation provides insights into complex molecular strategies employed during pathogenesis between host, pathogen, and the microbiome.

Preparation of microorganism free carrier for biofertilizer product

International Nuclear Information System (INIS)

Latiffah Norddin; Maizatul Akmam Mhd Nasir; Phua Choo Kwai Hoe

2007-01-01

Biofertilizer has been identified as an alternative or complementary to chemical fertilizer to increase soil fertility and crop production in sustainable farming. Biofertilizers are products containing living cells of different types of known microorganisms that may increase crop productivity through N2 fixation, phosphate solubilization or stimulation of plant growth by synthesising phytohormones. A good biofertilizer product needs a good carrier or substrate. A good carrier is free from microbial contamination and can optimise the growth of the biofertilizer microorganisms. Compost is commonly used as carrier or substrate for biofertilizer microorganisms. In the present study, compost produced by Nuclear Malaysia using the Natural Farming was used as a carrier for the biofertilizer products. Gamma irradiation has been used to produce a ?clean? or sterile carrier. The sterilization effect of the carrier was checked by using serial dilution technique. Carriers that were irradiated at 50 kGy of gamma irradiation were found to be sterile. The shelf life of the sterile carriers was also determined. After six months the compost carriers were still free from microbial contamination. (Author)

Selection of potential microorganism for sago starch fermentation

Directory of Open Access Journals (Sweden)

RUTH MELLIAWATI

2006-02-01

Full Text Available Fermentation process of sago starch for the production of bioproduct requires potential microorganism that have ability to hydrolyze sago starch. The purpose of this research was to get the potential of amylolytic microorganisms for their capability of amyloglucosidase activity and to know the sugar strains of the fermentation result. Eleven amylolytic microorganisms (9 strains of mold and 2 strains of yeast were obtained from the collection Research Centre for Biotechnology – Indonesian Institute of Sciences (LIPI, Cibinong-Bogor were used. The selection step was carried out based on their capability of starch hydrolysis to reducing sugar. The best result indicates that the production of reducing sugar reached the highest 18.485 ppm and amyloglucosidase activities was 3.583 units by KTU-1 strain. The highest total acid obtained was 5.85 mg/mL by Rhizopus IFO.R5442. The cell biomass was obtained between 0.5 to 1.74 g dry weight/100 mL and pH of the final fermentation (72 h were 3.57 to 8.38.

Serine/Threonine Protein Phosphatase PstP of Mycobacterium tuberculosis Is Necessary for Accurate Cell Division and Survival of Pathogen*

Science.gov (United States)

Sharma, Aditya K.; Arora, Divya; Singh, Lalit K.; Gangwal, Aakriti; Sajid, Andaleeb; Molle, Virginie; Singh, Yogendra; Nandicoori, Vinay Kumar

2016-01-01

Protein phosphatases play vital roles in phosphorylation-mediated cellular signaling. Although there are 11 serine/threonine protein kinases in Mycobacterium tuberculosis, only one serine/threonine phosphatase, PstP, has been identified. Although PstP has been biochemically characterized and multiple in vitro substrates have been identified, its physiological role has not yet been elucidated. In this study, we have investigated the impact of PstP on cell growth and survival of the pathogen in the host. Overexpression of PstP led to elongated cells and partially compromised survival. We find that depletion of PstP is detrimental to cell survival, eventually leading to cell death. PstP depletion results in elongated multiseptate cells, suggesting a role for PstP in regulating cell division events. Complementation experiments performed with PstP deletion mutants revealed marginally compromised survival, suggesting that all of the domains, including the extracellular domain, are necessary for complete rescue. On the other hand, the catalytic activity of PstP is absolutely essential for the in vitro growth. Mice infection experiments establish a definitive role for PstP in pathogen survival within the host. Depletion of PstP from established infections causes pathogen clearance, indicating that the continued presence of PstP is necessary for pathogen survival. Taken together, our data suggest an important role for PstP in establishing and maintaining infection, possibly via the modulation of cell division events. PMID:27758870

A Comprehensive Characterization of Microorganisms and Allergens in Spacecraft Environment

Science.gov (United States)

Castro, V.A.; Ott, C.M.; Garcia, V.M.; John, J.; Buttner, M.P.; Cruz, P.; Pierson, D.L.

2009-01-01

The determination of risk from infectious disease during long-duration missions is composed of several factors including the concentration and the characteristics of the infectious agent. Thus, a thorough knowledge of the microorganisms aboard spacecraft is essential in mitigating infectious disease risk to the crew. While stringent steps are taken to minimize the transfer of potential pathogens to spacecraft, several medically significant organisms have been isolated from both the Mir and International Space Station (ISS). Historically, the method for isolation and identification of microorganisms from spacecraft environmental samples depended upon their growth on culture media. Unfortunately, only a fraction of the organisms may grow on a culture medium, potentially omitting those microorganisms whose nutritional and physical requirements for growth are not met. Thus, several pathogens may not have been detected, such as Legionella pneumophila, the etiological agent of Legionnaire s disease. We hypothesize that environmental analysis using non-culture-based technologies will reveal microorganisms, allergens, and microbial toxins not previously reported in spacecraft, allowing for a more complete health assessment. The development of techniques for this flight experiment, operationally named SWAB, has already provided advances in NASA laboratory processes and beneficial information toward human health risk assessment. The translation of 16S ribosomal DNA sequencing for the identification of bacteria from the SWAB experiment to nominal operations has increased bacterial speciation of environmental isolates from previous flights three fold compared to previous conventional methodology. The incorporation of molecular-based DNA fingerprinting using repetitive sequence-based polymerase chain reaction (rep-PCR) into the capabilities of the laboratory has provided a methodology to track microorganisms between crewmembers and their environment. Both 16S ribosomal DNA

Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

Science.gov (United States)

Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

2012-07-01

Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

Effects of Atrazine on Soil Microorganisms

Directory of Open Access Journals (Sweden)

Ljiljana Radivojević

2006-01-01

Full Text Available Effects of the herbicide atrazine on soil microorganisms was investigated. Trials were set up in laboratory, on a clay loam soil. Atrazine was applied at 8.0, 40.0 and 80.0 mg/kg soil rates. The abundance of total microorganisms, fungi, actinomycetes, cellulolytic microorganisms and amino-heterotrophs was recorded. Soil samples were collected 1, 7, 14, 21, 30 and 60 days after atrazine treatment for microbiological analyses.The results showed that the intensity of atrazine effect on soil microorganisms depended on treatment rate, exposure time and group of microorganisms. Atrazine had an inhibiting effect on cellulolytic microorganisms and amino-heterotrophs. Initially, it inhibited fungiand actinomycetes but its effect turned into a stimulating one once a population recovered. Atrazine had a stimulating effect on total abundance of microorganisms.

Is arsenic biotransformation a detoxification mechanism for microorganisms?

Energy Technology Data Exchange (ETDEWEB)

Rahman, M. Azizur, E-mail: Mohammad.Rahman@uts.edu.au [Centre for Environmental Sustainability, School of the Environment, Faculty of Science, University of Technology, P.O. Box 123, Broadway, Sydney, NSW 2007 (Australia); Hassler, Christel [Marine and Lake Biogeochemistry, Institute F. A. Forel, University of Geneva, 10 rte de Suisse, Versoix, 1290 Switzerland (Switzerland)

2014-01-15

Arsenic (As) is extremely toxic to living organisms at high concentration. In aquatic systems, As exists in different chemical forms. The two major inorganic As (iAs) species are As{sup V}, which is thermodynamically stable in oxic waters, and As{sup III}, which is predominant in anoxic conditions. Photosynthetic microorganisms (e.g., phytoplankton and cyanobacteria) take up As{sup V}, biotransform it to As{sup III}, then biomethylate it to methylarsenic (MetAs) forms. Although As{sup III} is more toxic than As{sup V}, As{sup III} is much more easily excreted from the cells than As{sup V}. Therefore, majority of researchers consider the reduction of As{sup V} to As{sup III} as a detoxification process. The biomethylation process results in the conversion of toxic iAs to the less toxic pentavalent MetAs forms (monomethylarsonate; MMA{sup V}, dimethylarsonate; DMA{sup V}, and trimethylarsenic oxide; TMAO{sup V}) and trimethylarsine (TMAO{sup III}). However, biomethylation by microorganisms also produces monomethylarsenite (MMA{sup III}) and dimethylarsenite (DMA{sup III}), which are more toxic than iAs, as a result of biomethylation by the microorganisms, demonstrates the need to reconsider to what extent As biomethylation contributes to a detoxification process. In this review, we focused on the discussion of whether the biotransformation of As species in microorganisms is really a detoxification process with recent data.

Non- chemical methods of seed treatment for control of seed- borne pathogens on vegetables

NARCIS (Netherlands)

Amein, T.; Wright, S.A.I.; Wickstrom, M.; Schmitt, A.; Koch, E.; Wolf, van der J.M.; Groot, S.P.C.; Werner, S.; Jahn, M.

2006-01-01

The aim of EU-project "Seed Treatments for Organic Vegetable Production" (STOVE) was to evaluate non-chemical methods for control of seed-borne pathogens in organic vegetable production. Physical (hot air, hot water and electron) and biologi-cal (microorganisms and different agents of natural

Genomic and evolutionary comparisons of diazotrophic and pathogenic bacteria of the order Rhizobiales

Directory of Open Access Journals (Sweden)

Vasconcelos Ana

2010-02-01

Full Text Available Abstract Background Species belonging to the Rhizobiales are intriguing and extensively researched for including both bacteria with the ability to fix nitrogen when in symbiosis with leguminous plants and pathogenic bacteria to animals and plants. Similarities between the strategies adopted by pathogenic and symbiotic Rhizobiales have been described, as well as high variability related to events of horizontal gene transfer. Although it is well known that chromosomal rearrangements, mutations and horizontal gene transfer influence the dynamics of bacterial genomes, in Rhizobiales, the scenario that determine pathogenic or symbiotic lifestyle are not clear and there are very few studies of comparative genomic between these classes of prokaryotic microorganisms trying to delineate the evolutionary characterization of symbiosis and pathogenesis. Results Non-symbiotic nitrogen-fixing bacteria and bacteria involved in bioremediation closer to symbionts and pathogens in study may assist in the origin and ancestry genes and the gene flow occurring in Rhizobiales. The genomic comparisons of 19 species of Rhizobiales, including nitrogen-fixing, bioremediators and pathogens resulted in 33 common clusters to biological nitrogen fixation and pathogenesis, 15 clusters exclusive to all nitrogen-fixing bacteria and bacteria involved in bioremediation, 13 clusters found in only some nitrogen-fixing and bioremediation bacteria, 01 cluster exclusive to some symbionts, and 01 cluster found only in some pathogens analyzed. In BBH performed to all strains studied, 77 common genes were obtained, 17 of which were related to biological nitrogen fixation and pathogenesis. Phylogenetic reconstructions for Fix, Nif, Nod, Vir, and Trb showed possible horizontal gene transfer events, grouping species of different phenotypes. Conclusions The presence of symbiotic and virulence genes in both pathogens and symbionts does not seem to be the only determinant factor for lifestyle

Genomic and evolutionary comparisons of diazotrophic and pathogenic bacteria of the order Rhizobiales.

Science.gov (United States)

Carvalho, Fabíola M; Souza, Rangel C; Barcellos, Fernando G; Hungria, Mariangela; Vasconcelos, Ana Tereza R

2010-02-08

Species belonging to the Rhizobiales are intriguing and extensively researched for including both bacteria with the ability to fix nitrogen when in symbiosis with leguminous plants and pathogenic bacteria to animals and plants. Similarities between the strategies adopted by pathogenic and symbiotic Rhizobiales have been described, as well as high variability related to events of horizontal gene transfer. Although it is well known that chromosomal rearrangements, mutations and horizontal gene transfer influence the dynamics of bacterial genomes, in Rhizobiales, the scenario that determine pathogenic or symbiotic lifestyle are not clear and there are very few studies of comparative genomic between these classes of prokaryotic microorganisms trying to delineate the evolutionary characterization of symbiosis and pathogenesis. Non-symbiotic nitrogen-fixing bacteria and bacteria involved in bioremediation closer to symbionts and pathogens in study may assist in the origin and ancestry genes and the gene flow occurring in Rhizobiales. The genomic comparisons of 19 species of Rhizobiales, including nitrogen-fixing, bioremediators and pathogens resulted in 33 common clusters to biological nitrogen fixation and pathogenesis, 15 clusters exclusive to all nitrogen-fixing bacteria and bacteria involved in bioremediation, 13 clusters found in only some nitrogen-fixing and bioremediation bacteria, 01 cluster exclusive to some symbionts, and 01 cluster found only in some pathogens analyzed. In BBH performed to all strains studied, 77 common genes were obtained, 17 of which were related to biological nitrogen fixation and pathogenesis. Phylogenetic reconstructions for Fix, Nif, Nod, Vir, and Trb showed possible horizontal gene transfer events, grouping species of different phenotypes. The presence of symbiotic and virulence genes in both pathogens and symbionts does not seem to be the only determinant factor for lifestyle evolution in these microorganisms, although they may act in

How cells jump: Ultrafast motions in the single-celled micro-organism Halteria grandinella

Science.gov (United States)

Krishnamurthy, Deepak; Cockenpot, Fabien; Prakash, Manu

Here we describe a novel behavior of ''jumping'' in micro-organisms, observed in the common freshwater ciliate Halteria grandinella. This organism's swimming motion is characterized by periods of forward swimming at around 10 body lengths/s punctuated by extremely rapid backward ''jumps'' where the organism reaches speeds of more than 150 body lengths/s. We show, using detailed measurements of the swimming motion through high-speed video microscopy, that the extreme swimming speeds are achieved by the motile cilia transitioning to a beating mode characterized by a significantly larger beat amplitude and an associated reversal in the direction of thrust production. We further show that H.grandinella cells can sense a fluid shear stress signal and ''jump'' in response: a possible predator avoidance mechanism. We investigate this mechanism of shear sensing and study the role of the long, slender structures known as ''cirri'' as microscale sensors of shear stress. The jumping of H.grandinella is at the limits of the metabolic rate of the organism and thus offers insights into the limiting factors governing energy storage and mechanical power release at the microscale. Concurrently their sensing apparatus allows an understanding of the physical limits of microscale mechanical sensing. This material is based on work supported by, or in part by, the US Army Research Laboratory and the US Army Research Office under contract/Grant Number W911NF-15-1-0358.

Preclinical and clinical studies of photodynamic action on some pathogenic micro-organisms of the oral cavity

Science.gov (United States)

Ovchinnikov, Ilya S.; Tuchin, Valery V.; Ivanov, Krill I.; Titorenko, Vladimir A.

2001-10-01

The work is devoted to an analysis of pre-clinical and clinical experiments on photodynamic action of HeNe laser radiation in aggregate with a cation thiazinium dye Methylene Blue (MB) on a mix of pathogenic and conditionally pathogenic aerobic bacteria being activators of pyoinflammatory diseases of oral cavity. Concentration of photosensitizes at which there is no own bactericidal influence on dying microflora, and parameters of influence at which the efficiency of irradiated microflora defeat reaches 99% are determined.

The Effects of Allium sativum Extracts on Biofilm Formation and Activities of Six Pathogenic Bacteria.

Science.gov (United States)

Mohsenipour, Zeinab; Hassanshahian, Mehdi

2015-08-01

Garlic is considered a rich source of many compounds, which shows antimicrobial effects. The ability of microorganisms to adhere to both biotic and abiotic surfaces and to form biofilm is responsible for a number of diseases of chronic nature, demonstrating extremely high resistance to antibiotics. Bacterial biofilms are complex communities of sessile microorganisms, embedded in an extracellular matrix and irreversibly attached to various surfaces. The present study evaluated the antimicrobial activity of Allium sativum extract against the biofilms of six pathogenic bacteria and their free-living forms. The clinical isolates in this study had not been studied in any other studies, especially in regard to biofilm disruption and inhibition of biofilm cell metabolic activity. Antimicrobial activities of A. sativum L. extracts (methanol and ethanol extracts) against planktonic forms of bacteria were determined using the disc diffusion method. The minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) values were evaluated by a macrobroth dilution technique. The anti-biofilm effects were assessed by microtiter plate method. The results showed that the A. sativum L. extract discs did not have any zone of inhibition for the tested bacteria. However, The MIC values of A. sativum L. extracts (0.078 - 2.5 mg/mL) confirmed the high ability of these extracts for inhibition of planktonic bacteria. A. sativum L. extracts were efficient to inhibit biofilm structures and the concentration of each extract had a direct relation with the inhibitory effect. Finally, it can be suggested that the extracts of this plant be applied as antimicrobial agents against these pathogens, particularly in biofilm forms.

Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

Science.gov (United States)

David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

2015-01-01

Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widely recognized as an important player in innate immunity and the early response to infections. Here we review the complex relationship between Burkholderia species and epithelial cells with an emphasis on the most pathogenic species, Burkholderia pseudomallei and Burkholderia mallei. The current gaps in knowledge in our understanding are highlighted along with the epithelial host-pathogen interactions that offer potential opportunities for therapeutic intervention. PMID:26636042

Physical Interactions between Yeast Pichia guilliermondii and Post-Harvest Fruit Pathogen Penicillium expansum

Directory of Open Access Journals (Sweden)

SRI WIDYASTUTI

2008-03-01

Full Text Available Attachment of yeast cells or bacteria on fungal hyphae have been observed in various antagonisms between microorganisms. Physical interactions between yeast Pichia guilliermondii and postharvest fruit pathogen Penicillium expansum in culture were studied in detail using light and transmission electron microscope to give better understanding on their mode of antagonism. Both organisms were co-cultured for 24-hr on potato dextrose agar. Light microscopy observations on the co-culture showed that the yeast cells attached firmly on the fungal hyphae. This attachment was inhibited by several substances such as enzymes degrading protein (protease or trypsin, a respiration inhibitor (sodium azide, an acid (hydrochloric acid or an alkali (sodium hydroxide. Although autoclaved hyphae did not affect the attachment, but boiled enzymes and autoclaved yeast cells totally abolished the attachment. These evidences suggested that the attachment might be an active process mediated by certain protein from live yeast cells. Transmission electron micrographs on the ultrastructure of the co-culture revealed that the hyphae showed abnormalities in their structure and organelles, and a degree of obvious damage. Physical interactions observed in this study could be contributed to the mechanism of antagonism between P. guilliermondii and P. expansum.

A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

Science.gov (United States)

Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

2015-04-24

Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to fructo-oligosaccharides (FOS) and decreasing potentially pathogenic gastro-intestinal microorganisms (ID 781), pursuant to Article 13(1) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

claims in relation to fructo-oligosaccharides and decreasing potentially pathogenic gastro-intestinal microorganisms. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims and references that EFSA has received from......Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a list of health claims pursuant to Article 13 of Regulation (EC) No 1924/2006. This opinion addresses the scientific substantiation of health...... conclusions could be drawn for the scientific substantiation of the claim were provided. On the basis of the data presented, the Panel concludes that a cause and effect relationship has not been established between the consumption of fructo-oligosaccharides and decreasing potentially pathogenic gastro...

Presence of pathogenic microorganisms in power-plant cooling waters. Report for October 1, 1979-September 30, 1981

Energy Technology Data Exchange (ETDEWEB)

Tyndall, R.L.

1982-10-01

Cooling waters from eleven geographically disparate power plants were tested for the presence of Naegleria fowleri and Legionella pneumophila (LDB). Control source waters for each plant were also tested for these pathogens. Water from two of the eleven plants contained pathogenic Naegleria, and infectious Legionella were found in seven of the test sites. Pathogenic Naegleria were not found in control waters, but infectious Legionella were found in five of the eleven control source water sites. Concentrations of nitrite, sulfate, and total organic carbon correlated with the concentrations of LDB. A new species of Legionella was isolated from one of the test sites. In laboratory tests, both Acanthamoeba and Naegleria were capable of supporting the growth of Legionella pneumophila.

Chemosensing in microorganisms to practical biosensors

OpenAIRE

Ghosh, Surya K.; Kundu, Tapanendu; Sain, Anirban

2012-01-01

Microorganisms like bacteria can sense concentration of chemo-attractants in its medium very accurately. They achieve this through interaction between the receptors on their cell surface and the chemo-attractant molecules (like sugar). But the physical processes like diffusion set some limits on the accuracy of detection which was discussed by Berg and Purcell in the late seventies. We have a re-look at their work in order to assess what insight it may offer towards making efficient, practica...

Mechanisms of hexavalent chromium resistance and removal by microorganisms.

Science.gov (United States)

Joutey, Nezha Tahri; Sayel, Hanane; Bahafid, Wifak; El Ghachtouli, Naïma

2015-01-01

Chromium has been and is extensively used worldwide in multiple industrial processes and is routinely discharged to the environment from such processes. Therefore, this heavy metal is a potential threat to the environment and to public health, primarily because it is non-biodegradable and environmentally persistent. Chromium exists in several oxidation states, the most stable of which are trivalent Cr(Ill) and hexavalent Cr(VI) species. Each species possesses its own individual chemical characteristics and produces its own biological effects. For example, Cr (Ill) is an essential oligoelement for humans, whereas Cr(VI) is carcinogenic and mutagenic. Several chemical methods are used to remove Cr(VI) from contaminated sites. Each of these methods has advantages and disadvantages. Currently, bioremediation is often the preferred method to deal with Cr contaminated sites, because it is eco-friendly, cost-effective and is a "natural" technology. Many yeast, bacterial and fungal species have been assessed for their suitability to reduce or remove Cr(VI) contamination. The mechanisms by which these microorganisms resist and reduce Cr(VI) are variable and are species dependent. There are several Cr-resistance mechanisms that are displayed by microorganisms. These include active efflux of Cr compounds, metabolic reduction of Cr(VI) to Cr (ill), and either intercellular or extracellular prec1p1tation. Microbial Cr (VI) removal typically involves three stages: binding of chromium to the cell surface, translocation of chromium into the cell, and reduction of Cr(VI) to Cr (ill). Cr(VI) reduction by microorganisms may proceed on the cell surface, outside the cell, or intracellularly, either directly via chromate reductase enzymes, or indirectly via metabolite reduction of Cr(VI). The uptake of chromium ions is a biphasic process. The primary step is known as biosorption, a metabolic energyindependent process. Thereafter, bioaccumulation occurs, but is much slower, and is

Microstructure of Cell Wall-Associated Melanin in the Human Pathogenic Fungus cryptococcus neoformans

OpenAIRE

Eisenman, H.C.; Nosanchuk, J.D.; Webber, J. Beau W.; Emerson, T.A.; Casadevall, A.

2005-01-01

Melanin is a virulence factor for many pathogenic fungal species,including Cryptococcus neoformans. Melanin is deposited in the cell wall, and melanin isolated from this fungus retains the shape of the cells, resulting in hollow spheres called ``ghosts''. In this study, atomic force, scanning electron, and transmission electron microscopy revealed that melanin ghosts are covered with roughly spherical granular particles approximately 40-130 nm in diameter, and that the melanin is arranged in ...

Microorganisms in food technology

Energy Technology Data Exchange (ETDEWEB)

Rose, A H

1981-11-01

Man has been using microorganisms for thousands of years to make bread, cheese, beer, wine, etc. Today, microorganisms can be specially grown or genetically manipulated so as to synthesize high-quality proteins even from low-grade basic materials.

Fossil Microorganisms in Archaean

Science.gov (United States)

Astafleva, Marina; Hoover, Richard; Rozanov, Alexei; Vrevskiy, A.

2006-01-01

Ancient Archean and Proterozoic rocks are the model objects for investigation of rocks comprising astromaterials. The first of Archean fossil microorganisms from Baltic shield have been reported at the last SPIE Conference in 2005. Since this confeence biomorphic structures have been revealed in Archean rocks of Karelia. It was determined that there are 3 types of such bion structures: 1. structures found in situ, in other words microorganisms even-aged with rock matrix, that is real Archean fossils biomorphic structures, that is to say forms inhabited early formed rocks, and 3. younger than Archean-Protherozoic minerali microorganisms, that is later contamination. We made attempt to differentiate these 3 types of findings and tried to understand of burial of microorganisms. The structures belongs (from our point of view) to the first type, or real Archean, forms were under examination. Practical investigation of ancient microorganisms from Green-Stone-Belt of Northern Karelia turns to be very perspective. It shows that even in such ancient time as Archean ancient diverse world existed. Moreover probably such relatively highly organized cyanobacteria and perhaps eukaryotic formes existed in Archean world.

Performance and mechanism of standard nano-TiO2(P-25) in photocatalytic disinfection of foodborne microorganisms - salmonella typhimurium and listeria monocytogenes

Science.gov (United States)

In this paper, effects of disinfection by nano-TiO2 were studied on the two typical foodborne microorganisms, Gram-negative bacterium Salmonella typhimurium and Gram-positive bacterium-Listeria monocytogenes, in meat products. The performance of nano-TiO2 against the foodborne pathogens was evaluate...

Biosurfactants from marine microorganisms

Directory of Open Access Journals (Sweden)

Suppasil Maneerat

2005-11-01

Full Text Available Biosurfactants are the surface-active molecules synthesized by microorganisms. With the advantage of environmental compatibility, the demand for biosurfactants has been steadily increasing and may eventually replace their chemically synthesized counterparts. Marine biosurfactants produced by some marine microorganisms have been paid more attention, particularly for the bioremediation of the sea polluted by crude oil. This review describes screening of biosurfactant-producing microorganisms, the determination of biosurfactant activity as well as the recovery of marine surfactant. The uses of marine biosurfactants for bioremediation are also discussed.

Necromass as a source of energy to microorganisms in marine sediments.

Science.gov (United States)

Bradley, J.; Amend, J.; LaRowe, D.

2017-12-01

Marine sediments constitute one of the largest, most energy-limited biospheres on Earth. Despite increasing exploration and interest characterizing microbial communities in marine sediments, the production and role of microbial dead-matter (necromass) has largely been overlooked. Necromass is produced on a global scale, yet its significance as a power source to heterotrophic microorganisms remains unknown. We developed a physical, bio-energetic and geochemical model to quantify the total power supply from necromass oxidation and the total power demand of living microorganisms in marine sediments. This model is first applied to sediments from the oligotrophic South Pacific Gyre (SPG), where organic carbon and biomass concentrations are extremely low, yet microorganisms persist for millions of years in some of the lowest energy states on Earth. We show that necromass does not supply sufficient power to support the total demands of the living community (maintenance demands of microorganisms in marine sediments for up to 60,000 years following burial. Our model assumes that all counted cells are viable. Yet, if only a fraction of counted cells are alive, the role of necromass as an electron donor in fueling microbial metabolisms is even greater. This new insight requires a reassessment of carbon fluxes in the deep biosphere. By extension, we also demonstrate a mechanism for microbial communities to persist by oxidizing necromass over geological timescales, and thereby endure unfavorable, low-energy settings that might be analogous to conditions on early Earth and on other planetary bodies.

Biobased production of alkanes and alkenes through metabolic engineering of microorganisms

DEFF Research Database (Denmark)

Kang, Min Kyoung; Nielsen, Jens

2017-01-01

Advancement in metabolic engineering of microorganisms has enabled bio-based production of a range of chemicals, and such engineered microorganism can be used for sustainable production leading to reduced carbon dioxide emission there. One area that has attained much interest is microbial...... hydrocarbon biosynthesis, and in particular, alkanes and alkenes are important high-value chemicals as they can be utilized for a broad range of industrial purposes as well as ‘drop-in’ biofuels. Some microorganisms have the ability to biosynthesize alkanes and alkenes naturally, but their production level...... is extremely low. Therefore, there have been various attempts to recruit other microbial cell factories for production of alkanes and alkenes by applying metabolic engineering strategies. Here we review different pathways and involved enzymes for alkane and alkene production and discuss bottlenecks...

Post irradiation effect on some antiphagocytic substances produced by pathogenic microorganisms

International Nuclear Information System (INIS)

Shehata, M.M.K.

2003-01-01

Some clinical isolated microorganiams can produce antiphagocytic virulence substance. In this study 43 bacterial strains were isolated from cervix of 50 patients. Escheruchia coli was the most common species isolated (39.53%) followed by Klebsiella pneumoniae (23.26), Pseudomonas aeruginosa (11.63%), Proteus mirabilis (9.30%), Klebsiella oxytoca (4.65%), Staphylococcus warneri (4.65%), Klebsiella group 47 (2.33%), Morganella morganii (2.33%) and Staphylococcus hominis (2.33%) four yeast fungal organisms were isolated in this study Candida albicans was the only Candida species isolated representing 8.51% of total number of pathogenic bacteria and yeast fungi isolated. Radiotherapy of these cancer patients had many effects on the microbial cells. The tested isolates were exposed to in-vivo multiple fractionated doses 10-50Gy and in-vitro single equivalent dose 7.04-20Gy. The isolated strains were tested for antimicrbial agent susceptibility using 18 different antibiotics for bacterial isolates and anystatin for Candida albicans. The effect of bacterial and yeast fungal virulence factors on neutrophil phagocytosis and antimicrobial activity was examined. Disk susceptibility testing suggested that, the isolated producer strains which were positive for extracellular proteinase enzyme and/or for slime production that correlate with infectivity were resistant to erythromycin, streptomycin, neomycin, kanamycin, tetracycline, cephalothin and sulphamethoxazol/trimethoprim and rarely susceptible to amoxicillin /clavulanic acid and cefotaxime. In contrast, many non-producer strains were susceptible to most of the tested antibiotics with marked variability among species. In case of Candida albicans all the tested strains were susceptible to the tested antimycotic agent used before and after in-vitro irradiation at a dose level of 20gy. It was found that slime substance and/or proteinase enzyme reduced the phagocytic activity of the leukocytes against the producer bacterial

Comparing culture and molecular methods for the identification of microorganisms involved in necrotizing soft tissue infections

DEFF Research Database (Denmark)

Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan

2016-01-01

BACKGROUND: Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold...... to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also...... that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially...

Association of microorganisms of reproductive tract of women with vaginal microbiome disorders

Directory of Open Access Journals (Sweden)

Tetyana V. Sklyar

2016-12-01

Full Text Available Disorders of the microbiome of the reproductive tract of women is quite common and can have significant consequences for the woman and for her sexual partners or to the fetus during pregnancy. The study of vaginal microbiome and biological properties of same microorganisms is a necessary step for choice the treatment strategy. The aim of research was to analyze qualitative and quantitative composition of microbiome of the vagina of women using the test-system Femoflor-16 and to study the ability of staphylococci strains to biofilm-formation. Using molecular genetic methods for detecting of microorganisms disorders of vaginal microbiome was confirmed in 92.7% of the surveyed women. It our study, 21 (41.2% cases of dysbiosis were found to accompany infectious diseases. Candida spp., Mycoplasma hominis, M. genitalium and Ureaplasma (urealyticum + parvum showed overwhelming. Most of the pathogens detected were a monoinfection (71%, with two-agent associations accounting for only 29% of the cases. The predominant associations of opportunistic bacteria, detected during disorders of vaginal microbiome, were Gardnerella vaginalis + Prevotella bivia + Porphyromonas spp. that found in 50.9% of patients and Megasphaera spp. + Veillonella spp. + Dialister spp. – found in 34.5% of patients. Among cases of monoinfection the most often found opportunistic pathogens were Eubacterium spp. – 50.9% of cases and Staphylococcus spp. – 49.1% of cases: 92.6% of these were identified as Staphylococcus epidermidis and 7.4% – as Staphylococcus saprophyticus. 44% of S. epidermidis strains were able to form biofilm. None of S. saprophyticus strains was film-forming.

Partha P Majumder | Speakers | Indian Academy of Sciences

Indian Academy of Sciences (India)

Only about 10% of cells associated with a human body are human cells; the remaining 90% are cells of microorganisms. In 2001, Joshua Lederberg coined the term microbiome to “signify the ecological community of commensal, symbiotic, and pathogenic microorganisms that literally share our body space and have been ...

Anti-lipolytic activity and phytochemical screening ofChelianthesalbomarginataagainst pathogenic microorganisms

Directory of Open Access Journals (Sweden)

Rini Jarial

2017-12-01

Full Text Available ABSTRACT:The aim of the present study was to evaluate the therapeutic properties of selected fern, Chelianthusalbomarginataand to identify its functional compounds. The methanolic fern-extract (MFE of these ferns was assessed for anti-bacterial activities by measuring inhibition zones against a panel of pathogenic bacterial strains using agar diffusion method. MFE at a concentration of 25 μg/ml showed marked anti-bacterial activity against all bacterial strains (6-23mm zone of inhibition and was maximum against Enterobacter sp (23 mm. In addition, the MFE of C. albomarginatahad the best MIC values of 2.25µg/ml against S. aureus and Enterobacter sp., respectively. The MFE also possessed good anti-lipolytic activity (66.5% against a porcine pancreatic lipase (PPL and cholesterol oxidase inhibition (79%. This result showed that MFE of C. albomarginataunder optimal concentrationis not only a potent source of natural anti-oxidants and anti-bacterial activity but also possesses efficient cholesterol degradation and anti-lipolytic activities, that is to be beneficial in the body weight management.

9 CFR 310.25 - Contamination with microorganisms; process control verification criteria and testing; pathogen...

Science.gov (United States)

2010-01-01

... criteria and testing; pathogen reduction standards. (a) Criteria for verifying process control; E. coli... 1 (E.coli) Establishments that slaughter more than one type of livestock or both livestock and... E. coli that is approved as an AOAC Official Method of the AOAC International (formerly the...

Effect of microorganisms on the uptake of radionuclides by plant, application of the plant-microorganism complex system to the phytoremediation

International Nuclear Information System (INIS)

Soshi, Takayuki; Enomoto, Shuichi; Yamaguchi, Isamu

2003-01-01

Effects of the microorganisms to the uptake of radionuclides by host plant of endophyte (Neotyphodium lolii) to perennial ryegrass, rice pathogenic fungi Gibberella fujikuroi to rice, Fusarium species that is symbiotic to tomato was monitored using the multitracer technique. Perennial ryegrass colonized by endophyte showed lower uptake rate rather than the plant without endophyte. Gibberella fujikuroi was able to increase the uptake of radionuclides (Cs, Sr, Mn, Zn and Co) by rice via infection. Uptake rate of Mn and Co by infected rice plant was elevated to almost two times as that of non-infected plant. The effect of five nonpathogenic strains of F. oxysporum, F. spio rycopersici (N.P.F.) isolated from tomato rhizosphere was analyzed. Each strain shows uptake enhancement of some radionuclide by plant. At least one strain shows critical enhancement of the uptake of Sr and Cs both. (author)

Mechanisms of Surface Antigenic Variation in the Human Pathogenic Fungus Pneumocystis jirovecii.

Science.gov (United States)

Schmid-Siegert, Emanuel; Richard, Sophie; Luraschi, Amanda; Mühlethaler, Konrad; Pagni, Marco; Hauser, Philippe M

2017-11-07

of antigenic variation used by this pathogen to escape the human immune system, a strategy commonly used by pathogenic microorganisms. Using a new DNA sequencing technology generating long reads, we could characterize the highly repetitive gene families encoding the proteins that are present on the cellular surface of this pest. These gene families are localized in the regions close to the ends of all chromosomes, the subtelomeres. Such chromosomal localization was found to favor genetic recombinations between members of each gene family and to allow diversification of these proteins continuously over time. This pathogen seems to use a strategy of antigenic variation consisting of the continuous production of new subpopulations composed of cells that are antigenically different. Such a strategy is unique among human pathogens. Copyright © 2017 Schmid-Siegert et al.

Survival of pathogenic bacteria under nutrient starvation conditions. [aboard orbiting space stations

Science.gov (United States)

Boyle, Michael; Ford, Tim; Mitchell, Ralph; Maki, James

1990-01-01

The survival of opportunistic pathogenic microorganisms in water, under nutrient-limiting conditions, has been investigated in order to ascertain whether human pathogens can survive within a water-distribution system of the kind proposed for the NASA Space Station. Cultures of a strain of pseudomonas aeruginosa and two strains of staphylococcus aureus were incubated at 10, 25, or 37 C, and samples at 1 day, 1 week, 1 month, and six weeks. While neither of the staphylococcus strains tested were detected after 1 week of starvation, the pseudomonas strain can survive in deionized water at all three temperatures.

Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

Science.gov (United States)

Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

2016-08-31

Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

Science.gov (United States)

Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

2016-02-01

Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7-10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase.

Science.gov (United States)

Patil, Sonali; Pincas, Hanna; Seto, Jeremy; Nudelman, German; Nudelman, Irina; Sealfon, Stuart C

2010-10-07

Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to pathogen detection. This map represents a navigable

Modeling the intracellular pathogen-immune interaction with cure rate

Science.gov (United States)

Dubey, Balram; Dubey, Preeti; Dubey, Uma S.

2016-09-01

Many common and emergent infectious diseases like Influenza, SARS, Hepatitis, Ebola etc. are caused by viral pathogens. These infections can be controlled or prevented by understanding the dynamics of pathogen-immune interaction in vivo. In this paper, interaction of pathogens with uninfected and infected cells in presence or absence of immune response are considered in four different cases. In the first case, the model considers the saturated nonlinear infection rate and linear cure rate without absorption of pathogens into uninfected cells and without immune response. The next model considers the effect of absorption of pathogens into uninfected cells while all other terms are same as in the first case. The third model incorporates innate immune response, humoral immune response and Cytotoxic T lymphocytes (CTL) mediated immune response with cure rate and without absorption of pathogens into uninfected cells. The last model is an extension of the third model in which the effect of absorption of pathogens into uninfected cells has been considered. Positivity and boundedness of solutions are established to ensure the well-posedness of the problem. It has been found that all the four models have two equilibria, namely, pathogen-free equilibrium point and pathogen-present equilibrium point. In each case, stability analysis of each equilibrium point is investigated. Pathogen-free equilibrium is globally asymptotically stable when basic reproduction number is less or equal to unity. This implies that control or prevention of infection is independent of initial concentration of uninfected cells, infected cells, pathogens and immune responses in the body. The proposed models show that introduction of immune response and cure rate strongly affects the stability behavior of the system. Further, on computing basic reproduction number, it has been found to be minimum for the fourth model vis-a-vis other models. The analytical findings of each model have been exemplified by

[Long-term storage of obligate anaerobic microorganisms in glycerol].

Science.gov (United States)

Briukhanov, A I; Netrusov, A I

2006-01-01

We evaluated the possibility of storing the cultures of obligate anaerobic microorganisms (clostridia. acetogenic and sulfate-reducing bacteria, and methanogenic archaea) in 25% glycerol at -70 degrees C for a long time (up to 3 years). This method of storage is adequate to preserve cell viability in most obligate anaerobes.

Effects of single- and multi-strain probiotics on biofilm formation and in vitro adhesion to bladder cells by urinary tract pathogens.

Science.gov (United States)

Chapman, C M C; Gibson, G R; Rowland, I

2014-06-01

There is increasing evidence that probiotic bacteria can inhibit and/or prevent urinary tract infections. Possible mechanisms include prevention of adhesion of pathogens to the bladder epithelium and inhibition of biofilm formation. Currently there is interest in the comparative efficacy of single probiotics vs. strain mixtures. We have therefore tested the inhibitory activity of four single probiotics and four probiotic mixtures towards the urinary tract pathogens Escherichia coli NCTC 9001 and Enterococcus faecalis NCTC 00775. Inhibition of biofilm formation by cell-free supernatants was tested using the Crystal Violet assay, while prevention of pathogen adhesion to host cells was tested by using bladder cancer cells as a model for the human urinary tract. Under pH-controlled conditions, there was no significant inhibition of biofilm formation by any treatment. Without pH control, 5/8 treatments significantly inhibited biofilm production by E. coli, while 5/8 treatments inhibited production by E. faecalis. Using data from all Crystal Violet assays, there was no significant difference in the ability of single- and multi-strain probiotics to inhibit biofilm formation. In the cell culture assays, all treatments were able to significantly reduce numbers of pathogenic cells adhering to host cells by 2.5-3.5 logs. No significant difference was observed between the displacement caused by single strains and mixtures for either pathogen. Inhibition of biofilm seems to be a major mechanism of urinary tract pathogen exclusion, related to, and possibly dependent upon, the probiotic ability to reduce environmental pH. Exclusion via competition of binding sites is a possible in vivo mechanism for these probiotics. If an additive or synergistic effect exists between strains within a mixture, it does not manifest itself in a greater effect through these two inhibitory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

Science.gov (United States)

Liechti, George; Kuru, Erkin; Packiam, Mathanraj; Hsu, Yen-Pang; Tekkam, Srinivas; Hall, Edward; Rittichier, Jonathan T; VanNieuwenhze, Michael; Brun, Yves V; Maurelli, Anthony T

2016-05-01

The peptidoglycan (PG) cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

Directory of Open Access Journals (Sweden)

George Liechti

2016-05-01

Full Text Available The peptidoglycan (PG cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

[Periodontal microbiota and microorganisms isolated from heart valves in patients undergoing valve replacement surgery in a clinic in Cali, Colombia].

Science.gov (United States)

Moreno, Sandra; Parra, Beatriz; Botero, Javier E; Moreno, Freddy; Vásquez, Daniel; Fernández, Hugo; Alba, Sandra; Gallego, Sara; Castillo, Gilberto; Contreras, Adolfo

2017-12-01

Periodontitis is an infectious disease that affects the support tissue of the teeth and it is associated with different systemic diseases, including cardiovascular disease. Microbiological studies facilitate the detection of microorganisms from subgingival and cardiovascular samples. To describe the cultivable periodontal microbiota and the presence of microorganisms in heart valves from patients undergoing valve replacement surgery in a clinic in Cali. We analyzed 30 subgingival and valvular tissue samples by means of two-phase culture medium, supplemented blood agar and trypticase soy agar with antibiotics. Conventional PCR was performed on samples of valve tissue. The periodontal pathogens isolated from periodontal pockets were: Fusobacterium nucleatum (50%), Prevotella intermedia/ nigrescens (40%), Campylobacter rectus (40%), Eikenella corrodens (36.7%), Gram negative enteric bacilli (36.7%), Porphyromonas gingivalis (33.3%), and Eubacterium spp. (33.3%). The pathogens isolated from the aortic valve were Propionibacterium acnes (12%), Gram negative enteric bacilli (8%), Bacteroides merdae (4%), and Clostridium bifermentans (4%), and from the mitral valve we isolated P. acnes and Clostridium beijerinckii. Conventional PCR did not return positive results for oral pathogens and bacterial DNA was detected only in two samples. Periodontal microbiota of patients undergoing surgery for heart valve replacement consisted of species of Gram-negative bacteria that have been associated with infections in extraoral tissues. However, there is no evidence of the presence of periodontal pathogens in valve tissue, because even though there were valve and subgingival samples positive for Gram-negative enteric bacilli, it is not possible to maintain they corresponded to the same phylogenetic origin.

Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

Directory of Open Access Journals (Sweden)

Marinela Contreras

2017-07-01

Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

Aerially transmitted human fungal pathogens: what can we learn from metagenomics and comparative genomics?

Science.gov (United States)

Aliouat-Denis, Cécile-Marie; Chabé, Magali; Delhaes, Laurence; Dei-Cas, Eduardo

2014-01-01

In the last few decades, aerially transmitted human fungal pathogens have been increasingly recognized to impact the clinical course of chronic pulmonary diseases, such as asthma, cystic fibrosis or chronic obstructive pulmonary disease. Thanks to recent development of culture-free high-throughput sequencing methods, the metagenomic approaches are now appropriate to detect, identify and even quantify prokaryotic or eukaryotic microorganism communities inhabiting human respiratory tract and to access the complexity of even low-burden microbe communities that are likely to play a role in chronic pulmonary diseases. In this review, we explore how metagenomics and comparative genomics studies can alleviate fungal culture bottlenecks, improve our knowledge about fungal biology, lift the veil on cross-talks between host lung and fungal microbiota, and gain insights into the pathogenic impact of these aerially transmitted fungi that affect human beings. We reviewed metagenomic studies and comparative genomic analyses of carefully chosen microorganisms, and confirmed the usefulness of such approaches to better delineate biology and pathogenesis of aerially transmitted human fungal pathogens. Efforts to generate and efficiently analyze the enormous amount of data produced by such novel approaches have to be pursued, and will potentially provide the patients suffering from chronic pulmonary diseases with a better management. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Pathogenicity of Shigella in chickens.

Science.gov (United States)

Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-ying; Zhao, Jun; Wang, Xin-wei; Wang, Chuan-qing

2014-01-01

Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results showed Shigella can cause death via intraperitoneal injection in SPF chickens, but only induce depression via crop injection. Immunohistochemistry and transmission electron microscopy revealed the Shigella can invade the intestinal epithelia. Immunohistochemistry of the primary chicken intestinal epithelial cells infected with Shigella showed the bacteria were internalized into the epithelial cells. Electron microscopy also confirmed that Shigella invaded primary chicken intestinal epithelia and was encapsulated by phagosome-like membranes. Our data demonstrate that Shigella can invade primary chicken intestinal epithelial cells in vitro and chicken intestinal mucosa in vivo, resulting in pathogenicity and even death. The findings suggest Shigella isolated from human or chicken share similar pathogenicity as well as the possibility of human-poultry cross-infection, which is of public health significance.

The formation of microorganism communities in the soil under the effect of chitosan and runner bean (Phaseolus coccineus L. cultivation

Directory of Open Access Journals (Sweden)

Danuta Pięta

2013-12-01

Full Text Available The subject of the studies was the soil with introduced solutions containing 0,1% chitosan. These materials were obtained from the Institute of Chemical Fibres in L6d2 (in the form of a microcrystalline gel and also from the Department of Food Biochemistry and Chemistry of the University of Agriculture in Lublin (in a liquid form,i.e.dissolved in acetic acid. In order to set an experiment in a growth chamber, grey brown podzolic soil formed from loesses and taken from a mechanically treated belt of black fallow was used. The soil (1000 g was watered every 8 days with 100 ml of examined chitosan solutions per pot. Control soil was watered with sterile distilled water. Seven days after each watering, soil samples were taken for microbiological analysis. Then 25 runner bean seeds were sown into each pot. After six weeks of plants' growth the experiment was finished and the number of plants was counted, their healthiness determined and soil microbiological analysis was performed. Regardless of chitosan form introduced to the soil it stimulated the growth of bacteria and fungi, since in these experimental combinations was found a significantly higher number of microorganisms as compared with the control. A particular high increase in the number of microorganism colonies was observed with simultaneous growth of plants and the application of chitosan. A considerable increase of fungi colonies from the Trichoderma genus was found in the soil treated with chitosan in the form ofboth a microcrystalline gel and a liquid. The species of this genus are considered to be antagonists; it affects pathogenic fungi through competition, antibiosis and over-parasitism. An increase in colonies of saprophytic microorganisms, including antagonistic ones of Bacillus spp. and Pseudomonas spp. was observed in the soil treated with chitosan . On the other hand, in the soil after the growth of bean and treated watered with chitosan only few colonies of Fusarium oxysporum f

Microorganisms involved in MIC

Energy Technology Data Exchange (ETDEWEB)

Sorensen, K. [Danish Technological Institute (Denmark)

2011-07-01

Microbiologically influenced corrosion (MIC) is a widespread problem that is difficult to detect and assess because of its complex mechanism. This paper presents the involvement of microorganisms in MIC. Some of the mechanisms that cause MIC include hydrogen consumption, production of acids, anode-cathode formation and electron shuttling. A classic bio-corrosive microorganism in the oil and gas industry is sulphate-reducing prokaryotes (SRP). Methanogens also increase corrosion rates in metals. Some of the phylogenetic orders detected while studying SRP and methanogens are archaeoglobales, clostridiales, methanosarcinales and methanothermococcus. There were some implications, such as growth of SRP not being correlated with growth of methanogens; methanogens were included in MIC risk assessment. A few examples are used to display how microorganisms are involved in topside corrosion and microbial community in producing wells. From the study, it can be concluded that, MIC risk assessment includes system data and empirical knowledge of the distribution and number of microorganisms in the system.

A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia.

Science.gov (United States)

Gisder, Sebastian; Möckel, Nadine; Linde, Andreas; Genersch, Elke

2011-02-01

The population of managed honey bees has been dramatically declining in the recent past in many regions of the world. Consensus now seems to be that pathogens and parasites (e.g. the ectoparasitic mite Varroa destructor, the microsporidium Nosema ceranae and viruses) play a major role in this demise. However, little is known about host-pathogen interactions for bee pathogens and attempts to develop novel strategies to combat bee diseases have been hampered by this gap in our knowledge. One reason for this dire situation is the complete lack of cell cultures for the propagation and study of bee pathogens. Here we present a cell culture model for two honey bee-pathogenic microsporidian species, Nosema apis and N. ceranae. Our cell culture system is based on a lepidopteran cell line, which proved to be susceptible to infection by both N. ceranae and N. apis and enabled us to illustrate the entire life cycle of these microsporidia. We observed hitherto undescribed spindle-shaped meronts and confirmed our findings in infected bees. Our cell culture model provides a previously unavailable means to explore the nature of interactions between the honey bee and its pathogen complex at a mechanistic level and will allow the development of novel treatment strategies.

Characterization of Microorganisms Isolated from Petroleum Hydrocarbon Polluted Soil

Directory of Open Access Journals (Sweden)

Adriana Criste

2016-02-01

Full Text Available Bioremediation has received a great deal of attention, and bacteria isolated from polluted soil can be usedin that process. In this study, we performed an evaluation of the physiological groups of microorganisms fromsoil contaminated with petroleum. Bacterial strains were isolated from contaminated soil using the selectiveenrichment technique. Minimal Salt Media was used for serial dilutions to determine viable cell count. Thenumber of total viable cells and different types of microorganisms in the original sample was determined by serialdilution, agar plating procedure using selective media. The plates were incubated at 300C for 24-72 hours. Distinctcolonies growing on each plate were selected, and stored at freezing temperatures. The bacterial colonies werethen identified by Gram staining and biochemical tests. Following our research, it was observed that although thetotal microbial load of soil is relatively close in value, there are differences regarding the physiological group ofmicroorganisms. In the oil contaminated soil sample the largest group of microorganisms was the nitrous nitrifyingbacteria followed by nitrate bacteria. All bacterial strains that were isolated from soil samples contaminated withhydrocarbons but also the Pseudomonas putida and Bacillus subtillis strains can use diesel fuel as a food source.With the increase of diesel fuel concentration from culture medium, the majority of the bacterial strains that wereused in our experiments showed an increased value of absorbance. This fact suggests that these strains can be usedin bioremediation processes.

Microorganisms as potential vectors of the migration of radionuclides?

International Nuclear Information System (INIS)

Yves, A.

1998-01-01

The aims of our work are the study of the sorption of radionuclides by bacteria as the first step in the microorganism-metal interaction. The latter involves the fixation of ions on a surface layer and it results in the immobilization of the metal, thus possibly being the primary step of bioaccumulation. After a rapid presentation of the direct and indirect mechanisms of the interactions, we shall present our experiments of radionuclide biosorption by bacteria. A salient feature of biosorption is the selectivity of the adsorption of some radionuclides from a composed solution. For example, Andres et al. (1993, 1995) have shown that Mycobacterium smegmatis, from a composed solution containing uranium, thorium, lanthanum, europium and ytterbium, selectively adsorbs thorium ions. The sequence of preferential fixation is: Th 4+ > UO 2 2+ > La 3+ = Eu 3+ = Yb 3+ . This selectivity is a function of the cell wall organization and of the speciation of the metal in the solution. Yet, each species of bacteria has characteristic and specific cell wall layer composition and organization. Moreover, the culture and the environmental conditions change the surface layer properties. Another parameter in the migration of radionuclides is the transfer from the soil to the microorganisms. In column experiments, Gd, and likely the rare earths, in general, adsorbed on sand can be removed with a suspension of bacteria (Thouand and Andres 1997). These examples will be discussed and serve as a basis to illustrate the diversity of the interactions between microorganisms and radionuclides

Targeting of the hydrophobic metabolome by pathogens.

Science.gov (United States)

Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F

2015-05-01

The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to Lactobacillus johnsonii NCC 533 (La1) (CNCM I-1225) and improving immune defence against pathogenic gastro-intestinal microorganisms (ID 896), and protection, of the skin from UV-induced damage (ID 900) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

claims in relation to Lactobacillus johnsonii NCC 533 (La1) (CNCM I-1225) and improving immune defence against pathogenic gastro-intestinal microorganisms, and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...

The Cell Wall-Associated Proteins in the Dimorphic Pathogenic Species of Paracoccidioides.

Science.gov (United States)

Puccia, Rosana; Vallejo, Milene C; Longo, Larissa V G

2017-01-01

Paracoccidioides brasiliensis and P. lutzii cause human paracoccidioidomycosis (PCM). They are dimorphic ascomycetes that grow as filaments at mild temperatures up to 28oC and as multibudding pathogenic yeast cells at 37oC. Components of the fungal cell wall have an important role in the interaction with the host because they compose the cell outermost layer. The Paracoccidioides cell wall is composed mainly of polysaccharides, but it also contains proportionally smaller rates of proteins, lipids, and melanin. The polysaccharide cell wall composition and structure of Paracoccidioides yeast cells, filamentous and transition phases were studied in detail in the past. Other cell wall components have been better analyzed in the last decades. The present work gives to the readers a detailed updated view of cell wall-associated proteins. Proteins that have been localized at the cell wall compartment using antibodies are individually addressed. We also make an overview about PCM, the Paracoccidioides cell wall structure, secretion mechanisms, and fungal extracellular vesicles. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Assessment of impact of culture conditions on capability of wastewater's microorganisms to flocculation

Directory of Open Access Journals (Sweden)

Il'inskiy V. V.

2017-06-01

Full Text Available Wastewater is one of the significant sources of pollution of the aquatic ecosystems of the Kola North. Sewage coming to the ground waters, surface waters and near shore marine basin have a complex negative impact on the biocenosis of water objects. Considering the fact that basin self-purification process in climatic environment of the Far North is slow, it seems to be current problem to research influence of external factors on the native microorganisms involved in the biological transformation of most pollutants. Along with oxygenizing activity microorganisms are able to accumulate pollutant in the cells and to form floccules. As a result, microorganisms fix the dissolved contaminants that may be mechanically derived from water. Using the data on the chemical makeup of some urban and domestic sewage, nutrient media have been developed where microorganisms isolated from effluents have been cultivated. As major characteristics of the cultivation media affecting the intensity and direction of metabolic processes in microorganisms, the ratios C / N, C / P and N / P have been chosen. Intensity growth of bacteria in experimental nutrient media has been studied and the flocculating activity of bacterial suspensions has been determined. The rate of these microorganisms (Pseudomonas spp. and cultures of bacteria of Enterobacteriaceae family average has been 70∙103 and 117∙103 cells/h respectively. The growth rate of each culture on different composition nutrient media has varied within three orders, and has correlated with the relative content of phosphates in the nutrient media. The flocculating potential does not depend on the ratio of biogenic elements C / N, C / P and N / P. Both cultures have shown the ability to precipitate suspended matter at the level of 50 % or more after cultivation on nutrient media similar in composition to habitat conditions.

Disinfectants - bacterial cells interactions in the view of hygiene and public health

Directory of Open Access Journals (Sweden)

Marta Książczyk

2015-09-01

Full Text Available In recent years, the use of biocides has increased rapidly. One common example is triclosan, with wide application in households as well as medical and industrial fields, especially food industry and animal husbandry. Chemical disinfection is a major mean to control and eliminate pathogenic bacteria, particularly those with multidrug resistance (MDR phenotype. However, exposition to biocides results in an adaptive response in microorganisms, causing them to display a wide range of resistance mechanisms. Numerous microorganisms are characterized by either natural resistance to chemical compounds or an ability to adapt to biocides using various strategies, such as: modification of cell surface structures (lipopolisaccharide, membrane fatty acids, over-expression of efflux pumps (a system for active transport of toxic compounds out of bacterial cell, enzymatic inactivation of biocides or altering biocide targets. For instance, it was shown that in vitro exposition of Salmonella Typhimurium to subinhibitory concentration of biocides (triclosan, quaternary ammonium compounds [QACs] resulted in selection of variants resistant to tested biocides and, additionally, to acridine dyes and antibiotics. Bacillus subtilis and Micrococcus luteus strains isolated from chlorine dioxide containing disinfection devices were found to be resistant to chlorine dioxide and also to other oxidizing compounds, such as peracetic acid and hydrogen peroxide. Interaction between chemical compounds, including disinfectants and microbial cells, can create a serious threat to public health and sanitary-hygienic security. This phenomenon is connected with factor risk that intensify the probability of selection and dissemination of multidrug resistance among pathogenic bacteria.

Roles of tRNA in cell wall biosynthesis

DEFF Research Database (Denmark)

Dare, Kiley; Ibba, Michael

2012-01-01

Recent research into various aspects of bacterial metabolism such as cell wall and antibiotic synthesis, degradation pathways, cellular stress, and amino acid biosynthesis has elucidated roles of aminoacyl-transfer ribonucleic acid (aa-tRNA) outside of translation. Although the two enzyme families...... responsible for cell wall modifications, aminoacyl-phosphatidylglycerol synthases (aaPGSs) and Fem, were discovered some time ago, they have recently become of intense interest for their roles in the antimicrobial resistance of pathogenic microorganisms. The addition of positively charged amino acids...... and play a role in resistance to antibiotics that target the cell wall. Additionally, the formation of truncated peptides results in shorter peptide bridges and loss of branched linkages which makes bacteria more susceptible to antimicrobials. A greater understanding of the structure and substrate...

Evaluation of quantitative PCR measurement of bacterial colonization of epithelial cells.

Science.gov (United States)

Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Myszka, Kamila; Borkowska, Monika; Grajek, Włodzimierz

2010-01-01

Microbial colonization is an important step in establishing pathogenic or probiotic relations to host cells and in biofilm formation on industrial or medical devices. The aim of this work was to verify the applicability of quantitative PCR (Real-Time PCR) to measure bacterial colonization of epithelial cells. Salmonella enterica and Caco-2 intestinal epithelial cell line was used as a model. To verify sensitivity of the assay a competition of the pathogen cells to probiotic microorganism was tested. The qPCR method was compared to plate count and radiolabel approach, which are well established techniques in this area of research. The three methods returned similar results. The best quantification accuracy had radiolabel method, followed by qPCR. The plate count results showed coefficient of variation two-times higher than this of qPCR. The quantitative PCR proved to be a reliable method for enumeration of microbes in colonization assay. It has several advantages that make it very useful in case of analyzing mixed populations, where several different species or even strains can be monitored at the same time.

Use of Extract of Citrus sinensis as an antimicrobial agent for foodborne zoonotic pathogens and spoilage bacteria

Science.gov (United States)

Foodborne pathogens remain global health problems despite concerted efforts to control the transmission of these microorganisms through food. The resurgence of drug resistant bacteria has renewed interest in developing and testing new sources of antimicrobial agents to control foodborne illness. Thi...

Removal of two waterborne pathogenic bacterial strains by activated carbon particles prior to and after charge modification

NARCIS (Netherlands)

Busscher, Henk J.; Dijkstra, Rene J. B.; Engels, Eefje; Langworthy, Don E.; Collias, Dimitris I.; Bjorkquist, David W.; Mitchell, Michael D.; van der Mei, Henny C.

2006-01-01

Waterborne diseases constitute a threat to public health despite costly treatment measures aimed at removing pathogenic microorganisms from potable water supplies. This paper compared the removal of Raoultella terrigena ATCC 33257 and Escherichia coli ATCC 25922 by negatively and positively charged

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

Science.gov (United States)

Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

2017-01-01

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

International Nuclear Information System (INIS)

Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

2017-01-01

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

Energy Technology Data Exchange (ETDEWEB)

Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

2017-01-15

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Identification of periodontopathogen microorganisms by PCR technique

Directory of Open Access Journals (Sweden)

Milićević Radovan

2008-01-01

Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

Radioresistant microorganisms and food irradiation

Energy Technology Data Exchange (ETDEWEB)

Ito, H [Japan Atomic Energy Research Inst., Takasaki, Gunma. Takasaki Radiation Chemistry Research Establishment

1976-01-01

This paper deals with Micrococcus radiodurans, Arthrobacter radiotolerance, etc., which were isolated and discovered as radioresistant microorganisms. As for the explanation of the mechanism of radioresistance of these microorganisms, the consideration that these organisms have marked repair power of the damaged DNA and have many opportunity to repair the damaged DNA because of their long fission term were cited. The relationship between the radioresistance of microorganisms and food irradiation was also mentioned.

Use of an Optical Trap for Study of Host-Pathogen Interactions for Dynamic Live Cell Imaging

OpenAIRE

Tam, Jenny M.; Castro, Carlos E.; Heath, Robert J. W.; Mansour, Michael K.; Cardenas, Michael L.; Xavier, Ramnik J.; Lang, Matthew J.; Vyas, Jatin M.

2011-01-01

Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system1, 2; however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis3 have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous int...

Screening and characterization of useful microorganisms to arsenic removal

OpenAIRE

宮武, 宗利; 林, 幸男

2007-01-01

Microorganisms were isolated from soil and their arsenic removal abilities were evaluated. Seven out of the 100 isolated strains showed more than 20% arsenic removal. Time courses of arsenic removal and cell growth were investigated in three of these isolated strains. Although the growth rates were different, the dependence of arsenic removal on cell growth was similar in three strains (A-84, 88, 89). Strain A-89 showed highest arsenic removal rate of 63% after first day. Strain A-88 was best...

Rim Pathway-Mediated Alterations in the Fungal Cell Wall Influence Immune Recognition and Inflammation.

Science.gov (United States)

Ost, Kyla S; Esher, Shannon K; Leopold Wager, Chrissy M; Walker, Louise; Wagener, Jeanette; Munro, Carol; Wormley, Floyd L; Alspaugh, J Andrew

2017-01-31

Compared to other fungal pathogens, Cryptococcus neoformans is particularly adept at avoiding detection by innate immune cells. To explore fungal cellular features involved in immune avoidance, we characterized cell surface changes of the C. neoformans rim101Δ mutant, a strain that fails to organize and shield immunogenic epitopes from host detection. These cell surface changes are associated with an exaggerated, detrimental inflammatory response in mouse models of infection. We determined that the disorganized strain rim101Δ cell wall increases macrophage detection in a contact-dependent manner. Using biochemical and microscopy methods, we demonstrated that the rim101Δ strain shows a modest increase in the levels of both cell wall chitin and chitosan but that it shows a more dramatic increase in chito-oligomer exposure, as measured by wheat germ agglutinin staining. We also created a series of mutants with various levels of cell wall wheat germ agglutinin staining, and we demonstrated that the staining intensity correlates with the degree of macrophage activation in response to each strain. To explore the host receptors responsible for recognizing the rim101Δ mutant, we determined that both the MyD88 and CARD9 innate immune signaling proteins are involved. Finally, we characterized the immune response to the rim101Δ mutant in vivo, documenting a dramatic and sustained increase in Th1 and Th17 cytokine responses. These results suggest that the Rim101 transcription factor actively regulates the C. neoformans cell wall to prevent the exposure of immune stimulatory molecules within the host. These studies further explored the ways in which immune cells detect C. neoformans and other fungal pathogens by mechanisms that include sensing N-acetylglucosamine-containing structures, such as chitin and chitosan. Infectious microorganisms have developed many ways to avoid recognition by the host immune system. For example, pathogenic fungi alter their cell surfaces to

40 CFR 725.85 - Microorganism identity.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Microorganism identity. 725.85 Section... to Information § 725.85 Microorganism identity. (a) Claims applicable to the period prior to... specific microorganism identity at the time of submission of the information. This claim will apply only to...

The structure of the Brassica napus seed microbiome is cultivar-dependent and affects the interactions of symbionts and pathogens.

Science.gov (United States)

Rybakova, Daria; Mancinelli, Riccardo; Wikström, Mariann; Birch-Jensen, Ann-Sofie; Postma, Joeke; Ehlers, Ralf-Udo; Goertz, Simon; Berg, Gabriele

2017-09-01

Although the plant microbiome is crucial for plant health, little is known about the significance of the seed microbiome. Here, we studied indigenous bacterial communities associated with the seeds in different cultivars of oilseed rape and their interactions with symbiotic and pathogenic microorganisms. We found a high bacterial diversity expressed by tight bacterial co-occurrence networks within the rape seed microbiome, as identified by llumina MiSeq amplicon sequencing. In total, 8362 operational taxonomic units (OTUs) of 40 bacterial phyla with a predominance of Proteobacteria (56%) were found. The three cultivars that were analyzed shared only one third of the OTUs. The shared core of OTUs consisted mainly of Alphaproteobacteria (33%). Each cultivar was characterized by having its own unique bacterial structure, diversity, and proportion of unique microorganisms (25%). The cultivar with the lowest bacterial abundance, diversity, and the highest predicted bacterial metabolic activity rate contained the highest abundance of potential pathogens within the seed. This data corresponded with the observation that seedlings belonging to this cultivar responded more strongly to the seed treatments with bacterial inoculants than other cultivars. Cultivars containing higher indigenous diversity were characterized as having a higher colonization resistance against beneficial and pathogenic microorganisms. Our results were confirmed by microscopic images of the seed microbiota. The structure of the seed microbiome is an important factor in the development of colonization resistance against pathogens. It also has a strong influence on the response of seedlings to biological seed treatments. These novel insights into seed microbiome structure will enable the development of next generation strategies combining both biocontrol and breeding approaches to address world agricultural challenges.

Comparison of a Four-Section Spindle and Stomacher for Efficacy of Detaching Microorganisms from Fresh Vegetables.

Science.gov (United States)

Kim, Do-Kyun; Kim, Soo-Ji; Kang, Dong-Hyun

2015-07-01

This study was undertaken to compare the effect of the spindle and stomacher for detaching microorganisms from fresh vegetables. The spindle is an apparatus for detaching microorganisms from food surfaces, which was developed in our laboratory. When processed with the spindle, food samples were barely disrupted, the original shape was maintained, and the diluent was clear, facilitating further detection analysis more easily than with stomacher treatment. The four-section spindle consists of four sample bag containers (A, B, C, and D) to economize time and effort by simultaneously processing four samples. The aerobic plate counts (APC) of 50 fresh vegetable samples were measured following spindle and stomacher treatment. Correlations between the two methods for each section of the spindle and stomacher were very high (R(2) = 0.9828 [spindle compartment A; Sp A], 0.9855 [Sp B], 0.9848 [Sp C], and 0.9851 [Sp D]). One-tenth milliliter of foodborne pathogens suspensions was inoculated onto surfaces of food samples, and ratios of spindle-to-stomacher enumerations were close to 1.00 log CFU/g between every section of the spindle and stomacher. One of the greatest features of the spindle is that it can treat large-sized samples that exceed 200 g. Uncut whole apples, green peppers, potatoes, and tomatoes were processed by the spindle and by hand massaging by 2 min. Large-sized samples were also assayed for aerobic plate count and recovery of the three foodborne pathogens, and the difference between each section of the spindle and hand massaging was not significant (P > 0.05). This study demonstrated that the spindle apparatus can be an alternative device for detaching microorganisms from all fresh vegetable samples for microbiological analysis by the food processing industry.

Anaerobic Co-Culture of Mesenchymal Stem Cells and Anaerobic Pathogens - A New In Vitro Model System

OpenAIRE

Kriebel, Katja; Biedermann, Anne; Kreikemeyer, Bernd; Lang, Hermann

2013-01-01

BACKGROUND: Human mesenchymal stem cells (hMSCs) are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIP...

Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

DEFF Research Database (Denmark)

Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.

2008-01-01

The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

Directory of Open Access Journals (Sweden)

Nudelman Irina

2010-10-01

Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

Interaction of pathogens with host cholesterol metabolism.

Science.gov (United States)

Sviridov, Dmitri; Bukrinsky, Michael

2014-10-01

Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.

Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Nansalmaa Amarsaikhan

Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

The role of hyperparasitism in microbial pathogen ecology and evolution.

Science.gov (United States)

Parratt, Steven R; Laine, Anna-Liisa

2016-08-01

Many micro-organisms employ a parasitic lifestyle and, through their antagonistic interactions with host populations, have major impacts on human, agricultural and natural ecosystems. Most pathogens are likely to host parasites of their own, that is, hyperparasites, but how nested chains of parasites impact on disease dynamics is grossly neglected in the ecological and evolutionary literature. In this minireview we argue that the diversity and dynamics of micro-hyperparasites are an important component of natural host-pathogen systems. We use the current literature from a handful of key systems to show that observed patterns of pathogen virulence and disease dynamics may well be influenced by hyperparasites. Exploring these factors will shed light on many aspects of microbial ecology and disease biology, including resistance-virulence evolution, apparent competition, epidemiology and ecosystem stability. Considering the importance of hyperparasites in natural populations will have applied consequences for the field of biological control and therapeutic science, where hyperparastism is employed as a control mechanism but not necessarily ecologically understood.

Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

Directory of Open Access Journals (Sweden)

García-Pérez Blanca Estela

2012-10-01

Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

Modulation of pathogen recognition by autophagy

Directory of Open Access Journals (Sweden)

Ji Eun eOh

2012-03-01

Full Text Available Autophagy is an ancient biological process for maintaining cellular homeostasis by degradation of long-lived cytosolic proteins and organelles. Recent studies demonstrated that autophagy is availed by immune cells to regulate innate immunity. On the one hand, cells exert direct effector function by degrading intracellular pathogens; on the other hand, autophagy modulates pathogen recognition and downstream signaling for innate immune responses. Pathogen recognition via pattern recognition receptors induces autophagy. The function of phagocytic cells is enhanced by recruitment of autophagy-related proteins. Moreover, autophagy acts as a delivery system for viral replication complexes to migrate to the endosomal compartments where virus sensing occurs. In another case, key molecules of the autophagic pathway have been found to negatively regulate immune signaling, thus preventing aberrant activation of cytokine production and consequent immune responses. In this review, we focus on the recent advances in the role of autophagy in pathogen recognition and modulation of innate immune responses.

Environmental assessment of the potential effects of aquifer thermal energy storage systems on microorganisms in groundwater

Energy Technology Data Exchange (ETDEWEB)

Hicks, R.J.; Stewart, D.L.

1988-03-01

The primary objective of this study was to evaluate the potential environmental effects (both adverse and beneficials) of aquifer thermal energy storage (ATES) technology pertaining to microbial communities indigenous to subsurface environments (i.e., aquifers) and the propagation, movement, and potential release of pathogenic microorganisms (specifically, Legionella) within ATES systems. Seasonal storage of thermal energy in aquifers shows great promise to reduce peak demand; reduce electric utility load problems; contribute to establishing favorable economics for district heating and cooling systems; and reduce pollution from extraction, refining, and combustion of fossil fuels. However, concerns that the widespread implementation of this technology may have adverse effects on biological systems indigeneous to aquifers, as well as help to propagate and release pathogenic organisms that enter thee environments need to be resolved. 101 refs., 2 tabs.

Pathogen Trojan Horse Delivers Bioactive Host Protein to Alter Maize Anther Cell Behavior in Situ.

Science.gov (United States)

van der Linde, Karina; Timofejeva, Ljudmilla; Egger, Rachel L; Ilau, Birger; Hammond, Reza; Teng, Chong; Meyers, Blake C; Doehlemann, Gunther; Walbot, Virginia

2018-03-01

Small proteins are crucial signals during development, host defense, and physiology. The highly spatiotemporal restricted functions of signaling proteins remain challenging to study in planta. The several month span required to assess transgene expression, particularly in flowers, combined with the uncertainties from transgene position effects and ubiquitous or overexpression, makes monitoring of spatiotemporally restricted signaling proteins lengthy and difficult. This situation could be rectified with a transient assay in which protein deployment is tightly controlled spatially and temporally in planta to assess protein functions, timing, and cellular targets as well as to facilitate rapid mutagenesis to define functional protein domains. In maize ( Zea mays ), secreted ZmMAC1 (MULTIPLE ARCHESPORIAL CELLS1) was proposed to trigger somatic niche formation during anther development by participating in a ligand-receptor module. Inspired by Homer's Trojan horse myth, we engineered a protein delivery system that exploits the secretory capabilities of the maize smut fungus Ustilago maydis , to allow protein delivery to individual cells in certain cell layers at precise time points. Pathogen-supplied ZmMAC1 cell-autonomously corrected both somatic cell division and differentiation defects in mutant Zm mac1-1 anthers. These results suggest that exploiting host-pathogen interactions may become a generally useful method for targeting host proteins to cell and tissue types to clarify cellular autonomy and to analyze steps in cell responses. © 2018 American Society of Plant Biologists. All rights reserved.

Screening and Isolation of Associated Bioactive Microorganisms from Fasciospongia cavernosa from of Visakhapatnam Coast, Bay of Bengal

Directory of Open Access Journals (Sweden)

P. Shamsher Kumar

2012-01-01

Full Text Available Nature, especially the marine environment, provides the most effective drugs used in human therapy. Among the metazoans, the marine sponges produce the most potent and highly selective bioactive secondary metabolites. These animals (or their associated symbiotic microorganisms synthesize secondary metabolites whose activity and selectivity has developed during their long evolutionary history. During the course of exploitation of these resources two marine sponges, Fasciospongia cavernosa doc var.brown (dark brown Fasciospongia cavernosa doc var.yellow (yellow collected from the visakhapatnam coast of Bay of Bengal were investigated in order to assess the potential of these microorganisms for the production of antimicrobial compounds. The aqueous and organic extracts of both the sponges showed broad spectrum antibiotic activity. In this study a total of 178 microorganisms were isolated from different parts of two sponges and most of them from middle part of the sponge. The isolates were investigated in order to assess the potential of these microorganisms for the production of antimicrobial compounds. Testing for antimicrobial activities were performed against Gram-positive (Staphylococcus aureus, Bacillus subtilis, Bacillus cereus Gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli, Proteus vulgaris, fungi (Candida albicans, Aspergillus niger and 10 pathogenic organisms. Resulting mean diameter of inhibition zones revealed isolates B4 & B6 were the most potent of all the isolates. The present study has revealed the presence of high numbers of diverse culturable microorganisms associated with the marine sponges from Visakhapatnam Coast of Bay of Bengal as well as their potential to produce bioactive metabolites.

Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov.

Science.gov (United States)

Visnuvinayagam, Sivam; Thangavel, K; Lalitha, N; Malmarugan, S; Sukumar, Kuppannan

2015-01-01

Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC) system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18(th)(final) passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

Living biointerfaces based on non-pathogenic bacteria to direct cell differentiation

Science.gov (United States)

Rodrigo-Navarro, Aleixandre; Rico, Patricia; Saadeddin, Anas; Garcia, Andres J.; Salmeron-Sanchez, Manuel

2014-07-01

Genetically modified Lactococcus lactis, non-pathogenic bacteria expressing the FNIII7-10 fibronectin fragment as a protein membrane have been used to create a living biointerface between synthetic materials and mammalian cells. This FNIII7-10 fragment comprises the RGD and PHSRN sequences of fibronectin to bind α5β1 integrins and triggers signalling for cell adhesion, spreading and differentiation. We used L. lactis strain to colonize material surfaces and produce stable biofilms presenting the FNIII7-10 fragment readily available to cells. Biofilm density is easily tunable and remains stable for several days. Murine C2C12 myoblasts seeded over mature biofilms undergo bipolar alignment and form differentiated myotubes, a process triggered by the FNIII7-10 fragment. This biointerface based on living bacteria can be further modified to express any desired biochemical signal, establishing a new paradigm in biomaterial surface functionalisation for biomedical applications.

A method to quantify infectious airborne pathogens at concentrations below the threshold of quantification by culture

Science.gov (United States)

Cutler, Timothy D.; Wang, Chong; Hoff, Steven J.; Zimmerman, Jeffrey J.

2013-01-01

In aerobiology, dose-response studies are used to estimate the risk of infection to a susceptible host presented by exposure to a specific dose of an airborne pathogen. In the research setting, host- and pathogen-specific factors that affect the dose-response continuum can be accounted for by experimental design, but the requirement to precisely determine the dose of infectious pathogen to which the host was exposed is often challenging. By definition, quantification of viable airborne pathogens is based on the culture of micro-organisms, but some airborne pathogens are transmissible at concentrations below the threshold of quantification by culture. In this paper we present an approach to the calculation of exposure dose at microbiologically unquantifiable levels using an application of the “continuous-stirred tank reactor (CSTR) model” and the validation of this approach using rhodamine B dye as a surrogate for aerosolized microbial pathogens in a dynamic aerosol toroid (DAT). PMID:24082399

Pathogenic agents in freshwater resources

Science.gov (United States)

Geldreich, Edwin E.

1996-02-01

Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

Anti-microorganism contamination measures for crude drugs utilizing radiation sterilization

International Nuclear Information System (INIS)

Kimura, Syojiro

1998-01-01

Crude drugs are manufactured by simple processing of natural mineral, animal or plant part materials, and are used in Chinese medicine. Because these components are originated by nature, they tend to have a much higher level of contaminating microorganisms than chemically synthesized compound. Many plant-derived crude drugs contain bacteria; 10 3 -10 5 cells/g and fungi; 10 2 -10 4 spores/g. Some animal-derived crude drugs contain bacteria levels of up to 10 8 cells/g, including dangerous varieties like E. coli or Salmonella. The survival rate and the required dose can be quantified as follows: N/No=e -kD and SD=D 10 x log (No/SAL), respectively. Where, k is the sterilization constant of microorganism, No is the initial count of bacteria, D is the absorbed dose, D 10 is the dose required to decrease the count to 1/10 and SAL is the count limit or sterilization assurance. The D 10 value for general microorganism is approximately 2 kGy for bacteria, 1 kGy for fungi, and 3-4 kGy for spore-forming bacteria. The results of our past studies have shown that the dose of 5-7 kGy is necessary to sterilize general microorganism that are attached to crude drugs. Besides, the D 10 value of specific bacteria ranges from 0.1 to 0.8 kGy, so the above dose should be sufficient for sterilizing the specific microorganism (SAL; 10 -6 ). The stability of crude drugs can be quantified be the following formula, C/Co=e -k'D . Where, C/Co is the residual rate of drug components, and k' is the loss coefficient. The value of k is 1-2, but that of k' is three to four figures smaller. The C/Co ratio of most drug components is more than 0.99 with a dose of 5-7 kGy. Furthermore, radiolysis materials that are decomposed by radiation are similar to compounds that are decomposed by ultraviolet rays or sunlight. 60 Co ray are suitable for sterilizing raw materials. On the other hand, electron beams are used to sterilize a thin layer of pulverized specimens, and can be incorporated into the

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Pathogen-induced Caenorhabditis elegans developmental plasticity has a hormetic effect on the resistance to biotic and abiotic stresses

Directory of Open Access Journals (Sweden)

Leroy Magali

2012-09-01

Full Text Available Abstract Background Phenotypic plasticity, i.e. the capacity to change the phenotype in response to changes in the environment without alteration of the genotype, is important for coping with unstable environments. In spite of the ample evidence that microorganisms are a major environmental component playing a significant role in eukaryotic organisms health and disease, there is not much information about the effect of microorganism-induced developmental phenotypic plasticity on adult animals’ stress resistance and longevity. Results We examined the consequences of development of Caenorhabditis elegans larvae fed with different bacterial strains on stress resistance and lifespan of adult nematodes. Bacterial strains used in this study were either pathogenic or innocuous to nematodes. Exposure to the pathogen during development did not affect larval survival. However, the development of nematodes on the pathogenic bacterial strains increased lifespan of adult nematodes exposed to the same or a different pathogen. A longer nematode lifespan, developed on pathogens and exposed to pathogens as adults, did not result from an enhanced capacity to kill bacteria, but is likely due to an increased tolerance to the damage inflicted by the pathogenic bacteria. We observed that adult nematodes developed on a pathogen induce higher level of expression of the hsp-16.2 gene and have higher resistance to heat shock than nematodes developed on an innocuous strain. Therefore, the increased resistance to pathogens could be, at least partially, due to the early induction of the heat shock response in nematodes developed on pathogens. The lifespan increase is controlled by the DBL-1 transforming growth factor beta-like, DAF-2/DAF-16 insulin-like, and p38 MAP kinase pathways. Therefore, the observed modulation of adult nematode lifespans by developmental exposure to a pathogen is likely a genetically controlled response. Conclusions Our study shows that development

Resistance to cereal rusts at the plant cell wall - what can we learn from other host-pathogen systems?

NARCIS (Netherlands)

Collins, N.C.; Niks, R.E.; Schulze-Lefert, P.

2007-01-01

The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of

Adaptive value of sex in microbial pathogens.

Science.gov (United States)

Michod, Richard E; Bernstein, Harris; Nedelcu, Aurora M

2008-05-01

Explaining the adaptive value of sex is one of the great outstanding problems in biology. The challenge comes from the difficulty in identifying the benefits provided by sex, which must outweigh the substantial costs of sex. Here, we consider the adaptive value of sex in viruses, bacteria and fungi, and particularly the information available on the adaptive role of sex in pathogenic microorganisms. Our general theme is that the varied aspects of sex in pathogens illustrate the varied issues surrounding the evolution of sex generally. These include, the benefits of sex (in the short- and long-term), as well as the costs of sex (both to the host and to the pathogen). For the benefits of sex (that is, its adaptive value), we consider three hypotheses: (i) sex provides for effective and efficient recombinational repair of DNA damages, (ii) sex provides DNA for food, and (iii) sex produces variation and reduces genetic associations among alleles under selection. Although the evolution of sex in microbial pathogens illustrates these general issues, our paper is not a general review of theories for the evolution of sex in all organisms. Rather, we focus on the adaptive value of sex in microbial pathogens and conclude that in terms of short-term benefits, the DNA repair hypothesis has the most support and is the most generally applicable hypothesis in this group. In particular, recombinational repair of DNA damages may substantially benefit pathogens when challenged by the oxidative defenses of the host. However, in the long-term, sex may help get rid of mutations, increase the rate of adaptation of the population, and, in pathogens, may infrequently create new infective strains. An additional general issue about sex illustrated by pathogens is that some of the most interesting consequences of sex are not necessarily the reasons for which sex evolved. For example, antibiotic resistance may be transferred by bacterial sex, but this transfer is probably not the reason sex

Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

Directory of Open Access Journals (Sweden)

Vincent Doublet

2016-12-01

Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

Directory of Open Access Journals (Sweden)

María-José Chapela

2015-12-01

Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

Science.gov (United States)

Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

2017-02-01

Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

Electrochemically active microorganisms from an acid mine drainage-affected site promote cathode oxidation in microbial fuel cells