Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

International Nuclear Information System (INIS)

Chang, Soo-Ik; Hammes, G.G.

1989-01-01

Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles.

Science.gov (United States)

Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl

2010-07-01

CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is web server is available at http://www.cbs.dtu.dk/services/CPHmodels/.

CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

KAUST Repository

Cui, Xuefeng

2016-06-15

Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. Method: We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence–structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. Results: We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM–HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods.

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

Directory of Open Access Journals (Sweden)

Michael Andrew Meyer

2013-07-01

Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

A sensitive short read homology search tool for paired-end read sequencing data.

Science.gov (United States)

Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai

2017-10-16

Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .

Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

International Nuclear Information System (INIS)

Megeed, A.A.

2011-01-01

The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs

NARCIS (Netherlands)

Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M.

The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange

The convergence of the order sequence and the solution function sequence on fractional partial differential equation

Science.gov (United States)

Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

2018-03-01

One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

Protein backbone angle restraints from searching a database for chemical shift and sequence homology

Energy Technology Data Exchange (ETDEWEB)

Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

1999-03-15

Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

MIPS: a database for protein sequences, homology data and yeast genome information.

Science.gov (United States)

Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

1997-01-01

The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

Science.gov (United States)

Ghebremedhin, B; Layer, F; König, W; König, B

2008-03-01

The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification.

Gene Discovery through Genomic Sequencing of Brucella abortus

OpenAIRE

Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

2001-01-01

Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposit...

Relative K-homology and normal operators

DEFF Research Database (Denmark)

Manuilov, Vladimir; Thomsen, Klaus

2009-01-01

-term exact sequence which generalizes the excision six-term exact sequence in the first variable of KK-theory. Subsequently we investigate the relative K-homology which arises from the group of relative extensions by specializing to abelian $C^*$-algebras. It turns out that this relative K-homology carries...

Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

Science.gov (United States)

We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

Top-Down-Assisted Bottom-Up Method for Homologous Protein Sequencing: Hemoglobin from 33 Bird Species

Science.gov (United States)

Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.

2015-11-01

Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.

Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

Directory of Open Access Journals (Sweden)

Harsi Dewantari Kusumaningrum

2016-08-01

Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

Gene Discovery through Genomic Sequencing of Brucella abortus

Science.gov (United States)

Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

2001-01-01

Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

The OGCleaner: filtering false-positive homology clusters.

Science.gov (United States)

Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

2017-01-01

Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

Science.gov (United States)

Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

2017-01-01

Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

Delineation of the genus Actinobacillus by comparison of partial infB sequences

DEFF Research Database (Denmark)

Nørskov-Lauritsen, Niels; Christensen, H; Okkels, H.

2004-01-01

A 426 bp fragment of infB, a housekeeping gene that encodes translation initiation factor 2, was sequenced from 59 clinical isolates and type strains of Actinobacillus species and sequences were compared. Partial sequences of 16S rRNA genes were also obtained. By comparing infB sequences, Actinob...

Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

International Nuclear Information System (INIS)

Deen, K.C.; Sweet, R.W.

1986-01-01

Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

Science.gov (United States)

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

Science.gov (United States)

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

Directory of Open Access Journals (Sweden)

Mukul Sharma

2017-01-01

Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

Science.gov (United States)

Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

2013-08-01

Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

KAUST Repository

Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin

2016-01-01

Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment

Hydroquinone: O-glucosyltransferase from cultivated Rauvolfia cells: enrichment and partial amino acid sequences.

Science.gov (United States)

Arend, J; Warzecha, H; Stöckigt, J

2000-01-01

Plant cell suspension cultures of Rauvolfia are able to produce a high amount of arbutin by glucosylation of exogenously added hydroquinone. A four step purification procedure using anion exchange, hydrophobic interaction, hydroxyapatite-chromatography and chromatofocusing delivered in a yield of 0.5%, an approximately 390 fold enrichment of the involved glucosyltransferase. SDS-PAGE showed a M(r) for the enzyme of 52 kDa. Proteolysis of the pure enzyme with endoproteinase LysC revealed six peptide fragments with 9-23 amino acids which were sequenced. Sequence alignment of the six peptides showed high homologies to glycosyltransferases from other higher plants.

Outbreak tracking of Aleutian mink disease virus (AMDV) using partial NS1 gene sequencing

DEFF Research Database (Denmark)

Ryt-Hansen, Pia; Hjulsager, Charlotte Kristiane; Hagberg, E. E.

2017-01-01

. However, in 2015, several outbreaks of AMDV occurred at mink farms throughout Denmark, and the sources of these outbreaks were not known. Partial NS1 gene sequencing, phylogenetic analyses data were utilized along with epidemiological to determine the origin of the outbreaks. The phylogenetic analyses...... not be excluded. This study confirmed that partial NS1 sequencing can be used in outbreak tracking to determine major viral clusters of AMDV. Using this method, two new distinct AMDV clusters with low intra-cluster sequence diversity were identified, and epidemiological data helped to reveal possible ways...

Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

Directory of Open Access Journals (Sweden)

Jaimie-Leigh Jonker

Full Text Available Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes. It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa. Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes. Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa are more conserved within barnacles than others (20 kDa.

Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

Directory of Open Access Journals (Sweden)

Budzanivska I. G.

2014-03-01

Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

Dualities in persistent (co)homology

International Nuclear Information System (INIS)

De Silva, Vin; Morozov, Dmitriy; Vejdemo-Johansson, Mikael

2011-01-01

We consider sequences of absolute and relative homology and cohomology groups that arise naturally for a filtered cell complex. We establish algebraic relationships between their persistence modules, and show that they contain equivalent information. We explain how one can use the existing algorithm for persistent homology to process any of the four modules, and relate it to a recently introduced persistent cohomology algorithm. We present experimental evidence for the practical efficiency of the latter algorithm

Neural network and SVM classifiers accurately predict lipid binding proteins, irrespective of sequence homology.

Science.gov (United States)

Bakhtiarizadeh, Mohammad Reza; Moradi-Shahrbabak, Mohammad; Ebrahimi, Mansour; Ebrahimie, Esmaeil

2014-09-07

Due to the central roles of lipid binding proteins (LBPs) in many biological processes, sequence based identification of LBPs is of great interest. The major challenge is that LBPs are diverse in sequence, structure, and function which results in low accuracy of sequence homology based methods. Therefore, there is a need for developing alternative functional prediction methods irrespective of sequence similarity. To identify LBPs from non-LBPs, the performances of support vector machine (SVM) and neural network were compared in this study. Comprehensive protein features and various techniques were employed to create datasets. Five-fold cross-validation (CV) and independent evaluation (IE) tests were used to assess the validity of the two methods. The results indicated that SVM outperforms neural network. SVM achieved 89.28% (CV) and 89.55% (IE) overall accuracy in identification of LBPs from non-LBPs and 92.06% (CV) and 92.90% (IE) (in average) for classification of different LBPs classes. Increasing the number and the range of extracted protein features as well as optimization of the SVM parameters significantly increased the efficiency of LBPs class prediction in comparison to the only previous report in this field. Altogether, the results showed that the SVM algorithm can be run on broad, computationally calculated protein features and offers a promising tool in detection of LBPs classes. The proposed approach has the potential to integrate and improve the common sequence alignment based methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

FastBLAST: homology relationships for millions of proteins.

Directory of Open Access Journals (Sweden)

Morgan N Price

Full Text Available BACKGROUND: All-versus-all BLAST, which searches for homologous pairs of sequences in a database of proteins, is used to identify potential orthologs, to find new protein families, and to provide rapid access to these homology relationships. As DNA sequencing accelerates and data sets grow, all-versus-all BLAST has become computationally demanding. METHODOLOGY/PRINCIPAL FINDINGS: We present FastBLAST, a heuristic replacement for all-versus-all BLAST that relies on alignments of proteins to known families, obtained from tools such as PSI-BLAST and HMMer. FastBLAST avoids most of the work of all-versus-all BLAST by taking advantage of these alignments and by clustering similar sequences. FastBLAST runs in two stages: the first stage identifies additional families and aligns them, and the second stage quickly identifies the homologs of a query sequence, based on the alignments of the families, before generating pairwise alignments. On 6.53 million proteins from the non-redundant Genbank database ("NR", FastBLAST identifies new families 25 times faster than all-versus-all BLAST. Once the first stage is completed, FastBLAST identifies homologs for the average query in less than 5 seconds (8.6 times faster than BLAST and gives nearly identical results. For hits above 70 bits, FastBLAST identifies 98% of the top 3,250 hits per query. CONCLUSIONS/SIGNIFICANCE: FastBLAST enables research groups that do not have supercomputers to analyze large protein sequence data sets. FastBLAST is open source software and is available at http://microbesonline.org/fastblast.

OCCURRENCE OF SMALL HOMOLOGOUS AND COMPLEMENTARY FRAGMENTS IN HUMAN VIRUS GENOMES AND THEIR POSSIBLE ROLE

Directory of Open Access Journals (Sweden)

E. P. Kharchenko

2017-01-01

Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture

Science.gov (United States)

Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens

2013-01-01

Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

Energy Technology Data Exchange (ETDEWEB)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

Prefiltering Model for Homology Detection Algorithms on GPU.

Science.gov (United States)

Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier

2016-01-01

Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

Directory of Open Access Journals (Sweden)

David Karlin

Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

Science.gov (United States)

Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

2018-02-01

Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

Science.gov (United States)

Kuznedelov, K D; Timoshkin, O A; Goldman, E

1997-01-01

Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

Science.gov (United States)

Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

2016-07-08

The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

An artificial functional family filter in homolog searching in next-generation sequencing metagenomics.

Directory of Open Access Journals (Sweden)

Ruofei Du

Full Text Available In functional metagenomics, BLAST homology search is a common method to classify metagenomic reads into protein/domain sequence families such as Clusters of Orthologous Groups of proteins (COGs in order to quantify the abundance of each COG in the community. The resulting functional profile of the community is then used in downstream analysis to correlate the change in abundance to environmental perturbation, clinical variation, and so on. However, the short read length coupled with next-generation sequencing technologies poses a barrier in this approach, essentially because similarity significance cannot be discerned by searching with short reads. Consequently, artificial functional families are produced, in which those with a large number of reads assigned decreases the accuracy of functional profile dramatically. There is no method available to address this problem. We intended to fill this gap in this paper. We revealed that BLAST similarity scores of homologues for short reads from COG protein members coding sequences are distributed differently from the scores of those derived elsewhere. We showed that, by choosing an appropriate score cut-off, we are able to filter out most artificial families and simultaneously to preserve sufficient information in order to build the functional profile. We also showed that, by incorporated application of BLAST and RPS-BLAST, some artificial families with large read counts can be further identified after the score cutoff filtration. Evaluated on three experimental metagenomic datasets with different coverages, we found that the proposed method is robust against read coverage and consistently outperforms the other E-value cutoff methods currently used in literatures.

Sequence homolog-based molecular engineering for shifting the enzymatic pH optimum

Directory of Open Access Journals (Sweden)

Fuqiang Ma

2016-09-01

Full Text Available Cell-free synthetic biology system organizes multiple enzymes (parts from different sources to implement unnatural catalytic functions. Highly adaption between the catalytic parts is crucial for building up efficient artificial biosynthetic systems. Protein engineering is a powerful technology to tailor various enzymatic properties including catalytic efficiency, substrate specificity, temperature adaptation and even achieve new catalytic functions. However, altering enzymatic pH optimum still remains a challenging task. In this study, we proposed a novel sequence homolog-based protein engineering strategy for shifting the enzymatic pH optimum based on statistical analyses of sequence-function relationship data of enzyme family. By two statistical procedures, artificial neural networks (ANNs and least absolute shrinkage and selection operator (Lasso, five amino acids in GH11 xylanase family were identified to be related to the evolution of enzymatic pH optimum. Site-directed mutagenesis of a thermophilic xylanase from Caldicellulosiruptor bescii revealed that four out of five mutations could alter the enzymatic pH optima toward acidic condition without compromising the catalytic activity and thermostability. Combination of the positive mutants resulted in the best mutant M31 that decreased its pH optimum for 1.5 units and showed increased catalytic activity at pH < 5.0 compared to the wild-type enzyme. Structure analysis revealed that all the mutations are distant from the active center, which may be difficult to be identified by conventional rational design strategy. Interestingly, the four mutation sites are clustered at a certain region of the enzyme, suggesting a potential “hot zone” for regulating the pH optima of xylanases. This study provides an efficient method of modulating enzymatic pH optima based on statistical sequence analyses, which can facilitate the design and optimization of suitable catalytic parts for the construction

CBH1 homologs and varian CBH1 cellulase

Energy Technology Data Exchange (ETDEWEB)

Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Neefe, Paulien

2014-07-01

Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

DEFF Research Database (Denmark)

Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

2013-01-01

as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

Directory of Open Access Journals (Sweden)

Apurva Barve

2013-01-01

Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

Down-regulation of the strawberry Bet v 1-homologous allergen in concert with the flavonoid biosynthesis pathway in colorless strawberry mutant

DEFF Research Database (Denmark)

Hjernø, Karin; Alm, Rikard; Canbäck, Björn

2006-01-01

Proteomic screening of strawberry (Fragaria ananassa) yielded a 58% success rate in protein identification in spite of the fact that no genomic sequence is available for this species. This was achieved by a combination of MALDI-MS/MS de novo sequencing of double-derivatized peptides and indel......-tolerant searching against local protein databases built on both EST and full-length nucleotide sequences. The amino acid sequence of a strawberry allergen, homologous to the well-known major birch pollen allergen Bet v 1, was partially determined. This strawberry allergen, named Fra a 1 according...... to the nomenclature for allergen proteins, showed sequence identity of 54 and 77%, respectively, with corresponding allergens from birch and apple. Differential expression, as evaluated by 2-D DIGE, occurred in 10% of protein spots when red strawberries were compared to a colorless (white) strawberry mutant. White...

Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.

Science.gov (United States)

Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S

1985-07-01

The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.

A family of cell-adhering peptides homologous to fibrinogen C-termini

International Nuclear Information System (INIS)

Levy-Beladev, Liron; Levdansky, Lilia; Gaberman, Elena; Friedler, Assaf; Gorodetsky, Raphael

2010-01-01

Research highlights: → Cell-adhesive sequences homologous to fibrinogen C-termini exist in other proteins. → The extended homologous cell-adhesive C-termini peptides family is termed Haptides. → In membrane-like environment random coiled Haptides adopt a helical conformation. → Replacing positively charged residues with alanine reduces Haptides activity. -- Abstract: A family of cell-adhesive peptides homologous to sequences on different chains of fibrinogen was investigated. These homologous peptides, termed Haptides, include the peptides Cβ, preCγ, and CαE, corresponding to sequences on the C-termini of fibrinogen chains β, γ, and αE, respectively. Haptides do not affect cell survival and rate of proliferation of the normal cell types tested. The use of new sensitive assays of cell adhesion clearly demonstrated the ability of Haptides, bound to inert matrices, to mediate attachment of different matrix-dependent cell types including normal fibroblasts, endothelial, and smooth muscle cells. Here we present new active Haptides bearing homologous sequences derived from the C-termini of other proteins, such as angiopoietin 1 and 2, tenascins C and X, and microfibril-associated glycoprotein-4. The cell adhesion properties of all the Haptides were found to be associated mainly with their 11 N-terminal residues. Mutated preCγ peptides revealed that positively charged residues account for their attachment effect. These results suggest a mechanism of direct electrostatic interaction of Haptides with the cell membrane. The extended Haptides family may be applied in modulating adhesion of cells to scaffolds for tissue regeneration and for enhancement of nanoparticulate transfection into cells.

Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

Science.gov (United States)

Zhao, Ya-E; Wu, Li-Ping

2012-09-01

To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

Induction of homologous recombination in Saccharomyces cerevisiae.

Science.gov (United States)

Simon, J R; Moore, P D

1988-09-01

We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

Directory of Open Access Journals (Sweden)

Kesterson Robert A

2003-04-01

Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

A recurrent translocation is mediated by homologous recombination between HERV-H elements

Directory of Open Access Journals (Sweden)

Hermetz Karen E

2012-01-01

Full Text Available Abstract Background Chromosome rearrangements are caused by many mutational mechanisms; of these, recurrent rearrangements can be particularly informative for teasing apart DNA sequence-specific factors. Some recurrent translocations are mediated by homologous recombination between large blocks of segmental duplications on different chromosomes. Here we describe a recurrent unbalanced translocation casued by recombination between shorter homologous regions on chromosomes 4 and 18 in two unrelated children with intellectual disability. Results Array CGH resolved the breakpoints of the 6.97-Megabase (Mb loss of 18q and the 7.30-Mb gain of 4q. Sequencing across the translocation breakpoints revealed that both translocations occurred between 92%-identical human endogenous retrovirus (HERV elements in the same orientation on chromosomes 4 and 18. In addition, we find sequence variation in the chromosome 4 HERV that makes one allele more like the chromosome 18 HERV. Conclusions Homologous recombination between HERVs on the same chromosome is known to cause chromosome deletions, but this is the first report of interchromosomal HERV-HERV recombination leading to a translocation. It is possible that normal sequence variation in substrates of non-allelic homologous recombination (NAHR affects the alignment of recombining segments and influences the propensity to chromosome rearrangement.

Homology of normal chains and cohomology of charges

CERN Document Server

Pauw, Th De; Pfeffer, W F

2017-01-01

The authors consider a category of pairs of compact metric spaces and Lipschitz maps where the pairs satisfy a linearly isoperimetric condition related to the solvability of the Plateau problem with partially free boundary. It includes properly all pairs of compact Lipschitz neighborhood retracts of a large class of Banach spaces. On this category the authors define homology and cohomology functors with real coefficients which satisfy the Eilenberg-Steenrod axioms, but reflect the metric properties of the underlying spaces. As an example they show that the zero-dimensional homology of a space in our category is trivial if and only if the space is path connected by arcs of finite length. The homology and cohomology of a pair are, respectively, locally convex and Banach spaces that are in duality. Ignoring the topological structures, the homology and cohomology extend to all pairs of compact metric spaces. For locally acyclic spaces, the authors establish a natural isomorphism between their cohomology and the �...

Regulation of homologous recombination at telomeres in budding yeast

DEFF Research Database (Denmark)

Eckert-Boulet, Nadine; Lisby, Michael

2010-01-01

Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

SANSparallel: interactive homology search against Uniprot.

Science.gov (United States)

Somervuo, Panu; Holm, Liisa

2015-07-01

Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at http://ekhidna2.biocenter.helsinki.fi/cgi-bin/sans/sans.cgi. It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

Science.gov (United States)

Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

2018-03-15

The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

Science.gov (United States)

Goonesekere, Nalin Cw

2009-01-01

The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

Synthesis of a hexasaccharide partial sequence of hyaluronan for click chemistry and more

Directory of Open Access Journals (Sweden)

Marina Bantzi

2015-04-01

Full Text Available In the present work, the synthesis of a hexasaccharide partial sequence of hyaluronan equipped with a terminal azido moiety is reported. This hexasaccharide can be used for the attachment on surfaces by means of click chemistry and after suitable deprotection for biophysical studies.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

Directory of Open Access Journals (Sweden)

Nalin CW Goonesekere

2009-06-01

Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

DEFF Research Database (Denmark)

Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

2004-01-01

an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

DNA sequence explains seemingly disordered methylation levels in partially methylated domains of Mammalian genomes.

Directory of Open Access Journals (Sweden)

Dimos Gaidatzis

2014-02-01

Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.

Homology groups for particles on one-connected graphs

Science.gov (United States)

MaciÄ Żek, Tomasz; Sawicki, Adam

2017-06-01

We present a mathematical framework for describing the topology of configuration spaces for particles on one-connected graphs. In particular, we compute the homology groups over integers for different classes of one-connected graphs. Our approach is based on some fundamental combinatorial properties of the configuration spaces, Mayer-Vietoris sequences for different parts of configuration spaces, and some limited use of discrete Morse theory. As one of the results, we derive the closed-form formulae for ranks of the homology groups for indistinguishable particles on tree graphs. We also give a detailed discussion of the second homology group of the configuration space of both distinguishable and indistinguishable particles. Our motivation is the search for new kinds of quantum statistics.

Homological methods, representation theory, and cluster algebras

CERN Document Server

Trepode, Sonia

2018-01-01

This text presents six mini-courses, all devoted to interactions between representation theory of algebras, homological algebra, and the new ever-expanding theory of cluster algebras. The interplay between the topics discussed in this text will continue to grow and this collection of courses stands as a partial testimony to this new development. The courses are useful for any mathematician who would like to learn more about this rapidly developing field; the primary aim is to engage graduate students and young researchers. Prerequisites include knowledge of some noncommutative algebra or homological algebra. Homological algebra has always been considered as one of the main tools in the study of finite-dimensional algebras. The strong relationship with cluster algebras is more recent and has quickly established itself as one of the important highlights of today’s mathematical landscape. This connection has been fruitful to both areas—representation theory provides a categorification of cluster algebras, wh...

Clustering evolving proteins into homologous families.

Science.gov (United States)

Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A

2013-04-08

Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better

p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

International Nuclear Information System (INIS)

Willers, H.; Powell, S.N.; Dahm-Daphi, J.

2003-01-01

Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

Structural analysis of human complement protein H: homology with C4b binding protein, beta 2-glycoprotein I, and the Ba fragment of B2

DEFF Research Database (Denmark)

Kristensen, Torsten; Wetsel, R A; Tack, B F

1986-01-01

We report here a partial primary structure for human complement protein H. Tryptic peptides comprising 27% of the H molecule were isolated by conventional techniques and were sequenced (333 amino acid residues). Several mixed-sequence oligonucleotide probes were constructed, based on the peptide...... sequence data, and were used to screen a human liver cDNA library. The largest recombinant plasmid (pH1050), which hybridized with two probes, was further characterized. The cDNA insert of this plasmid contained coding sequence (672 bp) for 224 amino acids of H. The 3' end of this clone had...... a polyadenylated tail preceded by a polyadenylation recognition site (ATTAAA) and a 3'-untranslated region (229 bp). Four regions of internal homology, each about 60 amino acids in length, were observed in the derived protein sequence from this cDNA clone, and a further seven from the tryptic peptide sequences...

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

Comparison of the degree of homology of DNA and quantity of repeated sequences in an intact plant and cell structure

International Nuclear Information System (INIS)

Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.

1986-01-01

This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter

A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

Science.gov (United States)

Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

1996-10-01

The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

Induction of intrachromosomal homologous recombination in whole plants

International Nuclear Information System (INIS)

Puchta, H.; Swoboda, P.; Hohn, B.

1995-01-01

The influence of different factors on frequencies of intrachromosomal homologous recombination in whole Arabidopsis thaliana and tobacco plants was analyzed using a disrupted β-glucuronidase marker gene. Recombination frequencies were enhanced several fold by DNA damaging agents like UV-light or MMS (methyl methanesulfonate). Applying 3-methoxybenzamide (3-MB), an inhibitor of poly(ADP)ribose polymerase (PARP), an enzyme that is postulated to be involved in DNA repair, enhanced homologous recombination frequencies strongly. These findings indicate that homologous recombination is involved in DNA repair and can (at least partially) compensate for other DNA repair pathways. Indications that recombination in plants can be induced by environmental stress factors that are not likely to be involved in DNA metabolism were also found; Arabidopsis plants growing in a medium containing 0.1 M NaCl exhibited elevated recombination frequencies. The possible general effects of ‘environmental’ challenges on genome flexibility are discussed. (author)

Construction and partial sequencing of a subtractive library in Calcutta 4 (Musa AA in early stage of infection with Mycosphaerella fijiensis Morelet

Directory of Open Access Journals (Sweden)

Milady Mendoza-Rodríguez

2006-10-01

Full Text Available The study of genes involved in plant defense response against pathogen attack, is one of most important steps leading to the elucidation of disease resistance molecular mechanisms. The generation of subtracted deoxyribonucleic acid libraries (cDNA, by means of suppression subtractive hybridization technique (SSH, has been used for this purpose. A subtractive hybridization was made between a cDNA population obtained from ‘Calcutta 4’ inoculated leaves with M. fijiensis (CCIBP-Pf83 and a mixture of cDNA from ‘Calcutta 4’ non inoculated leaves and mycelium. Leaves samples were taken at 6, 10 and 12 days after inoculation. The subtracted library was obtained by cloning and transformation of subtracted products and as a result, 600 recombinants clones were obtained. Sequence analysis of sixty nine clones, revealed redundancy of the expressed sequence tags and most of them showed no homology with reported sequences at databases and only 13 % had a high homology with metalothioneins. The results constitute a step in advance in the molecular study of Musa-Mycosphaerella fijiensis interaction. Key words: Banana-Mycosphaerella fijiensis interaction, BlackSigatoka, Musa spp., suppression subtractive hybridization

Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

Science.gov (United States)

Kovács, Endre R; Benko, Mária

2009-03-01

Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

Partial amino acid sequence of the branched chain amino acid aminotransferase (TmB) of E. coli JA199 pDU11

International Nuclear Information System (INIS)

Feild, M.J.; Armstrong, F.B.

1987-01-01

E. coli JA199 pDU11 harbors a multicopy plasmid containing the ilv GEDAY gene cluster of S. typhimurium. TmB, gene product of ilv E, was purified, crystallized, and subjected to Edman degradation using a gas phase sequencer. The intact protein yielded an amino terminal 31 residue sequence. Both carboxymethylated apoenzyme and [ 3 H]-NaBH-reduced holoenzyme were then subjected to digestion by trypsin. The digests were fractionated using reversed phase HPLC, and the peptides isolated were sequenced. The borohydride-treated holoenzyme was used to isolate the cofactor-binding peptide. The peptide is 27 residues long and a comparison with known sequences of other aminotransferases revealed limited homology. Peptides accounting for 211 of 288 predicted residues have been sequenced, including 9 residues of the carboxyl terminus. Comparison of peptides with the inferred amino acid sequence of the E. coli K-12 enzyme has helped determine the sequence of the amino terminal 59 residues; only two differences between the sequences are noted in this region

Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

DEFF Research Database (Denmark)

Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

1985-01-01

DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

Science.gov (United States)

Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

2017-11-17

The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

MollDE: a homology modeling framework you can click with.

Science.gov (United States)

Canutescu, Adrian A; Dunbrack, Roland L

2005-06-15

Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE. http://dunbrack.fccc.edu/molide/molide.php rl_dunbrack@fccc.edu.

Investigating homology between proteins using energetic profiles.

Science.gov (United States)

Wrabl, James O; Hilser, Vincent J

2010-03-26

Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding) and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved local stability, may

Investigating homology between proteins using energetic profiles.

Directory of Open Access Journals (Sweden)

James O Wrabl

2010-03-01

Full Text Available Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved

De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

Directory of Open Access Journals (Sweden)

Geisa P.C. Evaristo

2015-09-01

Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

GPCR-SSFE: A comprehensive database of G-protein-coupled receptor template predictions and homology models

Directory of Open Access Journals (Sweden)

Kreuchwig Annika

2011-05-01

Full Text Available Abstract Background G protein-coupled receptors (GPCRs transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Description Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. Conclusions The data provided by GPCR-SSFE are useful for investigating

GPCR-SSFE: a comprehensive database of G-protein-coupled receptor template predictions and homology models.

Science.gov (United States)

Worth, Catherine L; Kreuchwig, Annika; Kleinau, Gunnar; Krause, Gerd

2011-05-23

G protein-coupled receptors (GPCRs) transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. The data provided by GPCR-SSFE are useful for investigating general and detailed sequence-structure-function relationships

Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques.

Science.gov (United States)

Staheli, Jeannette P; Dyen, Michael R; Deutsch, Gail H; Basom, Ryan S; Fitzgibbon, Matthew P; Lewis, Patrick; Barcy, Serge

2016-08-01

Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

Science.gov (United States)

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

Science.gov (United States)

Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

1994-07-01

Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

Universal sequence map (USM of arbitrary discrete sequences

Directory of Open Access Journals (Sweden)

Almeida Jonas S

2002-02-01

Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

Directory of Open Access Journals (Sweden)

M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

2006-10-01

Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

Evolutionary distance from human homologs reflects allergenicity of animal food proteins.

Science.gov (United States)

Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare

2007-12-01

In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

MetaGO: Predicting Gene Ontology of Non-homologous Proteins Through Low-Resolution Protein Structure Prediction and Protein-Protein Network Mapping.

Science.gov (United States)

Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang

2018-03-10

Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

OpenAIRE

Goonesekere, Nalin CW

2009-01-01

Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

Double Strand Break Repair, one mechanism can hide another: Alternative non-homologous end joining

International Nuclear Information System (INIS)

Rass, E.; Grabarz, A.; Bertrand, P.; Lopez, B.S.

2012-01-01

DNA double strand breaks are major cytotoxic lesions encountered by the cells. They can be induced by ionizing radiation or endogenous stress and can lead to genetic instability. Two mechanisms compete for the repair of DNA double strand breaks: homologous recombination and non-homologous end joining (NHEJ). Homologous recombination requires DNA sequences homology and is initiated by single strand resection. Recently, advances have been made concerning the major steps and proteins involved in resection. NHEJ, in contrast, does not require sequence homology. The existence of a DNA double strand break repair mechanism, independent of KU and ligase IV, the key proteins of the canonical non homologous end joining pathway, has been revealed lately and named alternative non homologous end joining. The hallmarks of this highly mutagenic pathway are deletions at repair junctions and frequent use of distal micro-homologies. This mechanism is also initiated by a single strand resection of the break. The aim of this review is firstly to present recent data on single strand resection, and secondly the alternative NHEJ pathway, including a discussion on the fidelity of NHEJ. Based on current knowledge, canonical NHEJ does not appear as an intrinsically mutagenic mechanism, but in contrast, as a conservative one. The structure of broken DNA ends actually dictates the quality repair of the alternative NHEJ and seems the actual responsible for the mutagenesis attributed beforehand to the canonical NHEJ. The existence of this novel DNA double strand breaks repair mechanism needs to be taken into account in the development of radiosensitizing strategies in order to optimise the efficiency of radiotherapy. (authors)

Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

DEFF Research Database (Denmark)

Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

2007-01-01

Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

A Label Correcting Algorithm for Partial Disassembly Sequences in the Production Planning for End-of-Life Products

Directory of Open Access Journals (Sweden)

Pei-Fang (Jennifer Tsai

2012-01-01

Full Text Available Remanufacturing of used products has become a strategic issue for cost-sensitive businesses. Due to the nature of uncertain supply of end-of-life (EoL products, the reverse logistic can only be sustainable with a dynamic production planning for disassembly process. This research investigates the sequencing of disassembly operations as a single-period partial disassembly optimization (SPPDO problem to minimize total disassembly cost. AND/OR graph representation is used to include all disassembly sequences of a returned product. A label correcting algorithm is proposed to find an optimal partial disassembly plan if a specific reusable subpart is retrieved from the original return. Then, a heuristic procedure that utilizes this polynomial-time algorithm is presented to solve the SPPDO problem. Numerical examples are used to demonstrate the effectiveness of this solution procedure.

A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

Science.gov (United States)

Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

2015-09-01

Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

International Nuclear Information System (INIS)

Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

1988-01-01

The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

Statistical alignment: computational properties, homology testing and goodness-of-fit

DEFF Research Database (Denmark)

Hein, J; Wiuf, Carsten; Møller, Martin

2000-01-01

The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical...... alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum...... analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test...

Partial Sequence Analysis of Merozoite Surface Proteine-3α Gene in Plasmodium vivax Isolates from Malarious Areas of Iran

Directory of Open Access Journals (Sweden)

H Mirhendi

2008-12-01

Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geo­graphical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.

Identification of the porcine homologous of human disease causing trinucleotide repeat sequences

DEFF Research Database (Denmark)

Madsen, Lone Bruhn; Thomsen, Bo; Sølvsten, Christina Ane Elisabeth

2007-01-01

in this paper the identification of porcine noncoding and polyglutamine-encoding TNR regions and the comparison to the homologous TNRs from human, chimpanzee, dog, opossum, rat, and mouse. Several of the porcine TNR regions are highly polymorphic both within and between different breeds. The TNR regions...

Productive homologous and non-homologous recombination of hepatitis C virus in cell culture

DEFF Research Database (Denmark)

Scheel, Troels K H; Galli, Andrea; Li, Yi-Ping

2013-01-01

. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a......) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13-36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6...

Sequencing BPS spectra

Energy Technology Data Exchange (ETDEWEB)

Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

2016-03-02

This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

Sequencing BPS spectra

International Nuclear Information System (INIS)

Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

2016-01-01

This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

Homotopic Chain Maps Have Equal s-Homology and d-Homology

Directory of Open Access Journals (Sweden)

M. Z. Kazemi-Baneh

2016-01-01

Full Text Available The homotopy of chain maps on preabelian categories is investigated and the equality of standard homologies and d-homologies of homotopic chain maps is established. As a special case, if X and Y are the same homotopy type, then their nth d-homology R-modules are isomorphic, and if X is a contractible space, then its nth d-homology R-modules for n≠0 are trivial.

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

Directory of Open Access Journals (Sweden)

Rodrigo Pessôa

Full Text Available BACKGROUND: Here, we report on the partial and full-length genomic (FLG variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs, 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP and 7 adult T-cell leukemia/lymphoma (ATLL patients, using an Illumina paired-end protocol. METHODS: Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. RESULTS: A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14 and FLG (n = 76 data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5% individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA and that 4 individuals (4.5% were infected with the Japanese sub-subtypes (aB. A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. CONCLUSIONS: This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

Science.gov (United States)

Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

2014-01-01

Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

Science.gov (United States)

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Parametric representation of centrifugal pump homologous curves

International Nuclear Information System (INIS)

Veloso, Marcelo A.; Mattos, Joao R.L. de

2015-01-01

Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

BLAST and FASTA similarity searching for multiple sequence alignment.

Science.gov (United States)

Pearson, William R

2014-01-01

BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

Isolation and characterization of rhamnose-binding lectins from eggs of steelhead trout (Oncorhynchus mykiss) homologous to low density lipoprotein receptor superfamily.

Science.gov (United States)

Tateno, H; Saneyoshi, A; Ogawa, T; Muramoto, K; Kamiya, H; Saneyoshi, M

1998-07-24

Two L-rhamnose-binding lectins named STL1 and STL2 were isolated from eggs of steelhead trout (Oncorhynchus mykiss) by affinity chromatography and ion exchange chromatography. The apparent molecular masses of purified STL1 and STL2 were estimated to be 84 and 68 kDa, respectively, by gel filtration chromatography. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and matrix-assisted laser desorption ionization time of flight mass spectrometry of these lectins revealed that STL1 was composed of noncovalently linked trimer of 31.4-kDa subunits, and STL2 was noncovalently linked trimer of 21.5-kDa subunits. The minimum concentrations of STL1, a major component, and STL2, a minor component, needed to agglutinate rabbit erythrocytes were 9 and 0.2 microg/ml, respectively. The most effective saccharide in the hemagglutination inhibition assay for both STL1 and STL2 was L-rhamnose. Saccharides possessing the same configuration of hydroxyl groups at C2 and C4 as that in L-rhamnose, such as L-arabinose and D-galactose, also inhibited. The amino acid sequence of STL2 was determined by analysis of peptides generated by digestion of the S-carboxamidomethylated protein with Achromobacter protease I or Staphylococcus aureus V8 protease. The STL2 subunit of 195 amino acid residues proved to have a unique polypeptide architecture; that is, it was composed of two tandemly repeated homologous domains (STL2-N and STL2-C) with 52% internal homology. These two domains showed a sequence homology to the subunit (105 amino acid residues) of D-galactoside-specific sea urchin (Anthocidaris crassispina) egg lectin (37% for STL2-N and 46% for STL2-C, respectively). The N terminus of the STL1 subunit was blocked with an acetyl group. However, a partial amino acid sequence of the subunit showed a sequence similarity to STL2. Moreover, STL2 also showed a sequence homology to the ligand binding domain of the vitellogenin receptor. We have also employed surface plasmon resonance biosensor

Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

1987-01-01

DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology.

Science.gov (United States)

Durrant, Jacob D; Amaro, Rommie E; Xie, Lei; Urbaniak, Michael D; Ferguson, Michael A J; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E; McCammon, J Andrew

2010-01-22

Conventional drug design embraces the "one gene, one drug, one disease" philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology.

Fall Detection for Elderly from Partially Observed Depth-Map Video Sequences Based on View-Invariant Human Activity Representation

Directory of Open Access Journals (Sweden)

Rami Alazrai

2017-03-01

Full Text Available This paper presents a new approach for fall detection from partially-observed depth-map video sequences. The proposed approach utilizes the 3D skeletal joint positions obtained from the Microsoft Kinect sensor to build a view-invariant descriptor for human activity representation, called the motion-pose geometric descriptor (MPGD. Furthermore, we have developed a histogram-based representation (HBR based on the MPGD to construct a length-independent representation of the observed video subsequences. Using the constructed HBR, we formulate the fall detection problem as a posterior-maximization problem in which the posteriori probability for each observed video subsequence is estimated using a multi-class SVM (support vector machine classifier. Then, we combine the computed posteriori probabilities from all of the observed subsequences to obtain an overall class posteriori probability of the entire partially-observed depth-map video sequence. To evaluate the performance of the proposed approach, we have utilized the Kinect sensor to record a dataset of depth-map video sequences that simulates four fall-related activities of elderly people, including: walking, sitting, falling form standing and falling from sitting. Then, using the collected dataset, we have developed three evaluation scenarios based on the number of unobserved video subsequences in the testing videos, including: fully-observed video sequence scenario, single unobserved video subsequence of random lengths scenarios and two unobserved video subsequences of random lengths scenarios. Experimental results show that the proposed approach achieved an average recognition accuracy of 93 . 6 % , 77 . 6 % and 65 . 1 % , in recognizing the activities during the first, second and third evaluation scenario, respectively. These results demonstrate the feasibility of the proposed approach to detect falls from partially-observed videos.

Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

Directory of Open Access Journals (Sweden)

Ravi Chandra Yandamuri

2014-10-01

Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

SIMULATION OF HOMOLOGOUS AND CANNIBALISTIC CORONAL MASS EJECTIONS PRODUCED BY THE EMERGENCE OF A TWISTED FLUX ROPE INTO THE SOLAR CORONA

International Nuclear Information System (INIS)

Chatterjee, Piyali; Fan, Yuhong

2013-01-01

We report the first results of a magnetohydrodynamic simulation of the development of a homologous sequence of three coronal mass ejections (CMEs) and demonstrate their so-called cannibalistic behavior. These CMEs originate from the repeated formations and partial eruptions of kink unstable flux ropes as a result of continued emergence of a twisted flux rope across the lower boundary into a pre-existing coronal potential arcade field. The simulation shows that a CME erupting into the open magnetic field created by a preceding CME has a higher speed. The second of the three successive CMEs is cannibalistic, catching up and merging with the first into a single fast CME before exiting the domain. All the CMEs including the leading merged CME, attained speeds of about 1000 km s –1 as they exit the domain. The reformation of a twisted flux rope after each CME eruption during the sustained flux emergence can naturally explain the X-ray observations of repeated reformations of sigmoids and ''sigmoid-under-cusp'' configurations at a low-coronal source of homologous CMEs

Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities

DEFF Research Database (Denmark)

Guardabassi, L.; Agersø, Yvonne

2006-01-01

-Ala : D-Ala ligase genes unrelated to vanA. In order to enhance detection of vanA-homologous genes, a third PCR step was added using primers targeting vanA in soil Paenibacillus. Sequencing of 25 clones obtained by this method allowed recovery of 23 novel sequences having 86-100% identity with van...

The PLAC1-homology region of the ZP domain is sufficient for protein polymerisation

Directory of Open Access Journals (Sweden)

Litscher Eveline S

2006-04-01

Full Text Available Abstract Background Hundreds of extracellular proteins polymerise into filaments and matrices by using zona pellucida (ZP domains. ZP domain proteins perform highly diverse functions, ranging from structural to receptorial, and mutations in their genes are responsible for a number of severe human diseases. Recently, PLAC1, Oosp1-3, Papillote and CG16798 proteins were identified that share sequence homology with the N-terminal half of the ZP domain (ZP-N, but not with its C-terminal half (ZP-C. The functional significance of this partial conservation is unknown. Results By exploiting a highly engineered bacterial strain, we expressed in soluble form the PLAC1-homology region of mammalian sperm receptor ZP3 as a fusion to maltose binding protein. Mass spectrometry showed that the 4 conserved Cys residues within the ZP-N moiety of the fusion protein adopt the same disulfide bond connectivity as in full-length native ZP3, indicating that it is correctly folded, and electron microscopy and biochemical analyses revealed that it assembles into filaments. Conclusion These findings provide a function for PLAC1-like proteins and, by showing that ZP-N is a biologically active folding unit, prompt a re-evaluation of the architecture of the ZP domain and its polymers. Furthermore, they suggest that ZP-C might play a regulatory role in the assembly of ZP domain protein complexes.

The genome BLASTatlas - a GeneWiz extension for visualization of whole-genome homology

DEFF Research Database (Denmark)

Hallin, Peter Fischer; Binnewies, Tim Terence; Ussery, David

2008-01-01

://www.cbs.dtu.dk/ws/BLASTatlas), where programming examples are available in Perl. By providing an interoperable method to carry out whole genome visualization of homology, this service offers bioinformaticians as well as biologists an easy-to-adopt workflow that can be directly called from the programming language of the user, hence......The development of fast and inexpensive methods for sequencing bacterial genomes has led to a wealth of data, often with many genomes being sequenced of the same species or closely related organisms. Thus, there is a need for visualization methods that will allow easy comparison of many sequenced...... genomes to a defined reference strain. The BLASTatlas is one such tool that is useful for mapping and visualizing whole genome homology of genes and proteins within a reference strain compared to other strains or species of one or more prokaryotic organisms. We provide examples of BLASTatlases, including...

SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

Directory of Open Access Journals (Sweden)

Zhou Yuan Wu

2013-07-01

Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.

Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

Science.gov (United States)

Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

2010-04-30

Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

Homological stabilizer codes

Energy Technology Data Exchange (ETDEWEB)

Anderson, Jonas T., E-mail: jonastyleranderson@gmail.com

2013-03-15

In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

Science.gov (United States)

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

NHE3 in an ancestral vertebrate: primary sequence, distribution, localization, and function in gills.

Science.gov (United States)

Choe, Keith P; Kato, Akira; Hirose, Shigehisa; Plata, Consuelo; Sindic, Aleksandra; Romero, Michael F; Claiborne, J B; Evans, David H

2005-11-01

In mammals, the Na+/H+ exchanger 3 (NHE3) is expressed with Na+/K+-ATPase in renal proximal tubules, where it secretes H+ and absorbs Na+ to maintain blood pH and volume. In elasmobranchs (sharks, skates, and stingrays), the gills are the dominant site of pH and osmoregulation. This study was conducted to determine whether epithelial NHE homologs exist in elasmobranchs and, if so, to localize their expression in gills and determine whether their expression is altered by environmental salinity or hypercapnia. Degenerate primers and RT-PCR were used to deduce partial sequences of mammalian NHE2 and NHE3 homologs from the gills of the euryhaline Atlantic stingray (Dasyatis sabina). Real-time PCR was then used to demonstrate that mRNA expression of the NHE3 homolog increased when stingrays were transferred to low salinities but not during hypercapnia. Expression of the NHE2 homolog did not change with either treatment. Rapid amplification of cDNA was then used to deduce the complete sequence of a putative NHE3. The 2,744-base pair cDNA includes a coding region for a 2,511-amino acid protein that is 70% identical to human NHE3 (SLC9A3). Antisera generated against the carboxyl tail of the putative stingray NHE3 labeled the apical membranes of Na+/K+-ATPase-rich epithelial cells, and acclimation to freshwater caused a redistribution of labeling in the gills. This study provides the first NHE3 cloned from an elasmobranch and is the first to demonstrate an increase in gill NHE3 expression during acclimation to low salinities, suggesting that NHE3 can absorb Na+ from ion-poor environments.

Suboptimal Partial Transmit Sequence-Active Interference Cancellation with Particle Swarm Optimization

Directory of Open Access Journals (Sweden)

Tarasak Poramate

2010-01-01

Full Text Available Active interference cancellation (AIC is an effective technique to provide interference avoidance feature for an ultrawideband (UWB OFDM transmitter. Partial transmit sequence-AIC (PTS-AIC, which was recently proposed as an improvement of AIC, requires high computational complexity by doing the exhaustive search of all possible weighting factors whose number grows exponentially with the number of subblocks used. To reduce the complexity of PTS-AIC, this paper proposes a suboptimal way, called particle swarm optimization (PSO, to choose the weighting factors suboptimally without much performance degradation. Both continuous and discrete versions of PSO have been evaluated, and it has been shown that the discrete PSO is able to reduce the complexity significantly without sacrificing the performance of PTS-AIC in many cases.

Phylogeny of the genus Haemophilus as determined by comparison of partial infB sequences

DEFF Research Database (Denmark)

Hedegaard, J; Okkels, H; Bruun, B

2001-01-01

A 453 bp fragment of infB, the gene encoding translation initiation factor 2, was sequenced and compared from 66 clinical isolates and type strains of Haemophilus species and related bacteria. Analysis of the partial infB sequences obtained suggested that the human isolates dependent on X and V...... factor, H. influenzae, H. haemolyticus, H. aegyptius and some cryptic genospecies of H. influenzae, were closely related to each other. H. parainfluenzae constituted a heterogeneous group within the boundaries of the genus, whereas H. aphrophilus/paraphrophilus and Actinobacillus actinomycetemcomitans...... were only remotely related to the type species of the genus Haemophilus H. parahaemolyticus and H. paraphrohaemolyticus took up an intermediary position and may not belong in the genus Haemophilus sensu stricto. Ambiguous results were obtained with seven isolates tentatively identified as H. segnis...

Genetic Classification and Distinguishing of Staphylococcus Species Based on Different Partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf Gene Sequences▿

Science.gov (United States)

Ghebremedhin, B.; Layer, F.; König, W.; König, B.

2008-01-01

The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (∼931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (∼97%), rpoB (∼86%), hsp60 (∼82%), and sodA (∼78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification. PMID:18174295

Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

Directory of Open Access Journals (Sweden)

Jana Žiarovská

2015-05-01

Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

Homologies between the amino acid sequences of some vertebrate peptide hormones and peptides isolated from invertebrate sources.

Science.gov (United States)

De Loof, A; Schoofs, L

1990-01-01

1. The 4K-prothoracicotropic hormone (PTTH) or bombyxin and the melanization-reddish coloration hormone of the silkworm Bombyx mori resemble insulin and insulin-like growth factors. 2. The family of adipokinetic/red pigment concentrating hormones has some similarity with glucagon. 3. Members of the FMRFamide family are found in vertebrates as well as in invertebrates. 4. In Locusta, a molecule immunologically and biologically related to amphibian melanophore stimulating hormone has been partially characterized. 5. Enkephalins and enkephalin-related peptides occur in insects and other invertebrates. 6. Peptides belonging to the tachykinin family have been isolated from molluscan (Octopus) salivary glands and from insect nervous tissue (Locusta migratoria). 7. Invertebrate arginine-vasotocin homologs have been isolated from an insect (Locusta migratoria) and from a mollusc (Conus). 8. In Leucophaea, Locusta and Drosophila, peptides resembling those of the vertebrate gastrin/cholecystokinin family have been identified. 9. As the number of different neuro-/gut peptides with possible function(s) as hormone, neurotransmitter or neuromodulator is now estimated to be of the order of a few hundred, more similarities will probably show up in the near future.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

Science.gov (United States)

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.

Science.gov (United States)

Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D

1993-01-01

Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

Polar representation of centrifugal pump homologous curves

International Nuclear Information System (INIS)

Veloso, Marcelo Antonio; Mattos, Joao Roberto Loureiro de

2008-01-01

Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic parameters: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. Any one of these quantities can be expressed as a function of any two others. The curves showing the relationships between these four variables are called the pump characteristic curves, also referred to as four-quadrant curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, the four-quadrant configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the polar form appears as the simplest way to represent the homologous curves. In the polar method, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a

Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

Directory of Open Access Journals (Sweden)

Ujjwal Maulik

Full Text Available Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon request.sarkar@labri.fr.

In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

Directory of Open Access Journals (Sweden)

ERTUĞRUL FILIZ

2014-04-01

Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

Science.gov (United States)

Galián, José A; Rosato, Marcela; Rosselló, Josep A

2014-03-01

Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

African Journals Online (AJOL)

Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

International Nuclear Information System (INIS)

Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

1987-01-01

A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

FBH1 helicase disrupts RAD51 filaments in vitro and modulates homologous recombination in mammalian cells

DEFF Research Database (Denmark)

Simandlova, Jitka; Zagelbaum, Jennifer; Payne, Miranda J

2013-01-01

Efficient repair of DNA double strand breaks and interstrand cross-links requires the homologous recombination (HR) pathway, a potentially error-free process that utilizes a homologous sequence as a repair template. A key player in HR is RAD51, the eukaryotic ortholog of bacterial RecA protein. RAD......51 can polymerize on DNA to form a nucleoprotein filament that facilitates both the search for the homologous DNA sequences and the subsequent DNA strand invasion required to initiate HR. Because of its pivotal role in HR, RAD51 is subject to numerous positive and negative regulatory influences...... filaments on DNA through its ssDNA translocase function. Consistent with this, a mutant mouse embryonic stem cell line with a deletion in the FBH1 helicase domain fails to limit RAD51 chromatin association and shows hyper-recombination. Our data are consistent with FBH1 restraining RAD51 DNA binding under...

Emergence of Noroviruses homologous to strains reported from Djibouti (horn of Africa), Brazil, Italy, Japan and USA among children in Kolkata, India.

Science.gov (United States)

Nataraju, S M; Ganesh, B; Das, S; Chowdhury, S; Nayak, M K; Ghosh, M; Chatterjee, M K; Sarkar, U; Mitra, U; Bhattacharya, M K; Arora, R; Kobayashi, N; Krishnan, T

2010-09-01

A total of 625 faecal specimens of diarrheic cases (n-313) and non diarrheic controls (n-312), were screened by RT-PCR to detect Noroviruses in children aged below 5 years in Kolkata, India. Out of the 313 fecal specimens (cases) screened using CDC primer set, 10 (3.19%) showed amplification in reverse transcription-polymerase chain reaction (RT-PCR) for Norovirus. These included 5 of 260 (1.92%) from hospitalized and 5 of 53 (9.43%) from out patients departament (OPD) cases. Nine (90%) of Norovirus positive cases belonged to genogroup GII and one specimen (10%) was positive for genogroup GI. Among the 312 non diarrheic controls 2 (0.63%) were positive for Norovirus GII. Partial RNA dependent RNA polymerase gene (RdRp) sequences corresponding to the six Norovirus GII positive samples showed homology to the sequences of Djibouti (horn of Africa), Brazil, Italy, Japan and US norovirus strains. This study shows the detection of newly emerging Norovirus strains among diarrheic and non diarrheic children in Kolkata.

Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

Directory of Open Access Journals (Sweden)

Morrical Scott W

2010-12-01

Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

Science.gov (United States)

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

Science.gov (United States)

Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

2011-01-01

The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause.

Science.gov (United States)

Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M

2014-12-01

A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

Science.gov (United States)

Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

1994-10-01

Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

Science.gov (United States)

Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

2016-11-01

Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

Function of Rad51 paralogs in eukaryotic homologous recombinational repair

International Nuclear Information System (INIS)

Liu, N.; Skowronek, K.

2003-01-01

Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR

A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

Science.gov (United States)

Dhanasekar, P; Reddy, K S

2015-02-01

Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

Energy Technology Data Exchange (ETDEWEB)

Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

2010-08-27

Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

Allergenic characterization of a novel allergen, homologous to chymotrypsin, from german cockroach.

Science.gov (United States)

Jeong, Kyoung Yong; Son, Mina; Lee, Jae Hyun; Hong, Chein Soo; Park, Jung Won

2015-05-01

Cockroach feces are known to be rich in IgE-reactive components. Various protease allergens were identified by proteomic analysis of German cockroach fecal extract in a previous study. In this study, we characterized a novel allergen, a chymotrypsin-like serine protease. A cDNA sequence homologous to chymotrypsin was obtained by analysis of German cockroach expressed sequence tag (EST) clones. The recombinant chymotrypsins from the German cockroach and house dust mite (Der f 6) were expressed in Escherichia coli using the pEXP5NT/TOPO vector system, and their allergenicity was investigated by ELISA. The deduced amino acid sequence of German cockroach chymotrypsin showed 32.7 to 43.1% identity with mite group 3 (trypsin) and group 6 (chymotrypsin) allergens. Sera from 8 of 28 German cockroach allergy subjects (28.6%) showed IgE binding to the recombinant protein. IgE binding to the recombinant cockroach chymotrypsin was inhibited by house dust mite chymotrypsin Der f 6, while it minimally inhibited the German cockroach whole body extract. A novel allergen homologous to chymotrypsin was identified from the German cockroach and was cross-reactive with Der f 6.

Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

Directory of Open Access Journals (Sweden)

Margaret L Hoang

2010-12-01

Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

Pure homology of algebraic varieties

OpenAIRE

Weber, Andrzej

2003-01-01

We show that for a complete complex algebraic variety the pure component of homology coincides with the image of intersection homology. Therefore pure homology is topologically invariant. To obtain slightly more general results we introduce "image homology" for noncomplete varieties.

Lectures on functor homology

CERN Document Server

Touzé, Antoine

2015-01-01

This book features a series of lectures that explores three different fields in which functor homology (short for homological algebra in functor categories) has recently played a significant role. For each of these applications, the functor viewpoint provides both essential insights and new methods for tackling difficult mathematical problems. In the lectures by Aurélien Djament, polynomial functors appear as coefficients in the homology of infinite families of classical groups, e.g. general linear groups or symplectic groups, and their stabilization. Djament’s theorem states that this stable homology can be computed using only the homology with trivial coefficients and the manageable functor homology. The series includes an intriguing development of Scorichenko’s unpublished results. The lectures by Wilberd van der Kallen lead to the solution of the general cohomological finite generation problem, extending Hilbert’s fourteenth problem and its solution to the context of cohomology. The focus here is o...

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

International Nuclear Information System (INIS)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

1987-01-01

The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

Evolutionary relationships in Aspergillus section Fumigati inferred from partial beta-tubulin and hydrophobin sequences

DEFF Research Database (Denmark)

Geiser, D.M.; Frisvad, Jens Christian; Taylor, J.W.

1998-01-01

are heterothallic. Phylogenetic relationships were inferred among members of Aspergillus section Fumigati based on partial DNA sequences from the benA beta-tubulin and rodA hydrophobin genes. Aspergillus clavatus was chosen as an outgroup. The two gene regions provided nearly equal numbers of phylogenetically...... informative nucleotide characters. The rodA region possessed a considerably higher level of inferred amino acid variation than did the benA region. The results of a partition homogeneity test showed that the benA and rodA data sets were not in significant conflict, and the topologies of the most parsimonious...

Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

Directory of Open Access Journals (Sweden)

Weilong Hao

Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

DipoCoup: A versatile program for 3D-structure homology comparison based on residual dipolar couplings and pseudocontact shifts

International Nuclear Information System (INIS)

Meiler, Jens; Peti, Wolfgang; Griesinger, Christian

2000-01-01

A program, DipoCoup, is presented that allows to search the protein data bank for proteins which have a three dimensional fold that is at least partially homologous to a protein under investigation. The three dimensional homology search uses secondary structure alignment based on chemical shifts and dipolar couplings or pseudocontact shifts for the three dimensional orientation of secondary structure elements. Moreover, the program offers additional tools for handling and analyzing dipolar couplings

Homology modelling and docking analysis of L-lactate dehydrogenase from Streptococcus thermopilus

Directory of Open Access Journals (Sweden)

Vukić Vladimir R.

2016-01-01

Full Text Available The aim of this research was to create a three-dimensional model of L-lactate dehydrogenase from the main yoghurt starter culture - Streptococcus thermopilus, to analyse its structural features and investigate substrate binding in the active site. NCBI BlastP was used against the Protein Data Bank database in order to identify the template for construction of homology models. Multiple sequence alignment was performed using the program MUSCULE within the UGENE 1.11.3 program. Homology models were constructed using the program Modeller v. 9.17. The obtained 3D model was verified by Ramachandran plots. Molecular docking simulations were performed using the program Surflex-Dock. The highest sequence similarity was observed with L-lactate dehydrogenase from Lactobacillus casei subsp. casei, with 69% identity. Therefore, its structure (PDB ID: 2ZQY:A was selected as a modelling template for homology modelling. Active residues are by sequence similarity predicted: S. thermophilus - HIS181 and S. aureus - HIS179. Binding energy of pyruvate to L-lactate dehydrogenase of S. thermopilus was - 7.874 kcal/mol. Pyruvate in L-lactate dehydrogenase of S. thermopilus makes H bonds with catalytic HIS181 (1.9 Å, as well as with THR235 (3.6 Å. Although our results indicate similar position of substrates between L-lactate dehydrogenase of S. thermopilus and S. aureus, differences in substrate distances and binding energy values could influence the reaction rate. Based on these results, the L-lactate dehydrogenase model proposed here could be used as a guide for further research, such as transition states of the reaction through molecular dynamics. [Projekat Ministarstva nauke Republike Srbije, br. III 46009

MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

KAUST Repository

Kosinski, Jan; Barbato, Alessandro; Tramontano, Anna

2013-01-01

SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

KAUST Repository

Kosinski, Jan

2013-02-08

SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

Energy Technology Data Exchange (ETDEWEB)

Wei, D; Andrews, G K

1988-01-25

A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

Isolation, sequence identification and tissue expression profile of a ...

African Journals Online (AJOL)

The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

International Nuclear Information System (INIS)

Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

1988-01-01

cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

Science.gov (United States)

Mello-Sampayo, T

1973-01-01

Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary

The HMMER Web Server for Protein Sequence Similarity Search.

Science.gov (United States)

Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

2017-12-08

Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models.

Science.gov (United States)

Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson

2011-03-23

Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

Science.gov (United States)

Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

2018-01-01

We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

Mod two homology and cohomology

CERN Document Server

Hausmann, Jean-Claude

2014-01-01

Cohomology and homology modulo 2 helps the reader grasp more readily the basics of a major tool in algebraic topology. Compared to a more general approach to (co)homology this refreshing approach has many pedagogical advantages: It leads more quickly to the essentials of the subject, An absence of signs and orientation considerations simplifies the theory, Computations and advanced applications can be presented at an earlier stage, Simple geometrical interpretations of (co)chains. Mod 2 (co)homology was developed in the first quarter of the twentieth century as an alternative to integral homology, before both became particular cases of (co)homology with arbitrary coefficients. The first chapters of this book may serve as a basis for a graduate-level introductory course to (co)homology. Simplicial and singular mod 2 (co)homology are introduced, with their products and Steenrod squares, as well as equivariant cohomology. Classical applications include Brouwer's fixed point theorem, Poincaré duality, Borsuk-Ula...

HOMOLOGY BETWEEN SEGMENTS OF HUMAN HEMOSTATIC PROTEINS AND PROTEINS OF VIRUSES WHICH CAUSE ACUTE RESPIRATORY INFECTIONS OR DISEASES WITH SIMILAR SYMPTOMS

Directory of Open Access Journals (Sweden)

I. N. Zhilinskaya

2017-01-01

Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and www.nextprot.org databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

Science.gov (United States)

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

Science.gov (United States)

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Physical properties of layered homologous RE-B-C(N) compounds

International Nuclear Information System (INIS)

Mori, Takao; Zhang Fuxiang; Leithe-Jasper, Andreas

2004-01-01

Physical properties of a series of homologous RE-B-C(N) B 12 cluster compounds REB 17 CN, REB 22 C 2 N, and REB 28.5 C 4 (RE=Er,Ho) were investigated. The structures of the compounds are layer-like along the c-axis, with rare earth and B 6 octahedral layers separated by B 12 icosahedral and C-B-C chain layers whose number increases successively from two B 12 layers for the REB 17 CN compound to four for the REB 28.5 C 4 compound. The rare earth atoms are configured in two triangular flat layers which are stacked on top of one another in AB stacking where the nearest-neighbor rare earth directions are the three atoms forming a triangle in the adjacent layer. The series of homologous compounds exhibit a spin glass transition with T f shifting in correspondence with variations of the basal plane lattice constants, consistent with the magnetic interaction being effective in the basal planes. The isothermal remanent magnetization shows a stretched exponential decay I m (t)∝ exp[-Ct -(1-n) ]. Exponents determined for the different homologous compounds were scaled as a function of T r =T/T f and found to follow the empirical dependency determined for typical spin glasses. It is indicated that a mixture of disorder originating from the partial occupancy of the rare earth sites and frustration of interactions due to the unique configuration is responsible for the manifestation of spin glass transitions in these homologous systems

Partial volume effect in MRI

International Nuclear Information System (INIS)

Maeda, Munehiro; Yoshiya, Kazuhiko; Suzuki, Eiji

1989-01-01

According to the direction and the thickness of the imaging slice in tomography, the border between the tissues becomes unclear (partial volume effect). In the present MRI experiment, we examined border area between fat and water components using phantom in order to investigate the partial volume effect in MRI. In spin echo sequences, the intensity of the border area showed a linear relationship with composition of fat and water. Whereas, in inversion recovery and field echo sequences, we found the parameters to produce an extremely low intensity area at the border region between fat and water. This low intensity area was explained by cancellation of NMR signals from fat and water due to the difference in the direction of magnetic vectors. Clinically, partial volume effect can cause of mis-evaluation of walls, small nodules, tumor capsules and the tumor invasion in the use of inversion recovery and field echo sequences. (author)

High-precision, whole-genome sequencing of laboratory strains facilitates genetic studies.

Directory of Open Access Journals (Sweden)

Anjana Srivatsan

2008-08-01

Full Text Available Whole-genome sequencing is a powerful technique for obtaining the reference sequence information of multiple organisms. Its use can be dramatically expanded to rapidly identify genomic variations, which can be linked with phenotypes to obtain biological insights. We explored these potential applications using the emerging next-generation sequencing platform Solexa Genome Analyzer, and the well-characterized model bacterium Bacillus subtilis. Combining sequencing with experimental verification, we first improved the accuracy of the published sequence of the B. subtilis reference strain 168, then obtained sequences of multiple related laboratory strains and different isolates of each strain. This provides a framework for comparing the divergence between different laboratory strains and between their individual isolates. We also demonstrated the power of Solexa sequencing by using its results to predict a defect in the citrate signal transduction pathway of a common laboratory strain, which we verified experimentally. Finally, we examined the molecular nature of spontaneously generated mutations that suppress the growth defect caused by deletion of the stringent response mediator relA. Using whole-genome sequencing, we rapidly mapped these suppressor mutations to two small homologs of relA. Interestingly, stable suppressor strains had mutations in both genes, with each mutation alone partially relieving the relA growth defect. This supports an intriguing three-locus interaction module that is not easily identifiable through traditional suppressor mapping. We conclude that whole-genome sequencing can drastically accelerate the identification of suppressor mutations and complex genetic interactions, and it can be applied as a standard tool to investigate the genetic traits of model organisms.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

Energy Technology Data Exchange (ETDEWEB)

Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

Science.gov (United States)

Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

2013-11-01

In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

Science.gov (United States)

Shi, Jinming

In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

Amblyomma americanum salivary gland homolog of nSec1 is essential for saliva protein secretion

International Nuclear Information System (INIS)

Karim, Shahid; Ramakrishnan, Vijay G.; Tucker, James S.; Essenberg, Richard C.; Sauer, John R.

2004-01-01

Soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins assemble in tight core complexes which promote fusion of carrier vesicles with target compartments. Members of this class of proteins are expressed in all eukaryotic cells and distributed in distinct subcellular compartments. All vesicle transport mechanisms known to date have an essential requirement for a member of the Sec1 protein family, including the nSec1 in regulated exocytosis. A homolog of nSec1 was cloned and sequenced from the salivary glands of partially fed female ticks. Double-stranded RNA was used to specifically reduce the amount of nSec1 mRNA and protein in female adult tick salivary glands. This reduction was accompanied by a decrease in anticoagulant protein release by the glands and by abnormalities in feeding by dsRNA treated ticks. We report the efficacy of double-stranded RNA-mediated interference in 'knocking down' nSec1 both in vivo and in vitro in tick salivary glands and the applicability of this technique for studying the mechanism of exocytosis in tick salivary glands

Efficient Detection of Copy Number Mutations in PMS2 Exons with a Close Homolog.

Science.gov (United States)

Herman, Daniel S; Smith, Christina; Liu, Chang; Vaughn, Cecily P; Palaniappan, Selvi; Pritchard, Colin C; Shirts, Brian H

2018-07-01

Detection of 3' PMS2 copy-number mutations that cause Lynch syndrome is difficult because of highly homologous pseudogenes. To improve the accuracy and efficiency of clinical screening for these mutations, we developed a new method to analyze standard capture-based, next-generation sequencing data to identify deletions and duplications in PMS2 exons 9 to 15. The approach captures sequences using PMS2 targets, maps sequences randomly among regions with equal mapping quality, counts reads aligned to homologous exons and introns, and flags read count ratios outside of empirically derived reference ranges. The method was trained on 1352 samples, including 8 known positives, and tested on 719 samples, including 17 known positives. Clinical implementation of the first version of this method detected new mutations in the training (N = 7) and test (N = 2) sets that had not been identified by our initial clinical testing pipeline. The described final method showed complete sensitivity in both sample sets and false-positive rates of 5% (training) and 7% (test), dramatically decreasing the number of cases needing additional mutation evaluation. This approach leveraged the differences between gene and pseudogene to distinguish between PMS2 and PMS2CL copy-number mutations. These methods enable efficient and sensitive Lynch syndrome screening for 3' PMS2 copy-number mutations and may be applied similarly to other genomic regions with highly homologous pseudogenes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

DSAP: deep-sequencing small RNA analysis pipeline.

Science.gov (United States)

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

Directory of Open Access Journals (Sweden)

Johannes Asplund-Samuelsson

Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae)

Science.gov (United States)

2014-01-01

Background Anopheles sinensis is the major malaria vector in China and Southeast Asia. Vector control is one of the most effective measures to prevent malaria transmission. However, there is little transcriptome information available for the malaria vector. To better understand the biological basis of malaria transmission and to develop novel and effective means of vector control, there is a need to build a transcriptome dataset for functional genomics analysis by large-scale RNA sequencing (RNA-seq). Methods To provide a more comprehensive and complete transcriptome of An. sinensis, eggs, larvae, pupae, male adults and female adults RNA were pooled together for cDNA preparation, sequenced using the Illumina paired-end sequencing technology and assembled into unigenes. These unigenes were then analyzed in their genome mapping, functional annotation, homology, codon usage bias and simple sequence repeats (SSRs). Results Approximately 51.6 million clean reads were obtained, trimmed, and assembled into 38,504 unigenes with an average length of 571 bp, an N50 of 711 bp, and an average GC content 51.26%. Among them, 98.4% of unigenes could be mapped onto the reference genome, and 69% of unigenes could be annotated with known biological functions. Homology analysis identified certain numbers of An. sinensis unigenes that showed homology or being putative 1:1 orthologues with genomes of other Dipteran species. Codon usage bias was analyzed and 1,904 SSRs were detected, which will provide effective molecular markers for the population genetics of this species. Conclusions Our data and analysis provide the most comprehensive transcriptomic resource and characteristics currently available for An. sinensis, and will facilitate genetic, genomic studies, and further vector control of An. sinensis. PMID:25000941

Protein homology model refinement by large-scale energy optimization.

Science.gov (United States)

Park, Hahnbeom; Ovchinnikov, Sergey; Kim, David E; DiMaio, Frank; Baker, David

2018-03-20

Proteins fold to their lowest free-energy structures, and hence the most straightforward way to increase the accuracy of a partially incorrect protein structure model is to search for the lowest-energy nearby structure. This direct approach has met with little success for two reasons: first, energy function inaccuracies can lead to false energy minima, resulting in model degradation rather than improvement; and second, even with an accurate energy function, the search problem is formidable because the energy only drops considerably in the immediate vicinity of the global minimum, and there are a very large number of degrees of freedom. Here we describe a large-scale energy optimization-based refinement method that incorporates advances in both search and energy function accuracy that can substantially improve the accuracy of low-resolution homology models. The method refined low-resolution homology models into correct folds for 50 of 84 diverse protein families and generated improved models in recent blind structure prediction experiments. Analyses of the basis for these improvements reveal contributions from both the improvements in conformational sampling techniques and the energy function.

Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

Directory of Open Access Journals (Sweden)

Kenji Sonomoto

2006-03-01

Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

Protein Function Prediction Based on Sequence and Structure Information

KAUST Repository

Smaili, Fatima Z.

2016-05-25

The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

The colocalization transition of homologous chromosomes at meiosis

Science.gov (United States)

Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

2008-06-01

Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

Recurrent Partial Words

Directory of Open Access Journals (Sweden)

Francine Blanchet-Sadri

2011-08-01

Full Text Available Partial words are sequences over a finite alphabet that may contain wildcard symbols, called holes, which match or are compatible with all letters; partial words without holes are said to be full words (or simply words. Given an infinite partial word w, the number of distinct full words over the alphabet that are compatible with factors of w of length n, called subwords of w, refers to a measure of complexity of infinite partial words so-called subword complexity. This measure is of particular interest because we can construct partial words with subword complexities not achievable by full words. In this paper, we consider the notion of recurrence over infinite partial words, that is, we study whether all of the finite subwords of a given infinite partial word appear infinitely often, and we establish connections between subword complexity and recurrence in this more general framework.

Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

Directory of Open Access Journals (Sweden)

Yushen Du

2016-11-01

Full Text Available Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp, we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available.

Origin and spread of photosynthesis based upon conserved sequence features in key bacteriochlorophyll biosynthesis proteins.

Science.gov (United States)

Gupta, Radhey S

2012-11-01

The origin of photosynthesis and how this capability has spread to other bacterial phyla remain important unresolved questions. I describe here a number of conserved signature indels (CSIs) in key proteins involved in bacteriochlorophyll (Bchl) biosynthesis that provide important insights in these regards. The proteins BchL and BchX, which are essential for Bchl biosynthesis, are derived by gene duplication in a common ancestor of all phototrophs. More ancient gene duplication gave rise to the BchX-BchL proteins and the NifH protein of the nitrogenase complex. The sequence alignment of NifH-BchX-BchL proteins contain two CSIs that are uniquely shared by all NifH and BchX homologs, but not by any BchL homologs. These CSIs and phylogenetic analysis of NifH-BchX-BchL protein sequences strongly suggest that the BchX homologs are ancestral to BchL and that the Bchl-based anoxygenic photosynthesis originated prior to the chlorophyll (Chl)-based photosynthesis in cyanobacteria. Another CSI in the BchX-BchL sequence alignment that is uniquely shared by all BchX homologs and the BchL sequences from Heliobacteriaceae, but absent in all other BchL homologs, suggests that the BchL homologs from Heliobacteriaceae are primitive in comparison to all other photosynthetic lineages. Several other identified CSIs in the BchN homologs are commonly shared by all proteobacterial homologs and a clade consisting of the marine unicellular Cyanobacteria (Clade C). These CSIs in conjunction with the results of phylogenetic analyses and pair-wise sequence similarity on the BchL, BchN, and BchB proteins, where the homologs from Clade C Cyanobacteria and Proteobacteria exhibited close relationship, provide strong evidence that these two groups have incurred lateral gene transfers. Additionally, phylogenetic analyses and several CSIs in the BchL-N-B proteins that are uniquely shared by all Chlorobi and Chloroflexi homologs provide evidence that the genes for these proteins have also been

High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

Directory of Open Access Journals (Sweden)

Mikihiko eKawai

2014-03-01

Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

Gene mining a marama bean expressed sequence tags (ESTs ...

African Journals Online (AJOL)

The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...

Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

Energy Technology Data Exchange (ETDEWEB)

Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.

1983-01-01

The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

DEFF Research Database (Denmark)

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

2007-01-01

BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

Identification and partial characterization of Taastrup virus: a newly identified member species of the Mononegavirales

International Nuclear Information System (INIS)

Bock, J.O.; Lundsgaard, T.; Pedersen, P.A.; Christensen, L.S.

2004-01-01

We present a 8904-nt sequence of the central part of the RNA genome of a novel virus with a filovirus-like, nonidentical morphology named Taastrup virus (TV) detected in the leafhopper Psammotettix alienus. Sequence analysis identified five potential open reading frames (ORFs) and a complex pattern of homologies to various members of the Mononegavirales suggests a genome organization with the following order of genes: 3'-N-P-M-G-L-5'. Sequence analyses reveal an unusually large glycoprotein (G) containing both potential O-linked (14) and N-linked (9) glycosylation sites--a feature shared with the glycoproteins of Filoviridae and Pneumovirinae, and a nucleoprotein (N) with homology to the nucleoprotein of viral hemorrhagic septicemia virus (VHSV), a member of the Rhabdoviridae. Highly conserved domains were identified in the RNA-dependent RNA polymerase (L) between TV and other viruses within the order of Mononegavirales, and homology was found in particular with members of the Rhabdoviridae. The sequence similarities and the unique filovirus-like but nonidentical morphology unambiguously refer this newly identified virus to the order of Mononegavirales but to no family more than any, to other within the order

Analysis of the role of homology arms in gene-targeting vectors in human cells.

Directory of Open Access Journals (Sweden)

Ayako Ishii

Full Text Available Random integration of targeting vectors into the genome is the primary obstacle in human somatic cell gene targeting. Non-homologous end-joining (NHEJ, a major pathway for repairing DNA double-strand breaks, is thought to be responsible for most random integration events; however, absence of DNA ligase IV (LIG4, the critical NHEJ ligase, does not significantly reduce random integration frequency of targeting vector in human cells, indicating robust integration events occurring via a LIG4-independent mechanism. To gain insights into the mechanism and robustness of LIG4-independent random integration, we employed various types of targeting vectors to examine their integration frequencies in LIG4-proficient and deficient human cell lines. We find that the integration frequency of targeting vector correlates well with the length of homology arms and with the amount of repetitive DNA sequences, especially SINEs, present in the arms. This correlation was prominent in LIG4-deficient cells, but was also seen in LIG4-proficient cells, thus providing evidence that LIG4-independent random integration occurs frequently even when NHEJ is functionally normal. Our results collectively suggest that random integration frequency of conventional targeting vectors is substantially influenced by homology arms, which typically harbor repetitive DNA sequences that serve to facilitate LIG4-independent random integration in human cells, regardless of the presence or absence of functional NHEJ.

Sequence of human protamine 2 cDNA

Energy Technology Data Exchange (ETDEWEB)

Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

MRI of intracerebral haematoma at low field (0.15T) using T2 dependent partial saturation sequences

International Nuclear Information System (INIS)

Bydder, G.M.; Pennock, J.M.; Porteous, R.; Dubowitz, L.M.S.; Gadian, D.G.; Young, I.R.

1988-01-01

Results of MRI at 0.15T in twelve successive patients with intracerebral haematoma are reviewed. Using T 2 weighted spin echo (SE) and partial saturation (PS without a refocussing 180 0 pulse) sequences, low intensity areas were seen in eleven of the twelve cases. These included central regions (three cases), a peripheral rim (seven cases) and more diffuse patterns involving the brainstem and cerebral hemispheres (two cases). One case initially displayed a peripheral rim and later a central low intensity region. Central low intensity regions were seen in acute, subacute, and chronic cases. Follow up in five cases displayed an increase in signal within the haematoma in three cases and a decrease in signal intensity in two cases. Low signal intensity areas can be seen within and around intracerebral haematomas imaged with T 2 weighted sequences at low field strength. (orig.)

Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

Directory of Open Access Journals (Sweden)

Marc Lenoir

2015-10-01

Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.

Science.gov (United States)

Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

2015-10-23

The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

Science.gov (United States)

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-11

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

Human acid β-glucosidase: isolation and amino acid sequence of a peptide containing the catalytic site

International Nuclear Information System (INIS)

Dinur, T.; Osiecki, K.M.; Legler, G.; Gatt, S.; Desnick, R.J.; Grabowski, G.A.

1986-01-01

Human acid β-glucosidase (D-glucosyl-N-acylsphingosine glucohydrolase, EC 3.2.1.45) cleaves the glucosidic bonds of glucosylceramide and synthetic β-glucosides. The deficient activity of this hydrolase is the enzymatic defect in the subtypes and variants of Gaucher disease, the most prevalent lysosomal storage disease. To isolate and characterize the catalytic site of the normal enzyme, brominated 3 H-labeled conduritol B epoxide ( 3 H-Br-CBE), which inhibits the enzyme by binding covalently to this site, was used as an affinity label. Under optimal conditions 1 mol of 3 H-Br-CBE bound to 1 mol of pure enzyme protein, indicating the presence of a single catalytic site per enzyme subunit. After V 8 protease digestion of the 3 H-Br-CBE-labeled homogeneous enzyme, three radiolabeled peptides, designated peptide A, B, or C, were resolved by reverse-phase HPLC. The partial amino acid sequence (37 residues) of peptide A (M/sub r/, 5000) was determined. The sequence of this peptide, which contained the catalytic site, had exact homology to the sequence near the carboxyl terminus of the protein, as predicted from the nucleotide sequence of the full-length cDNA encoding acid β-glucosidase

Conservation of the glycoprotein B homologs of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) and Old World primate rhadinoviruses of chimpanzees and macaques

Science.gov (United States)

Bruce, A. Gregory; Horst, Jeremy A.; Rose, Timothy M.

2016-01-01

The envelope-associated glycoprotein B (gB) is highly conserved within the Herpesviridae and plays a critical role in viral entry. We analyzed the evolutionary conservation of sequence and structural motifs within the Kaposi’s sarcoma-associated herpesvirus (KSHV) gB and homologs of Old World primate rhadinoviruses belonging to the distinct RV1 and RV2 rhadinovirus lineages. In addition to gB homologs of rhadinoviruses infecting the pig-tailed and rhesus macaques, we cloned and sequenced gB homologs of RV1 and RV2 rhadinoviruses infecting chimpanzees. A structural model of the KSHV gB was determined, and functional motifs and sequence variants were mapped to the model structure. Conserved domains and motifs were identified, including an “RGD” motif that plays a critical role in KSHV binding and entry through the cellular integrin αVβ3. The RGD motif was only detected in RV1 rhadinoviruses suggesting an important difference in cell tropism between the two rhadinovirus lineages. PMID:27070755

Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

Science.gov (United States)

Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

2016-09-01

Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

Directory of Open Access Journals (Sweden)

Amit Kumar Dubey

2010-01-01

Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria

Directory of Open Access Journals (Sweden)

Gaomin Liu

2018-05-01

Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

Acetylcholine Receptor: Complex of Homologous Subunits

Science.gov (United States)

Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.

1980-06-01

The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

ORF Sequence: NC_001147 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available is loaded onto partial duplex DNA; homolog of human and S. pombe Rad1 and U. maydis Rec1 proteins; Rad17p [...the activation of the DNA damage and meiotic pachytene checkpoints; with Mec3p and Ddc1p, forms a clamp that

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

Science.gov (United States)

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

454 sequencing of pooled BAC clones on chromosome 3H of barley

Directory of Open Access Journals (Sweden)

Yamaji Nami

2011-05-01

Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

Sequence homology: A poor predictive value for profilins cross-reactivity

Directory of Open Access Journals (Sweden)

Pazouki Nazanin

2005-09-01

Full Text Available Summary Background Profilins are highly cross-reactive allergens which bind IgE antibodies of almost 20% of plant-allergic patients. This study is aimed at investigating cross-reactivity of melon profilin with other plant profilins and the role of the linear and conformational epitopes in human IgE cross-reactivity. Methods Seventeen patients with melon allergy were selected based on clinical history and a positive skin prick test to melon extract. Melon profilin has been cloned and expressed in E. coli. The IgE binding and cross-reactivity of the recombinant profilin were measured by ELISA and inhibition ELISA. The amino acid sequence of melon profilin was compared with other profilin sequences. A combination of chemical cleavage and immunoblotting techniques were used to define the role of conformational and linear epitopes in IgE binding. Comparative modeling was used to construct three-dimensional models of profilins and to assess theoretical impact of amino acid differences on conformational structure. Results Profilin was identified as a major IgE-binding component of melon. Alignment of amino acid sequences of melon profilin with other profilins showed the most identity with watermelon profilin. This melon profilin showed substantial cross-reactivity with the tomato, peach, grape and Cynodon dactylon (Bermuda grass pollen profilins. Cantaloupe, watermelon, banana and Poa pratensis (Kentucky blue grass displayed no notable inhibition. Our experiments also indicated human IgE only react with complete melon profilin. Immunoblotting analysis with rabbit polyclonal antibody shows the reaction of the antibody to the fragmented and complete melon profilin. Although, the well-known linear epitope of profilins were identical in melon and watermelon, comparison of three-dimensional models of watermelon and melon profilins indicated amino acid differences influence the electric potential and accessibility of the solvent-accessible surface of

Homologous Recombination and Xylella fastidiosa Host-Pathogen Associations in South America.

Science.gov (United States)

Coletta-Filho, Helvécio D; Francisco, Carolina S; Lopes, João R S; Muller, Christiane; Almeida, Rodrigo P P

2017-03-01

Homologous recombination affects the evolution of bacteria such as Xylella fastidiosa, a naturally competent plant pathogen that requires insect vectors for dispersal. This bacterial species is taxonomically divided into subspecies, with phylogenetic clusters within subspecies that are host specific. One subspecies, pauca, is primarily limited to South America, with the exception of recently reported strains in Europe and Costa Rica. Despite the economic importance of X. fastidiosa subsp. pauca in South America, little is known about its genetic diversity. Multilocus sequence typing (MLST) has previously identified six sequence types (ST) among plant samples collected in Brazil (both subsp. pauca and multiplex). Here, we report on a survey of X. fastidiosa genetic diversity (MLST based) performed in six regions in Brazil and two in Argentina, by sampling five different plant species. In addition to the six previously reported ST, seven new subsp. pauca and two new subsp. multiplex ST were identified. The presence of subsp. multiplex in South America is considered to be the consequence of a single introduction from its native range in North America more than 80 years ago. Different phylogenetic approaches clustered the South American ST into four groups, with strains infecting citrus (subsp. pauca); coffee and olive (subsp. pauca); coffee, hibiscus, and plum (subsp. pauca); and plum (subsp. multiplex). In areas where these different genetic clusters occurred sympatrically, we found evidence of homologous recombination in the form of bidirectional allelic exchange between subspp. pauca and multiplex. In fact, the only strain of subsp. pauca isolated from a plum host had an allele that originated from subsp. multiplex. These signatures of bidirectional homologous recombination between endemic and introduced ST indicate that gene flow occurs in short evolutionary time frames in X. fastidiosa, despite the ecological isolation (i.e., host plant species) of genotypes.

Protein 3D structure computed from evolutionary sequence variation.

Directory of Open Access Journals (Sweden)

Debora S Marks

Full Text Available The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing.In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy.We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues, including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7-4.8 Å C(α-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org. This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of

Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus

OpenAIRE

Savithri, HS; Murthy, MRN

1983-01-01

The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

Identification of five partial ABC genes in the liver of the Antarctic fish Trematomus bernacchii and sensitivity of ABCB1 and ABCC2 to Cd exposure

Energy Technology Data Exchange (ETDEWEB)

Zucchi, Sara, E-mail: zucchi2@unisi.i [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Corsi, Ilaria [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Luckenbach, Till [UFZ - Helmholtz Centre for Environmental Research, Permoserstr. 15, D-04318 Leipzig (Germany); Bard, Shannon Mala [Environmental Programmes, Dalhousie University, 1355 Oxford Street, Life Science Centre, Room 820, Halifax, Nova Scotia, Canada B3H 4J1 (Canada); Regoli, Francesco [Department of Biochemistry, Biology and Genetics, Polytechnic University of Marches, Ancona (Italy); Focardi, Silvano [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy)

2010-08-15

Several ABC transporters have been characterized from many aquatic organisms, but no information is yet available for Antarctic fish. The aim of this work was to identify the expression of genes for ABC proteins in Trematomus bernacchii, a bioindicator species of the Southern Ocean. Partial cDNA sequences of ABCB1, ABCC1, ABCC2, ABCC4 and ABCC9 were cloned from liver. Using RACE technology, 3.5 and 2.2 kb contigs were obtained for ABCB1 and ABCC2. Considering the elevated natural bioavailability of cadmium at Terra Nova Bay, responsiveness of ABCB1 and ABCC2 to this element was investigated under laboratory conditions. ABCB1 and ABCC2 mRNA levels were approximately four-fold higher in Cd-exposed fish compared to the controls. Induction of ABCB1 protein was also found by western blot. This study provides the first identification of five ABC genes in the liver of an Antarctic key species, some of which may be involved in cellular detoxification. - The presence of five partial sequences showing homology with ABC transporters and the sensitivity of ABCB1 and ABCC2 toward cadmium were determined in the liver of T. bernacchii.

Geometric homology revisited

OpenAIRE

Ruffino, Fabio Ferrari

2013-01-01

Given a cohomology theory, there is a well-known abstract way to define the dual homology theory using the theory of spectra. In [4] the author provides a more geometric construction of the homology theory, using a generalization of the bordism groups. Such a generalization involves in its definition the vector bundle modification, which is a particular case of the Gysin map. In this paper we provide a more natural variant of that construction, which replaces the vector bundle modification wi...

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

Science.gov (United States)

Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

2014-01-25

Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

NARCIS (Netherlands)

Al-Shahib, A.; Breitling, R.; Gilbert, D.

2005-01-01

Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

Mutations in the FHA-domain of ectopically expressed NBS1 lead to radiosensitization and to no increase in somatic mutation rates via a partial suppression of homologous recombination

International Nuclear Information System (INIS)

Ohara, Maki; Funyu, Yumi; Ebara, Shunsuke

2014-01-01

Ionizing radiation induces DNA double-strand breaks (DSBs). Mammalian cells repair DSBs through multiple pathways, and the repair pathway that is utilized may affect cellular radiation sensitivity. In this study, we examined effects on cellular radiosensitivity resulting from functional alterations in homologous recombination (HR). HR was inhibited by overexpression of the forkhead-associated (FHA) domain-mutated NBS1 (G27D/R28D: FHA-2D) protein in HeLa cells or in hamster cells carrying a human X-chromosome. Cells expressing FHA-2D presented partially (but significantly) HR-deficient phenotypes, which were assayed by the reduction of gene conversion frequencies measured with a reporter assay, a decrease in radiation-induced Mre11 foci formation, and hypersensitivity to camptothecin treatments. Interestingly, ectopic expression of FHA-2D did not increase the frequency of radiation-induced somatic mutations at the HPRT locus, suggesting that a partial reduction of HR efficiency has only a slight effect on genomic stability. The expression of FHA-2D rendered the exponentially growing cell population slightly (but significantly) more sensitive to ionizing radiation. This radiosensitization effect due to the expression of FHA-2D was enhanced when the cells were irradiated with split doses delivered at 24-h intervals. Furthermore, enhancement of radiation sensitivity by split dose irradiation was not seen in contact-inhibited G0/G1 populations, even though the cells expressed FHA-2D. These results suggest that the FHA domain of NBS1 might be an effective molecular target that can be used to induce radiosensitization using low molecular weight chemicals, and that partial inhibition of HR might improve the effectiveness of cancer radiotherapy. (author)

Protein remote homology detection based on bidirectional long short-term memory.

Science.gov (United States)

Li, Shumin; Chen, Junjie; Liu, Bin

2017-10-10

Protein remote homology detection plays a vital role in studies of protein structures and functions. Almost all of the traditional machine leaning methods require fixed length features to represent the protein sequences. However, it is never an easy task to extract the discriminative features with limited knowledge of proteins. On the other hand, deep learning technique has demonstrated its advantage in automatically learning representations. It is worthwhile to explore the applications of deep learning techniques to the protein remote homology detection. In this study, we employ the Bidirectional Long Short-Term Memory (BLSTM) to learn effective features from pseudo proteins, also propose a predictor called ProDec-BLSTM: it includes input layer, bidirectional LSTM, time distributed dense layer and output layer. This neural network can automatically extract the discriminative features by using bidirectional LSTM and the time distributed dense layer. Experimental results on a widely-used benchmark dataset show that ProDec-BLSTM outperforms other related methods in terms of both the mean ROC and mean ROC50 scores. This promising result shows that ProDec-BLSTM is a useful tool for protein remote homology detection. Furthermore, the hidden patterns learnt by ProDec-BLSTM can be interpreted and visualized, and therefore, additional useful information can be obtained.

Homologous Recombination—Experimental Systems, Analysis and Significance

Science.gov (United States)

Kuzminov, Andrei

2014-01-01

Homologous recombination is the most complex of all recombination events that shape genomes and produce material for evolution. Homologous recombination events are exchanges between DNA molecules in the lengthy regions of shared identity, catalyzed by a group of dedicated enzymes. There is a variety of experimental systems in E. coli and Salmonella to detect homologous recombination events of several different kinds. Genetic analysis of homologous recombination reveals three separate phases of this process: pre-synapsis (the early phase), synapsis (homologous strand exchange) and post-synapsis (the late phase). In E. coli, there are at least two independent pathway of the early phase and at least two independent pathways of the late phase. All this complexity is incongruent with the originally ascribed role of homologous recombination as accelerator of genome evolution: there is simply not enough duplication and repetition in enterobacterial genomes for homologous recombination to have a detectable evolutionary role, and therefore not enough selection to maintain such a complexity. At the same time, the mechanisms of homologous recombination are uniquely suited for repair of complex DNA lesions called chromosomal lesions. In fact, the two major classes of chromosomal lesions are recognized and processed by the two individual pathways at the early phase of homologous recombination. It follows, therefore, that homologous recombination events are occasional reflections of the continual recombinational repair, made possible in cases of natural or artificial genome redundancy. PMID:26442506

Comparative analysis of the prion protein gene sequences in African lion.

Science.gov (United States)

Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

2006-10-01

The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

Directory of Open Access Journals (Sweden)

Changrim Lee

Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

Directory of Open Access Journals (Sweden)

Wang Hehe

2012-08-01

Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

Genomic sequence of a ranavirus (family Iridoviridae) associated with salamander mortalities in North America

Energy Technology Data Exchange (ETDEWEB)

Jancovich, James K; Jinghe, Mao; Chinchar, V Gregory; Wyatt, Christopher; Case, Steven T; Kumar, Sudhir; Valente, Graziela; Subramanian, Sankar; Davidson, Elizabeth W; Collins, James P; Jacobs, Bertram L

2003-11-10

Disease is among the suspected causes of amphibian population declines, and an iridovirus and a chytrid fungus are the primary pathogens associated with amphibian mortalities. Ambystoma tigrinum virus (ATV) and a closely related strain, Regina ranavirus (RRV), are implicated in salamander die-offs in Arizona and Canada, respectively. We report the complete sequence of the ATV genome and partial sequence of the RRV genome. Sequence analysis of the ATV/RRV genomes showed marked similarity to other ranaviruses, including tiger frog virus (TFV) and frog virus 3 (FV3), the type virus of the genus Ranavirus (family Iridoviridae), as well as more distant relationships to lymphocystis disease virus, Chilo iridescent virus, and infectious spleen and kidney necrosis virus. Putative open reading frames (ORFs) in the ATV sequence identified 24 genes that appear to control virus replication and block antiviral responses. In addition, >50 other putative genes, homologous to ORFs in other iridoviral genomes but of unknown function, were also identified. Sequence comparison performed by dot plot analysis between ATV and itself revealed a conserved 14-bp palindromic repeat within most intragenic regions. Dot plot analysis of ATV vs RRV sequences identified several polymorphisms between the two isolates. Finally, a comparison of ATV and TFV genomic sequences identified genomic rearrangements consistent with the high recombination frequency of iridoviruses. Given the adverse effects that ranavirus infections have on amphibian and fish populations, ATV/RRV sequence information will allow the design of better diagnostic probes for identifying ranavirus infections and extend our understanding of molecular events in ranavirus-infected cells.

Genomic sequence of a ranavirus (family Iridoviridae) associated with salamander mortalities in North America

International Nuclear Information System (INIS)

Jancovich, James K.; Mao Jinghe; Chinchar, V. Gregory; Wyatt, Christopher; Case, Steven T.; Kumar, Sudhir; Valente, Graziela; Subramanian, Sankar; Davidson, Elizabeth W.; Collins, James P.; Jacobs, Bertram L.

2003-01-01

Disease is among the suspected causes of amphibian population declines, and an iridovirus and a chytrid fungus are the primary pathogens associated with amphibian mortalities. Ambystoma tigrinum virus (ATV) and a closely related strain, Regina ranavirus (RRV), are implicated in salamander die-offs in Arizona and Canada, respectively. We report the complete sequence of the ATV genome and partial sequence of the RRV genome. Sequence analysis of the ATV/RRV genomes showed marked similarity to other ranaviruses, including tiger frog virus (TFV) and frog virus 3 (FV3), the type virus of the genus Ranavirus (family Iridoviridae), as well as more distant relationships to lymphocystis disease virus, Chilo iridescent virus, and infectious spleen and kidney necrosis virus. Putative open reading frames (ORFs) in the ATV sequence identified 24 genes that appear to control virus replication and block antiviral responses. In addition, >50 other putative genes, homologous to ORFs in other iridoviral genomes but of unknown function, were also identified. Sequence comparison performed by dot plot analysis between ATV and itself revealed a conserved 14-bp palindromic repeat within most intragenic regions. Dot plot analysis of ATV vs RRV sequences identified several polymorphisms between the two isolates. Finally, a comparison of ATV and TFV genomic sequences identified genomic rearrangements consistent with the high recombination frequency of iridoviruses. Given the adverse effects that ranavirus infections have on amphibian and fish populations, ATV/RRV sequence information will allow the design of better diagnostic probes for identifying ranavirus infections and extend our understanding of molecular events in ranavirus-infected cells

Using SQL Databases for Sequence Similarity Searching and Analysis.

Science.gov (United States)

Pearson, William R; Mackey, Aaron J

2017-09-13

Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

DEFF Research Database (Denmark)

de Souza, S J; Camargo, A A; Briones, M R

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

Science.gov (United States)

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

Directory of Open Access Journals (Sweden)

Lee DT

2007-02-01

Full Text Available Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL http://biocomp.iis.sinica.edu.tw/phylomlogo.

Peak-to-average power ratio reduction in orthogonal frequency division multiplexing-based visible light communication systems using a modified partial transmit sequence technique

Science.gov (United States)

Liu, Yan; Deng, Honggui; Ren, Shuang; Tang, Chengying; Qian, Xuewen

2018-01-01

We propose an efficient partial transmit sequence technique based on genetic algorithm and peak-value optimization algorithm (GAPOA) to reduce high peak-to-average power ratio (PAPR) in visible light communication systems based on orthogonal frequency division multiplexing (VLC-OFDM). By analysis of hill-climbing algorithm's pros and cons, we propose the POA with excellent local search ability to further process the signals whose PAPR is still over the threshold after processed by genetic algorithm (GA). To verify the effectiveness of the proposed technique and algorithm, we evaluate the PAPR performance and the bit error rate (BER) performance and compare them with partial transmit sequence (PTS) technique based on GA (GA-PTS), PTS technique based on genetic and hill-climbing algorithm (GH-PTS), and PTS based on shuffled frog leaping algorithm and hill-climbing algorithm (SFLAHC-PTS). The results show that our technique and algorithm have not only better PAPR performance but also lower computational complexity and BER than GA-PTS, GH-PTS, and SFLAHC-PTS technique.

Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

International Nuclear Information System (INIS)

Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

1987-01-01

Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

Science.gov (United States)

Mackey, Aaron J; Pearson, William R

2004-10-01

Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

Science.gov (United States)

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lectures on homology with internal symmetries

International Nuclear Information System (INIS)

Solovyov, Yu.

1993-09-01

Homology with internal symmetries is a natural generalization of cyclic homology introduced, independently, by Connes and Tsygan, which has turned out to be a very useful tool in a number of problems of algebra, geometry topology, analysis and mathematical physics. It suffices to say cycling homology and cohomology are successfully applied in the index theory of elliptic operators on foliations, in the description of the homotopy type of pseudoisotopy spaces, in the theory of characteristic classes in algebraic K-theory. They are also applied in noncommutative differential geometry and in the cohomology of Lie algebras, the branches of mathematics which brought them to life in the first place. Essentially, we consider dihedral homology, which was successfully applied for the description of the homology type of groups of homeomorphisms and diffeomorphisms of simply connected manifolds. (author). 27 refs

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Improving model construction of profile HMMs for remote homology detection through structural alignment

Directory of Open Access Journals (Sweden)

Zaverucha Gerson

2007-11-01

Full Text Available Abstract Background Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. Results We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. Conclusion We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

Improving model construction of profile HMMs for remote homology detection through structural alignment.

Science.gov (United States)

Bernardes, Juliana S; Dávila, Alberto M R; Costa, Vítor S; Zaverucha, Gerson

2007-11-09

Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs) are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

Compositional Homology and Creative Thinking

Directory of Open Access Journals (Sweden)

Salvatore Tedesco

2015-05-01

Full Text Available The concept of homology is the most solid theoretical basis elaborated by the morphological thinking during its history. The enucleation of some general criteria for the interpretation of homology is today a fundamental tool for life sciences, and for restoring their own opening to the question of qualitative innovation that arose so powerfully in the original Darwinian project. The aim of this paper is to verify the possible uses of the concept of compositional homology in order to provide of an adequate understanding of the dynamics of creative thinking.

Rational Homological Stability for Automorphisms of Manifolds

DEFF Research Database (Denmark)

Grey, Matthias

In this thesis we prove rational homological stability for the classifying spaces of the homotopy automorphisms and block di↵eomorphisms of iterated connected sums of products of spheres of a certain connectivity.The results in particular apply to the manifolds       Npg,q  = (#g(Sp x Sq)) - int...... with coefficients in the homology of the universal covering, which is studied using rational homology theory. The result for the block di↵eomorphisms is deduced from the homological stability for the homotopy automorphisms upon using Surgery theory. Themain theorems of this thesis extend the homological stability...

Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation.

Science.gov (United States)

Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K

2017-07-01

To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.

Science.gov (United States)

Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat

2016-11-01

Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.

Partial characterization of nif genes from the bacterium Azospirillum amazonense

Directory of Open Access Journals (Sweden)

D.P. Potrich

2001-09-01

Full Text Available Azospirillum amazonense revealed genomic organization patterns of the nitrogen fixation genes similar to those of the distantly related species A. brasilense. Our work suggests that A. brasilense nifHDK, nifENX, fixABC operons and nifA and glnB genes may be structurally homologous to the counterpart genes of A. amazonense. This is the first analysis revealing homology between A. brasilense nif genes and the A. amazonense genome. Sequence analysis of PCR amplification products revealed similarities between the amino acid sequences of the highly conserved nifD and glnB genes of A. amazonense and related genes of A. brasilense and other bacteria. However, the A. amazonense non-coding regions (the upstream activator sequence region and the region between the nifH and nifD genes differed from related regions of A. brasilense even in nitrogenase structural genes which are highly conserved among diazotrophic bacteria. The feasibility of the 16S ribosomal RNA gene-based PCR system for specific detection of A. amazonense was shown. Our results indicate that the PCR primers for 16S rDNA defined in this article are highly specific to A. amazonense and can distinguish this species from A. brasilense.

Thumbs down: a molecular-morphogenetic approach to avian digit homology.

Science.gov (United States)

Capek, Daniel; Metscher, Brian D; Müller, Gerd B

2014-01-01

Avian forelimb digit homology remains one of the standard themes in comparative biology and EvoDevo research. In order to resolve the apparent contradictions between embryological and paleontological evidence a variety of hypotheses have been presented in recent years. The proposals range from excluding birds from the dinosaur clade, to assignments of homology by different criteria, or even assuming a hexadactyl tetrapod limb ground state. At present two approaches prevail: the frame shift hypothesis and the pyramid reduction hypothesis. While the former postulates a homeotic shift of digit identities, the latter argues for a gradual bilateral reduction of phalanges and digits. Here we present a new model that integrates elements from both hypotheses with the existing experimental and fossil evidence. We start from the main feature common to both earlier concepts, the initiating ontogenetic event: reduction and loss of the anterior-most digit. It is proposed that a concerted mechanism of molecular regulation and developmental mechanics is capable of shifting the boundaries of hoxD expression in embryonic forelimb buds as well as changing the digit phenotypes. Based on a distinction between positional (topological) and compositional (phenotypic) homology criteria, we argue that the identity of the avian digits is II, III, IV, despite a partially altered phenotype. Finally, we introduce an alternative digit reduction scheme that reconciles the current fossil evidence with the presented molecular-morphogenetic model. Our approach identifies specific experiments that allow to test whether gene expression can be shifted and digit phenotypes can be altered by induced digit loss or digit gain. © 2013 Wiley Periodicals, Inc.

Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

Directory of Open Access Journals (Sweden)

Mikhail Nefedov

2011-01-01

Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

Science.gov (United States)

Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.

2016-01-01

The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

Science.gov (United States)

Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

2018-03-01

It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins.

Science.gov (United States)

Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R

2018-02-01

This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

Directory of Open Access Journals (Sweden)

Asma NAJAR

2011-09-01

Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

Homology in Electromagnetic Boundary Value Problems

Directory of Open Access Journals (Sweden)

Pellikka Matti

2010-01-01

Full Text Available We discuss how homology computation can be exploited in computational electromagnetism. We represent various cellular mesh reduction techniques, which enable the computation of generators of homology spaces in an acceptable time. Furthermore, we show how the generators can be used for setting up and analysis of an electromagnetic boundary value problem. The aim is to provide a rationale for homology computation in electromagnetic modeling software.

[Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].

Science.gov (United States)

Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo

2008-09-01

Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line

DEFF Research Database (Denmark)

Xu, Xun; Pan, Shengkai; Liu, Xin

2011-01-01

Chinese hamster ovary (CHO)-derived cell lines are the preferred host cells for the production of therapeutic proteins. Here we present a draft genomic sequence of the CHO-K1 ancestral cell line. The assembly comprises 2.45 Gb of genomic sequence, with 24,383 predicted genes. We associate most....... Homologs of most human glycosylation-associated genes are present in the CHO-K1 genome, although 141 of these homologs are not expressed under exponential growth conditions. Many important viral entry genes are also present in the genome but not expressed, which may explain the unusual viral resistance...... property of CHO cell lines. We discuss how the availability of this genome sequence may facilitate genome-scale science for the optimization of biopharmaceutical protein production....

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

Energy Technology Data Exchange (ETDEWEB)

Devor, E.J.; Dill-Devor, R.M. [Univ. of Iowa College of Medicine, Iowa City (United States)

1994-09-01

We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCR assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.

Homologous series of induced early mutants in indican rice. Pt.1. The production of homologous series of early mutants

International Nuclear Information System (INIS)

Chen Xiulan; Yang Hefeng; He Zhentian; Han Yuepeng; Liu Xueyu

1999-01-01

The percentage of homologous series of early mutants induced from the same Indican rice variety were almost the same (1.37%∼1.64%) in 1983∼1993, but the ones from the different eco-typical varieties were different. The early variety was 0.73%, the mid variety was 1.51%, and the late variety was 1.97%. The percentage of homologous series of early mutants from the varieties with the same pedigree and relationship were similar, but the one from the cog nation were lower than those from distant varieties. There are basic laws and characters in the homologous series of early mutants: 1. The inhibited phenotype is the basic of the homologous series of early mutants; 2. The production of the homologous series of early mutants is closely related with the growing period of the parent; 3. The parallel mutation of the stem and leaves are simultaneously happened with the variation of early or late maturing; 4. The occurrence of the homologous series of early mutants is in a state of imbalance. According to the law of parallel variability, the production of homologous series of early mutants can be predicted as long as the parents' classification of plant, pedigree and ecological type are identified. Therefore, the early breeding can be guided by the law of homologous series of early mutants

Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.

Science.gov (United States)

Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C

1997-12-01

Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

Science.gov (United States)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

Directory of Open Access Journals (Sweden)

Javed Iqbal Wattoo

2016-11-01

Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

Autonomously folding protein fragments reveal differences in the energy landscapes of homologous RNases H.

Directory of Open Access Journals (Sweden)

Laura E Rosen

Full Text Available An important approach to understanding how a protein sequence encodes its energy landscape is to compare proteins with different sequences that fold to the same general native structure. In this work, we compare E. coli and T. thermophilus homologs of the protein RNase H. Using protein fragments, we create equilibrium mimics of two different potential partially-folded intermediates (I(core and I(core+1 hypothesized to be present on the energy landscapes of these two proteins. We observe that both T. thermophilus RNase H (ttRNH fragments are folded and have distinct stabilities, indicating that both regions are capable of autonomous folding and that both intermediates are present as local minima on the ttRNH energy landscape. In contrast, the two E. coli RNase H (ecRNH fragments have very similar stabilities, suggesting that the presence of additional residues in the I(core+1 fragment does not affect the folding or structure as compared to I(core. NMR experiments provide additional evidence that only the I(core intermediate is populated by ecRNH. This is one of the biggest differences that has been observed between the energy landscapes of these two proteins. Additionally, we used a FRET experiment in the background of full-length ttRNH to specifically monitor the formation of the I(core+1 intermediate. We determine that the ttRNH I(core+1 intermediate is likely the intermediate populated prior to the rate-limiting barrier to global folding, in contrast to E. coli RNase H for which I(core is the folding intermediate. This result provides new insight into the nature of the rate-limiting barrier for the folding of RNase H.

Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

Science.gov (United States)

Abraham, Anup; Chandler, Douglas E

2017-10-01

Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

Supraspinatus tendon tears at 3.0 T shoulder MR arthrography: diagnosis with 3D isotropic turbo spin-echo SPACE sequence versus 2D conventional sequences

Energy Technology Data Exchange (ETDEWEB)

Jung, Joon-Yong; Jee, Won-Hee; Park, Michael Y.; Lee, So-Yeon [Seoul St. Mary' s Hospital, The Catholic University of Korea, Department of Radiology, Seoul (Korea, Republic of); Kim, Yang-Soo [Seoul St. Mary' s Hospital, The Catholic University of Korea, Department of Orthopedic Surgery, Seoul (Korea, Republic of)

2012-11-15

To assess the diagnostic performance of shoulder MR arthrography with 3D isotropic fat-suppressed (FS) turbo spin-echo sequence (TSE-SPACE) for supraspinatus tendon tears in comparison with 2D conventional sequences at 3.0 T. The study was HIPAA-compliant and approved by the institutional review board with a waiver of informed consent. Eighty-seven arthroscopically confirmed patients who underwent 3.0 T shoulder MR arthrography with 2D sequences and 3D TSE-SPACE were included in a consecutive fashion from March 2009 to February 2010. Two reviewers independently analyzed 2D sequences and 3D TSE-SPACE. Sensitivity, specificity, accuracy, and interobserver agreement ({kappa}) were compared between 2D sequences and 3D TSE-SPACE for full-thickness and partial-thickness supraspinatus tendon tears together and for partial-thickness supraspinatus tendon tears alone. There were 33 full-thickness tears and 28 partial-thickness tears of supraspinatus tendons. For full-thickness and partial-thickness supraspinatus tendon tears together, the mean sensitivity, specificity, and accuracy of both readers were 96, 92, and 94% on 2D sequences and 91, 84, and 89% on 3D TSE-SPACE. For partial-thickness supraspinatus tendon tears alone, the mean sensitivity, specificity, and accuracy were 95, 92, and 94% on 2D sequences and 84, 85, and 84% on 3D TSE-SPACE. There was no statistical difference between 2D sequences and 3D TSE-SPACE. Interobserver agreements were almost perfect on 2D conventional sequences and substantial on 3D TSE-SPACE. Compared with 2D conventional sequences, MR arthrography using 3D TSE-SPACE was comparable for diagnosing supraspinatus tendon tears despite limitations in detecting small partial-thickness tears and in discriminating between full-thickness and deep partial-thickness tears. (orig.)

Supraspinatus tendon tears at 3.0 T shoulder MR arthrography: diagnosis with 3D isotropic turbo spin-echo SPACE sequence versus 2D conventional sequences

International Nuclear Information System (INIS)

Jung, Joon-Yong; Jee, Won-Hee; Park, Michael Y.; Lee, So-Yeon; Kim, Yang-Soo

2012-01-01

To assess the diagnostic performance of shoulder MR arthrography with 3D isotropic fat-suppressed (FS) turbo spin-echo sequence (TSE-SPACE) for supraspinatus tendon tears in comparison with 2D conventional sequences at 3.0 T. The study was HIPAA-compliant and approved by the institutional review board with a waiver of informed consent. Eighty-seven arthroscopically confirmed patients who underwent 3.0 T shoulder MR arthrography with 2D sequences and 3D TSE-SPACE were included in a consecutive fashion from March 2009 to February 2010. Two reviewers independently analyzed 2D sequences and 3D TSE-SPACE. Sensitivity, specificity, accuracy, and interobserver agreement (κ) were compared between 2D sequences and 3D TSE-SPACE for full-thickness and partial-thickness supraspinatus tendon tears together and for partial-thickness supraspinatus tendon tears alone. There were 33 full-thickness tears and 28 partial-thickness tears of supraspinatus tendons. For full-thickness and partial-thickness supraspinatus tendon tears together, the mean sensitivity, specificity, and accuracy of both readers were 96, 92, and 94% on 2D sequences and 91, 84, and 89% on 3D TSE-SPACE. For partial-thickness supraspinatus tendon tears alone, the mean sensitivity, specificity, and accuracy were 95, 92, and 94% on 2D sequences and 84, 85, and 84% on 3D TSE-SPACE. There was no statistical difference between 2D sequences and 3D TSE-SPACE. Interobserver agreements were almost perfect on 2D conventional sequences and substantial on 3D TSE-SPACE. Compared with 2D conventional sequences, MR arthrography using 3D TSE-SPACE was comparable for diagnosing supraspinatus tendon tears despite limitations in detecting small partial-thickness tears and in discriminating between full-thickness and deep partial-thickness tears. (orig.)

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

Science.gov (United States)

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

Science.gov (United States)

Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

2017-09-01

Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline.

Directory of Open Access Journals (Sweden)

Nima Najand

Full Text Available We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

Partial Transmit Sequence Optimization Using Improved Harmony Search Algorithm for PAPR Reduction in OFDM

Directory of Open Access Journals (Sweden)

Mangal Singh

2017-12-01

Full Text Available This paper considers the use of the Partial Transmit Sequence (PTS technique to reduce the Peak‐to‐Average Power Ratio (PAPR of an Orthogonal Frequency Division Multiplexing signal in wireless communication systems. Search complexity is very high in the traditional PTS scheme because it involves an extensive random search over all combinations of allowed phase vectors, and it increases exponentially with the number of phase vectors. In this paper, a suboptimal metaheuristic algorithm for phase optimization based on an improved harmony search (IHS is applied to explore the optimal combination of phase vectors that provides improved performance compared with existing evolutionary algorithms such as the harmony search algorithm and firefly algorithm. IHS enhances the accuracy and convergence rate of the conventional algorithms with very few parameters to adjust. Simulation results show that an improved harmony search‐based PTS algorithm can achieve a significant reduction in PAPR using a simple network structure compared with conventional algorithms.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Selective anticancer activity of a hexapeptide with sequence homology to a non-kinase domain of Cyclin Dependent Kinase 4

Directory of Open Access Journals (Sweden)

Agarwala Usha

2011-06-01

Full Text Available Abstract Background Cyclin-dependent kinases 2, 4 and 6 (Cdk2, Cdk4, Cdk6 are closely structurally homologous proteins which are classically understood to control the transition from the G1 to the S-phases of the cell cycle by combining with their appropriate cyclin D or cyclin E partners to form kinase-active holoenzymes. Deregulation of Cdk4 is widespread in human cancer, CDK4 gene knockout is highly protective against chemical and oncogene-mediated epithelial carcinogenesis, despite the continued presence of CDK2 and CDK6; and overexpresssion of Cdk4 promotes skin carcinogenesis. Surprisingly, however, Cdk4 kinase inhibitors have not yet fulfilled their expectation as 'blockbuster' anticancer agents. Resistance to inhibition of Cdk4 kinase in some cases could potentially be due to a non-kinase activity, as recently reported with epidermal growth factor receptor. Results A search for a potential functional site of non-kinase activity present in Cdk4 but not Cdk2 or Cdk6 revealed a previously-unidentified loop on the outside of the C'-terminal non-kinase domain of Cdk4, containing a central amino-acid sequence, Pro-Arg-Gly-Pro-Arg-Pro (PRGPRP. An isolated hexapeptide with this sequence and its cyclic amphiphilic congeners are selectively lethal at high doses to a wide range of human cancer cell lines whilst sparing normal diploid keratinocytes and fibroblasts. Treated cancer cells do not exhibit the wide variability of dose response typically seen with other anticancer agents. Cancer cell killing by PRGPRP, in a cyclic amphiphilic cassette, requires cells to be in cycle but does not perturb cell cycle distribution and is accompanied by altered relative Cdk4/Cdk1 expression and selective decrease in ATP levels. Morphological features of apoptosis are absent and cancer cell death does not appear to involve autophagy. Conclusion These findings suggest a potential new paradigm for the development of broad-spectrum cancer specific therapeutics with

Homologous SV40 RNA trans-splicing: Special case or prime example of viral RNA trans-splicing?

Directory of Open Access Journals (Sweden)

Sushmita Poddar

2014-06-01

Full Text Available To date the Simian Virus 40 (SV40 is the only proven example of a virus that recruits the mechanism of RNA trans-splicing to diversify its sequences and gene products. Thereby, two identical viral transcripts are efficiently joined by homologous trans-splicing triggering the formation of a highly transforming 100 kDa super T antigen. Sequences of other viruses including HIV-1 and the human adenovirus type 5 were reported to be involved in heterologous trans-splicing towards cellular or viral sequences but the meaning of these events remains unclear. We computationally and experimentally investigated molecular features associated with viral RNA trans-splicing and identified a common pattern: Viral RNA trans-splicing occurs between strong cryptic or regular viral splice sites and strong regular or cryptic splice sites of the trans-splice partner sequences. The majority of these splice sites are supported by exonic splice enhancers. Splice sites that could compete with the trans-splicing sites for cis-splice reactions are weaker or inexistent. Finally, all but one of the trans-splice reactions seem to be facilitated by one or more complementary binding domains of 11 to 16 nucleotides in length which, however occur with a statistical probability close to one for the given length of the involved sequences. The chimeric RNAs generated via heterologous viral RNA trans-splicing either did not lead to fusion proteins or led to proteins of unknown function. Our data suggest that distinct viral RNAs are highly susceptible to trans-splicing and that heterologous viral trans-splicing, unlike homologous SV40 trans-splicing, represents a chance event.

Coding sequence of human rho cDNAs clone 6 and clone 9

Energy Technology Data Exchange (ETDEWEB)

Chardin, P; Madaule, P; Tavitian, A

1988-03-25

The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

DEFF Research Database (Denmark)

Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...... results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial...

Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

NARCIS (Netherlands)

D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)

1994-01-01

textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

FASH: A web application for nucleotides sequence search

Directory of Open Access Journals (Sweden)

Chew Paul

2008-05-01

Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

Colored Kauffman homology and super-A-polynomials

International Nuclear Information System (INIS)

Nawata, Satoshi; Ramadevi, P.; Zodinmawia

2014-01-01

We study the structural properties of colored Kauffman homologies of knots. Quadruple-gradings play an essential role in revealing the differential structure of colored Kauffman homology. Using the differential structure, the Kauffman homologies carrying the symmetric tensor products of the vector representation for the trefoil and the figure-eight are determined. In addition, making use of relations from representation theory, we also obtain the HOMFLY homologies colored by rectangular Young tableaux with two rows for these knots. Furthermore, the notion of super-A-polynomials is extended in order to encompass two-parameter deformations of PSL(2,ℂ) character varieties

Establishment of screening technique for mutant cell and analysis of base sequence in the mutation

International Nuclear Information System (INIS)

Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi

2000-01-01

This research project aimed to establish an easy and quick detection method for radiation-induced mutation using molecular-biological techniques and an effective analyzing method for the molecular changes in base sequence. In this year, Spi mutants derived from γ-radiation exposed mouse were analyzed by PCR method and DNA sequence method. Male transgenic mice were exposed to γ-ray at 5,10, 50 Gy and the transgene was taken out from the genome DNA from the spleen in vivo packaging method. Spi mutant plaques were obtained by infecting the recovered phage to E. coli. Sequence analysis for the mutants was made using ALFred DNA sequencer and SequiTherm TM Long-Red Cycle sequencing kit. Sequence analysis was carried out for 41 of 50 independent Spi mutants obtained. The deletions were classified into 4 groups; Group 1 included 15 mutants that were characterized with a large deletion (43 bp-10 kb) with a short homologous sequence. Group 2 included 11 mutants of a large deletion having no homologous sequence at the connecting region. Group 3 included 11 mutants having a short deletion of less than 20 bp, which occurred in the non-repetitive sequence of gam gene and possibly caused by oxidative breakage of DNA or recombination of DNA fragment produced by the breakage. Group 4 included 4 mutants having deletions as short as 20 bp or less in the repetitive sequence of gam gene, resulting in an alteration of the reading frame. Thus, the synthesis of Gam protein was terminated by the appearance of TGA between code 13 and 14 of redB gene, leading to inactivation of gam gene and redBA gene. These results indicated that most of Spi mutants had a deletion in red/gam region and the deletions in more than half mutants occurred in homologous sequences as short as 8 bp. (M.N.)

Protein secondary structure prediction for a single-sequence using hidden semi-Markov models

Directory of Open Access Journals (Sweden)

Borodovsky Mark

2006-03-01

Full Text Available Abstract Background The accuracy of protein secondary structure prediction has been improving steadily towards the 88% estimated theoretical limit. There are two types of prediction algorithms: Single-sequence prediction algorithms imply that information about other (homologous proteins is not available, while algorithms of the second type imply that information about homologous proteins is available, and use it intensively. The single-sequence algorithms could make an important contribution to studies of proteins with no detected homologs, however the accuracy of protein secondary structure prediction from a single-sequence is not as high as when the additional evolutionary information is present. Results In this paper, we further refine and extend the hidden semi-Markov model (HSMM initially considered in the BSPSS algorithm. We introduce an improved residue dependency model by considering the patterns of statistically significant amino acid correlation at structural segment borders. We also derive models that specialize on different sections of the dependency structure and incorporate them into HSMM. In addition, we implement an iterative training method to refine estimates of HSMM parameters. The three-state-per-residue accuracy and other accuracy measures of the new method, IPSSP, are shown to be comparable or better than ones for BSPSS as well as for PSIPRED, tested under the single-sequence condition. Conclusions We have shown that new dependency models and training methods bring further improvements to single-sequence protein secondary structure prediction. The results are obtained under cross-validation conditions using a dataset with no pair of sequences having significant sequence similarity. As new sequences are added to the database it is possible to augment the dependency structure and obtain even higher accuracy. Current and future advances should contribute to the improvement of function prediction for orphan proteins inscrutable

Induction of human immunodeficiency virus (HIV-1 envelope specific cell-mediated immunity by a non-homologous synthetic peptide.

Directory of Open Access Journals (Sweden)

Ammar Achour

2007-11-01

Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.

No allelic variation in genes with high gliadin homology in patients with celiac disease and type 1 diabetes

DEFF Research Database (Denmark)

Nielsen, Christian; Hansen, Dorte; Husby, Steffen

2004-01-01

recognize gluten-derived peptides in which specific glutamine residues are deamidated to glutamic acid by tissue transglutaminase. Recently, intestinally expressed human genes with high homology to DQ2-gliadin celiac T-cell epitopes have been identified. Single or double point mutations which would increase...... the celiac T-cell epitope homology, and mutation in these genes, leading to the expression of glutamic acid at particular positions, could hypothetically be involved in the initiation of CD in HLA-DQ2-positive children. Six gene regions with high celiac T-cell epitope homology were investigated for single......-nucleotide polymorphisms using direct sequencing of DNA from 20 CD patients, 27 type 1 diabetes mellitus (T1DM) patients with associated CD, 24 patients with T1DM without CD and 110 healthy controls, all of Caucasian origin. No variants in any of these genes in any of the investigated groups were found. We conclude...

Detection and partial identification of proteins in pearls formed in ...

African Journals Online (AJOL)

They were ground into a powder of >10,000 mesh followed by ultra-sonication and extraction in water for 4 h at room temperature. ... that one protein had significant sequence homology to a putative vitelline envelop receptor for lysine in the common marine mussel Mytilus edulis, and the other to the putative imaginal disc ...

Statistical distributions of optimal global alignment scores of random protein sequences

Directory of Open Access Journals (Sweden)

Tang Jiaowei

2005-10-01

Full Text Available Abstract Background The inference of homology from statistically significant sequence similarity is a central issue in sequence alignments. So far the statistical distribution function underlying the optimal global alignments has not been completely determined. Results In this study, random and real but unrelated sequences prepared in six different ways were selected as reference datasets to obtain their respective statistical distributions of global alignment scores. All alignments were carried out with the Needleman-Wunsch algorithm and optimal scores were fitted to the Gumbel, normal and gamma distributions respectively. The three-parameter gamma distribution performs the best as the theoretical distribution function of global alignment scores, as it agrees perfectly well with the distribution of alignment scores. The normal distribution also agrees well with the score distribution frequencies when the shape parameter of the gamma distribution is sufficiently large, for this is the scenario when the normal distribution can be viewed as an approximation of the gamma distribution. Conclusion We have shown that the optimal global alignment scores of random protein sequences fit the three-parameter gamma distribution function. This would be useful for the inference of homology between sequences whose relationship is unknown, through the evaluation of gamma distribution significance between sequences.

Partial sequence determination of metabolically labeled radioactive proteins and peptides

International Nuclear Information System (INIS)

Anderson, C.W.

1982-01-01

The author has used the sequence analysis of radioactive proteins and peptides to approach several problems during the past few years. They, in collaboration with others, have mapped precisely several adenovirus proteins with respect to the nucleotide sequence of the adenovirus genome; identified hitherto missed proteins encoded by bacteriophage MS2 and by simian virus 40; analyzed the aminoterminal maturation of several virus proteins; determined the cleavage sites for processing of the poliovirus polyprotein; and analyzed the mechanism of frameshifting by excess normal tRNAs during cell-free protein synthesis. This chapter is designed to aid those without prior experience at protein sequence determinations. It is based primarily on the experience gained in the studies cited above, which made use of the Beckman 890 series automated protein sequencers

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

A computational approach to discovering the functions of bacterial phytochromes by analysis of homolog distributions

Directory of Open Access Journals (Sweden)

Lamparter Tilman

2006-03-01

Full Text Available Abstract Background Phytochromes are photoreceptors, discovered in plants, that control a wide variety of developmental processes. They have also been found in bacteria and fungi, but for many species their biological role remains obscure. This work concentrates on the phytochrome system of Agrobacterium tumefaciens, a non-photosynthetic soil bacterium with two phytochromes. To identify proteins that might share common functions with phytochromes, a co-distribution analysis was performed on the basis of protein sequences from 138 bacteria. Results A database of protein sequences from 138 bacteria was generated. Each sequence was BLASTed against the entire database. The homolog distribution of each query protein was then compared with the homolog distribution of every other protein (target protein of the same species, and the target proteins were sorted according to their probability of co-distribution under random conditions. As query proteins, phytochromes from Agrobacterium tumefaciens, Pseudomonas aeruginosa, Deinococcus radiodurans and Synechocystis PCC 6803 were chosen along with several phytochrome-related proteins from A. tumefaciens. The Synechocystis photosynthesis protein D1 was selected as a control. In the D1 analyses, the ratio between photosynthesis-related proteins and those not related to photosynthesis among the top 150 in the co-distribution tables was > 3:1, showing that the method is appropriate for finding partner proteins with common functions. The co-distribution of phytochromes with other histidine kinases was remarkably high, although most co-distributed histidine kinases were not direct BLAST homologs of the query protein. This finding implies that phytochromes and other histidine kinases share common functions as parts of signalling networks. All phytochromes tested, with one exception, also revealed a remarkably high co-distribution with glutamate synthase and methionine synthase. This result implies a general role of

How to Choose the Suitable Template for Homology Modelling of GPCRs: 5-HT7 Receptor as a Test Case.

Science.gov (United States)

Shahaf, Nir; Pappalardo, Matteo; Basile, Livia; Guccione, Salvatore; Rayan, Anwar

2016-09-01

G protein-coupled receptors (GPCRs) are a super-family of membrane proteins that attract great pharmaceutical interest due to their involvement in almost every physiological activity, including extracellular stimuli, neurotransmission, and hormone regulation. Currently, structural information on many GPCRs is mainly obtained by the techniques of computer modelling in general and by homology modelling in particular. Based on a quantitative analysis of eighteen antagonist-bound, resolved structures of rhodopsin family "A" receptors - also used as templates to build 153 homology models - it was concluded that a higher sequence identity between two receptors does not guarantee a lower RMSD between their structures, especially when their pair-wise sequence identity (within trans-membrane domain and/or in binding pocket) lies between 25 % and 40 %. This study suggests that we should consider all template receptors having a sequence identity ≤50 % with the query receptor. In fact, most of the GPCRs, compared to the currently available resolved structures of GPCRs, fall within this range and lack a correlation between structure and sequence. When testing suitability for structure-based drug design, it was found that choosing as a template the most similar resolved protein, based on sequence resemblance only, led to unsound results in many cases. Molecular docking analyses were carried out, and enrichment factors as well as attrition rates were utilized as criteria for assessing suitability for structure-based drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

Directory of Open Access Journals (Sweden)

Aboubaker M. Garbaj

2016-11-01

Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

Science.gov (United States)

Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

2017-03-01

Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

The influence of spherical cavity surface charge distribution on the sequence of partial discharge events

International Nuclear Information System (INIS)

Illias, Hazlee A; Chen, George; Lewin, Paul L

2011-01-01

In this work, a model representing partial discharge (PD) behaviour of a spherical cavity within a homogeneous dielectric material has been developed to study the influence of cavity surface charge distribution on the electric field distribution in both the cavity and the material itself. The charge accumulation on the cavity surface after a PD event and charge movement along the cavity wall under the influence of electric field magnitude and direction has been found to affect the electric field distribution in the whole cavity and in the material. This in turn affects the likelihood of any subsequent PD activity in the cavity and the whole sequence of PD events. The model parameters influencing cavity surface charge distribution can be readily identified; they are the cavity surface conductivity, the inception field and the extinction field. Comparison of measurement and simulation results has been undertaken to validate the model.

The influence of spherical cavity surface charge distribution on the sequence of partial discharge events

Energy Technology Data Exchange (ETDEWEB)

Illias, Hazlee A [Department of Electrical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Chen, George; Lewin, Paul L, E-mail: h.illias@um.edu.my [Tony Davies High Voltage Laboratory, School of Electronics and Computer Science, University of Southampton, Southampton, SO17 1BJ (United Kingdom)

2011-06-22

In this work, a model representing partial discharge (PD) behaviour of a spherical cavity within a homogeneous dielectric material has been developed to study the influence of cavity surface charge distribution on the electric field distribution in both the cavity and the material itself. The charge accumulation on the cavity surface after a PD event and charge movement along the cavity wall under the influence of electric field magnitude and direction has been found to affect the electric field distribution in the whole cavity and in the material. This in turn affects the likelihood of any subsequent PD activity in the cavity and the whole sequence of PD events. The model parameters influencing cavity surface charge distribution can be readily identified; they are the cavity surface conductivity, the inception field and the extinction field. Comparison of measurement and simulation results has been undertaken to validate the model.

Nature and distribution of feline sarcoma virus nucleotide sequences.

Science.gov (United States)

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

Universal Partial Words over Non-Binary Alphabets

OpenAIRE

Goeckner, Bennet; Groothuis, Corbin; Hettle, Cyrus; Kell, Brian; Kirkpatrick, Pamela; Kirsch, Rachel; Solava, Ryan

2016-01-01

Chen, Kitaev, M\\"{u}tze, and Sun recently introduced the notion of universal partial words, a generalization of universal words and de Bruijn sequences. Universal partial words allow for a wild-card character $\\diamond$, which is a placeholder for any letter in the alphabet. We settle and strengthen conjectures posed in the same paper where this notion was introduced. For non-binary alphabets, we show that universal partial words have periodic $\\diamond$ structure and are cyclic, and we give ...

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

OpenAIRE

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-01

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

Rfam: annotating families of non-coding RNA sequences.

Science.gov (United States)

Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

2015-01-01

The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

PEST sequences in the malaria parasite Plasmodium falciparum: a genomic study

Directory of Open Access Journals (Sweden)

Bell Angus

2003-06-01

Full Text Available Abstract Background Inhibitors of the protease calpain are known to have selectively toxic effects on Plasmodium falciparum. The enzyme has a natural inhibitor calpastatin and in eukaryotes is responsible for turnover of proteins containing short sequences enriched in certain amino acids (PEST sequences. The genome of P. falciparum was searched for this protease, its natural inhibitor and putative substrates. Methods The publicly available P. falciparum genome was found to have too many errors to permit reliable analysis. An earlier annotation of chromosome 2 was instead examined. PEST scores were determined for all annotated proteins. The published genome was searched for calpain and calpastatin homologs. Results Typical PEST sequences were found in 13% of the proteins on chromosome 2, including a surprising number of cell-surface proteins. The annotated calpain gene has a non-biological "intron" that appears to have been created to avoid an unrecognized frameshift. Only the catalytic domain has significant similarity with the vertebrate calpains. No calpastatin homologs were found in the published annotation. Conclusion A calpain gene is present in the genome and many putative substrates of this enzyme have been found. Calpastatin homologs may be found once the re-annotation is completed. Given the selective toxicity of calpain inhibitors, this enzyme may be worth exploring further as a potential drug target.

Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

DEFF Research Database (Denmark)

Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

1991-01-01

After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

Chromhome: a rich internet application for accessing comparative chromosome homology maps.

Science.gov (United States)

Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

2008-03-26

Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant

Chromhome: A rich internet application for accessing comparative chromosome homology maps

Directory of Open Access Journals (Sweden)

Cox Tony

2008-03-01

Full Text Available Abstract Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to

Fast and accurate taxonomic assignments of metagenomic sequences using MetaBin.

Directory of Open Access Journals (Sweden)

Vineet K Sharma

Full Text Available Taxonomic assignment of sequence reads is a challenging task in metagenomic data analysis, for which the present methods mainly use either composition- or homology-based approaches. Though the homology-based methods are more sensitive and accurate, they suffer primarily due to the time needed to generate the Blast alignments. We developed the MetaBin program and web server for better homology-based taxonomic assignments using an ORF-based approach. By implementing Blat as the faster alignment method in place of Blastx, the analysis time has been reduced by severalfold. It is benchmarked using both simulated and real metagenomic datasets, and can be used for both single and paired-end sequence reads of varying lengths (≥45 bp. To our knowledge, MetaBin is the only available program that can be used for the taxonomic binning of short reads (<100 bp with high accuracy and high sensitivity using a homology-based approach. The MetaBin web server can be used to carry out the taxonomic analysis, by either submitting reads or Blastx output. It provides several options including construction of taxonomic trees, creation of a composition chart, functional analysis using COGs, and comparative analysis of multiple metagenomic datasets. MetaBin web server and a standalone version for high-throughput analysis are available freely at http://metabin.riken.jp/.

On (co)homology of Frobenius Poisson algebras

OpenAIRE

Zhu, Can; Van Oystaeyen, Fred; ZHANG, Yinhuo

2014-01-01

In this paper, we study Poisson (co)homology of a Frobenius Poisson algebra. More precisely, we show that there exists a duality between Poisson homology and Poisson cohomology of Frobenius Poisson algebras, similar to that between Hochschild homology and Hochschild cohomology of Frobenius algebras. Then we use the non-degenerate bilinear form on a unimodular Frobenius Poisson algebra to construct a Batalin-Vilkovisky structure on the Poisson cohomology ring making it into a Batalin-Vilkovisk...

N-terminal sequence of human leukocyte glycoprotein Mo1: conservation across species and homology to platelet IIb/IIIa.

Science.gov (United States)

Pierce, M W; Remold-O'Donnell, E; Todd, R F; Arnaout, M A

1986-12-12

Mo1 and gp160-gp93 are two surface membrane glycoprotein heterodimers present on granulocytes and monocytes derived from humans and guinea pigs, respectively. We purified both antigens and found that their alpha subunits had identical N-termini which were significantly homologous to the alpha subunit of the human adhesion platelet glycoprotein IIb/IIIa.

Compilation and analysis of Escherichia coli promoter DNA sequences.

OpenAIRE

Hawley, D K; McClure, W R

1983-01-01

The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

The Coding and Effector Transfer of Movement Sequences

Science.gov (United States)

Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.

2009-01-01

Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

Microsatellite marker development by partial sequencing of the sour passion fruit genome (Passiflora edulis Sims).

Science.gov (United States)

Araya, Susan; Martins, Alexandre M; Junqueira, Nilton T V; Costa, Ana Maria; Faleiro, Fábio G; Ferreira, Márcio E

2017-07-21

The Passiflora genus comprises hundreds of wild and cultivated species of passion fruit used for food, industrial, ornamental and medicinal purposes. Efforts to develop genomic tools for genetic analysis of P. edulis, the most important commercial Passiflora species, are still incipient. In spite of many recognized applications of microsatellite markers in genetics and breeding, their availability for passion fruit research remains restricted. Microsatellite markers in P. edulis are usually limited in number, show reduced polymorphism, and are mostly based on compound or imperfect repeats. Furthermore, they are confined to only a few Passiflora species. We describe the use of NGS technology to partially assemble the P. edulis genome in order to develop hundreds of new microsatellite markers. A total of 14.11 Gbp of Illumina paired-end sequence reads were analyzed to detect simple sequence repeat sites in the sour passion fruit genome. A sample of 1300 contigs containing perfect repeat microsatellite sequences was selected for PCR primer development. Panels of di- and tri-nucleotide repeat markers were then tested in P. edulis germplasm accessions for validation. DNA polymorphism was detected in 74% of the markers (PIC = 0.16 to 0.77; number of alleles/locus = 2 to 7). A core panel of highly polymorphic markers (PIC = 0.46 to 0.77) was used to cross-amplify PCR products in 79 species of Passiflora (including P. edulis), belonging to four subgenera (Astrophea, Decaloba, Distephana and Passiflora). Approximately 71% of the marker/species combinations resulted in positive amplicons in all species tested. DNA polymorphism was detected in germplasm accessions of six closely related Passiflora species (P. edulis, P. alata, P. maliformis, P. nitida, P. quadrangularis and P. setacea) and the data used for accession discrimination and species assignment. A database of P. edulis DNA sequences obtained by NGS technology was examined to identify microsatellite repeats in

Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

KAUST Repository

Huang, Chao-Li; Pu, Pei-Hua; Huang, Hao-Jen; Sung, Huang-Mo; Liaw, Hung-Jiun; Chen, Yi-Min; Chen, Chien-Ming; Huang, Ming-Ban; Osada, Naoki; Gojobori, Takashi; Pai, Tun-Wen; Chen, Yu-Tin; Hwang, Chi-Chuan; Chiang, Tzen-Yuh

2015-01-01

Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

KAUST Repository

Huang, Chao-Li

2015-03-15

Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

Energy Technology Data Exchange (ETDEWEB)

Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.

2010-01-27

Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

International Nuclear Information System (INIS)

Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina

2002-01-01

In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

FASTERp: A Feature Array Search Tool for Estimating Resemblance of Protein Sequences

Energy Technology Data Exchange (ETDEWEB)

Macklin, Derek; Egan, Rob; Wang, Zhong

2014-03-14

Metagenome sequencing efforts have provided a large pool of billions of genes for identifying enzymes with desirable biochemical traits. However, homology search with billions of genes in a rapidly growing database has become increasingly computationally impractical. Here we present our pilot efforts to develop a novel alignment-free algorithm for homology search. Specifically, we represent individual proteins as feature vectors that denote the presence or absence of short kmers in the protein sequence. Similarity between feature vectors is then computed using the Tanimoto score, a distance metric that can be rapidly computed on bit string representations of feature vectors. Preliminary results indicate good correlation with optimal alignment algorithms (Spearman r of 0.87, ~;;1,000,000 proteins from Pfam), as well as with heuristic algorithms such as BLAST (Spearman r of 0.86, ~;;1,000,000 proteins). Furthermore, a prototype of FASTERp implemented in Python runs approximately four times faster than BLAST on a small scale dataset (~;;1000 proteins). We are optimizing and scaling to improve FASTERp to enable rapid homology searches against billion-protein databases, thereby enabling more comprehensive gene annotation efforts.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

OpenAIRE

Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

2005-01-01

Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

Science.gov (United States)

Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

2012-09-01

FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

Bioaugmentation with endophytic bacterium E6S homologous to Achromobacter piechaudii enhances metal rhizoaccumulation in host Sedum plumbizincicola

Directory of Open Access Journals (Sweden)

Ying eMa

2016-02-01

Full Text Available Application of hyperaccumulator–endophyte symbiotic systems is a potential approach to improve phytoremediation efficiency, since some beneficial endophytic bacteria are able to detoxify heavy metals, alter metal solubility in soil and facilitate plant growth. The objective of this study was to isolate multi-metal resistant and plant beneficial endophytic bacteria and to evaluate their role in enhancing plant growth and metal accumulation/translocation. The metal resistant endophytic bacterial strain E6S was isolated from stems of the Zn/Cd hyperaccumulator plant Sedum plumbizincicola growing in metalliferous mine soils using Dworkin and Foster salts minimal agar medium with 1-aminocyclopropane-1-carboxylate (ACC as the sole nitrogen source, and identified as homologous to Achromobacter piechaudii based on morphological and biochemical characteristics, partial 16S rDNA sequence and phylogenetic analysis. Strain E6S showed high level of resistance to various metals (Cd, Zn and Pb. Besides utilizing ACC, strain E6S exhibited plant beneficial traits, such as solubilization of phosphate and production of indole-3-acetic acid. Inoculation with E6S significantly increased the bioavailability of Cd, Zn and Pb in soil. In addition, bacterial cells bound considerable amounts of metal ions in the following order: Zn ˃ Cd ˃ Pb. Inoculation of E6S significantly stimulated plant biomass, uptake and bioaccumulation of Cd, Zn and Pb. However, E6S greatly reduced the root to shoot translocation of Cd and Zn, indicating that bacterial inoculation assisted the host plant to uptake and store heavy metals in its root system. Inoculation with the endophytic bacterium E6S homologous to A. piechaudii can improve phytostabilization of metalliferous soils due to its effective ability to enhance in situ metal rhizoaccumulation in plants.

Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination.

Science.gov (United States)

Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

2016-01-01

We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case. Increased frequency of short sequence

Accurate protein structure modeling using sparse NMR data and homologous structure information.

Science.gov (United States)

Thompson, James M; Sgourakis, Nikolaos G; Liu, Gaohua; Rossi, Paolo; Tang, Yuefeng; Mills, Jeffrey L; Szyperski, Thomas; Montelione, Gaetano T; Baker, David

2012-06-19

While information from homologous structures plays a central role in X-ray structure determination by molecular replacement, such information is rarely used in NMR structure determination because it can be incorrect, both locally and globally, when evolutionary relationships are inferred incorrectly or there has been considerable evolutionary structural divergence. Here we describe a method that allows robust modeling of protein structures of up to 225 residues by combining (1)H(N), (13)C, and (15)N backbone and (13)Cβ chemical shift data, distance restraints derived from homologous structures, and a physically realistic all-atom energy function. Accurate models are distinguished from inaccurate models generated using incorrect sequence alignments by requiring that (i) the all-atom energies of models generated using the restraints are lower than models generated in unrestrained calculations and (ii) the low-energy structures converge to within 2.0 Å backbone rmsd over 75% of the protein. Benchmark calculations on known structures and blind targets show that the method can accurately model protein structures, even with very remote homology information, to a backbone rmsd of 1.2-1.9 Å relative to the conventional determined NMR ensembles and of 0.9-1.6 Å relative to X-ray structures for well-defined regions of the protein structures. This approach facilitates the accurate modeling of protein structures using backbone chemical shift data without need for side-chain resonance assignments and extensive analysis of NOESY cross-peak assignments.

Morphological and genetic characteristics of the liver hydatid cyst of a donkey with iran origin.

Directory of Open Access Journals (Sweden)

Ali Eslami

2014-09-01

Full Text Available No data is available on morphology and genetic characteristics of Echinococcus granulosus derived from donkeys of Iran, despite of its existence in donkeys. In the present study morphometric variations of the rostellar hooks of protoscoleces and genotype characteristics of hydatid cyst of donkey from Iran were determined.Protoscoleces prepared from hydatid cyst of donkey of Iran were morphometric and genetic analyzed. The genetic analysis was done using Cox 1 gene by comparative sequence analysis.Our morphometric results showed that donkey of Iran shares 6 out of 7 determined parameters with donkeys of Jordan and 4 out of 7 with 4 available data with Switzerland donkeys. Morphological similarities and dissimilarities were observed with sheep-dog (G1 and camel-dog strains (G6 of Iran. The nucleotide sequence alignment showed that the partial sequence of Cox 1 from donkey had 91% homology with query coverage of 99% to the corresponding sequence of E. equinus, 90% homology to the E. felidis, 90% homology to E. ortleppi, 89% homology to the E. shiquinus, 89% homology to the E. vogeli, 89% homology to the E. oligarthrus, 88% homology to the E. canadensis and 83% homology to the Taenia solium. Additionally, the amino acid sequence of this gene has also some differences between this strain and all known strains of E. granulosus even with E. equinus (G4.Despite of common morphological characteristics of Iranian donkey hydatid cyst with those of donkeys of other parts of the world, genetically it has its own entity.

Salmon louse (Lepeophtheirus salmonis transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis

Directory of Open Access Journals (Sweden)

Jonassen Inge

2008-03-01

Full Text Available Abstract Background Lepeophtheirus salmonis is an ectoparasitic copepod feeding on skin, mucus and blood from salmonid hosts. Initial analysis of EST sequences from pre adult and adult stages of L. salmonis revealed a large proportion of novel transcripts. In order to link unknown transcripts to biological functions we have combined EST sequencing and microarray analysis to characterize female salmon louse transcriptomes during post molting maturation and egg production. Results EST sequence analysis shows that 43% of the ESTs have no significant hits in GenBank. Sequenced ESTs assembled into 556 contigs and 1614 singletons and whenever homologous genes were identified no clear correlation with homologous genes from any specific animal group was evident. Sequence comparison of 27 L. salmonis proteins with homologous proteins in humans, zebrafish, insects and crustaceans revealed an almost identical sequence identity with all species. Microarray analysis of maturing female adult salmon lice revealed two major transcription patterns; up-regulation during the final molting followed by down regulation and female specific up regulation during post molting growth and egg production. For a third minor group of ESTs transcription decreased during molting from pre-adult II to immature adults. Genes regulated during molting typically gave hits with cuticula proteins whilst transcripts up regulated during post molting growth were female specific, including two vitellogenins. Conclusion The copepod L.salmonis contains high a level of novel genes. Among analyzed L.salmonis proteins, sequence identities with homologous proteins in crustaceans are no higher than to homologous proteins in humans. Three distinct processes, molting, post molting growth and egg production correlate with transcriptional regulation of three groups of transcripts; two including genes related to growth, one including genes related to egg production. The function of the regulated

Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR

Directory of Open Access Journals (Sweden)

Madlung Johannes

2010-05-01

Full Text Available Abstract Background Often high-quality MS/MS spectra of tryptic peptides do not match to any database entry because of only partially sequenced genomes and therefore, protein identification requires de novo peptide sequencing. To achieve protein identification of the economically important but still unsequenced plant pathogenic oomycete Plasmopara halstedii, we first evaluated the performance of three different de novo peptide sequencing algorithms applied to a protein digests of standard proteins using a quadrupole TOF (QStar Pulsar i. Results The performance order of the algorithms was PEAKS online > PepNovo > CompNovo. In summary, PEAKS online correctly predicted 45% of measured peptides for a protein test data set. All three de novo peptide sequencing algorithms were used to identify MS/MS spectra of tryptic peptides of an unknown 57 kDa protein of P. halstedii. We found ten de novo sequenced peptides that showed homology to a Phytophthora infestans protein, a closely related organism of P. halstedii. Employing a second complementary approach, verification of peptide prediction and protein identification was performed by creation of degenerate primers for RACE-PCR and led to an ORF of 1,589 bp for a hypothetical phosphoenolpyruvate carboxykinase. Conclusions Our study demonstrated that identification of proteins within minute amounts of sample material improved significantly by combining sensitive LC-MS methods with different de novo peptide sequencing algorithms. In addition, this is the first study that verified protein prediction from MS data by also employing a second complementary approach, in which RACE-PCR led to identification of a novel elicitor protein in P. halstedii.

A local homology theory for linearly compact modules

International Nuclear Information System (INIS)

Nguyen Tu Cuong; Tran Tuan Nam

2004-11-01

We introduce a local homology theory for linearly modules which is in some sense dual to the local cohomology theory of A. Grothendieck. Some basic properties of local homology modules are shown such as: the vanishing and non-vanishing, the noetherianness of local homology modules. By using duality, we extend some well-known results in theory of local cohomology of A. Grothendieck. (author)

Identification and partial sequencing of a crocodile poxvirus associated with deeply penetrating skin lesions in farmed Nile crocodiles, Crocodylus niloticus.

Science.gov (United States)

Huchzermeyer, F W; Wallace, D B; Putterill, J F; Gerdes, G H

2009-09-01

When large numbers of crocodile skins were downgraded because of the presence of small pin prick-like holes, collapsed epidermal cysts were found deep in the dermis of juvenile crocodiles while forming cysts were observed in hatchlings. Histopathology of these forming cysts showed the presence of intracytoplasmic inclusions in proliferating and ballooning epidermal cells. Pox virions were seen in electron microscope preparations made from the scabs of such early lesions. The partial sequencing of virus material from scrapings of these lesions and comparison of it with the published sequence of crocodile poxvirus showed the virus associated with the deep lesions to be closely related, but different. To differentiate between the two forms of crocodile pox infection it is suggested that the previously known form should be called "classical crocodile pox" and the newly discovered form "atypical crocodile pox". The application of strict hygiene measures brought about a decline in the percentage of downgraded skins.

Identification and partial sequencing of a crocodile poxvirus associated with deeply penetrating skin lesions in farmed Nile crocodiles, Crocodylus niloticus

Directory of Open Access Journals (Sweden)

F.W. Huchzermeyer

2009-09-01

Full Text Available When large numbers of crocodile skins were downgraded because of the presence of small pin pricklike holes, collapsed epidermal cysts were found deep in the dermis of juvenile crocodiles while forming cysts were observed in hatchlings. Histopathology of these forming cysts showed the presence of intracytoplasmic inclusions in proliferating and ballooning epidermal cells. Pox virions were seen in electron microscope preparations made from the scabs of such early lesions. The partial sequencing of virus material from scrapings of these lesions and comparison of it with the published sequence of crocodile poxvirus showed the virus associated with the deep lesions to be closely related, but different. To differentiate between the two forms of crocodile pox infection it is suggested that the previously known form should be called ''classical crocodile pox'' and the newly discovered form ''atypical crocodile pox''. The application of strict hygiene measures brought about a decline in the percentage of downgraded skins.

Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions.

Science.gov (United States)

Zhou, Hufeng; Gao, Shangzhi; Nguyen, Nam Ninh; Fan, Mengyuan; Jin, Jingjing; Liu, Bing; Zhao, Liang; Xiong, Geng; Tan, Min; Li, Shijun; Wong, Limsoon

2014-04-08

H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both

Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

Directory of Open Access Journals (Sweden)

Holly J Atkinson

Full Text Available The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

Science.gov (United States)

Atkinson, Holly J; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C

2009-01-01

The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

Synergistic interactions between RAD5, RAD16, and RAD54, three partially homologous yeast DNA repair genes each in a different repair pathway

International Nuclear Information System (INIS)

Glassner, B.J.; Mortimer, R.K.

1994-01-01

Considerable homology has recently been noted between the proteins encoded by the RAD5, RAD16 and RAD54 genes of Saccharomyces cerevisiae. These genes are members of the RAD6, RAD3 and RAD50 epistasis groups, respectively, which correspond to the three major DNA repair pathways in yeast. These proteins also share homology with other eucaryotic proteins, including those encoded by SNF2 and MO1 of yeast, brahma and lodestar of Drosophila and the human ERCC6 gene. The homology shares features with known helicases, suggesting a newly identified helicase subfamily. We have constructed a series of congenic single-, double- and triple-deletion mutants involving RAD5, RAD16 and RAD54 to examine the interactions between these genes. Each deletion mutation alone has only a moderate effect on survival after exposure to UV radiation. Each pairwise-double mutant exhibits marked synergism. The triple-deletion mutant displays further synergism. These results confirm the assignment of the RAD54 gene to the RAD50 epistasis group and suggest that the RAD16 gene plays a larger role in DNA repair after exposure to UV radiation than has been suggested previously. Additionally, the proteins encoded by RAD5, RAD16, and RAD54 may compete for the same substrate after damage induced by UV radiation, possibly at an early step in their respective pathways. 49 refs., 6 figs., 2 tabs

[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

Science.gov (United States)

Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

2008-05-01

One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

The concept of homology as a basis for evaluating developmental mechanisms: exploring selective attention across the life-span.

Science.gov (United States)

Lickliter, Robert; Bahrick, Lorraine E

2013-01-01

Research with human infants as well as non-human animal embryos and infants has consistently demonstrated the benefits of intersensory redundancy for perceptual learning and memory for redundantly specified information during early development. Studies of infant affect discrimination, face discrimination, numerical discrimination, sequence detection, abstract rule learning, and word comprehension and segmentation have all shown that intersensory redundancy promotes earlier detection of these properties when compared to unimodal exposure to the same properties. Here we explore the idea that such intersensory facilitation is evident across the life-span and that this continuity is an example of a developmental behavioral homology. We present evidence that intersensory facilitation is most apparent during early phases of learning for a variety of tasks, regardless of developmental level, including domains that are novel or tasks that require discrimination of fine detail or speeded responses. Under these conditions, infants, children, and adults all show intersensory facilitation, suggesting a developmental homology. We discuss the challenge and propose strategies for establishing appropriate guidelines for identifying developmental behavioral homologies. We conclude that evaluating the extent to which continuities observed across development are homologous can contribute to a better understanding of the processes of development. Copyright © 2012 Wiley Periodicals, Inc.

Functional Coverage of the Human Genome by Existing Structures, Structural Genomics Targets, and Homology Models.

Directory of Open Access Journals (Sweden)

2005-08-01

Full Text Available The bias in protein structure and function space resulting from experimental limitations and targeting of particular functional classes of proteins by structural biologists has long been recognized, but never continuously quantified. Using the Enzyme Commission and the Gene Ontology classifications as a reference frame, and integrating structure data from the Protein Data Bank (PDB, target sequences from the structural genomics projects, structure homology derived from the SUPERFAMILY database, and genome annotations from Ensembl and NCBI, we provide a quantified view, both at the domain and whole-protein levels, of the current and projected coverage of protein structure and function space relative to the human genome. Protein structures currently provide at least one domain that covers 37% of the functional classes identified in the genome; whole structure coverage exists for 25% of the genome. If all the structural genomics targets were solved (twice the current number of structures in the PDB, it is estimated that structures of one domain would cover 69% of the functional classes identified and complete structure coverage would be 44%. Homology models from existing experimental structures extend the 37% coverage to 56% of the genome as single domains and 25% to 31% for complete structures. Coverage from homology models is not evenly distributed by protein family, reflecting differing degrees of sequence and structure divergence within families. While these data provide coverage, conversely, they also systematically highlight functional classes of proteins for which structures should be determined. Current key functional families without structure representation are highlighted here; updated information on the "most wanted list" that should be solved is available on a weekly basis from http://function.rcsb.org:8080/pdb/function_distribution/index.html.

Protein sequence comparison and protein evolution

Energy Technology Data Exchange (ETDEWEB)

Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry

1995-12-31

This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

Identification and partial characterization of Taastrup virus: a newly identified member species of the Mononegavirales

DEFF Research Database (Denmark)

Bock, J.O.; Lundsgaard, T.; Pedersen, P.A.

2004-01-01

with the glycoproteins of Filoviridae and Pneumovirinae, and a nucleoprotein (N) with homology to the nucleoprotein of viral hemorrhagic septicemia virus (VHSV), a member of the Rhabdoviridae. Highly conserved domains were identified in the RNA-dependent RNA polymerase (L) between TV and other viruses within the order...... of Mononegavirales, and homology was found in particular with members of the Rhabdoviridae. The sequence similarities and the unique filovirus-like but nonidentical morphology unambiguously refer this newly identified virus to the order of Mononegavirales but to no family more than any to other within the order....

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

DEFF Research Database (Denmark)

Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...

The partial mitochondrial sequence of the Old World stingless bee ...

Indian Academy of Sciences (India)

Sequences of primers used in PCR reactions of T. pagdeni mtDNA. mtDNA genes. Primer. Sequence. ATPase (6,8). ATPS6-F. 5 -AAG ATA TAT GGA AAT AAG CT-3. tRNA-ASP-R. 5 -ATA AAA TAA CGT CAA AAT GTC A-3. COI. COI-F. 5 - ATA ATT ATT GTT GCT GAT GTA-3. COI-R. 5 -CTA TTC ATA TAA CTG GAA TTT C-3.

The root epidermis-specific pea gene RH2 is homologous to a pathogenesis-related gene.

NARCIS (Netherlands)

Mylona, P.; Moerman, M.; Yang, W.C.; Gloudemans, T.; Kerckhove, van de J.; Kammen, van A.; Bisseling, T.; Franssen, H.J.

1994-01-01

Two-dimensional gel electrophoresis of pea root and root hair proteins revealed the existence of at least 10 proteins present at elevated levels in root hairs. One of these, named RH2, was isolated and a partial amino acid sequence was determined from two tryptic peptides. Using this sequence

Statistical Inference for Porous Materials using Persistent Homology.

Energy Technology Data Exchange (ETDEWEB)

Moon, Chul [Univ. of Georgia, Athens, GA (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mitchell, Scott A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-12-01

We propose a porous materials analysis pipeline using persistent homology. We rst compute persistent homology of binarized 3D images of sampled material subvolumes. For each image we compute sets of homology intervals, which are represented as summary graphics called persistence diagrams. We convert persistence diagrams into image vectors in order to analyze the similarity of the homology of the material images using the mature tools for image analysis. Each image is treated as a vector and we compute its principal components to extract features. We t a statistical model using the loadings of principal components to estimate material porosity, permeability, anisotropy, and tortuosity. We also propose an adaptive version of the structural similarity index (SSIM), a similarity metric for images, as a measure to determine the statistical representative elementary volumes (sREV) for persistence homology. Thus we provide a capability for making a statistical inference of the uid ow and transport properties of porous materials based on their geometry and connectivity.

Bioinformatics approach of three partial polyprenol reductase genes in Kandelia obovata

Science.gov (United States)

Basyuni, M.; Wati, R.; Sagami, H.; Oku, H.; Baba, S.

2018-03-01

This present study describesthe bioinformatics approach to analyze three partial polyprenol reductase genes from mangrove plant, Kandeliaobovataas well aspredictedphysical and chemical properties, potential peptide, subcellular localization, and phylogenetic. The diversity was noted in the physical and chemical properties of three partial polyprenol reductase genes. The values of chloroplast were relatively high, showed that chloroplast transit peptide occurred in mangrove polyprenol reductase. The target peptide value of mitochondria varied from 0.088 to 0.198 indicated it was possible to be present. These results suggested the importance of understanding the diversity of physicochemical properties of the different amino acids in polyprenol reductase. The subcellular localization of two partial genes located in the plasma membrane. To confirm the homology among the polyprenol reductase in the database, a dendrogram was drawn. The phylogenetic tree depicts that there are three clusters, the partial genes of K. obovata joined the largest one: C23157 was close to Ricinus communis polyprenol reductase. Whereas, C23901 and C24171 were grouped with Ipomoea nil polyprenol reductase, suggested that these polyprenol reductase genes form distinct separation into tropical habitat plants.

K-homology and K-cohomology constructions of relations

International Nuclear Information System (INIS)

Abd El-Sattar, A. Dabbour; Bayoumy, F.M.

1990-08-01

One of the important homology (cohomology) theories, based on systems of covering of the space, is the homology (cohomology) theory of relations. In the present work, by using the idea of K-homology and K-cohomology groups different varieties of the Dowker's theory are introduced and studied. These constructions are defined on the category of pairs of topological spaces and over a pair of coefficient groups. (author). 14 refs

The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

NARCIS (Netherlands)

Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

2001-01-01

The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae.

Science.gov (United States)

Bao, Zehua; Xiao, Han; Liang, Jing; Zhang, Lu; Xiong, Xiong; Sun, Ning; Si, Tong; Zhao, Huimin

2015-05-15

One-step multiple gene disruption in the model organism Saccharomyces cerevisiae is a highly useful tool for both basic and applied research, but it remains a challenge. Here, we report a rapid, efficient, and potentially scalable strategy based on the type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated proteins (Cas) system to generate multiple gene disruptions simultaneously in S. cerevisiae. A 100 bp dsDNA mutagenizing homologous recombination donor is inserted between two direct repeats for each target gene in a CRISPR array consisting of multiple donor and guide sequence pairs. An ultrahigh copy number plasmid carrying iCas9, a variant of wild-type Cas9, trans-encoded RNA (tracrRNA), and a homology-integrated crRNA cassette is designed to greatly increase the gene disruption efficiency. As proof of concept, three genes, CAN1, ADE2, and LYP1, were simultaneously disrupted in 4 days with an efficiency ranging from 27 to 87%. Another three genes involved in an artificial hydrocortisone biosynthetic pathway, ATF2, GCY1, and YPR1, were simultaneously disrupted in 6 days with 100% efficiency. This homology-integrated CRISPR (HI-CRISPR) strategy represents a powerful tool for creating yeast strains with multiple gene knockouts.

Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

Science.gov (United States)

Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

2017-04-01

Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of

Homologation of methanol catalyzed by transition metal complexes in the presence of tertiary amines

Energy Technology Data Exchange (ETDEWEB)

Tanaka, Masato; Ogata, Ikuei

1987-12-18

This paper describes the homologation of methanol by transition metal carbonyl catalysts in the presence of tertiary amines. Methanol was reacted with amine using a catalyst at 180/sup 0/C under 100 atm in the atmosphere of CO and H/sub 2/ mixed at the ratio of 4 in an autoclave. The reaction activities and selectivities of ethanol using iron carbonyl and Co carbonyl catalysts are superior. Only the iron catalyst was used hereafter because phosphine is required for the latter catalyst. N-methyl- piperidine, a cyclic amine, is superior to the other amines. The selectivity of ethanol is higher under higher partial pressure of H/sub 2/ and lower partial pressure of CO. The conversion rate is optimum at 180/sup 0/ and it goes down with increasing the temperature from it. Since the selectivity is markedly decreased with increasing amine, the reaction activity must be balanced with the amount of amine. The presence of solvent affects it. (3 figs, 6 tabs, 15 refs)

Multiscale analysis of nonlinear systems using computational homology

Energy Technology Data Exchange (ETDEWEB)

Konstantin Mischaikow; Michael Schatz; William Kalies; Thomas Wanner

2010-05-24

This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

Multiscale analysis of nonlinear systems using computational homology

Energy Technology Data Exchange (ETDEWEB)

Konstantin Mischaikow, Rutgers University/Georgia Institute of Technology, Michael Schatz, Georgia Institute of Technology, William Kalies, Florida Atlantic University, Thomas Wanner,George Mason University

2010-05-19

This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

Persistent homology of complex networks

International Nuclear Information System (INIS)

Horak, Danijela; Maletić, Slobodan; Rajković, Milan

2009-01-01

Long-lived topological features are distinguished from short-lived ones (considered as topological noise) in simplicial complexes constructed from complex networks. A new topological invariant, persistent homology, is determined and presented as a parameterized version of a Betti number. Complex networks with distinct degree distributions exhibit distinct persistent topological features. Persistent topological attributes, shown to be related to the robust quality of networks, also reflect the deficiency in certain connectivity properties of networks. Random networks, networks with exponential connectivity distribution and scale-free networks were considered for homological persistency analysis

TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

Directory of Open Access Journals (Sweden)

Sharma Gaurav

2011-04-01

Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

Micropathogen Community Analysis in Hyalomma rufipes via High-Throughput Sequencing of Small RNAs

Science.gov (United States)

Luo, Jin; Liu, Min-Xuan; Ren, Qiao-Yun; Chen, Ze; Tian, Zhan-Cheng; Hao, Jia-Wei; Wu, Feng; Liu, Xiao-Cui; Luo, Jian-Xun; Yin, Hong; Wang, Hui; Liu, Guang-Yuan

2017-01-01

Ticks are important vectors in the transmission of a broad range of micropathogens to vertebrates, including humans. Because of the role of ticks in disease transmission, identifying and characterizing the micropathogen profiles of tick populations have become increasingly important. The objective of this study was to survey the micropathogens of Hyalomma rufipes ticks. Illumina HiSeq2000 technology was utilized to perform deep sequencing of small RNAs (sRNAs) extracted from field-collected H. rufipes ticks in Gansu Province, China. The resultant sRNA library data revealed that the surveyed tick populations produced reads that were homologous to St. Croix River Virus (SCRV) sequences. We also observed many reads that were homologous to microbial and/or pathogenic isolates, including bacteria, protozoa, and fungi. As part of this analysis, a phylogenetic tree was constructed to display the relationships among the homologous sequences that were identified. The study offered a unique opportunity to gain insight into the micropathogens of H. rufipes ticks. The effective control of arthropod vectors in the future will require knowledge of the micropathogen composition of vectors harboring infectious agents. Understanding the ecological factors that regulate vector propagation in association with the prevalence and persistence of micropathogen lineages is also imperative. These interactions may affect the evolution of micropathogen lineages, especially if the micropathogens rely on the vector or host for dispersal. The sRNA deep-sequencing approach used in this analysis provides an intuitive method to survey micropathogen prevalence in ticks and other vector species. PMID:28861401

Survey of transposable elements in sugarcane expressed sequence tags (ESTs

Directory of Open Access Journals (Sweden)

Rossi Magdalena

2001-01-01

Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

Directory of Open Access Journals (Sweden)

Yang Jie

2017-01-01

Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

Exploring sequence characteristics related to high-level production of secreted proteins in Aspergillus niger.

Directory of Open Access Journals (Sweden)

Bastiaan A van den Berg

Full Text Available Protein sequence features are explored in relation to the production of over-expressed extracellular proteins by fungi. Knowledge on features influencing protein production and secretion could be employed to improve enzyme production levels in industrial bioprocesses via protein engineering. A large set, over 600 homologous and nearly 2,000 heterologous fungal genes, were overexpressed in Aspergillus niger using a standardized expression cassette and scored for high versus no production. Subsequently, sequence-based machine learning techniques were applied for identifying relevant DNA and protein sequence features. The amino-acid composition of the protein sequence was found to be most predictive and interpretation revealed that, for both homologous and heterologous gene expression, the same features are important: tyrosine and asparagine composition was found to have a positive correlation with high-level production, whereas for unsuccessful production, contributions were found for methionine and lysine composition. The predictor is available online at http://bioinformatics.tudelft.nl/hipsec. Subsequent work aims at validating these findings by protein engineering as a method for increasing expression levels per gene copy.

Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

Science.gov (United States)

Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

1995-02-15

The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

Identification of a Flavivirus Sequence in a Marine Arthropod.

Directory of Open Access Journals (Sweden)

Michael J Conway

Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

Conservation and co-option in developmental programmes: the importance of homology relationships

Directory of Open Access Journals (Sweden)

Becker May-Britt

2005-10-01

Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

A Line-Tau Collocation Method for Partial Differential Equations ...

African Journals Online (AJOL)

This paper deals with the numerical solution of second order linear partial differential equations with the use of the method of lines coupled with the tau collocation method. The method of lines is used to convert the partial differential equation (PDE) to a sequence of ordinary differential equations (ODEs) which is then ...

Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

Science.gov (United States)

Kuzmin, I V; Hughes, G J; Rupprecht, C E

2006-08-01

Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus.

Science.gov (United States)

Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming

2016-01-01

The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis

International Nuclear Information System (INIS)

Skory, C.D.; Horng, J.S.; Pestka, J.J.; Linz, J.E.

1990-01-01

The lack of efficient transformation methods for aflatoxigenic Aspergillus parasiticus has been a major constraint for the study of aflatoxin biosynthesis at the genetic level. A transformation system with efficiencies of 30 to 50 stable transformants per μg of DNA was developed for A. parasiticus by using homologous pyrG gene. The pyrG gene from A. parasiticus was isolated by in situ plaque hybridization of a lambda genomic DNA library. Uridine auxotrophs of A. parasiticus ATCC 36537, a mutant blocked in aflatoxin biosynthesis, were isolated by selection on 5-fluoroorotic acid following nitrosoguanidine mutagenesis. Isolates with mutations in the pyrG gene resulting in elimination of orotidine monophosphate (OMP) decarboxylase activity were detected by assaying cell extracts for their ability to convert [ 14 C]OMP to [ 14 C]UMP. Transformation of A. parasiticus pyrG protoplasts with the homologous pyrG gene restored the fungal cells to prototrophy. Enzymatic analysis of cell extracts of transformant clones demonstrated that these extracts had the ability to convert [ 14 C]OMP to [ 14 C]UMP. Southern analysis of DNA purified from transformant clones indicated that both pUC19 vector sequences and pyrG sequences were integrated into the genome. The development of this pyrG transformation system should allow cloning of the aflatoxin-biosynthetic genes, which will be useful in studying the regulation of aflatoxin biosynthesis and may ultimately provide a means for controlling aflatoxin production in the field

Ancient DNA analyses of museum specimens from selected Presbytis (primate: Colobinae) based on partial Cyt b sequences

Science.gov (United States)

Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.

2016-11-01

The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

Science.gov (United States)

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

Directory of Open Access Journals (Sweden)

Maréchal Eric

2005-03-01

Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

Generation and analysis of expressed sequence tags from Botrytis cinerea

Directory of Open Access Journals (Sweden)

EVELYN SILVA

2006-01-01

Full Text Available Botrytis cinerea is a filamentous plant pathogen of a wide range of plant species, and its infection may cause enormous damage both during plant growth and in the post-harvest phase. We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions: more than 50% of the sequences code for genes involved in cellular metabolism, 12% for transport of metabolites, and approximately 10% for cellular organization. Other functional categories include responses to biotic and abiotic stimuli, cell communication, cell homeostasis, and cell development. We carried out pair-wise comparisons with fungal databases to determine the B. cinerea unisequence set with relevant similarity to genes in other fungal pathogenic counterparts. Among the 4,035 non-redundant B. cinerea unigenes, 1,338 (23% have significant homology with Fusarium verticillioides unigenes. Similar values were obtained for Saccharomyces cerevisiae and Aspergillus nidulans (22% and 24%, respectively. The lower percentages of homology were with Magnaporthe grisae and Neurospora crassa (13% and 19%, respectively. Several genes involved in putative and known fungal virulence and general pathogenicity were identified. The results provide important information for future research on this fungal pathogen

A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci.

Science.gov (United States)

Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun

2013-03-25

Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

The K-homology of nets of C∗-algebras

Science.gov (United States)

Ruzzi, Giuseppe; Vasselli, Ezio

2014-12-01

Let X be a space, intended as a possibly curved space-time, and A a precosheaf of C∗-algebras on X. Motivated by algebraic quantum field theory, we study the Kasparov and Θ-summable K-homology of A interpreting them in terms of the holonomy equivariant K-homology of the associated C∗-dynamical system. This yields a characteristic class for K-homology cycles of A with values in the odd cohomology of X, that we interpret as a generalized statistical dimension.

New Insight Into the Diversity of SemiSWEET Sugar Transporters and the Homologs in Prokaryotes

Directory of Open Access Journals (Sweden)

Baolei Jia

2018-05-01

Full Text Available Sugars will eventually be exported transporters (SWEETs and SemiSWEETs represent a family of sugar transporters in eukaryotes and prokaryotes, respectively. SWEETs contain seven transmembrane helices (TMHs, while SemiSWEETs contain three. The functions of SemiSWEETs are less studied. In this perspective article, we analyzed the diversity and conservation of SemiSWEETs and further proposed the possible functions. 1,922 SemiSWEET homologs were retrieved from the UniProt database, which is not proportional to the sequenced prokaryotic genomes. However, these proteins are very diverse in sequences and can be classified into 19 clusters when >50% sequence identity is required. Moreover, a gene context analysis indicated that several SemiSWEETs are located in the operons that are related to diverse carbohydrate metabolism. Several proteins with seven TMHs can be found in bacteria, and sequence alignment suggested that these proteins in bacteria may be formed by the duplication and fusion. Multiple sequence alignments showed that the amino acids for sugar translocation are still conserved and coevolved, although the sequences show diversity. Among them, the functions of a few amino acids are still not clear. These findings highlight the challenges that exist in SemiSWEETs and provide future researchers the foundation to explore these uncharted areas.

Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

DEFF Research Database (Denmark)

Ibaraki, K; Kozak, C A; Wewer, U M

1995-01-01

regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

Pathogenesis-related proteins in Brazilian wheat genotypes: protein induction and partial gene sequencing Proteínas relacionadas à patogênese em genótipos brasileiros de trigo: indução e seqüenciamento parcial

Directory of Open Access Journals (Sweden)

Loreta Brandão de Freitas

2003-06-01

Full Text Available Leaves from 14 Brazilian genotypes of Triticum aestivum L. were treated with salicylic acid to induce pathogenesis-related (PR proteins. Inter and intracellular extracts were then obtained and investigated through polyacrilamide gel electrophoresis. Seven bands were observed. Material related to two of them (of 40 and 24 kDa occurred in intracellular spaces only. DNA from these same genotypes was then amplified through PCR using primers developed from three sequences encoding PR proteins, and compared with previously described sequences. The fragments presented homologies to PR groups 1, 3 (chitinases, and 5 (thaumatin-like. The PR3-like sequence also showed a site characteristic of PRs induced by ethylene and a portion without homology with previous sequences. No variation among genotypes were observed, either for protein extracts or DNA sequences.Folhas de 14 genótipos brasileiros de Triticum aestivum L. foram tratadas com ácido salicílico para a indução de proteínas relacionadas à patogênese (PR. Extratos inter e intracelulares foram assim obtidos e estudados através de eletroforese em gel de poliacrilamida. Sete bandas foram observadas, sendo que o material referente a duas delas (de 40 e 24 kDa foi detectado somente nos espaços intracelulares. O DNA desses mesmos genótipos foi então amplificado através de PCR, usando iniciadores desenvolvidos a partir de três seqüências que codificam proteínas PR, e comparados com seqüências previamente descritas. Eles apresentaram homologia com os grupos PR 1, PR 3 (quitinases e PR 5 (semelhante à taumatina, sendo que a seqüência do grupo PR 3 apresentou também um sítio característico de PRs induzidas pelo etileno e uma porção sem homologia com seqüências prévias. Não foi observada qualquer variação entre genótipos, seja nos extratos protéicos ou nas seqüências de DNA.

QUASAR--scoring and ranking of sequence-structure alignments.

Science.gov (United States)

Birzele, Fabian; Gewehr, Jan E; Zimmer, Ralf

2005-12-15

Sequence-structure alignments are a common means for protein structure prediction in the fields of fold recognition and homology modeling, and there is a broad variety of programs that provide such alignments based on sequence similarity, secondary structure or contact potentials. Nevertheless, finding the best sequence-structure alignment in a pool of alignments remains a difficult problem. QUASAR (quality of sequence-structure alignments ranking) provides a unifying framework for scoring sequence-structure alignments that aids finding well-performing combinations of well-known and custom-made scoring schemes. Those scoring functions can be benchmarked against widely accepted quality scores like MaxSub, TMScore, Touch and APDB, thus enabling users to test their own alignment scores against 'standard-of-truth' structure-based scores. Furthermore, individual score combinations can be optimized with respect to benchmark sets based on known structural relationships using QUASAR's in-built optimization routines.

Natural Homologous Triploidization and DNA Methylation in SARII-628, a Twin-seedling Line of Rice (Oryza sativa

Directory of Open Access Journals (Sweden)

Hai PENG

2007-12-01

Full Text Available A total of five pairs of diploid-triploid twin-seedlings (a diploid seedling and a triploid seedling emerged from a grain were selected out from 4500 pairs of seedlings from SARII-628, a twin-seedling rice line. SSR analysis indicated that no difference between the diploid seedling and corresponding triploid seedling in a twin-seedling was found at the 310 loci, indicating that there was no obvious change in DNA primary structure. A modified AFLP technique ‘MSAP (methylation-sensitive AFLP’ was used to analyze methylation mutation. Although no methylation mutation was noted among the five diploids, 29 methylation mutation loci were found from the corresponding triploids. This suggested that methylation mutation happened rapidly on M0 generation after natural homologous triploidization. The mutations were classified into 10 types, including 3 increased types, 3 decreased types and 4 undecided types of methylation-degrees. The bands of 22 loci were sequenced and then those sequences were searched through website. The result showed that the methylation mutation involved into the whole rice genome and the 12 pairs of chromosomes. The mutation trend was site-related and there were different mutation loci for different triploids, which foretold that SARII-628 would have different evolution fates after natural homologous triploidization.

Draft genome sequence of the Coccolithovirus Emiliania huxleyi virus 203.

Science.gov (United States)

Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

2011-12-01

The Coccolithoviridae are a recently discovered group of viruses that infect the marine coccolithophorid Emiliania huxleyi. Emiliania huxleyi virus 203 (EhV-203) has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 400 kbp, consisting of 464 coding sequences (CDSs). Here we describe the genomic features of EhV-203 together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

Science.gov (United States)

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

Efficient Generation of Orthologous Point Mutations in Pigs via CRISPR-assisted ssODN-mediated Homology-directed Repair

Directory of Open Access Journals (Sweden)

Kankan Wang

2016-01-01

Full Text Available Precise genome editing in livestock is of great value for the fundamental investigation of disease modeling. However, genetically modified pigs carrying subtle point mutations were still seldom reported despite the rapid development of programmable endonucleases. Here, we attempt to investigate single-stranded oligonucleotides (ssODN mediated knockin by introducing two orthologous pathogenic mutations, p.E693G for Alzheimer's disease and p.G2019S for Parkinson's disease, into porcine APP and LRRK2 loci, respectively. Desirable homology-directed repair (HDR efficiency was achieved in porcine fetal fibroblasts (PFFs by optimizing the dosage and length of ssODN templates. Interestingly, incomplete HDR alleles harboring partial point mutations were observed in single-cell colonies, which indicate the complex mechanism of ssODN-mediated HDR. The effect of mutation-to-cut distance on incorporation rate was further analyzed by deep sequencing. We demonstrated that a mutation-to-cut distance of 11 bp resulted in a remarkable difference in HDR efficiency between two point mutations. Finally, we successfully obtained one cloned piglet harboring the orthologous p.C313Y mutation at the MSTN locus via somatic cell nuclear transfer (SCNT. Our proof-of-concept study demonstrated efficient ssODN-mediated incorporation of pathogenic point mutations in porcine somatic cells, thus facilitating further development of disease modeling and genetic breeding in pigs.

Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

OpenAIRE

Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

2016-01-01

Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Computing Homology Group Generators of Images Using Irregular Graph Pyramids

OpenAIRE

Peltier , Samuel; Ion , Adrian; Haxhimusa , Yll; Kropatsch , Walter; Damiand , Guillaume

2007-01-01

International audience; We introduce a method for computing homology groups and their generators of a 2D image, using a hierarchical structure i.e. irregular graph pyramid. Starting from an image, a hierarchy of the image is built, by two operations that preserve homology of each region. Instead of computing homology generators in the base where the number of entities (cells) is large, we first reduce the number of cells by a graph pyramid. Then homology generators are computed efficiently on...

Homologs of the Acinetobacter baumannii AceI transporter represent a new family of bacterial multidrug efflux systems.

Science.gov (United States)

Hassan, Karl A; Liu, Qi; Henderson, Peter J F; Paulsen, Ian T

2015-02-10

Multidrug efflux systems are a major cause of resistance to antimicrobials in bacteria, including those pathogenic to humans, animals, and plants. These proteins are ubiquitous in these pathogens, and five families of bacterial multidrug efflux systems have been identified to date. By using transcriptomic and biochemical analyses, we recently identified the novel AceI (Acinetobacter chlorhexidine efflux) protein from Acinetobacter baumannii that conferred resistance to the biocide chlorhexidine, via an active efflux mechanism. Proteins homologous to AceI are encoded in the genomes of many other bacterial species and are particularly prominent within proteobacterial lineages. In this study, we expressed 23 homologs of AceI and examined their resistance and/or transport profiles. MIC analyses demonstrated that, like AceI, many of the homologs conferred resistance to chlorhexidine. Many of the AceI homologs conferred resistance to additional biocides, including benzalkonium, dequalinium, proflavine, and acriflavine. We conducted fluorimetric transport assays using the AceI homolog from Vibrio parahaemolyticus and confirmed that resistance to both proflavine and acriflavine was mediated by an active efflux mechanism. These results show that this group of AceI homologs represent a new family of bacterial multidrug efflux pumps, which we have designated the proteobacterial antimicrobial compound efflux (PACE) family of transport proteins. Bacterial multidrug efflux pumps are an important class of resistance determinants that can be found in every bacterial genome sequenced to date. These transport proteins have important protective functions for the bacterial cell but are a significant problem in the clinical setting, since a single efflux system can mediate resistance to many structurally and mechanistically diverse antibiotics and biocides. In this study, we demonstrate that proteins related to the Acinetobacter baumannii AceI transporter are a new class of multidrug

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

International Nuclear Information System (INIS)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-01-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' Δgag-fms-Δpol-Δenv 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

Energy Technology Data Exchange (ETDEWEB)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-10-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' ..delta..gag-fms-..delta..pol-..delta..env 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV.

Inverse statistical physics of protein sequences: a key issues review.

Science.gov (United States)

Cocco, Simona; Feinauer, Christoph; Figliuzzi, Matteo; Monasson, Rémi; Weigt, Martin

2018-03-01

In the course of evolution, proteins undergo important changes in their amino acid sequences, while their three-dimensional folded structure and their biological function remain remarkably conserved. Thanks to modern sequencing techniques, sequence data accumulate at unprecedented pace. This provides large sets of so-called homologous, i.e. evolutionarily related protein sequences, to which methods of inverse statistical physics can be applied. Using sequence data as the basis for the inference of Boltzmann distributions from samples of microscopic configurations or observables, it is possible to extract information about evolutionary constraints and thus protein function and structure. Here we give an overview over some biologically important questions, and how statistical-mechanics inspired modeling approaches can help to answer them. Finally, we discuss some open questions, which we expect to be addressed over the next years.

Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

Science.gov (United States)

Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

2015-05-01

Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinated genes accompanies its sedentary parasitic phase

Directory of Open Access Journals (Sweden)

Overall Christopher C

2007-04-01

Full Text Available Abstract Background Heterodera glycines (soybean cyst nematode [SCN], the major pathogen of Glycine max (soybean, undergoes muscle degradation (sarcopenia as it becomes sedentary inside the root. Many genes encoding muscular and neuromuscular components belong to the uncoordinated (unc family of genes originally identified in Caenorhabditis elegans. Previously, we reported a substantial decrease in transcript abundance for Hg-unc-87, the H. glycines homolog of unc-87 (calponin during the adult sedentary phase of SCN. These observations implied that changes in the expression of specific muscle genes occurred during sarcopenia. Results We developed a bioinformatics database that compares expressed sequence tag (est and genomic data of C. elegans and H. glycines (CeHg database. We identify H. glycines homologs of C. elegans unc genes whose protein products are involved in muscle composition and regulation. RT-PCR reveals the transcript abundance of H. glycines unc homologs at mobile and sedentary stages of its lifecycle. A prominent reduction in transcript abundance occurs in samples from sedentary nematodes for homologs of actin, unc-60B (cofilin, unc-89, unc-15 (paromyosin, unc-27 (troponin I, unc-54 (myosin, and the potassium channel unc-110 (twk-18. Less reduction is observed for the focal adhesion complex gene Hg-unc-97. Conclusion The CeHg bioinformatics database is shown to be useful in identifying homologs of genes whose protein products perform roles in specific aspects of H. glycines muscle biology. Our bioinformatics comparison of C. elegans and H. glycines genomic data and our Hg-unc-87 expression experiments demonstrate that the transcript abundance of specific H. glycines homologs of muscle gene decreases as the nematode becomes sedentary inside the root during its parasitic feeding stages.

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

I-SceI-mediated double-strand break does not increase the frequency of homologous recombination at the Dct locus in mouse embryonic stem cells.

Science.gov (United States)

Fenina, Myriam; Simon-Chazottes, Dominique; Vandormael-Pournin, Sandrine; Soueid, Jihane; Langa, Francina; Cohen-Tannoudji, Michel; Bernard, Bruno A; Panthier, Jean-Jacques

2012-01-01

Targeted induction of double-strand breaks (DSBs) at natural endogenous loci was shown to increase the rate of gene replacement by homologous recombination in mouse embryonic stem cells. The gene encoding dopachrome tautomerase (Dct) is specifically expressed in melanocytes and their precursors. To construct a genetic tool allowing the replacement of Dct gene by any gene of interest, we generated an embryonic stem cell line carrying the recognition site for the yeast I-SceI meganuclease embedded in the Dct genomic segment. The embryonic stem cell line was electroporated with an I-SceI expression plasmid, and a template for the DSB-repair process that carried sequence homologies to the Dct target. The I-SceI meganuclease was indeed able to introduce a DSB at the Dct locus in live embryonic stem cells. However, the level of gene targeting was not improved by the DSB induction, indicating a limited capacity of I-SceI to mediate homologous recombination at the Dct locus. These data suggest that homologous recombination by meganuclease-induced DSB may be locus dependent in mammalian cells.

Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner

OpenAIRE

Checchi, Paula M.; Engebrecht, JoAnne

2011-01-01

Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

Sequence of a New World primate insulin having low biological potency and immunoreactivity

Energy Technology Data Exchange (ETDEWEB)

Seino, S.; Steiner, D.F.; Bell, G.I.

1987-11-01

The organization of the insulin gene of the owl or night monkey (Aotus trivirgatus), a New World primate, is similar to that of the human gene. The sequences of these two genes and flanking regions possess 84.3% homology. An unusual feature of the owl monkey gene is the partial duplication and insertion of a portion of the A-chain coding sequence into the 3' untranslated region. The insulin gene of this primate also lacks a region of tandem repeats that is present in the 5' flanking region of the human and chimpanzee genes. Owl monkey preproinsulin has 85.5% identity with the human insulin precursor and is the most divergent of the primate insulins/preproinsulins yet described. The differences between owl monkey and human preproinsulin include three substitutions in the signal peptide, two in the B chain, seven in the C peptide, and three in the A chain. One of these replacements is the conservative substitution of valine for isoleucine a position A2, an invariant site in all other vertebrate insulins and insulin-like growth factors. The substitutions in owl monkey insulin at B9, B27, A2, A4, and A17 alter its structure so that it has only 20% of the receptor-binding activity and 1% of the affinity with guinea pig anti-porcine insulin antibodies as compared to human insulin.

Sequence of a New World primate insulin having low biological potency and immunoreactivity

International Nuclear Information System (INIS)

Seino, S.; Steiner, D.F.; Bell, G.I.

1987-01-01

The organization of the insulin gene of the owl or night monkey (Aotus trivirgatus), a New World primate, is similar to that of the human gene. The sequences of these two genes and flanking regions possess 84.3% homology. An unusual feature of the owl monkey gene is the partial duplication and insertion of a portion of the A-chain coding sequence into the 3' untranslated region. The insulin gene of this primate also lacks a region of tandem repeats that is present in the 5' flanking region of the human and chimpanzee genes. Owl monkey preproinsulin has 85.5% identity with the human insulin precursor and is the most divergent of the primate insulins/preproinsulins yet described. The differences between owl monkey and human preproinsulin include three substitutions in the signal peptide, two in the B chain, seven in the C peptide, and three in the A chain. One of these replacements is the conservative substitution of valine for isoleucine a position A2, an invariant site in all other vertebrate insulins and insulin-like growth factors. The substitutions in owl monkey insulin at B9, B27, A2, A4, and A17 alter its structure so that it has only 20% of the receptor-binding activity and 1% of the affinity with guinea pig anti-porcine insulin antibodies as compared to human insulin

Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

International Nuclear Information System (INIS)

Mladenov, Emil; Iliakis, George

2011-01-01

A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

Homologous Recombination between Genetically Divergent Campylobacter fetus Lineages Supports Host-Associated Speciation

Science.gov (United States)

Duim, Birgitta; van der Graaf-van Bloois, Linda; Wagenaar, Jaap A; Zomer, Aldert L

2018-01-01

Abstract Homologous recombination is a major driver of bacterial speciation. Genetic divergence and host association are important factors influencing homologous recombination. Here, we study these factors for Campylobacter fetus, which shows a distinct intraspecific host dichotomy. Campylobacter fetus subspecies fetus (Cff) and venerealis are associated with mammals, whereas C. fetus subsp. testudinum (Cft) is associated with reptiles. Recombination between these genetically divergent C. fetus lineages is extremely rare. Previously it was impossible to show whether this barrier to recombination was determined by the differential host preferences, by the genetic divergence between both lineages or by other factors influencing recombination, such as restriction-modification, CRISPR/Cas, and transformation systems. Fortuitously, a distinct C. fetus lineage (ST69) was found, which was highly related to mammal-associated C. fetus, yet isolated from a chelonian. The whole genome sequences of two C. fetus ST69 isolates were compared with those of mammal- and reptile-associated C. fetus strains for phylogenetic and recombination analysis. In total, 5.1–5.5% of the core genome of both ST69 isolates showed signs of recombination. Of the predicted recombination regions, 80.4% were most closely related to Cft, 14.3% to Cff, and 5.6% to C. iguaniorum. Recombination from C. fetus ST69 to Cft was also detected, but to a lesser extent and only in chelonian-associated Cft strains. This study shows that despite substantial genetic divergence no absolute barrier to homologous recombination exists between two distinct C. fetus lineages when occurring in the same host type, which provides valuable insights in bacterial speciation and evolution. PMID:29608720

ChickVD: a sequence variation database for the chicken genome

DEFF Research Database (Denmark)

Wang, Jing; He, Ximiao; Ruan, Jue

2005-01-01

Working in parallel with the efforts to sequence the chicken (Gallus gallus) genome, the Beijing Genomics Institute led an international team of scientists from China, USA, UK, Sweden, The Netherlands and Germany to map extensive DNA sequence variation throughout the chicken genome by sampling DN...... on quantitative trait loci using data from collaborating institutions and public resources. Our data can be queried by search engine and homology-based BLAST searches. ChickVD is publicly accessible at http://chicken.genomics.org.cn. Udgivelsesdato: 2005-Jan-1...

Draft genome sequence of the coccolithovirus Emiliania huxleyi virus 202.

Science.gov (United States)

Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

2012-02-01

Emiliania huxleyi virus 202 (EhV-202) is a member of the Coccolithoviridae, a group of viruses that infect the marine coccolithophorid Emiliania huxleyi. EhV-202 has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 407 kbp, consisting of 485 coding sequences (CDSs). Here we describe the genomic features of EhV-202, together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

International Nuclear Information System (INIS)

Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

1987-01-01

The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

The Arabidopsis thaliana homolog of the helicase RTEL1 plays multiple roles in preserving genome stability.

Science.gov (United States)

Recker, Julia; Knoll, Alexander; Puchta, Holger

2014-12-01

In humans, mutations in the DNA helicase Regulator of Telomere Elongation Helicase1 (RTEL1) lead to Hoyeraal-Hreidarsson syndrome, a severe, multisystem disorder. Here, we demonstrate that the RTEL1 homolog in Arabidopsis thaliana plays multiple roles in preserving genome stability. RTEL1 suppresses homologous recombination in a pathway parallel to that of the DNA translocase FANCM. Cytological analyses of root meristems indicate that RTEL1 is involved in processing DNA replication intermediates independently from FANCM and the nuclease MUS81. Moreover, RTEL1 is involved in interstrand and intrastrand DNA cross-link repair independently from FANCM and (in intrastrand cross-link repair) parallel to MUS81. RTEL1 contributes to telomere homeostasis; the concurrent loss of RTEL1 and the telomerase TERT leads to rapid, severe telomere shortening, which occurs much more rapidly than it does in the single-mutant line tert, resulting in developmental arrest after four generations. The double mutant rtel1-1 recq4A-4 exhibits massive growth defects, indicating that this RecQ family helicase, which is also involved in the suppression of homologous recombination and the repair of DNA lesions, can partially replace RTEL1 in the processing of DNA intermediates. The requirement for RTEL1 in multiple pathways to preserve genome stability in plants can be explained by its putative role in the destabilization of DNA loop structures, such as D-loops and T-loops. © 2014 American Society of Plant Biologists. All rights reserved.

Homologous Recombination as a Replication Fork Escort: Fork-Protection and Recovery

Directory of Open Access Journals (Sweden)

Audrey Costes

2012-12-01

Full Text Available Homologous recombination is a universal mechanism that allows DNA repair and ensures the efficiency of DNA replication. The substrate initiating the process of homologous recombination is a single-stranded DNA that promotes a strand exchange reaction resulting in a genetic exchange that promotes genetic diversity and DNA repair. The molecular mechanisms by which homologous recombination repairs a double-strand break have been extensively studied and are now well characterized. However, the mechanisms by which homologous recombination contribute to DNA replication in eukaryotes remains poorly understood. Studies in bacteria have identified multiple roles for the machinery of homologous recombination at replication forks. Here, we review our understanding of the molecular pathways involving the homologous recombination machinery to support the robustness of DNA replication. In addition to its role in fork-recovery and in rebuilding a functional replication fork apparatus, homologous recombination may also act as a fork-protection mechanism. We discuss that some of the fork-escort functions of homologous recombination might be achieved by loading of the recombination machinery at inactivated forks without a need for a strand exchange step; as well as the consequence of such a model for the stability of eukaryotic genomes.

A geometric model for Hochschild homology of Soergel bimodules

DEFF Research Database (Denmark)

Webster, Ben; Williamson, Geordie

2008-01-01

An important step in the calculation of the triply graded link homology of Khovanov and Rozansky is the determination of the Hochschild homology of Soergel bimodules for SL(n). We present a geometric model for this Hochschild homology for any simple group G, as B–equivariant intersection cohomology...... on generators whose degree is explicitly determined by the geometry of the orbit closure, and to describe its Hilbert series, proving a conjecture of Jacob Rasmussen....

Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

Directory of Open Access Journals (Sweden)

Kiran Zahid

2015-01-01

Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

VITAL NMR: using chemical shift derived secondary structure information for a limited set of amino acids to assess homology model accuracy

Energy Technology Data Exchange (ETDEWEB)

Brothers, Michael C.; Nesbitt, Anna E.; Hallock, Michael J. [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Rupasinghe, Sanjeewa G. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Tang Ming [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Harris, Jason; Baudry, Jerome [University of Tennessee, Department of Biochemistry, Cellular and Molecular Biology (United States); Schuler, Mary A. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Rienstra, Chad M., E-mail: rienstra@illinois.edu [University of Illinois at Urbana-Champaign, Department of Chemistry (United States)

2012-01-15

Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., {sup 13}C-{sup 13}C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

VITAL NMR: Using Chemical Shift Derived Secondary Structure Information for a Limited Set of Amino Acids to Assess Homology Model Accuracy

Energy Technology Data Exchange (ETDEWEB)

Brothers, Michael C [University of Illinois, Urbana-Champaign; Nesbitt, Anna E [University of Illinois, Urbana-Champaign; Hallock, Michael J [University of Illinois, Urbana-Champaign; Rupasinghe, Sanjeewa [University of Illinois, Urbana-Champaign; Tang, Ming [University of Illinois, Urbana-Champaign; Harris, Jason B [ORNL; Baudry, Jerome Y [ORNL; Schuler, Mary A [University of Illinois, Urbana-Champaign; Rienstra, Chad M [University of Illinois, Urbana-Champaign

2011-01-01

Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., (13)C-(13)C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

Science.gov (United States)

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

Development and Testing of New Gene-Homologous EST-SSRs for Eucalyptus gomphocephala (Myrtaceae

Directory of Open Access Journals (Sweden)

Donna Bradbury

2013-07-01

Full Text Available Premise of the study: New microsatellite (simple sequence repeat [SSR] primers were developed from Eucalyptus expressed sequence tags (ESTs and optimized for genetic studies of the southwestern Australian tree E. gomphocephala, which is severely impacted by tree health decline and habitat fragmentation. Methods and Results: A total of 133 gene-homologous EST-SSR primer pairs were designed for Eucalyptus, and 44 were screened in E. gomphocephala. Of these, 17 produced reliable amplification products and 11 were polymorphic. Between two and 13 alleles were observed per locus, and observed heterozygosities ranged from 0.172 to 0.867. All 17 EST-SSRs that amplified E. gomphocephala cross-amplified to at least one of E. marginata, E. camaldulensis, and E. victrix. Conclusions: This set of EST-SSR primer pairs will be valuable tools for future population genetic studies of E. gomphocephala and other eucalypts, particularly for studying gene-linked variation and informing seed-sourcing strategies for ecological restoration.

Relative contribution of homologous recombination and non-homologous end-joining to DNA double-strand break repair after oxidative stress in Saccharomyces cerevisiae.

Science.gov (United States)

Letavayová, Lucia; Marková, Eva; Hermanská, Katarína; Vlcková, Viera; Vlasáková, Danusa; Chovanec, Miroslav; Brozmanová, Jela

2006-05-10

Oxidative damage to DNA seems to be an important factor in developing many human diseases including cancer. It involves base and sugar damage, base-free sites, DNA-protein cross-links and DNA single-strand (SSB) and double-strand (DSB) breaks. Oxidative DSB can be formed in various ways such as their direct induction by the drug or their generation either through attempted and aborted repair of primary DNA lesions or through DNA replication-dependent conversion of SSB. In general, two main pathways are responsible for repairing DSB, homologous recombination (HR) and non-homologous end-joining (NHEJ), with both of them being potential candidates for the repair of oxidative DSB. We have examined relative contribution of HR and NHEJ to cellular response after oxidative stress in Saccharomyces cerevisiae. Therefore, cell survival, mutagenesis and DSB induction and repair in the rad52, yku70 and rad52 yku70 mutants after hydrogen peroxide (H(2)O(2)), menadione (MD) or bleomycin (BLM) exposure were compared to those obtained for the corresponding wild type. We show that MD exposure does not lead to observable DSB induction in yeast, suggesting that the toxic effects of this agent are mediated by other types of DNA damage. Although H(2)O(2) treatment generates some DSB, their yield is relatively low and hence DSB may only partially be responsible for toxicity of H(2)O(2), particularly at high doses of the agent. On the other hand, the basis of the BLM toxicity resides primarily in DSB induction. Both HR and NHEJ act on BLM-induced DSB, although their relative participation in the process is not equal. Based on our results we suggest that the complexity and/or the quality of the BLM-induced DSB might represent an obstacle for the NHEJ pathway.

Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

DEFF Research Database (Denmark)

Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

2014-01-01

, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

Science.gov (United States)

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

Identification of three homologous latex-clearing protein (lcp) genes from the genome of Streptomyces sp. strain CFMR 7.

Science.gov (United States)

Nanthini, Jayaram; Ong, Su Yean; Sudesh, Kumar

2017-09-10

Rubber materials have greatly contributed to human civilization. However, being a polymeric material does not decompose easily, it has caused huge environmental problems. On the other hand, only few bacteria are known to degrade rubber, with studies pertaining them being intensively focusing on the mechanism involved in microbial rubber degradation. The Streptomyces sp. strain CFMR 7, which was previously confirmed to possess rubber-degrading ability, was subjected to whole genome sequencing using the single molecule sequencing technology of the PacBio® RS II system. The genome was further analyzed and compared with previously reported rubber-degrading bacteria in order to identify the potential genes involved in rubber degradation. This led to the interesting discovery of three homologues of latex-clearing protein (Lcp) on the chromosome of this strain, which are probably responsible for rubber degrading activities. Genes encoding oxidoreductase α-subunit (oxiA) and oxidoreductase β-subunit (oxiB) were also found downstream of two lcp genes which are located adjacent to each other. In silico analysis reveals genes that have been identified to be involved in the microbial degradation of rubber in the Streptomyces sp. strain CFMR 7. This is the first whole genome sequence of a clear-zone-forming natural rubber- degrading Streptomyces sp., which harbours three Lcp homologous genes with the presence of oxiA and oxiB genes compared to the previously reported Gordonia polyisoprenivorans strain VH2 (with two Lcp homologous genes) and Nocardia nova SH22a (with only one Lcp gene). Copyright © 2017 Elsevier B.V. All rights reserved.

Antibodies against homologous microbial caseinolytic proteases P characterise primary biliary cirrhosis.

Science.gov (United States)

Bogdanos, Dimitrios-Petrou; Baum, Harold; Sharma, Umesh C; Grasso, Alessandro; Ma, Yun; Burroughs, Andrew K; Vergani, Diego

2002-01-01

Antibodies to caseinolytic protease P(177-194) (ClpP(177-194)) of the proteolytic subunit of the Clp complex of Escherichia coli (E. coli) are uniquely present in primary biliary cirrhosis (PBC). Molecular mimicry between the regulatory subunit ClpX and the principal T-cell epitope of pyruvate dehydrogenase complex (PDC-E2) in PBC, has been proposed to account for this. Since ClpP is highly conserved among bacteria we investigated whether the micro-organisms triggering these antibodies may be other than E. coli. E. coli ClpP(177-194) is homologous with ClpP peptides of Yersinia enterocolitica (YEREN) and Haemophilus influenzae (HAEIN). Enzyme linked immunosorbent assay (ELISA) reactivity to these peptides was tested in 45 patients with PBC, 44 pathological and 32 healthy controls. Reactivity to at least one of the ClpP peptides was observed in 21 (47%) PBC patients, 5.8% pathological and 3.1% healthy controls (PECOLI ClpP(177-194), alone or in association with YEREN and/or HAEIN peptides, compared to three (14.2%) reactive with YEREN, two (9.5%) with YEREN/HAEIN and one (4.7%) with HAEIN peptide. Simultaneous reactivity to homologous sequences was due to cross-reactivity as confirmed by competition ELISAs. The PBC-specificity of anti-microbial ClpP reactivity is confirmed: the questions as to primary trigger(s) and relevance to PBC pathogenesis remain open.

(D,A)∞-modules over (D,A)∞-algebras and spectral sequences

International Nuclear Information System (INIS)

Lapin, S V

2002-01-01

We introduce the construction of a (D,A) ∞ -(co)module over a (D,A) ∞ -(co) algebra and study its main homotopy properties. We establish a connection between (D,A) ∞ -(co)modules over (D,A) ∞ -(co)algebras and spectral sequences, and thus obtain the structure of an A ∞ -comodule over the Milnor A ∞ -coalgebra on the homology of any spectrum directly from the differentials of the Adams spectral sequence of this spectrum

The Complete Genome Sequence of Herpesvirus Papio 2 (Cercopithecine Herpesvirus 16) Shows Evidence of Recombination Events among Various Progenitor Herpesviruses†

Science.gov (United States)

Tyler, Shaun D.; Severini, Alberto

2006-01-01

We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an “a” sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (γ134.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses. PMID:16414998

The complete genome sequence of herpesvirus papio 2 (Cercopithecine herpesvirus 16) shows evidence of recombination events among various progenitor herpesviruses.

Science.gov (United States)

Tyler, Shaun D; Severini, Alberto

2006-02-01

We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an "a" sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (gamma(1)34.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses.

Changes in homologous and heterologous gap junction contacts during maturation-inducing hormone-dependent meiotic resumption in ovarian follicles of Atlantic croaker

Science.gov (United States)