WorldWideScience

Sample records for partial cdna sequence

  1. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  2. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  3. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  4. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  5. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  6. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  8. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  9. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  10. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  11. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  12. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  13. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  14. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  15. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  16. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  17. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  18. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  19. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  20. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  1. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  2. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  3. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  4. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  5. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  6. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  7. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  8. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  9. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  10. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  11. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  12. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  13. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  14. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  15. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  16. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  17. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  18. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  19. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  20. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  1. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  2. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  3. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  4. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Science.gov (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  5. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  6. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  7. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  8. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  9. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  11. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  12. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  13. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    Science.gov (United States)

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  14. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  15. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  16. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  17. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  18. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  19. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  20. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  1. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  2. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  3. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  4. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  5. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  6. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  7. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  8. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  9. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  10. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  11. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  12. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  13. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

    International Nuclear Information System (INIS)

    Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

    1988-01-01

    Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

  14. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  15. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves

    2015-11-01

    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  16. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    Science.gov (United States)

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  17. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  18. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  19. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  20. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  1. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  2. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  3. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  4. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

  5. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    International Nuclear Information System (INIS)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-01-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

  6. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  7. Characterization of cDNA for PMT: a Partial Nicotine Biosynthesis-Related Gene Isolated from Indonesian Local Tobacco (Nicotiana tabacum cv. Sindoro1

    Directory of Open Access Journals (Sweden)

    SESANTI BASUKI

    2013-12-01

    Full Text Available Nicotine is the major alkaloid compound in cultivated tobacco (Nicotiana tabacum that could potentially be converted into carcinogenic compound (nor-nicotine. The PMT gene encoding putrescine N-methyltransferase (PMT is one of the two key genes that play a prominent role in nicotine biosynthesis. The aimed of this study was to isolate and characterize the cDNA sequence originated from Indonesian local tobacco cv. Sindoro1 (Ntpmt_Sindoro1. The results showed that the Ntpmt_Sindoro1 was 1124 bp in length. This cDNA fragment encodes for 374 amino acid residues. The predicted polypeptide from the cDNA is a hidrophilic protein, and has a predicted molecular weight of 40.95 kDa. The predicted amino acids sequence also showed high similarity to the PMT gene product Nicotiana sp. available in the GenBank data base. The amino acid sequences also exert conserved residues specifically exhibited only by PMT gene originated from N. tabacum. Clustering analysis revealed that Ntpmt_Sindoro1 belongs to the same clade as the PMT3 gene, a member of the N. tabacum PMT gene family. The Ntpmt_Sindoro1 cDNA sequence covering exon1-exon8 of the PMT gene fragment has been registered in the GenBank data base, under the accession number JX978277.

  8. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  9. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  10. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  11. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  12. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  13. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    NARCIS (Netherlands)

    Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

    2002-01-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  14. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

    NARCIS (Netherlands)

    Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  15. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  16. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  17. Analysis of xylem formation in pine by cDNA sequencing

    Science.gov (United States)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  18. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  19. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  20. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  1. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  2. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  3. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  4. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  5. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  6. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  7. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  8. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  9. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  10. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  11. The convergence of the order sequence and the solution function sequence on fractional partial differential equation

    Science.gov (United States)

    Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

    2018-03-01

    One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

  12. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    Science.gov (United States)

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  14. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  15. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  16. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  17. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  18. ISOLATION OF JUVENILE HORMONES ESTERASE AND ITS PARTIAL CDNA CLONE FROM THE BEETLE, TENEBRIO MOLITOR. (R825433)

    Science.gov (United States)

    Juvenile hormone esterase (JHE) plays an essential role in insect development. It is partially responsible for the clearance of juvenile hormone (JH) which regulates various aspects of insect development and reproduction. Because of its role in regulating JH titer, this enzyme...

  19. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  20. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  1. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  2. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  3. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  4. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  5. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  6. Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

    Science.gov (United States)

    Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

    2005-12-01

    Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

  7. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  8. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  9. Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

    Science.gov (United States)

    Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

    2005-05-01

    Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

  10. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

    Science.gov (United States)

    Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

    2013-04-01

    The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

  11. Delineation of the genus Actinobacillus by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Nørskov-Lauritsen, Niels; Christensen, H; Okkels, H.

    2004-01-01

    A 426 bp fragment of infB, a housekeeping gene that encodes translation initiation factor 2, was sequenced from 59 clinical isolates and type strains of Actinobacillus species and sequences were compared. Partial sequences of 16S rRNA genes were also obtained. By comparing infB sequences, Actinob...

  12. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  13. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Sztrolovics, R.; Grover, J.; Roughley, P.J. [McGill Univ., Montreal (Canada)] [and others

    1994-10-01

    This report describes the cloning of the 3{prime}-untranslated region of the human fibromodulin cDNA and its use to map the gene. For somatic cell hybrids, the generation of the PCR product was concordant with the presence of chromosome 1 and discordant with the presence of all other chromosomes, confirming that the fibromodulin gene is located within region q32 of chromosome 1. The physical mapping of genes is a critical step in the process of identifying which genes may be responsible for various inherited disorders. Specifically, the mapping of the fibromodulin gene now provides the information necessary to evaluate its potential role in genetic disorders of connective tissues. The analysis of previously reported diseases mapped to chromosome 1 reveals two genes located in the proximity of the fibromodulin locus. These are Usher syndrome type II, a recessive disorder characterized by hearing loss and retinitis pigmentosa, and Van der Woude syndrome, a dominant condition associated with abnormalities such as cleft lip and palate and hyperdontia. The genes for both of these disorders have been projected to be localized to 1q32 of a physical map that integrates available genetic linkage and physical data. However, it seems improbable that either of these disorders, exhibiting restricted tissue involvement, could be linked to the fibromodulin gene, given the wide tissue distribution of the encoded proteoglycan, although it remains possible that the relative importance of the quantity and function of the proteoglycan may avry between tissues. 11 refs., 1 fig.

  14. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  15. Partial sequence determination of metabolically labeled radioactive proteins and peptides

    International Nuclear Information System (INIS)

    Anderson, C.W.

    1982-01-01

    The author has used the sequence analysis of radioactive proteins and peptides to approach several problems during the past few years. They, in collaboration with others, have mapped precisely several adenovirus proteins with respect to the nucleotide sequence of the adenovirus genome; identified hitherto missed proteins encoded by bacteriophage MS2 and by simian virus 40; analyzed the aminoterminal maturation of several virus proteins; determined the cleavage sites for processing of the poliovirus polyprotein; and analyzed the mechanism of frameshifting by excess normal tRNAs during cell-free protein synthesis. This chapter is designed to aid those without prior experience at protein sequence determinations. It is based primarily on the experience gained in the studies cited above, which made use of the Beckman 890 series automated protein sequencers

  16. The partial mitochondrial sequence of the Old World stingless bee ...

    Indian Academy of Sciences (India)

    Sequences of primers used in PCR reactions of T. pagdeni mtDNA. mtDNA genes. Primer. Sequence. ATPase (6,8). ATPS6-F. 5 -AAG ATA TAT GGA AAT AAG CT-3. tRNA-ASP-R. 5 -ATA AAA TAA CGT CAA AAT GTC A-3. COI. COI-F. 5 - ATA ATT ATT GTT GCT GAT GTA-3. COI-R. 5 -CTA TTC ATA TAA CTG GAA TTT C-3.

  17. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  18. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  19. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  20. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  1. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  2. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  3. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  4. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  5. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  6. Outbreak tracking of Aleutian mink disease virus (AMDV) using partial NS1 gene sequencing

    DEFF Research Database (Denmark)

    Ryt-Hansen, Pia; Hjulsager, Charlotte Kristiane; Hagberg, E. E.

    2017-01-01

    . However, in 2015, several outbreaks of AMDV occurred at mink farms throughout Denmark, and the sources of these outbreaks were not known. Partial NS1 gene sequencing, phylogenetic analyses data were utilized along with epidemiological to determine the origin of the outbreaks. The phylogenetic analyses...... not be excluded. This study confirmed that partial NS1 sequencing can be used in outbreak tracking to determine major viral clusters of AMDV. Using this method, two new distinct AMDV clusters with low intra-cluster sequence diversity were identified, and epidemiological data helped to reveal possible ways...

  7. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  8. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  9. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  10. Synthesis of a hexasaccharide partial sequence of hyaluronan for click chemistry and more

    Directory of Open Access Journals (Sweden)

    Marina Bantzi

    2015-04-01

    Full Text Available In the present work, the synthesis of a hexasaccharide partial sequence of hyaluronan equipped with a terminal azido moiety is reported. This hexasaccharide can be used for the attachment on surfaces by means of click chemistry and after suitable deprotection for biophysical studies.

  11. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens.

    Science.gov (United States)

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z

    2017-03-14

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.

  12. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  13. DNA sequence explains seemingly disordered methylation levels in partially methylated domains of Mammalian genomes.

    Directory of Open Access Journals (Sweden)

    Dimos Gaidatzis

    2014-02-01

    Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.

  14. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  15. Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen

    International Nuclear Information System (INIS)

    Eaton, D.L.; Fless, G.M.; Kohr, W.J.; McLean, J.W.; Xu, Q.T.; Miller, C.G.; Lawn, R.M.; Scanu, A.M.

    1987-01-01

    Apolipoprotein(a) [apo(a)] is a glycoprotein with M/sub r/ ∼ 280,000 that is disulfide linked to apolipoprotein B in lipoprotein(a) particles. Elevated plasma levels of lipoprotein(a) are correlated with atherosclerosis. Partial amino acid sequence of apo(a) shows that it has striking homology to plasminogen. Plasminogen is a plasma serine protease zymogen that consists of five homologous and tandemly repeated domains called kringles and a trypsin-like protease domain. The amino-terminal sequence obtained for apo(a) is homologous to the beginning of kringle 4 but not the amino terminus of plasminogen. Apo(a) was subjected to limited proteolysis by trypsin or V8 protease, and fragments generated were isolated and sequenced. Sequences obtained from several of these fragments are highly (77-100%) homologous to plasminogen residues 391-421, which reside within kringle 4. Analysis of these internal apo(a) sequences revealed that apo(a) may contain at least two kringle 4-like domains. A sequence obtained from another tryptic fragment also shows homology to the end of kringle 4 and the beginning of kringle 5. Sequence data obtained from the two tryptic fragments shows homology with the protease domain of plasminogen. One of these sequences is homologous to the sequences surrounding the activation site of plasminogen. Plasminogen is activated by the cleavage of a specific arginine residue by urokinase and tissue plasminogen activator; however, the corresponding site in apo(a) is a serine that would not be cleaved by tissue plasminogen activator or urokinase. Using a plasmin-specific assay, no proteolytic activity could be demonstrated for lipoprotein(a) particles. These results suggest that apo(a) contains kringle-like domains and an inactive protease domain

  16. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    Institute of Scientific and Technical Information of China (English)

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  17. Characterization of the porcine carboxypeptidase E cDNA

    DEFF Research Database (Denmark)

    Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

    2007-01-01

    the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

  18. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  19. Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

    Science.gov (United States)

    Kovács, Endre R; Benko, Mária

    2009-03-01

    Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

  20. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  1. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  2. Evolutionary relationships in Aspergillus section Fumigati inferred from partial beta-tubulin and hydrophobin sequences

    DEFF Research Database (Denmark)

    Geiser, D.M.; Frisvad, Jens Christian; Taylor, J.W.

    1998-01-01

    are heterothallic. Phylogenetic relationships were inferred among members of Aspergillus section Fumigati based on partial DNA sequences from the benA beta-tubulin and rodA hydrophobin genes. Aspergillus clavatus was chosen as an outgroup. The two gene regions provided nearly equal numbers of phylogenetically...... informative nucleotide characters. The rodA region possessed a considerably higher level of inferred amino acid variation than did the benA region. The results of a partition homogeneity test showed that the benA and rodA data sets were not in significant conflict, and the topologies of the most parsimonious...

  3. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  4. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  5. Phylogeny of the genus Haemophilus as determined by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Hedegaard, J; Okkels, H; Bruun, B

    2001-01-01

    A 453 bp fragment of infB, the gene encoding translation initiation factor 2, was sequenced and compared from 66 clinical isolates and type strains of Haemophilus species and related bacteria. Analysis of the partial infB sequences obtained suggested that the human isolates dependent on X and V...... factor, H. influenzae, H. haemolyticus, H. aegyptius and some cryptic genospecies of H. influenzae, were closely related to each other. H. parainfluenzae constituted a heterogeneous group within the boundaries of the genus, whereas H. aphrophilus/paraphrophilus and Actinobacillus actinomycetemcomitans...... were only remotely related to the type species of the genus Haemophilus H. parahaemolyticus and H. paraphrohaemolyticus took up an intermediary position and may not belong in the genus Haemophilus sensu stricto. Ambiguous results were obtained with seven isolates tentatively identified as H. segnis...

  6. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.

    2001-01-01

    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  7. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  8. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  9. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  10. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  11. Involvement of pectin methyl-esterase during the ripening of grape berries: partial cDNA isolation, transcript expression and changes in the degree of methyl-esterification of cell wall pectins.

    Science.gov (United States)

    Barnavon, L; Doco, T; Terrier, N; Ageorges, A; Romieu, C; Pellerin, P

    2001-11-01

    Grape berries (Vitis vinifera L., cv Ugni blanc) were harvested at 12 different weeks of development in 1996 and 1997. Ripening was induced at veraison, the crucial stage of berry softening, and was followed by a rapid accumulation of glucose and fructose and an increase of pH. Total RNAs, crude proteins and cell wall material were isolated from each developmental stage. A partial length cDNA (pme1, accession number AF159122, GenBank) encoding a pectin methyl-esterase (PME, EC 3.1.1.11) was cloned by RT-PCR with degenerate primers. Northern blots revealed that mRNAs coding for PME accumulate from one week before the onset of ripening until complete maturity, indicating that this transcript represents an early marker of veraison and could be involved in berry softening. However, PME activity was detected during all developmental stages. Total activity per berry increased, whereas "specific" activity, on a fresh weight basis, decreased during development. The amount of cell wall material (per berry and per g of berry) followed the same pattern as that of PME activity (total and "specific" respectively), indicating they were tightly correlated and that PME levels varied very little in the cell walls. Nevertheless, the degree of methyl-esterification of insoluble pectins decreased throughout the development from 68% in green stages to less than 20% for the ripe berries, and this observation is consistent with the induction of PME mRNAs during ripening. Relations between transcript expression, PME activity, the DE of insoluble pectic polysaccharides and their involvement in grape berry ripening are discussed.

  12. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  13. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  14. The influence of spherical cavity surface charge distribution on the sequence of partial discharge events

    International Nuclear Information System (INIS)

    Illias, Hazlee A; Chen, George; Lewin, Paul L

    2011-01-01

    In this work, a model representing partial discharge (PD) behaviour of a spherical cavity within a homogeneous dielectric material has been developed to study the influence of cavity surface charge distribution on the electric field distribution in both the cavity and the material itself. The charge accumulation on the cavity surface after a PD event and charge movement along the cavity wall under the influence of electric field magnitude and direction has been found to affect the electric field distribution in the whole cavity and in the material. This in turn affects the likelihood of any subsequent PD activity in the cavity and the whole sequence of PD events. The model parameters influencing cavity surface charge distribution can be readily identified; they are the cavity surface conductivity, the inception field and the extinction field. Comparison of measurement and simulation results has been undertaken to validate the model.

  15. The influence of spherical cavity surface charge distribution on the sequence of partial discharge events

    Energy Technology Data Exchange (ETDEWEB)

    Illias, Hazlee A [Department of Electrical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Chen, George; Lewin, Paul L, E-mail: h.illias@um.edu.my [Tony Davies High Voltage Laboratory, School of Electronics and Computer Science, University of Southampton, Southampton, SO17 1BJ (United Kingdom)

    2011-06-22

    In this work, a model representing partial discharge (PD) behaviour of a spherical cavity within a homogeneous dielectric material has been developed to study the influence of cavity surface charge distribution on the electric field distribution in both the cavity and the material itself. The charge accumulation on the cavity surface after a PD event and charge movement along the cavity wall under the influence of electric field magnitude and direction has been found to affect the electric field distribution in the whole cavity and in the material. This in turn affects the likelihood of any subsequent PD activity in the cavity and the whole sequence of PD events. The model parameters influencing cavity surface charge distribution can be readily identified; they are the cavity surface conductivity, the inception field and the extinction field. Comparison of measurement and simulation results has been undertaken to validate the model.

  16. Partial Transmit Sequence Optimization Using Improved Harmony Search Algorithm for PAPR Reduction in OFDM

    Directory of Open Access Journals (Sweden)

    Mangal Singh

    2017-12-01

    Full Text Available This paper considers the use of the Partial Transmit Sequence (PTS technique to reduce the Peak‐to‐Average Power Ratio (PAPR of an Orthogonal Frequency Division Multiplexing signal in wireless communication systems. Search complexity is very high in the traditional PTS scheme because it involves an extensive random search over all combinations of allowed phase vectors, and it increases exponentially with the number of phase vectors. In this paper, a suboptimal metaheuristic algorithm for phase optimization based on an improved harmony search (IHS is applied to explore the optimal combination of phase vectors that provides improved performance compared with existing evolutionary algorithms such as the harmony search algorithm and firefly algorithm. IHS enhances the accuracy and convergence rate of the conventional algorithms with very few parameters to adjust. Simulation results show that an improved harmony search‐based PTS algorithm can achieve a significant reduction in PAPR using a simple network structure compared with conventional algorithms.

  17. Suboptimal Partial Transmit Sequence-Active Interference Cancellation with Particle Swarm Optimization

    Directory of Open Access Journals (Sweden)

    Tarasak Poramate

    2010-01-01

    Full Text Available Active interference cancellation (AIC is an effective technique to provide interference avoidance feature for an ultrawideband (UWB OFDM transmitter. Partial transmit sequence-AIC (PTS-AIC, which was recently proposed as an improvement of AIC, requires high computational complexity by doing the exhaustive search of all possible weighting factors whose number grows exponentially with the number of subblocks used. To reduce the complexity of PTS-AIC, this paper proposes a suboptimal way, called particle swarm optimization (PSO, to choose the weighting factors suboptimally without much performance degradation. Both continuous and discrete versions of PSO have been evaluated, and it has been shown that the discrete PSO is able to reduce the complexity significantly without sacrificing the performance of PTS-AIC in many cases.

  18. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

    Science.gov (United States)

    Kuzmin, I V; Hughes, G J; Rupprecht, C E

    2006-08-01

    Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

  19. Fiscal 1998 achievement report. Industrial technology research and development project. (Strategic human cDNA genome application technology development); 1998 nendo senryakuteki hito cDNA genome oyo gijutsu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)

  20. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    Science.gov (United States)

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the

  1. Microsatellite marker development by partial sequencing of the sour passion fruit genome (Passiflora edulis Sims).

    Science.gov (United States)

    Araya, Susan; Martins, Alexandre M; Junqueira, Nilton T V; Costa, Ana Maria; Faleiro, Fábio G; Ferreira, Márcio E

    2017-07-21

    The Passiflora genus comprises hundreds of wild and cultivated species of passion fruit used for food, industrial, ornamental and medicinal purposes. Efforts to develop genomic tools for genetic analysis of P. edulis, the most important commercial Passiflora species, are still incipient. In spite of many recognized applications of microsatellite markers in genetics and breeding, their availability for passion fruit research remains restricted. Microsatellite markers in P. edulis are usually limited in number, show reduced polymorphism, and are mostly based on compound or imperfect repeats. Furthermore, they are confined to only a few Passiflora species. We describe the use of NGS technology to partially assemble the P. edulis genome in order to develop hundreds of new microsatellite markers. A total of 14.11 Gbp of Illumina paired-end sequence reads were analyzed to detect simple sequence repeat sites in the sour passion fruit genome. A sample of 1300 contigs containing perfect repeat microsatellite sequences was selected for PCR primer development. Panels of di- and tri-nucleotide repeat markers were then tested in P. edulis germplasm accessions for validation. DNA polymorphism was detected in 74% of the markers (PIC = 0.16 to 0.77; number of alleles/locus = 2 to 7). A core panel of highly polymorphic markers (PIC = 0.46 to 0.77) was used to cross-amplify PCR products in 79 species of Passiflora (including P. edulis), belonging to four subgenera (Astrophea, Decaloba, Distephana and Passiflora). Approximately 71% of the marker/species combinations resulted in positive amplicons in all species tested. DNA polymorphism was detected in germplasm accessions of six closely related Passiflora species (P. edulis, P. alata, P. maliformis, P. nitida, P. quadrangularis and P. setacea) and the data used for accession discrimination and species assignment. A database of P. edulis DNA sequences obtained by NGS technology was examined to identify microsatellite repeats in

  2. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  3. Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

    Science.gov (United States)

    Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

    2015-05-01

    Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

  4. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  5. [Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

    Science.gov (United States)

    Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

    2011-07-01

    Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

  6. Partial Sequence Analysis of Merozoite Surface Proteine-3α Gene in Plasmodium vivax Isolates from Malarious Areas of Iran

    Directory of Open Access Journals (Sweden)

    H Mirhendi

    2008-12-01

    Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geo­graphical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.

  7. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  8. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    Science.gov (United States)

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  9. Construction and partial sequencing of a subtractive library in Calcutta 4 (Musa AA in early stage of infection with Mycosphaerella fijiensis Morelet

    Directory of Open Access Journals (Sweden)

    Milady Mendoza-Rodríguez

    2006-10-01

    Full Text Available The study of genes involved in plant defense response against pathogen attack, is one of most important steps leading to the elucidation of disease resistance molecular mechanisms. The generation of subtracted deoxyribonucleic acid libraries (cDNA, by means of suppression subtractive hybridization technique (SSH, has been used for this purpose. A subtractive hybridization was made between a cDNA population obtained from ‘Calcutta 4’ inoculated leaves with M. fijiensis (CCIBP-Pf83 and a mixture of cDNA from ‘Calcutta 4’ non inoculated leaves and mycelium. Leaves samples were taken at 6, 10 and 12 days after inoculation. The subtracted library was obtained by cloning and transformation of subtracted products and as a result, 600 recombinants clones were obtained. Sequence analysis of sixty nine clones, revealed redundancy of the expressed sequence tags and most of them showed no homology with reported sequences at databases and only 13 % had a high homology with metalothioneins. The results constitute a step in advance in the molecular study of Musa-Mycosphaerella fijiensis interaction. Key words: Banana-Mycosphaerella fijiensis interaction, BlackSigatoka, Musa spp., suppression subtractive hybridization

  10. A Label Correcting Algorithm for Partial Disassembly Sequences in the Production Planning for End-of-Life Products

    Directory of Open Access Journals (Sweden)

    Pei-Fang (Jennifer Tsai

    2012-01-01

    Full Text Available Remanufacturing of used products has become a strategic issue for cost-sensitive businesses. Due to the nature of uncertain supply of end-of-life (EoL products, the reverse logistic can only be sustainable with a dynamic production planning for disassembly process. This research investigates the sequencing of disassembly operations as a single-period partial disassembly optimization (SPPDO problem to minimize total disassembly cost. AND/OR graph representation is used to include all disassembly sequences of a returned product. A label correcting algorithm is proposed to find an optimal partial disassembly plan if a specific reusable subpart is retrieved from the original return. Then, a heuristic procedure that utilizes this polynomial-time algorithm is presented to solve the SPPDO problem. Numerical examples are used to demonstrate the effectiveness of this solution procedure.

  11. Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

    Science.gov (United States)

    Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

    1994-07-01

    Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

  12. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  13. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  14. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  15. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  16. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  17. Fall Detection for Elderly from Partially Observed Depth-Map Video Sequences Based on View-Invariant Human Activity Representation

    Directory of Open Access Journals (Sweden)

    Rami Alazrai

    2017-03-01

    Full Text Available This paper presents a new approach for fall detection from partially-observed depth-map video sequences. The proposed approach utilizes the 3D skeletal joint positions obtained from the Microsoft Kinect sensor to build a view-invariant descriptor for human activity representation, called the motion-pose geometric descriptor (MPGD. Furthermore, we have developed a histogram-based representation (HBR based on the MPGD to construct a length-independent representation of the observed video subsequences. Using the constructed HBR, we formulate the fall detection problem as a posterior-maximization problem in which the posteriori probability for each observed video subsequence is estimated using a multi-class SVM (support vector machine classifier. Then, we combine the computed posteriori probabilities from all of the observed subsequences to obtain an overall class posteriori probability of the entire partially-observed depth-map video sequence. To evaluate the performance of the proposed approach, we have utilized the Kinect sensor to record a dataset of depth-map video sequences that simulates four fall-related activities of elderly people, including: walking, sitting, falling form standing and falling from sitting. Then, using the collected dataset, we have developed three evaluation scenarios based on the number of unobserved video subsequences in the testing videos, including: fully-observed video sequence scenario, single unobserved video subsequence of random lengths scenarios and two unobserved video subsequences of random lengths scenarios. Experimental results show that the proposed approach achieved an average recognition accuracy of 93 . 6 % , 77 . 6 % and 65 . 1 % , in recognizing the activities during the first, second and third evaluation scenario, respectively. These results demonstrate the feasibility of the proposed approach to detect falls from partially-observed videos.

  18. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  19. Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Harsi Dewantari Kusumaningrum

    2016-08-01

    Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

  20. Hydroquinone: O-glucosyltransferase from cultivated Rauvolfia cells: enrichment and partial amino acid sequences.

    Science.gov (United States)

    Arend, J; Warzecha, H; Stöckigt, J

    2000-01-01

    Plant cell suspension cultures of Rauvolfia are able to produce a high amount of arbutin by glucosylation of exogenously added hydroquinone. A four step purification procedure using anion exchange, hydrophobic interaction, hydroxyapatite-chromatography and chromatofocusing delivered in a yield of 0.5%, an approximately 390 fold enrichment of the involved glucosyltransferase. SDS-PAGE showed a M(r) for the enzyme of 52 kDa. Proteolysis of the pure enzyme with endoproteinase LysC revealed six peptide fragments with 9-23 amino acids which were sequenced. Sequence alignment of the six peptides showed high homologies to glycosyltransferases from other higher plants.

  1. Intrauterine transfusion combined with partial exchange transfusion for twin anemia polycythemia sequence: modeling a novel technique

    NARCIS (Netherlands)

    Slaghekke, F.; van den Wijngaard, J. P. H. M.; Akkermans, J.; van Gemert, M. J. C.; Middeldorp, J. M.; Klumper, F. J.; Oepkes, D.; Lopriore, E.

    2015-01-01

    Twin anemia-polycythemia sequence (TAPS) is a newly described disease in monochorionic twin pregnancies, characterized by large inter-twin hemoglobin differences. Optimal management for TAPS is not clear. One of the possible treatment modalities is intrauterine blood transfusion (IUT) in the donor

  2. Identification and partial sequencing of a crocodile poxvirus associated with deeply penetrating skin lesions in farmed Nile crocodiles, Crocodylus niloticus.

    Science.gov (United States)

    Huchzermeyer, F W; Wallace, D B; Putterill, J F; Gerdes, G H

    2009-09-01

    When large numbers of crocodile skins were downgraded because of the presence of small pin prick-like holes, collapsed epidermal cysts were found deep in the dermis of juvenile crocodiles while forming cysts were observed in hatchlings. Histopathology of these forming cysts showed the presence of intracytoplasmic inclusions in proliferating and ballooning epidermal cells. Pox virions were seen in electron microscope preparations made from the scabs of such early lesions. The partial sequencing of virus material from scrapings of these lesions and comparison of it with the published sequence of crocodile poxvirus showed the virus associated with the deep lesions to be closely related, but different. To differentiate between the two forms of crocodile pox infection it is suggested that the previously known form should be called "classical crocodile pox" and the newly discovered form "atypical crocodile pox". The application of strict hygiene measures brought about a decline in the percentage of downgraded skins.

  3. Identification and partial sequencing of a crocodile poxvirus associated with deeply penetrating skin lesions in farmed Nile crocodiles, Crocodylus niloticus

    Directory of Open Access Journals (Sweden)

    F.W. Huchzermeyer

    2009-09-01

    Full Text Available When large numbers of crocodile skins were downgraded because of the presence of small pin pricklike holes, collapsed epidermal cysts were found deep in the dermis of juvenile crocodiles while forming cysts were observed in hatchlings. Histopathology of these forming cysts showed the presence of intracytoplasmic inclusions in proliferating and ballooning epidermal cells. Pox virions were seen in electron microscope preparations made from the scabs of such early lesions. The partial sequencing of virus material from scrapings of these lesions and comparison of it with the published sequence of crocodile poxvirus showed the virus associated with the deep lesions to be closely related, but different. To differentiate between the two forms of crocodile pox infection it is suggested that the previously known form should be called ''classical crocodile pox'' and the newly discovered form ''atypical crocodile pox''. The application of strict hygiene measures brought about a decline in the percentage of downgraded skins.

  4. MRI of intracerebral haematoma at low field (0.15T) using T2 dependent partial saturation sequences

    International Nuclear Information System (INIS)

    Bydder, G.M.; Pennock, J.M.; Porteous, R.; Dubowitz, L.M.S.; Gadian, D.G.; Young, I.R.

    1988-01-01

    Results of MRI at 0.15T in twelve successive patients with intracerebral haematoma are reviewed. Using T 2 weighted spin echo (SE) and partial saturation (PS without a refocussing 180 0 pulse) sequences, low intensity areas were seen in eleven of the twelve cases. These included central regions (three cases), a peripheral rim (seven cases) and more diffuse patterns involving the brainstem and cerebral hemispheres (two cases). One case initially displayed a peripheral rim and later a central low intensity region. Central low intensity regions were seen in acute, subacute, and chronic cases. Follow up in five cases displayed an increase in signal within the haematoma in three cases and a decrease in signal intensity in two cases. Low signal intensity areas can be seen within and around intracerebral haematomas imaged with T 2 weighted sequences at low field strength. (orig.)

  5. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  6. Partial cytochrome b sequences for six Hymenoptera of the eastern United States.

    Science.gov (United States)

    Collins, A M; Gardner, L M

    2001-01-01

    Mitochondrial DNA (mtDNA) haplotypes have been commonly used to determine honeybee subspecies relationships. To see if these markers would also be useful for comparisons of other Hymenoptera, we collected workers of six local species: Vespa crabro, the European hornet; Bombus impatiens, a bumblebee; Vespula germanica, the German yellow jacket; Polistes fuscatus, a paper wasp; Halictus ligatus, an alkali bee; and an unspecified Megachile, a leafcutting bee. MtDNA was isolated and digested with six endonucleases (AvaI, BglII, EcoRI, HindIII, HinfI, XbaI). The digested DNA was electrophoresed and visualized on agarose gels with comparison to a standard fragment marker and similarly treated honeybee mtDNA. The fragments obtained were also purified and sequenced. Phylogenetic relationships between six wasp and bee species, Apis mellifera, and several other similar aculeate Hymenoptera were determined. Newly defined DNA sequences were posted to GenBank (AF281169-AF281174).

  7. Genetic Analysis Using Partial Sequencing of Melanocortin 4 Receptor (MC4R Gene in Bligon Goat

    Directory of Open Access Journals (Sweden)

    Latifah Latifah

    2017-08-01

    Full Text Available Melanocortin 4 Receptor gene is involved in sympathetic nerve activity, adrenal and thyroid functions, and media for leptin in regulating energy balance and homeostasis. The aim of this research was to perform genetic analysis of MC4R gene sequences from Bligon goats. Fourty blood samples of Bligon does were used for DNA extraction. The primers were designed after alignment of 12 DNA sequences of MC4R gene from goat, sheep, and cattle. The primers were constructed on the Capra hircus MC4R gene sequence from GenBank (accession No. NM_001285591. Two DNA polymorphisms of MC4R were revealed in exon region (g.998 A/G and g.1079 C/T. The SNP g.998 A/G was a non-synonymous polymorphism i.e., changing of amino acid from methionine (Met to isoleucine (Ile. The SNP g.1079 C/T was a synonymous polymorphism. Restriction enzyme mapping on Bligon goat MC4R gene revealed three restriction enzymes (RsaI (GT’AC, Acc651 (G’GTAC_C, and KpnI (G_GTAC’C, which can recognize the SNP at g.1079 C/T. The restriction enzymes may be used for genotyping of the gene target using PCR-RFLP method in the future research.

  8. A new clade, based on partial LSU rDNA sequences, of unarmoured dinoflagellates.

    Science.gov (United States)

    Reñé, Albert; de Salas, Miguel; Camp, Jordi; Balagué, Vanessa; Garcés, Esther

    2013-09-01

    The order Gymnodiniales comprises unarmoured dinoflagellates. However, the lack of sequences hindered determining the phylogenetic positions and systematic relationships of several gymnodinioid taxa. In this study, a monophyletic clade was defined for the species Ceratoperidinium margalefii Loeblich III, Gyrodinium falcatum Kofoid & Swezy, three Cochlodinium species, and two Gymnodinium-like dinoflagellates. Despite their substantial morphotypic differentiation, Cochlodinium cf. helix, G. falcatum and 'Gymnodinium' sp. 1 share a common shape of the acrobase. The phylogenetic data led to the following conclusions: (1) C. margalefii is closely related to several unarmoured dinoflagellates. Its sulcus shape has been observed for the first time. (2) G. falcatum was erroneously assigned to the genus Gyrodinium and is transferred to Ceratoperidinium (C. falcatum (Kofoid & Swezy) Reñé & de Salas comb. nov.). (3) The genus Cochlodinium is polyphyletic and thus artificial; our data support its separation into three different genera. (4) The two Gymnodinium-like species could not be morphologically or phylogenetically related to any other gymnodinioid species sequenced to date. While not all studied species have been definitively transferred to the correct genus, our study is a step forward in the classification of inconspicuous unarmoured dinoflagellates. The family Ceratoperidiniaeceae and the genus Ceratoperidinium are emended. Copyright © 2013 Elsevier GmbH. All rights reserved.

  9. Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

    Directory of Open Access Journals (Sweden)

    Wang Hehe

    2012-08-01

    Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

  10. Partial summations of stationary sequences of non-Gaussian random variables

    DEFF Research Database (Denmark)

    Mohr, Gunnar; Ditlevsen, Ove Dalager

    1996-01-01

    The distribution of the sum of a finite number of identically distributed random variables is in many cases easily determined given that the variables are independent. The moments of any order of the sum can always be expressed by the moments of the single term without computational problems...... of convergence of the distribution of a sum (or an integral) of mutually dependent random variables to the Gaussian distribution. The paper is closely related to the work in Ditlevsen el al. [Ditlevsen, O., Mohr, G. & Hoffmeyer, P. Integration of non-Gaussian fields. Prob. Engng Mech 11 (1996) 15-23](2)....... lognormal variables or polynomials of standard Gaussian variables. The dependency structure is induced by specifying the autocorrelation structure of the sequence of standard Gaussian variables. Particularly useful polynomials are the Winterstein approximations that distributionally fit with non...

  11. Genetic analysis of the Hungarian draft horse population using partial mitochondrial DNA D-loop sequencing

    Science.gov (United States)

    2018-01-01

    Background The Hungarian draft is a horse breed with a recent mixed ancestry created in the 1920s by crossing local mares with draught horses imported from France and Belgium. The interest in its conservation and characterization has increased over the last few years. The aim of this work is to contribute to the characterization of the endangered Hungarian heavy draft horse populations in order to obtain useful information to implement conservation strategies for these genetic stocks. Methods To genetically characterize the breed and to set up the basis for a conservation program, in the present study a hypervariable region of the mitochrondial DNA (D-loop) was used to assess genetic diversity in Hungarian draft horses. Two hundred and eighty five sequences obtained in our laboratory and 419 downloaded sequences available from Genbank were analyzed. Results One hundred and sixty-four haplotypes and thirty-six polymorphic sites were observed. High haplotype and nucleotide diversity values (Hd = 0.954 ± 0.004; π = 0.028 ± 0.0004) were identified in Hungarian population, although they were higher within than among the different populations (Hd = 0.972 ± 0.002; π = 0.03097 ± 0.002). Fourteen of the previously observed seventeen haplogroups were detected. Discussion Our samples showed a large intra- and interbreed variation. There was no clear clustering on the median joining network figure. The overall information collected in this work led us to consider that the genetic scenario observed for Hungarian draft breed is more likely the result of contributions from ‘ancestrally’ different genetic backgrounds. This study could contribute to the development of a breeding plan for Hungarian draft horses and help to formulate a genetic conservation plan, avoiding inbreeding while. PMID:29404201

  12. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  13. Purification and partial amino-acid sequence of gibberellin 20-oxidase from Cucurbita maxima L. endosperm.

    Science.gov (United States)

    Lange, T

    1994-01-01

    Gibberellin (GA) 20-oxidase was purified to apparent homogeneity from Cucurbita maxima endosperm by fractionated ammonium-sulphate precipitation, gel-filtration chromatography and anion-exchange and hydrophobic-interaction high-performance liquid chromatography (HPLC). Average purification after the last step was 55-fold with 3.9% of the activity recovered. The purest single fraction was enriched 101-fold with 0.2% overall recovery. Apparent relative molecular mass of the enzyme was 45 kDa, as determined by gel-filtration HPLC and sodium dodecyl sulphate-polyacrylamide gel electrophoresis, indicating that GA 20-oxidase is probably a monomeric enzyme. The purified enzyme degraded on two-dimensional gel electrophoresis, giving two protein spots: a major one corresponding to a molecular mass of 30 kDa and a minor one at 45 kDa. The isoelectric point for both was 5.4. The amino-acid sequences of the amino-terminus of the purified enzyme and of two peptides from a tryptic digest were determined. The purified enzyme catalysed the sequential conversion of [14C]GA12 to [14C]GA15, [14C]GA24 and [14C]GA25, showing that carbon atom 20 was oxidised to the corresponding alcohol, aldehyde and carboxylic acid in three consecutive reactions. [14C]Gibberellin A53 was similarly converted to [14C]GA44, [14C]GA19, [14C]GA17 and small amounts of a fourth product, which was preliminarily identified as [14C]GA20, a C19-gibberellin. All GAs except [14C]GA20 were identified by combined gas chromatography-mass spectrometry. The cofactor requirements in the absence of dithiothreitol were essentially as in its presence (Lange et al., Planta 195, 98-107, 1994), except that ascorbate was essential for enzyme activity and the optimal concentration of catalase was lower.

  14. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  15. Radioactive cDNA microarray in neurospsychiatry

    International Nuclear Information System (INIS)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

    2003-01-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  16. Radioactive cDNA microarray in neurospsychiatry

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

    2003-02-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  17. Ancient DNA analyses of museum specimens from selected Presbytis (primate: Colobinae) based on partial Cyt b sequences

    Science.gov (United States)

    Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.

    2016-11-01

    The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.

  18. Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2018-04-01

    Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.

  19. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  20. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  1. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  2. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  3. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  4. Evaluation of short repetition time, partial flip angle, gradient recalled echo pulse sequences in cervical spine imaging

    International Nuclear Information System (INIS)

    Enzmann, D.; Rubin, J.B.

    1987-01-01

    A short repetition time (TR), partial flip angle, gradient recalled echo pulse sequence (GRASS) was prospectively studied to optimize it for the diagnosis of cervical disk and cord disease in 98 patients. Changes in signal-to-noise ratio (SNR) and contrast were measured as the following parameters were varied: flip angle (3 0 to 18 0 ), TR (22-60 msec), and echo time (TE) (12.5-25 msec). Flip angle was the single most important parameter. For disk disease, cerebrospinal fluid (CSF) SNR peaked at an 8 0 flip angle in the axial view but at a 4 0 flip angle in the sagittal view. In the sagittal view, disk-CSF contrast decreased progressively from a flip angle of 3 0 , while in the axial view it peaked at 10 0 . For cord lesions the findings were similar except that lesion-cord contrast could be increased by lengthening both TR and TE. No one combination of parameters proved greatly superior for either disk disease or cord disease. The selection of parameters required balancing of several factors that often had opposing effects

  5. Stoichiometric evaluation of partial nitritation, anammox and denitrification processes in a sequencing batch reactor and interpretation of online monitoring parameters.

    Science.gov (United States)

    Langone, Michela; Ferrentino, Roberta; Cadonna, Maria; Andreottola, Gianni

    2016-12-01

    A laboratory-scale sequencing batch reactor (SBR) performing partial nitritation - anammox and denitrification was used to treat anaerobic digester effluents. The SBR cycle consisted of a short mixing filling phase followed by oxic and anoxic reaction phases. Working at 25 °C, an ammonium conversion efficiency of 96.5%, a total nitrogen removal efficiency of 88.6%, and an organic carbon removal efficiency of 63.5% were obtained at a nitrogen loading rate of 0.15 kg N m -3 d -1 , and a biodegradable organic carbon to nitrogen ratio of 0.37. The potential contribution of each biological process was evaluated by using a stoichiometric model. The nitritation contribution decreased as the temperature decreased, while the contribution from anammox depended on the wastewater type and soluble carbon to nitrogen ratio. Denitrification improved the total nitrogen removal efficiency, and it was influenced by the biodegradable organic carbon to nitrogen ratio. The characteristic patterns of conductivity, oxidation-reduction potential (ORP) and pH in the SBR cycle were well related to biological processes. Conductivity profiles were found to be directly related to the decreasing profiles of ammonium. Positive ORP values at the end of the anoxic phases were detected for total nitrogen removal efficiency of lower than 85%, and the occurrence of bending points on the ORP curves during the anoxic phases was associated with nitrite depletion by the anammox process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  7. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  8. Purification, reactivity with IgE and cDNA cloning of parvalbumin as the major allergen of mackerels.

    Science.gov (United States)

    Hamada, Y; Tanaka, H; Ishizaki, S; Ishida, M; Nagashima, Y; Shiomi, K

    2003-08-01

    Three species of mackerels (Scomber japonicus, S. australasicus and S. scombrus) are widely consumed and considered to be most frequently involved in incidents of IgE-mediated fish allergy in Japan. In this study, parvalbumin, a possible candidate for the major allergen, was purified from the white muscle of three species of mackerels by gel filtration on Sephadex G-75 and reverse-phase HPLC on TSKgel ODS-120T. All the purified preparations from three species gave a single band of about 11 kDa and were clearly identified as parvalbumins by analyses of their partial amino acid sequences. In ELISA experiments, four of five sera from fish-allergic patients reacted to all the purified parvalbumins, demonstrating that parvalbumin is the major allergen in common with the mackerels. Antigenic cross-reactivity among the mackerel parvalbumins was also established by ELISA inhibition experiments. A cDNA library was constructed from the white muscle of S. japonicus and the cDNA encoding parvalbumin was cloned. The amino acid sequence translated from the nucleotide sequence revealed that the S. japonicus parvalbumin is composed of 108 residues, being a member of beta-type parvalbumins.

  9. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

    Science.gov (United States)

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-12-31

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

  10. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  11. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  12. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  13. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  14. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  15. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  16. Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

    Directory of Open Access Journals (Sweden)

    Rodrigo Pessôa

    Full Text Available BACKGROUND: Here, we report on the partial and full-length genomic (FLG variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs, 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP and 7 adult T-cell leukemia/lymphoma (ATLL patients, using an Illumina paired-end protocol. METHODS: Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. RESULTS: A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14 and FLG (n = 76 data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5% individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA and that 4 individuals (4.5% were infected with the Japanese sub-subtypes (aB. A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. CONCLUSIONS: This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data

  17. Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

    Science.gov (United States)

    Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

    2014-01-01

    Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the

  18. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  19. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  20. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  1. Construction and characterization of cDNA library for IRM-2 mice

    International Nuclear Information System (INIS)

    Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

    2010-01-01

    Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

  2. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  3. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  4. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  5. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

    Science.gov (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

    1998-08-01

    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  6. Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

    International Nuclear Information System (INIS)

    Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

    1990-01-01

    A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

  7. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  8. Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

    International Nuclear Information System (INIS)

    Fritz, E.

    1994-06-01

    In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

  9. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  10. Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic arabidopsis.

    Science.gov (United States)

    Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W

    2000-03-01

    Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.

  11. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  12. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...... results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial...

  13. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  14. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    Directory of Open Access Journals (Sweden)

    Aboubaker M. Garbaj

    2016-11-01

    Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

  15. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

    Directory of Open Access Journals (Sweden)

    Gurpreet Kaur

    2015-01-01

    Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  16. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S

    2015-01-01

    The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  17. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...

  18. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  19. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  20. Peak-to-average power ratio reduction in orthogonal frequency division multiplexing-based visible light communication systems using a modified partial transmit sequence technique

    Science.gov (United States)

    Liu, Yan; Deng, Honggui; Ren, Shuang; Tang, Chengying; Qian, Xuewen

    2018-01-01

    We propose an efficient partial transmit sequence technique based on genetic algorithm and peak-value optimization algorithm (GAPOA) to reduce high peak-to-average power ratio (PAPR) in visible light communication systems based on orthogonal frequency division multiplexing (VLC-OFDM). By analysis of hill-climbing algorithm's pros and cons, we propose the POA with excellent local search ability to further process the signals whose PAPR is still over the threshold after processed by genetic algorithm (GA). To verify the effectiveness of the proposed technique and algorithm, we evaluate the PAPR performance and the bit error rate (BER) performance and compare them with partial transmit sequence (PTS) technique based on GA (GA-PTS), PTS technique based on genetic and hill-climbing algorithm (GH-PTS), and PTS based on shuffled frog leaping algorithm and hill-climbing algorithm (SFLAHC-PTS). The results show that our technique and algorithm have not only better PAPR performance but also lower computational complexity and BER than GA-PTS, GH-PTS, and SFLAHC-PTS technique.

  1. Prune belly syndrome with overlapping presentation of partial urorectal septum malformation sequence in a female newborn with absent perineal openings.

    Science.gov (United States)

    Farooqui, Azhar; AlAqeel, Alaa; Habib, Zakaria

    2014-01-01

    Prune belly syndrome (PBS) is a rare congenital anomaly characterized in males by a triad of anomalous genitourinary tract, deficient development of abdominal wall muscles, and bilateral cryptorchidism. Although similar anomalies have been reported in females, by definition they do not full fill the classical triad. Urorectal septum malformation sequence (URSM) is a lethal condition characterized by presence of ambiguous genitalia, absent perineal openings (urogenital and anal), and lumbosacral abnormalities. In this original case report, the authors discuss the presentation and management of what would be analogous to a Woodhouse category 1 PBS in a female newborn associated with an overlapping presentation of URSM.

  2. Prune Belly Syndrome with Overlapping Presentation of Partial Urorectal Septum Malformation Sequence in a Female Newborn with Absent Perineal Openings

    Directory of Open Access Journals (Sweden)

    Azhar Farooqui

    2014-01-01

    Full Text Available Prune belly syndrome (PBS is a rare congenital anomaly characterized in males by a triad of anomalous genitourinary tract, deficient development of abdominal wall muscles, and bilateral cryptorchidism. Although similar anomalies have been reported in females, by definition they do not full fill the classical triad. Urorectal septum malformation sequence (URSM is a lethal condition characterized by presence of ambiguous genitalia, absent perineal openings (urogenital and anal, and lumbosacral abnormalities. In this original case report, the authors discuss the presentation and management of what would be analogous to a Woodhouse category 1 PBS in a female newborn associated with an overlapping presentation of URSM.

  3. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    Science.gov (United States)

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  4. Alternative splicing enriched cDNA libraries identify breast cancer-associated transcripts

    Science.gov (United States)

    2010-01-01

    Background Alternative splicing (AS) is a central mechanism in the generation of genomic complexity and is a major contributor to transcriptome and proteome diversity. Alterations of the splicing process can lead to deregulation of crucial cellular processes and have been associated with a large spectrum of human diseases. Cancer-associated transcripts are potential molecular markers and may contribute to the development of more accurate diagnostic and prognostic methods and also serve as therapeutic targets. Alternative splicing-enriched cDNA libraries have been used to explore the variability generated by alternative splicing. In this study, by combining the use of trapping heteroduplexes and RNA amplification, we developed a powerful approach that enables transcriptome-wide exploration of the AS repertoire for identifying AS variants associated with breast tumor cells modulated by ERBB2 (HER-2/neu) oncogene expression. Results The human breast cell line (C5.2) and a pool of 5 ERBB2 over-expressing breast tumor samples were used independently for the construction of two AS-enriched libraries. In total, 2,048 partial cDNA sequences were obtained, revealing 214 alternative splicing sequence-enriched tags (ASSETs). A subset with 79 multiple exon ASSETs was compared to public databases and reported 138 different AS events. A high success rate of RT-PCR validation (94.5%) was obtained, and 2 novel AS events were identified. The influence of ERBB2-mediated expression on AS regulation was evaluated by capillary electrophoresis and probe-ligation approaches in two mammary cell lines (Hb4a and C5.2) expressing different levels of ERBB2. The relative expression balance between AS variants from 3 genes was differentially modulated by ERBB2 in this model system. Conclusions In this study, we presented a method for exploring AS from any RNA source in a transcriptome-wide format, which can be directly easily adapted to next generation sequencers. We identified AS transcripts

  5. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  6. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Automation of cDNA Synthesis and Labelling Improves Reproducibility

    Directory of Open Access Journals (Sweden)

    Daniel Klevebring

    2009-01-01

    Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

  8. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  9. Construction and application of a bovine immune-endocrine cDNA microarray.

    Science.gov (United States)

    Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

    2004-09-01

    A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha

  10. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  11. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  12. Cloning of soluble alkaline phosphatase cDNA and molecular basis of the polymorphic nature in alkaline phosphatase isozymes of Bombyx mori midgut.

    Science.gov (United States)

    Itoh, M; Kanamori, Y; Takao, M; Eguchi, M

    1999-02-01

    A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.

  13. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  14. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  15. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  16. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  17. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  18. Genomic comparison of the endophyte Herbaspirillum seropedicae SmR1 and the phytopathogen Herbaspirillum rubrisubalbicans M1 by suppressive subtractive hybridization and partial genome sequencing.

    Science.gov (United States)

    Monteiro, Rose A; Balsanelli, Eduardo; Tuleski, Thalita; Faoro, Helison; Cruz, Leonardo M; Wassem, Roseli; de Baura, Valter A; Tadra-Sfeir, Michelle Z; Weiss, Vinícius; DaRocha, Wanderson D; Muller-Santos, Marcelo; Chubatsu, Leda S; Huergo, Luciano F; Pedrosa, Fábio O; de Souza, Emanuel M

    2012-05-01

    Herbaspirillum rubrisubalbicans M1 causes the mottled stripe disease in sugarcane cv. B-4362. Inoculation of this cultivar with Herbaspirillum seropedicae SmR1 does not produce disease symptoms. A comparison of the genomic sequences of these closely related species may permit a better understanding of contrasting phenotype such as endophytic association and pathogenic life style. To achieve this goal, we constructed suppressive subtractive hybridization (SSH) libraries to identify DNA fragments present in one species and absent in the other. In a parallel approach, partial genomic sequence from H. rubrisubalbicans M1 was directly compared in silico with the H. seropedicae SmR1 genome. The genomic differences between the two organisms revealed by SSH suggested that lipopolysaccharide and adhesins are potential molecular factors involved in the different phenotypic behavior. The cluster wss probably involved in cellulose biosynthesis was found in H. rubrisubalbicans M1. Expression of this gene cluster was increased in H. rubrisubalbicans M1 cells attached to the surface of maize root, and knockout of wssD gene led to decrease in maize root surface attachment and endophytic colonization. The production of cellulose could be responsible for the maize attachment pattern of H. rubrisubalbicans M1 that is capable of outcompeting H. seropedicae SmR1. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  19. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  20. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  1. Display of a Maize cDNA library on baculovirus infected insect cells

    Directory of Open Access Journals (Sweden)

    Jones Ian M

    2008-08-01

    Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  2. Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

    Science.gov (United States)

    Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

    2000-08-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

  3. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam.

    Science.gov (United States)

    Takano, Kohei Takenaka; Nguyen, Ngoc Thi Hong; Nguyen, Binh Thi Huong; Sunahara, Toshihiko; Yasunami, Michio; Nguyen, Manh Duc; Takagi, Masahiro

    2010-04-30

    During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A) among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1) the geographic distribution, which is potentially spreading along the Vietnam, China, Laos, and Myanmar borders

  4. Biochemical Characterization, Thermal Stability, and Partial Sequence of a Novel Exo-Polygalacturonase from the Thermophilic Fungus Rhizomucor pusillus A13.36 Obtained by Submerged Cultivation

    Directory of Open Access Journals (Sweden)

    Lucas Vinícius Trindade

    2016-01-01

    Full Text Available This work reports the production of an exo-polygalacturonase (exo-PG by Rhizomucor pusillus A13.36 in submerged cultivation (SmC in a shaker at 45°C for 96 h. A single pectinase was found and purified in order to analyze its thermal stability, by salt precipitation and hydrophobic interaction chromatography. The pectinase has an estimated Mw of approximately 43.5–47 kDa and optimum pH of 4.0 but is stable in pH ranging from 3.5 to 9.5 and has an optimum temperature of 61°C. It presents thermal stability between 30 and 60°C, has 70% activation in the presence of Ca2+, and was tested using citrus pectin with a degree of methyl esterification (DE of 26%. Ea(d for irreversible denaturation was 125.5 kJ/mol with positive variations of entropy and enthalpy for that and ΔG(d values were around 50 kJ/mol. The hydrolysis of polygalacturonate was analyzed by capillary electrophoresis which displayed a pattern of sequential hydrolysis (exo. The partial identification of the primary sequence was done by MS MALDI-TOF and a comparison with data banks showed the highest identity of the sequenced fragments of exo-PG from R. pusillus with an exo-pectinase from Aspergillus fumigatus. Pectin hydrolysis showed a sigmoidal curve for the Michaelis-Menten plot.

  5. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  6. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  7. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

    Science.gov (United States)

    Ghebremedhin, B; Layer, F; König, W; König, B

    2008-03-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification.

  8. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    International Nuclear Information System (INIS)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.

    1986-01-01

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting

  9. Illumina MiSeq sequencing reveals the key microorganisms involved in partial nitritation followed by simultaneous sludge fermentation, denitrification and anammox process.

    Science.gov (United States)

    Wang, Bo; Peng, Yongzhen; Guo, Yuanyuan; Zhao, Mengyue; Wang, Shuying

    2016-05-01

    A combined process including a partial nitritation SBR (PN-SBR) followed by a simultaneous sludge fermentation, denitrification and anammox reactor (SFDA) was established to treat low C/N domestic wastewater in this study. An average nitrite accumulation rate of 97.8% and total nitrogen of 9.4mg/L in the effluent was achieved during 140days' operation. The underlying mechanisms were investigated by using Illumina MiSeq sequencing to analyze the microbial community structures in the PN-SBR and SFDA. Results showed that the predominant bacterial phylum was Proteobacteria in the external waste activated sludge (WAS, added to the SFDA) and SFDA while Bacteroidetes in the PN-SBR. Further study indicated that in the PN-SBR, the dominant nitrobacteria, Nitrosomonas genus, facilitated nitritation and little nitrate was generated in the PN-SBR effluent. In the SFDA, the co-existence of functional microorganisms Thauera, Candidatus Anammoximicrobium and Pseudomonas were found to contribute to simultaneous sludge fermentation, denitrification and anammox. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Management of twin anemia-polycythemia sequence using intrauterine blood transfusion for the donor and partial exchange transfusion for the recipient.

    Science.gov (United States)

    Genova, L; Slaghekke, F; Klumper, F J; Middeldorp, J M; Steggerda, S J; Oepkes, D; Lopriore, E

    2013-01-01

    Twin anemia-polycythemia sequence (TAPS) is a rare condition which may occur either spontaneously in uncomplicated monochorionic twin pregnancies or may develop after laser treatment in twin-twin transfusion syndrome. TAPS is characterized by a large intertwin discordance in hemoglobin levels without discordance in amniotic fluid levels, and may lead to severe complications including fetal hydrops, hematological morbidity and perinatal mortality. Several treatments have been proposed including intrauterine transfusion, laser surgery, elective delivery and expectant management. The optimal treatment remains unclear. In this case series we report 3 TAPS cases managed recently at our center with a combination of intrauterine blood transfusion for the anemic twin and intrauterine partial exchange transfusion for the polycythemic twin. In 1 case, the donor was found to have severe cerebral injury on neuroimaging examination. We propose etiologic mechanisms for cerebral injury in TAPS, discuss the rationale behind this treatment alternative, and evaluate the pros and cons of the various management options. Copyright © 2013 S. Karger AG, Basel.

  11. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  12. Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

    International Nuclear Information System (INIS)

    Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

    1988-01-01

    Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

  13. Comparison of cDNA-derived protein sequences of the human fibronectin and vitronectin receptor α-subunits and platelet glycoprotein IIb

    International Nuclear Information System (INIS)

    Fitzgerald, L.A.; Poncz, M.; Steiner, B.; Rall, S.C. Jr.; Bennett, J.S.; Phillips, D.R.

    1987-01-01

    The fibronectin receptor (FnR), the vitronectin receptor (VnR), and the platelet membrane glycoprotein (GP) IIb-IIIa complex are members of a family of cell adhesion receptors, which consist of noncovalently associated α- and β-subunits. The present study was designed to compare the cDNA-derived protein sequences of the α-subunits of human FnR, VnR, and platelet GP IIb. cDNA clones for the α-subunit of the FnR (FnR/sub α/) were obtained from a human umbilical vein endothelial (HUVE) cell library by using an oligonucleotide probe designed from a peptide sequence of platelet GP IIb. cDNA clones for platelet GP IIb were isolated from a cDNA expression library of human erythroleukemia cells by using antibodies. cDNA clones of the VnR α-subunit (VnR/sub α/) were obtained from the HUVE cell library by using an oligonucleotide probe from the partial cDNA sequence for the VnR/sub α/. Translation of these sequences showed that the FNR/sub α/, the VnR/sub α/, and GP IIb are composed of disulfide-linked large (858-871 amino acids) and small (137-158 amino acids) chains that are posttranslationally processed from a single mRNA. A single hydrophobic segment located near the carboxyl terminus of each small chain appears to be a transmembrane domain. The large chains appear to be entirely extracellular, and each contains four repeated putative Ca 2+ -binding domains of about 30 amino acids that have sequence similarities to other Ca 2+ -binding proteins. The identity among the protein sequences of the three receptor α-subunits ranges from 36.1% to 44.5%, with the Ca 2+ -binding domains having the greatest homology. These proteins apparently evolved by a process of gene duplication

  14. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae, forest malaria vectors, in northern Vietnam

    Directory of Open Access Journals (Sweden)

    Yasunami Michio

    2010-04-01

    Full Text Available Abstract Background During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. Results In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. Conclusions The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1 the geographic distribution, which is potentially

  15. Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

    Science.gov (United States)

    Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

    2010-04-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

  16. Purification of MUC1 from Bovine Milk-Fat Globules and Characterization of a Corresponding Full-Length cDNA Clone

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Andersen, Mikkel Holmen; Nielsen, Rune

    2001-01-01

    acid sequences obtained by peptide mapping. The complete amino acid sequence of MUC1 was determined by cloning and sequencing the corresponding bovine mammary gland cDNA, which was shown to encode a protein of 580 amino acid residues comprising a cleavable signal peptide of 22 residues. The deduced...

  17. The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

    Science.gov (United States)

    Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

    2015-04-01

    Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

  18. Consistent errors in first strand cDNA due to random hexamer mispriming.

    Directory of Open Access Journals (Sweden)

    Thomas P van Gurp

    Full Text Available Priming of random hexamers in cDNA synthesis is known to show sequence bias, but in addition it has been suggested recently that mismatches in random hexamer priming could be a cause of mismatches between the original RNA fragment and observed sequence reads. To explore random hexamer mispriming as a potential source of these errors, we analyzed two independently generated RNA-seq datasets of synthetic ERCC spikes for which the reference is known. First strand cDNA synthesized by random hexamer priming on RNA showed consistent position and nucleotide-specific mismatch errors in the first seven nucleotides. The mismatch errors found in both datasets are consistent in distribution and thermodynamically stable mismatches are more common. This strongly indicates that RNA-DNA mispriming of specific random hexamers causes these errors. Due to their consistency and specificity, mispriming errors can have profound implications for downstream applications if not dealt with properly.

  19. Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Soumen Naskar

    2012-01-01

    Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

  20. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  1. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  2. CDNA library from the Latex of Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Wilaiwan Chotigeat

    2010-12-01

    Full Text Available Latex from Hevea brasiliensis contains 30-50% (w/w of natural rubber (cis-1,4-polyisoprene, the important rawmaterial for many rubber industries. We have constructed a cDNA library from the latex of H. brasiliensis to investigate theexpressed genes and molecular events in the latex. We analyzed 412 expressed sequence tags (ESTs. More than 90% of theEST clones showed homology to previously described sequences in public databases. Functional classification of the ESTsshowed that the largest category were proteins of unknown function (30.1%, 11.4% of ESTs encoded for rubber synthesisrelatedproteins (RS and 8.5% for defense or stress related proteins (DS. Those with no significant homology to knownsequences (NSH accounted for 8.7%, primary metabolism (PM and gene expression and RNA metabolism were 7.8% and6.6%, respectively. Other categories included, protein synthesis-related proteins (6.6%, chromatin and DNA metabolism(CDM 3.9%, energy metabolism (EM 3.4%, cellular transport (CT 3.2%, cell structure (CS 3.2%, signal transduction (ST2.2%, secondary metabolism (SM 1.7%, protein fate (PF 2.2%, and reproductive proteins (RP 0.7%.

  3. Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.

    Science.gov (United States)

    Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo

    2011-09-01

    Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC 1.14.18.1) activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  4. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  5. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  6. Construction of cDNA libraries from Pseudocercospora fijiensis Morelet infected leaves of the cultivars Calcutta 4 and Niyarma Yik

    Directory of Open Access Journals (Sweden)

    Milady Mendoza-Rodríguez

    2004-01-01

    Full Text Available Molecular studies of plant-pathogen interaction are very important for the identification of gene (s related with the pathogenic process, as well as with the plant resistance. These gene (s could be use for the genetic improvement programs in order to obtain resistant cultivars. The aim of this work was to construct complementary DNA (cDNA libraries from infected leaves with Pseudocercospora fijiensis CCIBP-Pf1 isolated of two banana cultivars (a resistant one Calcutta4 and another one susceptible Niyarma Yik. First-strand cDNA synthesis, was made beginning with one microgram of total RNA by using oligo dT primer and cDNA quality was checked by Polimerase chain reaction (PCR with cytochrome b specific primers. Second-strand cDNA synthesis was performed by using the homopolymeric tailing with dC-BamH I + dT-Not I primer combination. Four cDNA libraries of infected plants at different times of infection with the pathogen were obtained. Forty one clones of one of the libraries of Niyarma Yik were sequenced and the obtained sequences correspond with genes related to fungi. Key words: Banana-Mycosphaerella fijiensis interaction,Black Sigatoka, Musa spp.

  7. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  8. Cloning of the human carnitine-acylcarnitine carrier cDNA and identification of the molecular defect in a patient

    NARCIS (Netherlands)

    Huizing, M.; Iacobazzi, V.; IJlst, L.; Savelkoul, P.; Ruitenbeek, W.; van den Heuvel, L.; Indiveri, C.; Smeitink, J.; Trijbels, F.; Wanders, R.; Palmieri, F.

    1997-01-01

    The carnitine-acylcarnitine carrier (CAC) catalyzes the translocation of long-chain fatty acids across the inner mitochondrial membrane. We cloned and sequenced the human CAC cDNA, which has an open reading frame of 903 nucleotides. Northern blot studies revealed different expression levels of CAC

  9. Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

    DEFF Research Database (Denmark)

    Christensen, C B; Jørgensen, L; Jensen, A T

    2000-01-01

    Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

  10. A tobacco cDNA reveals two different transcription patterns in vegetative and reproductive organs

    Directory of Open Access Journals (Sweden)

    I. da Silva

    2002-08-01

    Full Text Available In order to identify genes expressed in the pistil that may have a role in the reproduction process, we have established an expressed sequence tags project to randomly sequence clones from a Nicotiana tabacum stigma/style cDNA library. A cDNA clone (MTL-8 showing high sequence similarity to genes encoding glycine-rich RNA-binding proteins was chosen for further characterization. Based on the extensive identity of MTL-8 to the RGP-1a sequence of N. sylvestris, a primer was defined to extend the 5' sequence of MTL-8 by RT-PCR from stigma/style RNAs. The amplification product was sequenced and it was confirmed that MTL-8 corresponds to an mRNA encoding a glycine-rich RNA-binding protein. Two transcripts of different sizes and expression patterns were identified when the MTL-8 cDNA insert was used as a probe in RNA blots. The largest is 1,100 nucleotides (nt long and markedly predominant in ovaries. The smaller transcript, with 600 nt, is ubiquitous to the vegetative and reproductive organs analyzed (roots, stems, leaves, sepals, petals, stamens, stigmas/styles and ovaries. Plants submitted to stress (wounding, virus infection and ethylene treatment presented an increased level of the 600-nt transcript in leaves, especially after tobacco necrosis virus infection. In contrast, the level of the 1,100-nt transcript seems to be unaffected by the stress conditions tested. Results of Southern blot experiments have suggested that MTL-8 is present in one or two copies in the tobacco genome. Our results suggest that the shorter transcript is related to stress while the larger one is a flower predominant and nonstress-inducible messenger.

  11. Recurrent Partial Words

    Directory of Open Access Journals (Sweden)

    Francine Blanchet-Sadri

    2011-08-01

    Full Text Available Partial words are sequences over a finite alphabet that may contain wildcard symbols, called holes, which match or are compatible with all letters; partial words without holes are said to be full words (or simply words. Given an infinite partial word w, the number of distinct full words over the alphabet that are compatible with factors of w of length n, called subwords of w, refers to a measure of complexity of infinite partial words so-called subword complexity. This measure is of particular interest because we can construct partial words with subword complexities not achievable by full words. In this paper, we consider the notion of recurrence over infinite partial words, that is, we study whether all of the finite subwords of a given infinite partial word appear infinitely often, and we establish connections between subword complexity and recurrence in this more general framework.

  12. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  13. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  14. Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

    Science.gov (United States)

    Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

    2017-04-01

    Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of

  15. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

  16. Infectious Maize rayado fino virus from cloned cDNA

    Science.gov (United States)

    Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

  17. Growth hormone and prolactin in Andrias davidianus: cDNA cloning, tissue distribution and phylogenetic analysis.

    Science.gov (United States)

    Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran

    2010-01-15

    The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.

  18. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  19. Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

    Science.gov (United States)

    Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

    2018-03-15

    The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan

  20. cDNA library Table - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available c00951-005 Description of data contents List of Bombyx mori cDNA libraries. Data file File name: kaiko_cdna_...library.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kaiko-cdna/LATEST/kaiko_cdna_library.zip File size:... 4.8 KB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/kaiko_cdna_l

  1. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  2. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

    2014-01-25

    Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Partial amino acid sequence of the branched chain amino acid aminotransferase (TmB) of E. coli JA199 pDU11

    International Nuclear Information System (INIS)

    Feild, M.J.; Armstrong, F.B.

    1987-01-01

    E. coli JA199 pDU11 harbors a multicopy plasmid containing the ilv GEDAY gene cluster of S. typhimurium. TmB, gene product of ilv E, was purified, crystallized, and subjected to Edman degradation using a gas phase sequencer. The intact protein yielded an amino terminal 31 residue sequence. Both carboxymethylated apoenzyme and [ 3 H]-NaBH-reduced holoenzyme were then subjected to digestion by trypsin. The digests were fractionated using reversed phase HPLC, and the peptides isolated were sequenced. The borohydride-treated holoenzyme was used to isolate the cofactor-binding peptide. The peptide is 27 residues long and a comparison with known sequences of other aminotransferases revealed limited homology. Peptides accounting for 211 of 288 predicted residues have been sequenced, including 9 residues of the carboxyl terminus. Comparison of peptides with the inferred amino acid sequence of the E. coli K-12 enzyme has helped determine the sequence of the amino terminal 59 residues; only two differences between the sequences are noted in this region

  4. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  5. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    Science.gov (United States)

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  6. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  7. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  8. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  9. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    International Nuclear Information System (INIS)

    Chen, J.; Varner, J.E.

    1985-01-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

  10. The Effect of Uncertain End-of-Life Product Quality and Consumer Incentives on Partial Disassembly Sequencing in Value Recovery Operations

    OpenAIRE

    Rickli, Jeremy Lewis

    2013-01-01

    This dissertation addresses gaps in the interaction between End-of-Life (EoL) product acquisition systems and disassembly sequencing. The research focuses on two remanufacturing research problems; 1) modeling uncertain EoL product quality, quantity, and timing in regards to EoL product acquisition and disassembly sequencing and 2) designing EoL product acquisition schemes considering EoL product uncertainty. The main research objectives within these areas are; analyzing, predicting, and contr...

  11. Cloning the human lysozyme cDNA: Inverted Alu repeat in the mRNA and in situ hybridization for macrophages and Paneth cells

    International Nuclear Information System (INIS)

    Chung, L.P.; Keshav, S.; Gordon, S.

    1988-01-01

    Lysozyme is a major secretory product of human and rodent macrophages and a useful marker for myelomonocytic cells. Based on the known human lysozyme amino acid sequence, oligonucleotides were synthesized and used as probes to screen a phorbol 12-myristate 13-acetate-treated U937 cDNA library. A full-length human lysozyme cDNA clone, pHL-2, was obtained and characterized. Sequence analysis shows that human lysozyme, like chicken lysozyme, has in 18-amino-acid-long signal peptide, but unlike the chicken lysozyme cDNA, the human lysozyme cDNA has a >1-kilobase-long 3' nontranslated sequence. Interestingly, within this 3' region, an inverted repeat of the Alu family of repetitive sequences was discovered. In RNA blot analyses, DNA probes prepared from pHL-2 can be used to detect lysozyme mRNA not only from human but also from mouse and rat. Moreover, by in situ hybridization, complementary RNA transcripts have been used as probes to detect lysozyme mRNA in mouse macrophages and Paneth cells. This human lysozyme cDNA clone is therefore likely to be a useful molecular probe for studying macrophage distribution and gene expression

  12. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  13. cDNA cloning of porcine brain prolyl endopeptidase and identification of the active-site seryl residue

    Energy Technology Data Exchange (ETDEWEB)

    Rennex, D.; Hemmings, B.A.; Hofsteenge, J.; Stone, S.R. (Friedrich Miescher-Institut, Basel (Switzerland))

    1991-02-26

    Prolyl endopeptidase is a cytoplasmic serine protease. The enzyme was purified from porcine kidney, and oligonucleotides based on peptide sequences from this protein were used to isolate a cDNA clone from a porcine brain library. This clone contained the complete coding sequence of prolyl endopeptidase and encoded a polypeptide with a molecular mass of 80751 Da. The deduced amino acid sequence of prolyl endopeptidase showed no sequence homology with other known serine proteases. ({sup 3}H)Diisopropyl fluorophosphate was used to identify the active-site serine of prolyl endopeptidase. One labeled peptide was isolated and sequenced. The sequence surrounding the active-site serine was Asn-Gly-Gly-Ser-Asn-Gly-Gly. This sequence is different from the active-site sequences of other known serine proteases. This difference and the lack of overall homology with the known families of serine proteases suggest that prolyl endopeptidase represents a new type of serine protease.

  14. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    Science.gov (United States)

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  15. Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

    Science.gov (United States)

    Mattsson, J G; Ljunggren, E L; Bergström, K

    2001-05-01

    The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

  16. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  17. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  18. Identification and expression analysis of peroxisome proliferator-activated receptors cDNA in a reptile, the leopard gecko (Eublepharis macularius).

    Science.gov (United States)

    Kato, Keisuke; Oka, Yoshitaka; Park, Min Kyun

    2008-05-01

    Despite the physiological and evolutionary significance of lipid metabolism in amniotes, the molecular mechanisms involved have been unclear in reptiles. To elucidate this, we investigated peroxisome proliferators-activated receptors (PPARs) in the leopard gecko (Eublepharis macularius). PPARs belong to a nuclear hormone-receptor family mainly involved in lipid metabolism. Although PPARs have been widely studied in mammals, little information about them is yet available from reptiles. We identified in the leopard gecko partial cDNA sequences of PPARalpha and beta, and full sequences of two isoforms of PPARgamma. This is the first report of reptilian PPARgamma mRNA isoforms. We also evaluated the organ distribution of expression of these genes by using RT-PCR and competitive PCR. The expression level of PPARalpha mRNA was highest in the large intestine, and moderate in the liver and kidney. The expression level of PPARbeta mRNA was highest in the kidney and large intestine, and moderate in the liver. Similarly to the expression of human PPARgamma isoforms, PPARgammaa was expressed ubiquitously, whereas the expression of PPARgammab was restricted. The highest levels of their expression, however, were observed in the large intestine, rather than in the adipose tissue as in mammals. Taken together, these results showed that the profile of PPARbeta mRNA expression in the leopard gecko is similar to that in mammals, and that those of PPAR alpha and gamma are species specific. This may reflect adaptation to annual changes in lipid storage due to seasonal food availability.

  19. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  20. Cdna cloning and expression analyses of the isoflavone reductase-like gene of dendrobium officinale

    International Nuclear Information System (INIS)

    Qian, X.; Xu, S.Z.

    2015-01-01

    The full length of the isoflavone reductase-like gene (IRL) cDNA of Dendrobium officinale was cloned by using reverse transcription (RT) PCR combined with cDNA library, the IRL function was identified by Bioinformatics and prokaryotic expression analyses, and the IRL expression levels in the organs and tissues of D. officinale plants with different ages were determined by using real-time quantitative PCR (RT-qPCR). The results indicated that the full length of the cDNA of D. officinale IRL, DoIRL, was 1238 bp (accession no. KJ661023). Its open reading frame (ORF) was 930 bp which encoded 309 amino acids with a predicted molecular mass of 34 kDa, the 5 untranslated region (UTR) was 61 bp and the 3 UTR containing a poly (A) tail was 247 bp. The deduced amino acid sequence of DoIRL, DoIRL, was forecast to contain a NAD(P)H-binding motif (GGTGYIG) in the N-terminal region, two conserved N-glycosylation sites, a conserved nitrogen metabolite repression regulator (NmrA) domain and a phenylcoumaran benzylic ether reductase (PCBER) domain, to hold the nearest phylogenetic relationship with the PCBER of Striga asiatica, and to share both 73% identity with the isoflavone reductases-like (IRLs) of Cucumis sativus and Striga asiatica. In Escherichia coli 'BL21' cells, the DoIRL cDNA expression produced a protein band holding the predicted molecular mass of 34 kDa. DoIRL expressed in all organs and tissues of D. officinale plants with different ages at comparatively low levels, and the expression level in the leaves of the two-year-old plants was the highest. (author)

  1. Cloning of the cDNA for murine von Willebrand factor and identification of orthologous genes reveals the extent of conservation among diverse species.

    Science.gov (United States)

    Chitta, Mohan S; Duhé, Roy J; Kermode, John C

    2007-05-01

    Interaction of von Willebrand factor (VWF) with circulating platelets promotes hemostasis when a blood vessel is injured. The A1 domain of VWF is responsible for the initial interaction with platelets and is well conserved among species. Knowledge of the cDNA and genomic DNA sequences for human VWF allowed us to predict the cDNA sequence for murine VWF in silico and amplify its entire coding region by RT-PCR. The murine VWF cDNA has an open reading frame of 8,442 bp, encoding a protein of 2,813 amino acid residues with 83% identity to human pre-pro-VWF. The same strategy was used to predict in silico the cDNA sequence for the ortholog of VWF in a further six species. Many of these predictions diverged substantially from the putative Reference Sequences derived by ab initio methods. Our predicted sequences indicated that the VWF gene has a conserved structure of 52 exons in all seven mammalian species examined, as well as in the chicken. There is a minor structural variation in the pufferfish Takifugu rubripes insofar as the VWF gene in this species has 53 exons. Comparison of the translated amino acid sequences also revealed a high degree of conservation. In particular, the cysteine residues are conserved precisely throughout both the pro-peptide and the mature VWF sequence in all species, with a minor exception in the pufferfish VWF ortholog where two adjacent cysteine residues are omitted. The marked conservation of cysteine residues emphasizes the importance of the intricate pattern of disulfide bonds in governing the structure of pro-VWF and regulating the function of the mature VWF protein. It should also be emphasized that many of the conserved features of the VWF gene and protein were obscured when the comparison among species was based on the putative Reference Sequences instead of our predicted cDNA sequences.

  2. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    International Nuclear Information System (INIS)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  3. Identification of Trichoderma Species Using Partial Sequencing of nrRNA and tef1α Genes with Report of Trichoderma capillare in Iran Mycoflore

    Directory of Open Access Journals (Sweden)

    mehdi Mehrabi-Koushki

    2018-01-01

    Full Text Available Introduction: Trichoderma is monophyletic (16, with teleomorphs in the genus Hypocrea. Some cryptic Trichoderma species are hidden within morphological species complexes and can only be elucidated by in-depth molecular studies. The genealogical concordance phylogenetic species recognition (GCPSR using several non-linked genes are needed to give accurate identification of Trichoderma spp. (6. Although the ITS region has been successfully used for species delimitation of Trichoderma and Hypocrea (5, but, it is not sufficient for accurate identification of some species. Translation elongation factor 1α gene (tef1α is a reliable barcode for Fusarium (9, Trichoderma and Hypocrea (5. Here, ITS and tef1α genes were selected as candidate DNA barcodes to identify Trichoderma isolates. Material and methods: 40 Trichoderma isolates used in this study were from a fungal collection archived in the plant pathology laboratory in the Department of Plant Protection at the Shahid Chamran University of Ahvaz. Spore suspension (105/ml prepared from single spore cultures of each Trichoderma isolates was added into flasks containing PDB medium. The flasks were shaken at 180 rpm for 10-15 days at 28ºC and the biomass was harvested by passing through sterilized filter papers. The mycelia were freeze-dried (Freeze-Dryer, Alpha 1-2LD Plus, Christ and powdered in the mortar containing liquid nitrogen by pestle. The genomic DNA was isolated according to modified method established by Raeder and Broda (21. The universal primers (ITS1–F; 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4-R; 5'-TCCTCCGCTTATTGATATGC-3' were employed for amplifying around 700bp from 18s, ITS1, 5.8s, ITS2 and 28s rDNA regions (27. The specific primers (tef1α71-f; 5'-CAAAATGGGTAAGGAGGASAAGAC-3' and tef1997-R; 5'-CAGTACCGGCRGCRATRATSAG-3' were employed for amplifying around 950bp from tef1α gene (24. PCR products were purified through ethanol-precipitation method and then sequenced using forward and

  4. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    International Nuclear Information System (INIS)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

  5. cDNA table - RPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available of data contents Results of homology search to cDNA clones in the KOME. Data file File name: rpd_cdna.zip F...ile URL: ftp://ftp.biosciencedbc.jp/archive/rpd/LATEST/rpd_cdna.zip File size: 15 KB Simple search URL http:...//togodb.biosciencedbc.jp/togodb/view/rpd_cdna#en Data acquisition method - Data

  6. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  7. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    Science.gov (United States)

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    Science.gov (United States)

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  9. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  10. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  11. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    Science.gov (United States)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  12. Brain histamine depletion enhances the behavioural sequences complexity of mice tested in the open-field: Partial reversal effect of the dopamine D2/D3 antagonist sulpiride.

    Science.gov (United States)

    Santangelo, Andrea; Provensi, Gustavo; Costa, Alessia; Blandina, Patrizio; Ricca, Valdo; Crescimanno, Giuseppe; Casarrubea, Maurizio; Passani, M Beatrice

    2017-02-01

    Markers of histaminergic dysregulation were found in several neuropsychiatric disorders characterized by repetitive behaviours, thoughts and stereotypies. We analysed the effect of acute histamine depletion by means of i. c.v. injections of alpha-fluoromethylhistidine, a blocker of histidine decarboxylase, on the temporal organization of motor sequences of CD1 mice behaviour in the open-field test. An ethogram encompassing 9 behavioural components was employed. Durations and frequencies were only slightly affected by treatments. However, as revealed by multivariate t-pattern analysis, histamine depletion was associated with a striking increase in the number of behavioural patterns. We found 42 patterns of different composition occurring, on average, 520.90 ± 50.23 times per mouse in the histamine depleted (HD) group, whereas controls showed 12 different patterns occurring on average 223.30 ± 20.64 times. Exploratory and grooming behaviours clustered separately, and the increased pattern complexity involved exclusively exploratory patterns. To test the hypothesis of a histamine-dopamine interplay on behavioural pattern phenotype, non-sedative doses of the D2/D3 antagonist sulpiride (12.5-25-50 mg/kg) were additionally administered to different groups of HD mice. Sulpiride counterbalanced the enhancement of exploratory patterns of different composition, but it did not affect the mean number of patterns at none of the doses used. Our results provide new insights on the role of histamine on repetitive behavioural sequences of freely moving mice. Histamine deficiency is correlated with a general enhancement of pattern complexity. This study supports a putative involvement of histamine in the pathophysiology of tics and related disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. cDNA microarray screening in food safety

    International Nuclear Information System (INIS)

    Roy, Sashwati; Sen, Chandan K.

    2006-01-01

    The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests

  14. Inconsistencies of genome annotations in apicomplexan parasites revealed by 5'-end-one-pass and full-length sequences of oligo-capped cDNAs

    Directory of Open Access Journals (Sweden)

    Sugano Sumio

    2009-07-01

    Full Text Available Abstract Background Apicomplexan parasites are causative agents of various diseases including malaria and have been targets of extensive genomic sequencing. We generated 5'-EST collections for six apicomplexa parasites using our full-length oligo-capping cDNA library method. To improve upon the current genome annotations, as well as to validate the importance for physical cDNA clone resources, we generated a large-scale collection of full-length cDNAs for several apicomplexa parasites. Results In this study, we used a total of 61,056 5'-end-single-pass cDNA sequences from Plasmodium falciparum, P. vivax, P. yoelii, P. berghei, Cryptosporidium parvum, and Toxoplasma gondii. We compared these partially sequenced cDNA sequences with the currently annotated gene models and observed significant inconsistencies between the two datasets. In particular, we found that on average 14% of the exons in the current gene models were not supported by any cDNA evidence, and that 16% of the current gene models may contain at least one mis-annotation and should be re-evaluated. We also identified a large number of transcripts that had been previously unidentified. For 732 cDNAs in T. gondii, the entire sequences were determined in order to evaluate the annotated gene models at the complete full-length transcript level. We found that 41% of the T. gondii gene models contained at least one inconsistency. We also identified and confirmed by RT-PCR 140 previously unidentified transcripts found in the intergenic regions of the current gene annotations. We show that the majority of these discrepancies are due to questionable predictions of one or two extra exons in the upstream or downstream regions of the genes. Conclusion Our data indicates that the current gene models are likely to still be incomplete and have much room for improvement. Our unique full-length cDNA information is especially useful for further refinement of the annotations for the genomes of

  15. Dissection of the inflammatory bowel disease transcriptome using genome-wide cDNA microarrays.

    Directory of Open Access Journals (Sweden)

    Christine M Costello

    2005-08-01

    Full Text Available BACKGROUND: The differential pathophysiologic mechanisms that trigger and maintain the two forms of inflammatory bowel disease (IBD, Crohn disease (CD, and ulcerative colitis (UC are only partially understood. cDNA microarrays can be used to decipher gene regulation events at a genome-wide level and to identify novel unknown genes that might be involved in perpetuating inflammatory disease progression. METHODS AND FINDINGS: High-density cDNA microarrays representing 33,792 UniGene clusters were prepared. Biopsies were taken from the sigmoid colon of normal controls (n = 11, CD patients (n = 10 and UC patients (n = 10. 33P-radiolabeled cDNA from purified poly(A+ RNA extracted from biopsies (unpooled was hybridized to the arrays. We identified 500 and 272 transcripts differentially regulated in CD and UC, respectively. Interesting hits were independently verified by real-time PCR in a second sample of 100 individuals, and immunohistochemistry was used for exemplary localization. The main findings point to novel molecules important in abnormal immune regulation and the highly disturbed cell biology of colonic epithelial cells in IBD pathogenesis, e.g., CYLD (cylindromatosis, turban tumor syndrome and CDH11 (cadherin 11, type 2. By the nature of the array setup, many of the genes identified were to our knowledge previously uncharacterized, and prediction of the putative function of a subsection of these genes indicate that some could be involved in early events in disease pathophysiology. CONCLUSION: A comprehensive set of candidate genes not previously associated with IBD was revealed, which underlines the polygenic and complex nature of the disease. It points out substantial differences in pathophysiology between CD and UC. The multiple unknown genes identified may stimulate new research in the fields of barrier mechanisms and cell signalling in the context of IBD, and ultimately new therapeutic approaches.

  16. Partial VP2 sequencing of canine parvovirus (CPV strains circulating in the state of Rio de Janeiro, Brazil: detection of the new variant CPV-2c

    Directory of Open Access Journals (Sweden)

    T.X. Castro

    2010-12-01

    Full Text Available Canine parvovirus (CPV is the most important enteric virus for dogs and it seems to be undergoing continuous evolution, generating new genetic and antigenic variants throughout the world. The aim of this study was to analyze the distribution of CPV variants from 1995 to 2009 and to investigate the circulation of the new variant CPV-2c in Rio de Janeiro, Brazil. In addition, the clinical features of CPV infection were also reported. After CPV laboratorial confirmation by HA/HI and PCR, thirty-two fecal samples were analyzed by sequencing a 583-bp fragment of the VP2 gene. One sample, collected in 2008 was typed as the new type CPV-2c. All samples from 1995 to 2003 were identified as "new CPV-2a". From 2004 to 2006, both "new CPV-2a" and CPV-2b were observed. From 2006 to 2009, most of the samples were characterized as CPV-2b. The classical signs of CPV enteritis were observed in 16/18 CPV-2a and 5/13 CPV-2b infected puppies. These results show that continuous epidemiological surveillance of CPV strain distribution is essential for studying the patterns of CPV-2a and 2b spread and for determining whether the new variant CPV-2c has become permanently established in Brazilian canine population.

  17. Gastrointestinal expression and partial cDNA cloning of murine Muc2

    NARCIS (Netherlands)

    van Klinken, B. J.; Einerhand, A. W.; Duits, L. A.; Makkink, M. K.; Tytgat, K. M.; Renes, I. B.; Verburg, M.; Büller, H. A.; Dekker, J.

    1999-01-01

    To help us investigate the role of mucin in the protection of the colonic epithelium in the mouse, we aimed to identify the murine colonic mucin (MCM) and its encoding gene. We isolated MCM, raised an anti-MCM antiserum, and studied the biosynthesis of MCM in the gastrointestinal tract. Isolated MCM

  18. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  19. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    International Nuclear Information System (INIS)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki; Ohashi, Yuko; Kano-Murakami, Yuriko; Ozeki, Yoshihiro

    1989-01-01

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M r of its subunit was 77,000. The cells converted [ 14 C]-L-phenylalanine into [ 14 C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading frame capable of coding for a polypeptide with 707 amino acids (M r 77,137), a 22-bp 5'-noncoding region and a 207-bp 3'-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology

  20. cDNA library information - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Dicty_cDB cDNA library information Data detail Data name cDNA library information DOI 10.189...s Data item Description cDNA library name Names of cDNA libraries (AF, AH, CF, CH, FC, FC-IC, FCL, SF, SH, S...(C) 5) sexually fusion-competent KAX3 cells (Gamete phase) (F) cDNA library construction method How to construct cDNA library...dir) 2) Full-length cDNA libraries (oligocapped method)(fl) 3) Gamete-specific subtraction library (sub) cDNA library... construction protocol Link to the webpage describing the protocol for generating cDNA library Size

  1. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae based on 18S ribosomal DNA partial sequences

    Directory of Open Access Journals (Sweden)

    Ana M Xet-Mull

    2004-09-01

    Full Text Available Tagosodes orizicolus Muir (Homoptera: Delphacidae, the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus(YLSTo were purified on Percoll® gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP, showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella furcifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. Rev. Biol. Trop. 52(3: 777-785. Epub 2004 Dic 15.Tagosodes orizicolus Muir (Homoptera: Delphacidae es una especie endémica de América tropical que al igual que otros saltahojas de Asia, tiene simbiontes levaduriformes (YLS, por sus siglas en Inglés en los cuerpos grasos del abdomen y en los tejidos de los ovarios. Los YLS son simbiontes obligados que se transmiten transovarialmente y que mantienen relaciones mutualística con el insecto hospedero. Esta característica ha hecho muy difícil su cultivo in vitro y por ende su clasificaci

  2. Mapping Breakpoints of Complex Chromosome Rearrangements Involving a Partial Trisomy 15q23.1-q26.2 Revealed by Next Generation Sequencing and Conventional Techniques.

    Directory of Open Access Journals (Sweden)

    Qiong Pan

    Full Text Available Complex chromosome rearrangements (CCRs, which are rather rare in the whole population, may be associated with aberrant phenotypes. Next-generation sequencing (NGS and conventional techniques, could be used to reveal specific CCRs for better genetic counseling. We report the CCRs of a girl and her mother, which were identified using a combination of NGS and conventional techniques including G-banding, fluorescence in situ hybridization (FISH and PCR. The girl demonstrated CCRs involving chromosomes 3 and 8, while the CCRs of her mother involved chromosomes 3, 5, 8, 11 and 15. HumanCytoSNP-12 Chip analysis identified a 35.4 Mb duplication on chromosome 15q21.3-q26.2 in the proband and a 1.6 Mb microdeletion at chromosome 15q21.3 in her mother. The proband inherited the rearranged chromosomes 3 and 8 from her mother, and the duplicated region on chromosome 15 of the proband was inherited from the mother. Approximately one hundred genes were identified in the 15q21.3-q26.2 duplicated region of the proband. In particular, TPM1, SMAD6, SMAD3, and HCN4 may be associated with her heart defects, and HEXA, KIF7, and IDH2 are responsible for her developmental and mental retardation. In addition, we suggest that a microdeletion on the 15q21.3 region of the mother, which involved TCF2, TCF12, ADMA10 and AQP9, might be associated with mental retardation. We delineate the precise structures of the derivative chromosomes, chromosome duplication origin and possible molecular mechanisms for aberrant phenotypes by combining NGS data with conventional techniques.

  3. Complementation of the UV-sensitive phenotype of a xeroderma pigmentosum human cell line by transfection with a cDNA clone library

    International Nuclear Information System (INIS)

    Teitz, T.; Naiman, T.; Avissar, S.S.; Bar, S.; Okayama, H.; Canaani, D.

    1987-01-01

    In previous work, a xeroderma pigmentosum cell line belonging to complementation group C was established by transformation with origin-defective simian virus 40. We now report the complementation of the UV sensitivity of this cell line by gene transfer. A human cDNA clone library constructed in a mammalian expression vector, and itself incorporated in a lambda phage vector, was introduced into the cells as a calcium phosphate precipitate. Following selection to G418 resistance, provided by the neo gene of the vector, transformants were selected for UV resistance. Twenty-one cell clones were obtained with UV-resistance levels typical of normal human fibroblasts. All transformants contained vector DNA sequences in their nuclei. Upon further propagation in the absence of selection for G418 resistance, about half of the primary transformants remained UV-resistant. Secondary transformants were generated by transfection with a partial digest of total chromosomal DNA from one of these stable transformants. This resulted in 15 G418-resistant clones, 2 of which exhibited a UV-resistant phenotype. The other primary clones lost UV resistance rapidly when subcultured in the absence of G418. Importantly, several retained UV resistance under G418 selection pressure. The acquisition of UV resistance by secondary transformants derived by transfection of DNA from a stable primary transformant, and the linkage between G418 and UV resistances in the unstable primary transformants, strongly suggests that the transformants acquired UV resistance through DNA-mediated gene transfer and not by reversion

  4. An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

    Directory of Open Access Journals (Sweden)

    Kaur Jatinder

    2010-05-01

    Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

  5. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  6. MOLECULAR CHARACTERIZATION OF ENDOCRINE DISRUPTION IN FISH USING CDNA ARRAYS.

    Science.gov (United States)

    We are developing cDNA macroarrays to measure the induction of gene expression in sheepshead minnows and largemouth bass exposed to anthropogenic chemicals that can mimic the action of endogenous hormones. For sheepshead minnows exposed in aqua, we observed similar genetic profil...

  7. A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

    Science.gov (United States)

    A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

  8. NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

    Science.gov (United States)

    Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

  9. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    Science.gov (United States)

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

  10. Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

    2013-01-01

    Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

  11. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  12. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  13. Human cDNA clones for an α subunit of G/sub i/ signal-transduction protein

    International Nuclear Information System (INIS)

    Bray, P.; Carter, A.; Guo, V.; Puckett, C.; Kamholz, J.; Spiegel, A.; Nirenberg, M.

    1987-01-01

    Two cDNA clones were obtained from a λgt11 cDNA human brain library that correspond to α/sub i/ subunits of G signal-transduction proteins (where α/sub i/ subunits refer to the α subunits of G proteins that inhibit adenylate cyclase). The nucleotide sequence of human brain α/sub i/ is highly homologous to that of bovine brain α/sub i/ and the predicted amino acid sequences are identical. However, human and bovine brain α/sub i/ cDNAs differ significantly from α/sub i/ cDNAs from human monocytes, rat glioma, and mouse macrophages in amino acid (88% homology) and nucleotide (71-75% homology) sequences. In addition, the nucleotide sequences of the 3' untranslated regions of human and bovine brain α/sub i/ cDNAs differ markedly from the sequences of human monocyte, rat glioma, and mouse macrophage α/sub i/ cDNAs. These results suggest there are at least two classes of α/sub i/ mRNA

  14. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  15. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: Evidence for more than one receptor class

    International Nuclear Information System (INIS)

    Gronwald, R.G.K.; Grant, F.J.; Haldeman, B.A.; Hart, C.E.; O'Hara, P.J.; Hagen, F.S.; Ross, R.; Bowen-Pope, D.F.; Murray, M.J.

    1988-01-01

    The complete nucleotide sequence of a cDNA encoding the human platelet-derived growth factor (PDGF) receptor is presented. The cDNA contains an open reading frame that codes for a protein of 1106 amino acids. Comparison to the mouse PDGF receptor reveals an overall amino acid sequence identity of 86%. This sequence identity rises to 98% in the cytoplasmic split tyrosine kinase domain. RNA blot hybridization analysis of poly(A) + RNA from human dermal fibroblasts detects a major and a minor transcript using the cDNA as a probe. Baby hamster kidney cells, transfected with an expression vector containing the receptor cDNA, express an ∼ 190-kDa cell surface protein that is recognized by an anti-human PDGF receptor antibody. The recombinant PDGF receptor is functional in the transfected baby hamster kidney cells as demonstrated by ligand-induced phosphorylation of the receptor. Binding properties of the recombinant PDGF receptor were also assessed with pure preparations of BB and AB isoforms of PDGF. Unlike human dermal fibroblasts, which bind both isoforms with high affinity, the transfected baby hamster kidney cells bind only the BB isoform of PDGF with high affinity. This observation is consistent with the existence of more than one PDGF receptor class

  16. cDNA and deduced primary structure of basic phospholipase A2 with neurotoxic activity from the venom secretion of the Crotalus durissus collilineatus rattlesnake

    Directory of Open Access Journals (Sweden)

    F.H.R. Fagundes

    2010-03-01

    Full Text Available To illustrate the construction of precursor complementary DNAs, we isolated mRNAs from whole venom samples. After reverse transcription polymerase chain reaction (RT-PCR, we amplified the cDNA coding for a neurotoxic protein, phospholipase A2 D49 (PLA2 D49, from the venom of Crotalus durissus collilineatus (Cdc PLA2. The cDNA encoding Cdc PLA2 from whole venom was sequenced. The deduced amino acid sequence of this cDNA has high overall sequence identity with the group II PLA2 protein family. Cdc PLA2 has 14 cysteine residues capable of forming seven disulfide bonds that characterize this group of PLA2 enzymes. Cdc PLA2 was isolated using conventional Sephadex G75 column chromatography and reverse-phase high performance liquid chromatography (RP-HPLC. The molecular mass was estimated using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF mass spectrometry. We tested the neuromuscular blocking activities on chick biventer cervicis neuromuscular tissue. Phylogenetic analysis of Cdc PLA2 showed the existence of two lines of N6-PLA2, denominated F24 and S24. Apparently, the sequences of the New World’s N6-F24-PLA2 are similar to those of the agkistrodotoxin from the Asian genus Gloydius. The sequences of N6-S24-PLA2 are similar to the sequence of trimucrotoxin from the genus Protobothrops, found in the Old World.

  17. The effects of radiation on p53-mutated glioma cells using cDNA microarray technique

    International Nuclear Information System (INIS)

    Ngo, F.Q.H.; Hsiao, Y.-Y.H.

    2003-01-01

    Full text: In this study, we investigated the effects of 10-Gy irradiation on cell-cycle arrest, apoptosis and clonogenic death in the p53-mutated human U138MG (malignant glioblastoma) cell line. In order to evaluate time-dependent events in cellular responses to radiation, we did a time course study by incubating cells ranging from 0.5 to 48 hours after irradiation. Cell-cycle distribution and apoptosis were evaluated by flow cytometry using propidium iodide (PI) and annexin-V plus PI staining. Cell viability and proliferative capacity were studied by colony formation assay. Dual fluorescence cDNA microarray technique was used to examine the differential expression patterns of the irradiated cells. The cDNA microarray chips used contained DNA sequences corresponding to 12,814 human genes. From the flow cytometry data, it can be observed that radiation induced G2/M phase arrest and that late apoptosis was more evident following G2/M arrest. After 36 hours, some cells underwent senescence and the remains continued on with the cell cycle. Microarray analyses revealed changes in the expression of a small number of cell-cycle-related genes (p21, cyclin B1, etc.) and cell-death genes (tumor necrosis factors, DDB2, etc.) suggesting their involvement in radiation-induced cell-cycle arrest and apoptosis. In silico interpretations of the molecular mechanisms responsible for these radiation effects are in progress

  18. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    Science.gov (United States)

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  19. Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

    Science.gov (United States)

    Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

    2017-02-16

    Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

  20. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

    CSIR Research Space (South Africa)

    Van den Berg, N

    2004-11-01

    Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

  1. Partial Cancellation

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Partial Cancellation. Full Cancellation is desirable. But complexity requirements are enormous. 4000 tones, 100 Users billions of flops !!! Main Idea: Challenge: To determine which cross-talker to cancel on what “tone” for a given victim. Constraint: Total complexity is ...

  2. Characterization and sequence analysis of cysteine and glycine-rich ...

    African Journals Online (AJOL)

    Primers specific for CSRP3 were designed using known cDNA sequences of Bos taurus published in database with different accession numbers. Polymerase chain reaction (PCR) was performed and products were purified and sequenced. Sequence analysis and alignment were carried out using CLUSTAL W (1.83).

  3. cDNA - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ontents List of cDNA in locus Data file File name: astra_cdna.zip File URL: ftp://ftp.biosciencedbc.jp/archive/astra/LATEST/astra_cdn...a.zip File size: 3.3 MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/astra_cdna...n, Department of Molecular Genetics, National Institute of Agrobiological Sciences (Kikuchi et al., 2003; ftp://cdna

  4. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Transcriptome sequencing of the blind subterranean mole rat, Spalax galili: Utility and potential for the discovery of novel evolutionary patterns

    KAUST Repository

    Malik, Assaf; Korol, Abraham; Hü bner, Sariel; Hernandez, Alvaro G.; Thimmapuram, Jyothi; Ali, Shahjahan; Glaser, Fabian; Paz, Arnon; Avivi, Aaron; Band, Mark

    2011-01-01

    sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly

  6. Partial processing

    International Nuclear Information System (INIS)

    1978-11-01

    This discussion paper considers the possibility of applying to the recycle of plutonium in thermal reactors a particular method of partial processing based on the PUREX process but named CIVEX to emphasise the differences. The CIVEX process is based primarily on the retention of short-lived fission products. The paper suggests: (1) the recycle of fission products with uranium and plutonium in thermal reactor fuel would be technically feasible; (2) it would, however, take ten years or more to develop the CIVEX process to the point where it could be launched on a commercial scale; (3) since the majority of spent fuel to be reprocessed this century will have been in storage for ten years or more, the recycling of short-lived fission products with the U-Pu would not provide an effective means of making refabrication fuel ''inaccessible'' because the radioactivity associated with the fission products would have decayed. There would therefore be no advantage in partial processing

  7. Partial gigantism

    Directory of Open Access Journals (Sweden)

    М.М. Karimova

    2017-05-01

    Full Text Available A girl with partial gigantism (the increased I and II fingers of the left foot is being examined. This condition is a rare and unresolved problem, as the definite reason of its development is not determined. Wait-and-see strategy is recommended, as well as correcting operations after closing of growth zones, and forming of data pool for generalization and development of schemes of drug and radial therapeutic methods.

  8. Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

    Directory of Open Access Journals (Sweden)

    NED A SETAYESH

    2009-01-01

    Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

  9. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    Science.gov (United States)

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  10. ISOLASI cDNA SUCROSE TRANSPORTER (SUT DARI BATANG TANAMAN TEBU (Saccharum officinarum L.

    Directory of Open Access Journals (Sweden)

    - Slameto

    2010-09-01

    Full Text Available Sucrose Transporter (SUT is kind of protein transporter that control in sucrose translocation. Sucrose Transporter is intermediate in translocation of sucrose from apoplasmic to simplasmic. SUT facilitates sucrose transportation from vascular tissues to parenchyma cells toward in node sugarcane stem. This research was purposed to isolate cDNA SUT from sugarcane stem, and cloned in Escherichia coli strain DH5α. Total RNA of sugarcane stem was isolated by single step method, then add with oligo dT in order to obtain the first strand of SUT cDNA then used as template for PCR. The primer used for PCR is 5’ –ggg ctg att gtg gcc atg tc- ‘3 (SUT-F and 5’ –tgc cct ttg tct ccg gaa cc- ‘3 (SUT-R. PCR was programmed as follow denaturation at 94°C for 2 minutes and 30 second, annealing at 54°C for 30 s, extension at 72°C 2 min and 7 min, and storage at 4°C for unlimited, It was for 30 cycles. Complementary DNA SUT from PCR ligalized to pTOPO bunt-end, then it cloned in to E. coli strain DH5α. The cloning resulted then be sequenced in order to observe the homologues with other nucleotides sequences of some plant using BLASTn program in GENE BANK NCBI and the level of homology determined by Genetyx program. The concentrated of total RNA isolated was 5,024 μg/μl, with purity of 1,85. Complementary DNA SUT fragment from PCR with size 2037 bp appropriated to the both of primer was used. Complementary DNA SUT fragment showed by analyzed some of restriction enzyme e.g. EcoRI, PstI and BamHI. Homologues of this cDNA SUT fragment was 100% to SoSUT 2A of sugarcane stem and 84% to OsSUT of rice plant (Casu et al ., 2003.

  11. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  12. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    Science.gov (United States)

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  13. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

    International Nuclear Information System (INIS)

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-01-01

    An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

  14. Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

    Science.gov (United States)

    Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

    2017-07-15

    This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

    Science.gov (United States)

    Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

    1992-04-01

    This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

  16. Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

    Science.gov (United States)

    Yi, S Y; Yu, S H; Choi, D

    1999-06-30

    Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

  17. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  18. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  19. Methods to determine the transcriptomes of trypanosomes in mixtures with mammalian cells: the effects of parasite purification and selective cDNA amplification.

    Directory of Open Access Journals (Sweden)

    Julius Mulindwa

    2014-04-01

    Full Text Available Patterns of gene expression in cultured Trypanosoma brucei bloodstream and procyclic forms have been extensively characterized, and some comparisons have been made with trypanosomes grown to high parasitaemias in laboratory rodents. We do not know, however, to what extent these transcriptomes resemble those in infected Tsetse flies - or in humans or cattle, where parasitaemias are substantially lower. For clinical and field samples it is difficult to characterize parasite gene expression because of the large excess of host cell RNA. We have here examined two potential solutions to this problem for bloodstream form trypanosomes, assaying transcriptomes by high throughput cDNA sequencing (RNASeq. We first purified the parasites from blood of infected rats. We found that a red blood cell lysis procedure affected the transcriptome substantially more than purification using a DEAE cellulose column, but that too introduced significant distortions and variability. As an alternative, we specifically amplified parasite sequences from a mixture containing a 1000-fold excess of human RNA. We first purified polyadenylated RNA, then made trypanosome-specific cDNA by priming with a spliced leader primer. Finally, the cDNA was amplified using nested primers. The amplification procedure was able to produce samples in which 20% of sequence reads mapped to the trypanosome genome. Synthesis of the second cDNA strand with a spliced leader primer, followed by amplification, is sufficiently reproducible to allow comparison of different samples so long as they are all treated in the same way. However, SL priming distorted the abundances of the cDNA products and definitely cannot be used, by itself, to measure absolute mRNA levels. The amplification method might be suitable for clinical samples with low parasitaemias, and could also be adapted for other Kinetoplastids and to samples from infected vectors.

  20. In Situ Dark Adaptation Enhances the Efficiency of DNA Extraction from Mature Pin Oak (Quercus palustris Leaves, Facilitating the Identification of Partial Sequences of the 18S rRNA and Isoprene Synthase (IspS Genes

    Directory of Open Access Journals (Sweden)

    Csengele E. Barta

    2017-10-01

    Full Text Available Mature oak (Quercus spp. leaves, although abundantly available during the plants’ developmental cycle, are rarely exploited as viable sources of genomic DNA. These leaves are rich in metabolites difficult to remove during standard DNA purification, interfering with downstream molecular genetics applications. The current work assessed whether in situ dark adaptation, to deplete sugar reserves and inhibit secondary metabolite synthesis could compensate for the difficulties encountered when isolating DNA from mature leaves rich in secondary metabolites. We optimized a rapid, commercial kit based method to extract genomic DNA from dark- and light-adapted leaves. We demonstrated that in situ dark adaptation increases the yield and quality of genomic DNA obtained from mature oak leaves, yielding templates of sufficiently high quality for direct downstream applications, such as PCR amplification and gene identification. The quality of templates isolated from dark-adapted pin oak leaves particularly improved the amplification of larger fragments in our experiments. From DNA extracts prepared with our optimized method, we identified for the first time partial segments of the genes encoding 18S rRNA and isoprene synthase (IspS from pin oak (Quercus palustris, whose full genome has not yet been sequenced.

  1. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    Science.gov (United States)

    Ares, Manuel

    2014-01-01

    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  2. Partial volume effect in MRI

    International Nuclear Information System (INIS)

    Maeda, Munehiro; Yoshiya, Kazuhiko; Suzuki, Eiji

    1989-01-01

    According to the direction and the thickness of the imaging slice in tomography, the border between the tissues becomes unclear (partial volume effect). In the present MRI experiment, we examined border area between fat and water components using phantom in order to investigate the partial volume effect in MRI. In spin echo sequences, the intensity of the border area showed a linear relationship with composition of fat and water. Whereas, in inversion recovery and field echo sequences, we found the parameters to produce an extremely low intensity area at the border region between fat and water. This low intensity area was explained by cancellation of NMR signals from fat and water due to the difference in the direction of magnetic vectors. Clinically, partial volume effect can cause of mis-evaluation of walls, small nodules, tumor capsules and the tumor invasion in the use of inversion recovery and field echo sequences. (author)

  3. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.

    1989-01-01

    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  4. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

    Science.gov (United States)

    Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

    2001-01-01

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

  5. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

    Science.gov (United States)

    Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

    2001-10-09

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

  6. Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

    NARCIS (Netherlands)

    Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

    2000-01-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

  7. Thermodynamic properties of peptide solutions 20. Partial molar volumes and isothermal compressions for some tripeptides of sequence gly-X-gly (X = gly, ala, leu, asn, thr, and tyr) in aqueous solution at T = 298.15 K and p = (10–120) MPa

    International Nuclear Information System (INIS)

    Hedwig, Gavin R.; Høiland, Harald

    2016-01-01

    Highlights: • Sound speeds were measured for aqueous solutions of some tripeptides at high pressures. • Partial molar volumes and isothermal compressions were derived for T = 298.15 K and p = (10–120) MPa. • The partial molar volumes for non-polar amino acid side-chains decrease with increasing pressure. • The partial molar volumes for polar side-chains do not change significantly with increasing pressure. - Abstract: Sound speeds have been measured for aqueous solutions of six tripeptides of sequence glycyl-X-glycine, where X is one of the amino acids glycine, alanine, leucine, asparagine, threonine, and tyrosine at T = 298.15 K and at the pressures p = (10, 20, 40, 60, 80, 100, and 120) MPa. Using methods described in previous work, these sound speeds were used to derive the partial molar volumes at infinite dilution, V_2"o, the partial molar isentropic compressions at infinite dilution, K_S_,_2"o, and the partial molar isothermal compressions at infinite dilution, K"o_T_,_2 {K"o_T_,_2 = −(∂V_2"o/∂p)_T}, for the tripeptides in aqueous solution at the elevated pressures. The results were used to calculate the partial molar volumes and partial molar isothermal compressions for the various amino acid side-chains over the pressure range p = (10–120) MPa.

  8. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  9. A cDNA microarray, UniShrimpChip, for identification of genes relevant to testicular development in the black tiger shrimp (Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Klinbunga Sirawut

    2011-04-01

    Full Text Available Abstract Background Poor reproductive maturation in captive male broodstock of the black tiger shrimp (Penaeus monodon is one of the serious problems to the farming industries. Without genome sequence, EST libraries of P. monodon were previously constructed to identify transcripts with important biological functions. In this study, a new version of cDNA microarray, UniShrimpChip, was constructed from the Peneaus monodon EST libraries of 12 tissues, containing 5,568 non-redundant cDNA clones from 10,536 unique cDNA in the P. monodon EST database. UniShrimpChip was used to study testicular development by comparing gene expression levels of wild brooders from the West and East coasts of Thailand and domesticated brooders with different ages (10-, 14-, 18-month-old. Results The overall gene expression patterns from the microarray experiments revealed distinct transcriptomic patterns between the wild and domesticated groups. Moreover, differentially expressed genes from the microarray comparisons were identified, and the expression patterns of eight selected transcripts were subsequently confirmed by reverse-transcriptase quantitative PCR (RT-qPCR. Among these, expression levels of six subunits (CSN2, 4, 5, 6, 7a, and 8 of the COP9 signalosome (CSN gene family in wild and different ages of domesticated brooders were examined by RT-qPCR. Among the six subunits, CSN5 and CSN6 were most highly expressed in wild brooders and least expressed in the 18-month-old domesticated group; therefore, their full-length cDNA sequences were characterized. Conclusions This study is the first report to employ cDNA microarray to study testicular development in the black tiger shrimp. We show that there are obvious differences between the wild and domesticated shrimp at the transcriptomic level. Furthermore, our study is the first to investigate the feasibility that the CSN gene family might have involved in reproduction and development of this economically important

  10. Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L. Taub

    Directory of Open Access Journals (Sweden)

    Dixon Richard A

    2007-11-01

    Full Text Available Abstract Background Guar, Cyamopsis tetragonoloba (L. Taub, is a member of the Leguminosae (Fabaceae family and is economically the most important of the four species in the genus. The endosperm of guar seed is a rich source of mucilage or gum, which forms a viscous gel in cold water, and is used as an emulsifier, thickener and stabilizer in a wide range of foods and industrial applications. Guar gum is a galactomannan, consisting of a linear (1→4-β-linked D-mannan backbone with single-unit, (1→6-linked, α-D-galactopyranosyl side chains. To better understand regulation of guar seed development and galactomannan metabolism we created cDNA libraries and a resulting EST dataset from different developmental stages of guar seeds. Results A database of 16,476 guar seed ESTs was constructed, with 8,163 and 8,313 ESTs derived from cDNA libraries I and II, respectively. Library I was constructed from seeds at an early developmental stage (15–25 days after flowering, DAF, and library II from seeds at 30–40 DAF. Quite different sets of genes were represented in these two libraries. Approximately 27% of the clones were not similar to known sequences, suggesting that these ESTs represent novel genes or may represent non-coding RNA. The high flux of energy into carbohydrate and storage protein synthesis in guar seeds was reflected by a high representation of genes annotated as involved in signal transduction, carbohydrate metabolism, chaperone and proteolytic processes, and translation and ribosome structure. Guar unigenes involved in galactomannan metabolism were identified. Among the seed storage proteins, the most abundant contig represented a conglutin accounting for 3.7% of the total ESTs from both libraries. Conclusion The present EST collection and its annotation provide a resource for understanding guar seed biology and galactomannan metabolism.

  11. Infectious Maize rayado fino virus from Cloned cDNA.

    Science.gov (United States)

    Edwards, Michael C; Weiland, John J; Todd, Jane; Stewart, Lucy R

    2015-06-01

    A full-length cDNA clone was produced from a U.S. isolate of Maize rayado fino virus (MRFV), the type member of the genus Marafivirus within the family Tymoviridae. Infectivity of transcripts derived from cDNA clones was demonstrated by infection of maize plants and protoplasts, as well as by transmission via the known leafhopper vectors Dalbulus maidis and Graminella nigrifrons that transmit the virus in a persistent-propagative manner. Infection of maize plants through vascular puncture inoculation of seed with transcript RNA resulted in the induction of fine stipple stripe symptoms typical of those produced by wild-type MRFV and a frequency of infection comparable with that of the wild type. Northern and Western blotting confirmed the production of MRFV-specific RNAs and proteins in infected plants and protoplasts. An unanticipated increase in subgenomic RNA synthesis over levels in infected plants was observed in protoplasts infected with either wild-type or cloned virus. A conserved cleavage site motif previously demonstrated to function in both Oat blue dwarf virus capsid protein and tymoviral nonstructural protein processing was identified near the amino terminus of the MRFV replicase polyprotein, suggesting that cleavage at this site also may occur.

  12. In vitro and in silico cloning of Xenopus laevis SOD2 cDNA and its phylogenetic analysis.

    Science.gov (United States)

    Purrello, Michele; Di Pietro, Cinzia; Ragusa, Marco; Pulvirenti, Alfredo; Giugno, Rosalba; Di Pietro, Valentina; Emmanuele, Giovanni; Travali, Salvo; Scalia, Marina; Shasha, Dennis; Ferro, Alfredo

    2005-02-01

    By using the methodology of both wet and dry biology (i.e., RT-PCR and cycle sequencing, and biocomputational technology, respectively) and the data obtained through the Genome Projects, we have cloned Xenopus laevis SOD2 (MnSOD) cDNA and determined its nucleotide sequence. These data and the deduced protein primary structure were compared with all the other SOD2 nucleotide and amino acid sequences from eukaryotes and prokaryotes, published in public databases. The analysis was performed by using both Clustal W, a well known and widely used program for sequence analysis, and AntiClustAl, a new algorithm recently created and implemented by our group. Our results demonstrate a very high conservation of the enzyme amino acid sequence during evolution, which proves a close structure-function relationship. This is to be expected for very ancient molecules endowed with critical biological functions, performed through a specific structural organization. The nucleotide sequence conservation is less pronounced: this too was foreseeable, due to neutral mutations and to the species-specific codon usage. The data obtained by using AntiClustAl are comparable with those produced with Clustal W, which validates this algorithm as an important new tool for biocomputational analysis. Finally, it is noteworthy that evolutionary trees, drawn by using all the available data on SOD2 nucleotide sequences and amino acid and either Clustal W or AntiClustAl, are comparable to those obtained through phylogenetic analysis based on fossil records.

  13. Cloning of the γ-aminobutyric acid (GABA) ρ1 cDNA: A GABA receptor subunit highly expressed in the retina

    International Nuclear Information System (INIS)

    Cutting, G.R.; Lu, Luo; Kasch, L.M.; Montrose-Rafizadeh, C.; Antonarakis, S.E.; Guggino, W.B.; Kazazian, H.H. Jr.; O'Hara, B.F.; Donovan, D.M.; Shimada, Shoichi; Uhl, G.R.

    1991-01-01

    Type A γ-aminobutyric acid (GABA A ) receptors are a family of ligand-gated chloride channels that are the major inhibitory neurotransmitter receptors in the nervous system. Molecular cloning has revealed diversity in the subunits that compose this heterooligomeric receptor, but each previously elucidated subunit displays amino acid similarity in conserved structural elements. The authors have used these highly conserved regions to identify additional members of this family by using the polymerase chain reaction (PCR). One PCR product was used to isolate a full-length cDNA from a human retina cDNA library. The mature protein predicted from this cDNA sequence is 458 amino acids long and displays between 30 and 38% amino acid similarity to the previously identified GABA A subunits. This gene is expressed primarily in the retina but transcripts are also detected in the brain, lung, and thymus. Injection of Xenopus oocytes with RNA transcribed in vitro produces a GABA-responsive chloride conductance and expression of the cDNA in COS cells yields GABA-displaceable muscimol binding. These features are consistent with our identification of a GABA subunit, GABA ρ 1 , with prominent retinal expression that increases the diversity and tissue specificity of this ligand-gated ion-channel receptor family

  14. Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

    Science.gov (United States)

    Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

    2000-03-01

    The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

  15. Molecular cloning of a cDNA and chromosomal localization of a human theta-class glutathione S-transferase gene (GSTT2) to chromosome 22

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.L.; Baker, R.T.; Board, P.G. [Australian National Univ., Canberra (Australia)] [and others

    1995-01-20

    Until recently the Theta-class glutathione S-transferases (GSTs) were largely overlooked due to their low activity with the model substrate 1-chloro-2,4-dinitrobenzene (CDNB) and their failure to bind to immobilized glutathione affinity matrices. Little is known about the number of genes in this class. Recently, Pemble et al. reported the cDNA cloning of a human Theta-class GST, termed GSTT1. In this study, we describe the molecular cloning of a cDNA encoding a second human Theta-class GST (GSTT2) from a {lambda}gt11 human liver 5{prime}-stretch cDNA library. The encoded protein contains 244 amino acids and has 78.3% sequence identity with the rat subunit 12 and only 55.0% identity with human GSTT1. GSTT2 has been mapped to chromosome 22 by somatic cell hybrid analysis. The precise position of the gene was localized to subband 22q11.2 by in situ hybridization. The absence of other regions of hybridization suggests that there are no closely related sequences (e.g., reverse transcribed pseudogenes) scattered throughout the genome and that if there are closely related genes, they must be clustered near GSTT2. Southern blot analysis of human DNA digested with BamHI shows that the size of the GSTT2 gene is relatively small, as the coding sequence falls within a 3.6-kb BamHI fragment. 35 refs., 6 figs.

  16. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    Science.gov (United States)

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  17. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    Science.gov (United States)

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  18. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    Science.gov (United States)

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  19. FATHEAD MINNOW VITELLOGENIN: CDNA SEQUENCE AND MRNA AND PROTEIN EXPRESSION AFTER 17 BETA-ESTRADIOL TREATMENT

    Science.gov (United States)

    In the present study, a sensitive ribonuclease protection assay (RPA) for VTG mRNA was developed for the fathead minnow (Pimephales promelas), a species proposed for routine endocrine-disrupting chemical (EDC) screening.

  20. ASSESSMENT OF CLONE IDENTITY AND SEQUENCE FIDELITY FOR 1189 IMAGE CDNA CLONES. (R827402)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  1. Download - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  2. Database Description - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Frontier Sciences, The University of Tokyo(when creating) Creator Name: Takashi ...ating) Contact address GSFS - CB-06, Transdisciplinary Sciences, The University of ...Ito* Creator Affiliation: Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo(when cre

  3. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas; Tay, Boon-Hui; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa

    2009-01-01

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a

  4. Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

    Science.gov (United States)

    Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

    2002-07-01

    In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

  5. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    Science.gov (United States)

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  6. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  7. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Directory of Open Access Journals (Sweden)

    Alamar Santiago

    2009-09-01

    Full Text Available Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new

  8. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Science.gov (United States)

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an

  9. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  10. Functional cloning using pFB retroviral cDNA expression libraries.

    Science.gov (United States)

    Felts, Katherine A; Chen, Keith; Zaharee, Kim; Sundar, Latha; Limjoco, Jamie; Miller, Anna; Vaillancourt, Peter

    2002-09-01

    Retroviral cDNA expression libraries allow the efficient introduction of complex cDNA libraries into virtually any mitotic cell type for screening based on gene function. The cDNA copy number per cell can be easily controlled by adjusting the multiplicity of infection, thus cell populations may be generated in which >90% of infected cells contain one to three cDNAs. We describe the isolation of two known oncogenes and one cell-surface receptor from a human Burkitt's lymphoma (Daudi) cDNA library inserted into the high-titer retroviral vector pFB.

  11. A secreted aspartic proteinase from Glomerella cingulata: purification of the enzyme and molecular cloning of the cDNA.

    Science.gov (United States)

    Clark, S J; Templeton, M D; Sullivan, P A

    1997-04-01

    A secreted aspartic proteinase from Glomerella cingulata (GcSAP) was purified to homogeneity by ion exchange chromatography. The enzyme has an M, of 36000 as estimated by SDS-PAGE, optimal activity from pH 3.5 to pH 4.0 and is inhibited by pepstatin. The N-terminal sequence, 23 residues long, was used to design a gene-specific primer. This was used in 3' RACE (rapid amplification of cDNA ends) PCR to amplify a 1.2 kb fragment of the gcsap cDNA. A second gene-specific primer was designed and used in 5' RACE PCR to clone the 5' region. This yielded a 600 bp DNA fragment and completed the open reading frame. The gcsap open reading frame encodes a protein with a 78 residue prepro-sequence typical of other fungal secreted aspartic proteinases. Based on the deduced sequence, the mature enzyme contains 329 amino acids and shows approximately 40% identity to other fungal aspartic proteinases. Subsequent cloning and sequencing of gcsap fragments obtained from PCR with genomic DNA revealed a 73 bp intron beginning at nt 728. Southern analyses at medium and high stringency indicated that G. cingulata possesses one gene for the secreted aspartic proteinase, and Northern blots indicated that gene expression was induced by exogenous protein and repressed by ammonium salts. GcSAP is a putative pathogenicity factor of G. cingulata, and it will now be possible to create SAP-mutants and assess the role GcSAP plays in pathogenicity.

  12. KARAKTERISTIK SEKUEN cDNA PENGKODE GEN ANTI VIRUS DARI UDANG WINDU, Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Andi Parenrengi

    2016-11-01

    Full Text Available Transgenesis pada ikan merupakan sebuah teknik modern yang berpotensi besar dalam menghasilkan organisme yang memiliki karakter lebih baik melalui rekombinan DNA gen target termasuk gen anti virus dalam peningkatan resistensi pada udang. Gen anti virus PmAV (Penaeus monodon Anti Viral gene merupakan salah satu gen pengkode anti virus yang berasal dari spesies krustase. Penelitian ini dilakukan untuk mengetahui karakteristik gen anti virus yang diisolasi dari udang windu, Penaeus monodon. Isolasi gen anti virus menggunakan metode Polymerase Chain Reaction (PCR dan selanjutnya dipurifikasi untuk sekuensing. Data yang dihasilkan dianalisis dengan program Genetyx Versi 7 dan basic local alignment search tool (BLAST. Hasil penelitian menunjukkan bahwa gen anti virus PmAV yang berhasil diisolasi dari cDNA udang windu dengan panjang sekuen 520 bp yang mengkodekan 170 asam amino. BLAST-N menunjukkan tingkat similaritas yang sangat tinggi (100% dengan gen anti virus yang ada di GeneBank. Komposisi asam amino penyusun gen anti virus yang paling besar adalah serin (10,00%, sedangkan yang terkecil adalah asam amino prolin dan lisin masing-masing 1,76%. Analisis sekuen gen dan deduksi asam amino (BLAST-P memperlihatkan adanya C-type lectin-like domain (CTLD yang memiliki kemiripan dengan gen C-type lectin yang diisolasi dari beberapa spesies krustase. Transgenic fish technology is a potential modern technique in producing better character organism through DNA recombinant of target genes including anti viral gene for improvement of shrimp immunity. PmAV (Penaeus monodon Anti Viral gene is one of anti viral genes isolated from crustacean species. The research was conducted to analyze the characteristics anti viral gene isolated from tiger prawn, Penaeus monodon. Anti viral gene was isolated using Polymerase Chain Reaction (PCR technique and then purified for sequencing. Data obtained were analyzed using Genetyx Version 7 software and basic local alignment

  13. Identification and complete sequencing of novel human transcripts through the use of mouse orthologs and testis cDNA sequences

    DEFF Research Database (Denmark)

    Ferreira, Elisa N; Pires, Lilian C; Parmigiani, Raphael B

    2004-01-01

    The correct identification of all human genes, and their derived transcripts, has not yet been achieved, and it remains one of the major aims of the worldwide genomics community. Computational programs suggest the existence of 30,000 to 40,000 human genes. However, definitive gene identification ...

  14. Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

    Science.gov (United States)

    Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2015-02-02

    Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Peptidomics combined with cDNA library unravel the diversity of centipede venom

    DEFF Research Database (Denmark)

    Rong, Mingqiang; Yang, Shilong; Wen, Bo

    2015-01-01

    of centipede venom. In the present study, we use peptidomics combined with cDNA library to uncover the diversity of centipede Scolopendra subspinipes mutilans L. Koch. 192 peptides were identified by LC-MS/MS and 79 precursors were deduced by cDNA library. Surprisingly, the signal peptides of centipede toxins...

  16. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    In order to screen and isolate secondary metabolite biosynthesis related gene, we construct a cDNA library of white flower Salvia miltiorrhiza bge. f.alba. High quality of total RNA was successfully isolated from roots of white flower S. miltiorrhiza using modified CTAB method. Double strand cDNA was cloned into pDNR-LIB ...

  17. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    Science.gov (United States)

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  18. The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

    NARCIS (Netherlands)

    Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

    2002-01-01

    The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

  19. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    Science.gov (United States)

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  20. Molecular cloning of cDNA for the human tumor-associated antigen CO-029 and identification of related transmembrane antigens

    International Nuclear Information System (INIS)

    Szala, S.; Kasai, Yasushi; Steplewski, Z.; Rodeck, U.; Koprowski, H.; Linnenbach, A.J.

    1990-01-01

    The human tumor-associated antigen CO-029 is a monoclonal antibody-defined cell surface glycoprotein of 27-34 kDa. By using the high-efficiency COS cell expression system, a full-length cDNA clone for CO-029 was isolated. When transiently expressed in COS cells, the cDNA clone directed the synthesis of an antigen reactive to monoclonal antibody CO-029 in mixed hemadsorption and immunoblot assays. Sequence analysis revealed that CO-029 belongs to a family of cell surface antigens that includes the melanoma-associated antigen ME491, the leukocyte cell surface antigen CD37, and the Sm23 antigen of the parasitic helminth Schistosoma mansoni. CO-029 and ME491 antigen expression and the effect of their corresponding monoclonal antibodies on cell growth were compared in human tumor cell lines of various histologic origins

  1. Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

    Science.gov (United States)

    Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

    2002-04-01

    Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

  2. Purification, cDNA cloning and modification of a defensin from the coconut rhinoceros beetle, Oryctes rhinoceros.

    Science.gov (United States)

    Ishibashi, J; Saido-Sakanaka, H; Yang, J; Sagisaka, A; Yamakawa, M

    1999-12-01

    A novel member of the insect defensins, a family of antibacterial peptides, was purified from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros, immunized with Escherichia coli. A full-size cDNA was cloned by combining reverse-transcription PCR (RT-PCR), and 5'- and 3'-rapid amplification of cDNA ends (RACE). Analysis of the O. rhinoceros defensin gene expression showed it to be expressed in the fat body and hemocyte, midgut and Malpighian tubules. O. rhinoceros defensin showed strong antibacterial activity against Staphylococcus aureus. A 9-mer peptide amidated at its C-terminus, AHCLAICRK-NH2 (Ala22-Lys30-NH2), was synthesized based on the deduced amino-acid sequence, assumed to be an active site sequence by analogy with the sequence of a defensin isolated from larvae of the beetle Allomyrina dichotoma. This peptide showed antibacterial activity against S. aureus, methicillin-resistant S. aureus, E. coli and Pseudomonas aeruginosa. We further modified this oligopeptide and synthesized five 9-mer peptides, ALRLAIRKR-NH2, ALLLAIRKR-NH2, AWLLAIRKR-NH2, ALYLAIRKR-NH2 and ALWLAIRKR-NH2. These oligopeptides showed strong antibacterial activity against Gram-negative and Gram-positive bacteria. The antibacterial effect of Ala22-Lys30-NH2 analogues was due to its interaction with bacterial membranes, judging from the leakage of liposome-entrapped glucose. These Ala22-Lys30-NH2 analogues did not show haemolytic activity and did not inhibit the growth of murine fibroblast cells or macrophages, except for AWLLAIRKR-NH2.

  3. Identification of cDNA clones expressing immunodiagnostic antigens from Trichinella spiralis

    International Nuclear Information System (INIS)

    Zarlenga, D.; Gamble, H.R.

    1987-01-01

    A cDNA expression library was built in lambda gt11 phage using poly A mRNA isolated from Trichinella spiralis muscle stage larvae. This library was screened with rabbit antibodies to parasite excretory-secretory (ES) products and greater than 180 clones were isolated. Thirteen clones producing highly immunogenic protein antigens were plaque purified and rescreened with pig antisera to T.spiralis, Trichuris suis or Ascaris suum to identify clones producing epitopes specific to T.spiralis ES products, only. Two clones, TsAc-2 and TsAc-8, which displayed strong interactions with pig antisera to T. spiralis were lysogenized in E. coli Y1089 and the protein extracted. Western blots of the crude fusion proteins revealed molecular weights of 133 kD and 129 kD, respectively. Northern blot analysis of total RNA with 32 P labelled cDNA:lambda gt11 probes indicated single RNA transcripts for each clone with molecular sizes corresponding to 800-850 nucleotides. dscDNA inserts were estimated by southern blot analysis to be 500 bp and 340 bp, respectively, with no cross-hybridization observed between the cloned sequences. Dot blots using pig sera to screen crude fusion protein preparations, total bacterial protein (negative controls) and crude worm extract or ES products from T.spiralis, T.suis and A.suum (positive controls) corroborated the specificity and sensitivity of these clones as potential diagnostic antigens for swine trichinellosis

  4. cDNA cloning and mRNA expression of cat and dog Cdkal1

    Directory of Open Access Journals (Sweden)

    Sako T

    2012-08-01

    Full Text Available Ichiro Yamamoto, Shingo Ishikawa, Li Gebin, Hiroshi Takemitsu, Megumi Fujiwara, Nobuko Mori, Yutaka Hatano, Tomoko Suzuki, Akihiro Mori, Nobuhiro Nakao, Koh Kawasumi, Toshinori Sako, Toshiro AraiLaboratory of Veterinary Biochemistry, Nippon Veterinary and Life Science University, Tokyo, JapanAbstract: The cyclin-dependent kinase 5 regulatory subunit–associated protein 1–like 1 (CDKAL1 gene encodes methylthiotransferase, and the gene contains risk variants for type 2 diabetes in humans. In this study, we performed complementary DNA cloning for Cdkal1 in the cat and dog and characterized the tissue expression profiles of its messenger RNA. Cat and dog Cdkal1 complementary DNA encoded 576 and 578 amino acids, showing very high sequence homology to mammalian CDKAL1 (>88.4%. Real-time polymerase chain reaction analyses revealed that Cdkal1 messenger RNA is highly expressed in smooth muscle and that tissue distribution of Cdkal1 is similar in cats and dogs. Genotyping analysis of single-nucleotide polymorphism for cat Cdkal1 revealed that obese cats had different tendencies from normal cats. These findings suggest that the cat and dog Cdkal1 gene is highly conserved among mammals and that cat Cdkal1 may be a candidate marker for genetic diagnosis of obesity.Keywords: cat, dog, Cdkal1, obese, cDNA cloning, Q-PCR

  5. cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yamamura, Saburo; Koiwa, Hiroyuki; Nishihara, Masashiro; Sandmann, Gerhard

    2002-02-01

    All cDNAs involved in carotenoid biosynthesis leading to lycopene in yellow petals of Gentiana lutea have been cloned from a cDNA library. They encode a geranylgeranyl pyrophosphate synthase, a phytoene synthase, a phytoene desaturase and a zeta-carotene desaturase. The indicated function of all cDNAs was established by heterologous complementation in Escherichia coli. The amino acid sequences deduced from the cDNAs were between 47.5% and 78.9% identical to those reported for the corresponding enzymes from other higher plants. Southern analysis suggested that the genes for each enzyme probably represent a small multi-gene family. Tissue-specific expression of the genes and expression during flower development was investigated. The expression of the phytoene synthase gene, psy, was enhanced in flowers but transcripts were not detected in stems and leaves by northern blotting. Transcripts of the genes for geranylgeranyl pyrophosphate (ggpps), phytoene desaturase (pds) and zeta-carotene desaturase (zds) were detected in flowers and leaves but not in stems. Analysis of the expression of psy and zds in petals revealed that levels of the transcripts were lowest in young buds and highest in fully open flowers, in parallel with the formation of carotenoids. Obviously, the transcription of these genes control the accumulation of carotenoids during flower development in G. lutea. For pds only a very slight increase of mRNA was found whereas the transcripts of ggpps decreased during flower development.

  6. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  7. Next generation sequencing (NGS)technologies and applications

    Energy Technology Data Exchange (ETDEWEB)

    Vuyisich, Momchilo [Los Alamos National Laboratory

    2012-09-11

    NGS technology overview: (1) NGS library preparation - Nucleic acids extraction, Sample quality control, RNA conversion to cDNA, Addition of sequencing adapters, Quality control of library; (2) Sequencing - Clonal amplification of library fragments, (except PacBio), Sequencing by synthesis, Data output (reads and quality); and (3) Data analysis - Read mapping, Genome assembly, Gene expression, Operon structure, sRNA discovery, and Epigenetic analyses.

  8. Molecular cloning of a cysteine proteinase cDNA from the cotton boll weevil Anthonomus grandis (Coleoptera: Curculionidae).

    Science.gov (United States)

    De Oliveira Neto, Osmundo Brilhante; Batista, João Aguiar Nogueira; Rigden, Daniel John; Franco, Octávio Luiz; Fragoso, Rodrigo Rocha; Monteiro, Ana Carolina Santos; Monnerat, Rose Gomes; Grossi-De-Sa, Maria Fátima

    2004-06-01

    The cotton boll weevil (Anthonomus grandis) causes severe cotton crop losses in North and South America. This report describes the presence of cysteine proteinase activity in the cotton boll weevil. Cysteine proteinase inhibitors from different sources were assayed against total A. grandis proteinases but, unexpectedly, no inhibitor tested was particularly effective. In order to screen for active inhibitors against the boll weevil, a cysteine proteinase cDNA (Agcys1) was isolated from A. grandis larvae using degenerate primers and rapid amplification of cDNA ends (RACE) techniques. Sequence analysis showed significant homologies with other insect cysteine proteinases. Northern blot analysis indicated that the mRNA encoding the proteinase was transcribed mainly in the gut of larvae. No mRNA was detected in neonatal larvae, pupae, or in the gut of the adult insect, suggesting that Agcys1 is an important cysteine proteinase for larvae digestion. The isolated gene will facilitate the search for highly active inhibitors towards boll weevil larvae that may provide a new opportunity to control this important insect pest.

  9. Human beta 2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    DEFF Research Database (Denmark)

    Wewer, U M; Gerecke, D R; Durkin, M E

    1994-01-01

    or other known laminin genes. Immunostaining showed that the beta 2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous beta 1 chain is confined to the subendothelial basement membranes. The beta 2 chain was found in the basement membranes of ovarian carcinomas......Overlapping cDNA clones that encode the full-length human laminin beta 2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature...... beta 2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human beta 2 chain is predicted to have all of the seven structural domains typical of the beta chains of laminin, including the short cysteine-rich alpha region. The amino acid sequence of human beta 2...

  10. A method for diagnosis of plant environmental stresses by gene expression profiling using a cDNA macroarray

    International Nuclear Information System (INIS)

    Tamaoki, Masanori; Matsuyama, Takashi; Nakajima, Nobuyoshi; Aono, Mitsuko; Kubo, Akihiro; Saji, Hikaru

    2004-01-01

    Plants in the field are subjected to numerous environmental stresses. Lengthy continuation of such environmental stresses or a rapid increase in their intensity is harmful to vegetation. Assessments of the phytotoxicity of various stresses have been performed in many countries, although they have largely been based on estimates of leaf injury. We developed a novel method of detecting plant stresses that is more sensitive and specific than those previously available. This method is based on the detection of mRNA expression changes in 205 ozone-responsive Arabidopsis expressed sequence tags (ESTs) by cDNA macroarray analysis. By using this method, we illustrated shifts in gene expression in response to stressors such as drought, salinity, UV-B, low temperature, high temperature, and acid rain, as distinct from those in response to ozone. We also made a mini-scale macroarray with 12 ESTs for diagnosis of the above environmental stresses in plants. These results illustrate the potential of our cDNA macroarray for diagnosis of various stresses in plants

  11. cDNA cloning and transcriptional controlling of a novel low dose radiation-induced gene and its function analysis

    International Nuclear Information System (INIS)

    Zhou Pingkun; Sui Jianli

    2002-01-01

    Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response

  12. BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

    Science.gov (United States)

    Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

    2010-11-01

    A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

  13. Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

    International Nuclear Information System (INIS)

    Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

    2005-01-01

    Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

  14. Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

    Science.gov (United States)

    Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2006-01-01

    Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

  15. Some properties and cDNA cloning of proteinaceous toxins from two species of lionfish (Pterois antennata and Pterois volitans).

    Science.gov (United States)

    Kiriake, Aya; Shiomi, Kazuo

    2011-11-01

    Lionfish, members of the genera Pterois, Parapterois and Dendrochirus, are well known to be venomous, having venomous glandular tissues in dorsal, pelvic and anal spines. The lionfish toxins have been shown to cross-react with the stonefish toxins by neutralization tests using the commercial stonefish antivenom, although their chemical properties including structures have been little characterized. In this study, an antiserum against neoverrucotoxin, the stonefish Synanceia verrucosa toxin, was first raised in a guinea pig and used in immunoblotting and inhibition immunoblotting to confirm that two species of Pterois lionfish (P. antennata and P. volitans) contain a 75kDa protein (corresponding to the toxin subunit) cross-reacting with neoverrucotoxin. Then, the amino acid sequences of the P. antennata and P. volitans toxins were successfully determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Notably, either α-subunits (699 amino acid residues) or β-subunits (698 amino acid residues) of the P. antennata and P. volitans toxins share as high as 99% sequence identity with each other. Furthermore, both α- and β-subunits of the lionfish toxins exhibit high sequence identity (70-80% identity) with each other and also with the β-subunits of the stonefish toxins. As reported for the stonefish toxins, the lionfish toxins also contain a B30.2/SPRY domain (comprising nearly 200 amino acid residues) in the C-terminal region of each subunit. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    Science.gov (United States)

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  17. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    Science.gov (United States)

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  18. Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

    Science.gov (United States)

    Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

    2015-08-01

    Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

  19. Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

    Science.gov (United States)

    Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

    2017-12-01

    As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

  20. Identification and characterization of a new autoimmune protein in membranous nephropathy by immunoscreening of a renal cDNA library.

    Science.gov (United States)

    Cavazzini, Fabrizio; Magistroni, Riccardo; Furci, Luciana; Lupo, Valentina; Ligabue, Giulia; Granito, Maria; Leonelli, Marco; Albertazzi, Alberto; Cappelli, Gianni

    2012-01-01

    Membranous Nephropathy (MN) represents a large amount of Nephrotic Syndromes in the adult population and its definitive diagnosis is currently carried out through biopsy. An autoimmune condition has been demonstrated in idiopathic MN (iMN) in which some kidney structures are targeted by patient autoantibodies. Some candidate antigens have been described and other likely involved target proteins responsible for the disease are not known yet. In this work our aim is to identify these proteins by screening a lambda-phage library with patients' sera. We enrolled four groups of patients: two MN groups of 12 full iMN patients; one control group of 15 patients suffering from other renal diseases; one control group of 15 healthy individuals. A commercial cDNA phagemide library was screened using the above described sera, in order to detect positive signals due to antigen-antibody bond. We detected one phagemide clone expressing a protein which was shown to be targeted by the antibodies of the iMN sera only. Control sera were negative. The sequence analysis of cDNA matched the Synaptonemal Complex protein 65 (SC65) coding sequence. Further proteomic analyses were carried out to validate our results. We provide evidence of an involvement of SC65 protein as an autoimmune target in iMN. Considering the invasiveness and the resulting risk coming from renal biopsy, our ongoing aim is to set a procedure able to diagnose affected patients through a little- or non-invasive method such as blood sampling rather than biopsy.

  1. Identification and characterization of a new autoimmune protein in membranous nephropathy by immunoscreening of a renal cDNA library.

    Directory of Open Access Journals (Sweden)

    Fabrizio Cavazzini

    Full Text Available Membranous Nephropathy (MN represents a large amount of Nephrotic Syndromes in the adult population and its definitive diagnosis is currently carried out through biopsy. An autoimmune condition has been demonstrated in idiopathic MN (iMN in which some kidney structures are targeted by patient autoantibodies. Some candidate antigens have been described and other likely involved target proteins responsible for the disease are not known yet. In this work our aim is to identify these proteins by screening a lambda-phage library with patients' sera. We enrolled four groups of patients: two MN groups of 12 full iMN patients; one control group of 15 patients suffering from other renal diseases; one control group of 15 healthy individuals. A commercial cDNA phagemide library was screened using the above described sera, in order to detect positive signals due to antigen-antibody bond. We detected one phagemide clone expressing a protein which was shown to be targeted by the antibodies of the iMN sera only. Control sera were negative. The sequence analysis of cDNA matched the Synaptonemal Complex protein 65 (SC65 coding sequence. Further proteomic analyses were carried out to validate our results. We provide evidence of an involvement of SC65 protein as an autoimmune target in iMN. Considering the invasiveness and the resulting risk coming from renal biopsy, our ongoing aim is to set a procedure able to diagnose affected patients through a little- or non-invasive method such as blood sampling rather than biopsy.

  2. Development of a cDNA microarray for the measurement of gene expression in the sheep scab mite Psoroptes ovis

    Directory of Open Access Journals (Sweden)

    Burgess Stewart TG

    2012-02-01

    Full Text Available Abstract Background Sheep scab is caused by the ectoparasitic mite Psoroptes ovis which initiates a profound cutaneous inflammatory response, leading to the development of the skin lesions which are characteristic of the disease. Existing control strategies rely upon injectable endectocides and acaricidal dips but concerns over residues, eco-toxicity and the development of acaricide resistance limit the sustainability of this approach. In order to identify alternative means of disease control, a deeper understanding of both the parasite and its interaction with the host are required. Methods Herein we describe the development and utilisation of an annotated P. ovis cDNA microarray containing 3,456 elements for the measurement of gene expression in this economically important ectoparasite. The array consists of 981 P. ovis EST sequences printed in triplicate along with 513 control elements. Array performance was validated through the analysis of gene expression differences between fed and starved P. ovis mites. Results Sequences represented on the array include homologues of major house dust mite allergens and tick salivary proteins, along with factors potentially involved in mite reproduction and xenobiotic metabolism. In order to validate the performance of this unique resource under biological conditions we used the array to analyse gene expression differences between fed and starved P. ovis mites. These analyses identified a number of house dust mite allergen homologues up-regulated in fed mites and P. ovis transcripts involved in stress responses, autophagy and chemosensory perception up-regulated in starved mites. Conclusion The P. ovis cDNA microarray described here has been shown to be both robust and reproducible and will enable future studies to analyse gene expression in this important ectoparasite.

  3. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  4. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  5. (α,α-dimethyl)glycyl (dmg) PNAs: achiral PNA analogs that form stronger hybrids with cDNA relative to isosequential RNA.

    Science.gov (United States)

    Gourishankar, Aland; Ganesh, Krishna N

    2012-01-01

    The design and facile synthesis of sterically constrained new analogs of PNA having gem-dimethyl substitutions on glycine (dmg-PNA-T) is presented. The PNA oligomers [aminoethyl dimethylglycyl (aedmg) and aminopropyl dimethylglycyl (apdmg)] synthesized from the monomers 6 and 12) effected remarkable stabilization of homothyminePNA(2):homoadenine DNA/RNA triplexes and mixed base sequence duplexes with target cDNA or RNA. They show a higher binding to DNA relative to that with isosequential RNA. This may be a structural consequence of the sterically rigid gem-dimethyl group, imposing a pre-organized conformation favorable for complex formation with cDNA. The results complement our previous work that had demonstrated that cyclohexanyl-PNAs favor binding with cRNA compared with cDNA and imply that the biophysical and structural properties of PNAs can be directed by introduction of the right rigidity in PNA backbone devoid of chirality. This approach of tweaking selectivity in binding of PNA constructs by installing gem-dimethyl substitution in PNA backbone can be extended to further fine-tuning by similar substitution in the aminoethyl segment as well either individually or in conjunction with present substitution.

  6. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

  7. Development of Gene Expression Fingerprints for Identification of Environmental Contaminants Using cDNA Arrays

    National Research Council Canada - National Science Library

    Inouye, L

    2004-01-01

    ...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...

  8. Partial characterization of a low molecular weight human collagen that undergoes alternative splicing

    International Nuclear Information System (INIS)

    Pihlajaniemi, T.; Myllylea, R.; Kurkinen, M.; Prockop, D.J.

    1987-01-01

    A cDNA library prepared from RNA isolated from a cultured human tumor cell line, HT-1080, was screened with a mouse cDNA clone coding for part of the -Gly-Xaa-Yaa-domain of the α2(IV) collagen chain. Four overlapping cDNA clones were characterized that coded for a low molecular weight human collagen. The cDNA clones did not, however, code for the short-chain collagens, types IX and X. The amino acid sequences derived from the clones resembled type IV collagen in that there were short interruptions in the repeating -Gly-Xaa-Yaa-sequence. The noncollagenous, carboxyl-terminal domain was, however, much shorter and contained only 18 amino acid residues. Interestingly, one of the cDNA clones contained an additional 36 nucleotides not found in an overlapping clone. The 36 nucleotides encoded four -Gly-Xaa-Yaa-repeats without changing the reading frame. Nuclease S1 mapping using a 32 P-labelled probe demonstrated that the different between the clones was due to existence of two different mRNAs. A synthetic 24-residue peptide corresponding to the last two -Gly-Xaa-Yaa-triplets and the entire carboxyl-terminal domain was used to generate polyclonal antibodies. Electrophoretic transfer blot analysis of HT-1080 cells and normal human skin fibroblasts identified two polypeptides, M/sub r/ 67,000 and M/sub r/ 62,000, that were sensitive to bacterial collagenase

  9. Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

    Science.gov (United States)

    Liu, X; Gorovsky, M A

    1996-01-01

    A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

  10. A new genus of athecate interstitial dinoflagellates, Togula gen. nov., previously encompassed within Amphidinium sensu lato: Inferred from light and electron microscopy and phylogenetic analyses of partial large subunit ribosomal DNA sequences

    DEFF Research Database (Denmark)

    Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels

    2004-01-01

    was not closely related to other genera included in the molecular phylogenetic analyses, but formed a highly supported clade in Bayesian analysis together with the six small-sized strains. The six strains also formed a highly supported clade, consisting of two closely related, albeit distinct, clades. Light......The recent emendation of Amphidinium (Dinophyceae), which now only consists of species with minute left-deflected epicone, has left more than 100 species without a clear generic affiliation. In the present study, a strain identified as one of the species with a divergent epicone type, Amphidinium...... subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...

  11. Human cDNA mapping using fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  12. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon [College of Medicine, Univ. of Korea, Seoul (Korea, Republic of)

    2003-07-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology.

  13. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    International Nuclear Information System (INIS)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon

    2003-01-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology

  14. cDNA cloning and mRNA expression of heat shock protein 70 gene ...

    African Journals Online (AJOL)

    In this study, the full-length heat shock protein 70 of Tegillarca granosa was cloned from cDNA library by rapid amplification of cDNA end (RACE). The open reading frame (ORF) of heat shock protein 70 was 1968 bp, and it encoded a protein of 655 amino acids with a predicted molecular weight of 71.48 kDa and an ...

  15. [Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

    Science.gov (United States)

    Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

    2017-04-12

    Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

  16. NHE3 in an ancestral vertebrate: primary sequence, distribution, localization, and function in gills.

    Science.gov (United States)

    Choe, Keith P; Kato, Akira; Hirose, Shigehisa; Plata, Consuelo; Sindic, Aleksandra; Romero, Michael F; Claiborne, J B; Evans, David H

    2005-11-01

    In mammals, the Na+/H+ exchanger 3 (NHE3) is expressed with Na+/K+-ATPase in renal proximal tubules, where it secretes H+ and absorbs Na+ to maintain blood pH and volume. In elasmobranchs (sharks, skates, and stingrays), the gills are the dominant site of pH and osmoregulation. This study was conducted to determine whether epithelial NHE homologs exist in elasmobranchs and, if so, to localize their expression in gills and determine whether their expression is altered by environmental salinity or hypercapnia. Degenerate primers and RT-PCR were used to deduce partial sequences of mammalian NHE2 and NHE3 homologs from the gills of the euryhaline Atlantic stingray (Dasyatis sabina). Real-time PCR was then used to demonstrate that mRNA expression of the NHE3 homolog increased when stingrays were transferred to low salinities but not during hypercapnia. Expression of the NHE2 homolog did not change with either treatment. Rapid amplification of cDNA was then used to deduce the complete sequence of a putative NHE3. The 2,744-base pair cDNA includes a coding region for a 2,511-amino acid protein that is 70% identical to human NHE3 (SLC9A3). Antisera generated against the carboxyl tail of the putative stingray NHE3 labeled the apical membranes of Na+/K+-ATPase-rich epithelial cells, and acclimation to freshwater caused a redistribution of labeling in the gills. This study provides the first NHE3 cloned from an elasmobranch and is the first to demonstrate an increase in gill NHE3 expression during acclimation to low salinities, suggesting that NHE3 can absorb Na+ from ion-poor environments.

  17. Identification of five partial ABC genes in the liver of the Antarctic fish Trematomus bernacchii and sensitivity of ABCB1 and ABCC2 to Cd exposure

    Energy Technology Data Exchange (ETDEWEB)

    Zucchi, Sara, E-mail: zucchi2@unisi.i [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Corsi, Ilaria [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Luckenbach, Till [UFZ - Helmholtz Centre for Environmental Research, Permoserstr. 15, D-04318 Leipzig (Germany); Bard, Shannon Mala [Environmental Programmes, Dalhousie University, 1355 Oxford Street, Life Science Centre, Room 820, Halifax, Nova Scotia, Canada B3H 4J1 (Canada); Regoli, Francesco [Department of Biochemistry, Biology and Genetics, Polytechnic University of Marches, Ancona (Italy); Focardi, Silvano [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy)

    2010-08-15

    Several ABC transporters have been characterized from many aquatic organisms, but no information is yet available for Antarctic fish. The aim of this work was to identify the expression of genes for ABC proteins in Trematomus bernacchii, a bioindicator species of the Southern Ocean. Partial cDNA sequences of ABCB1, ABCC1, ABCC2, ABCC4 and ABCC9 were cloned from liver. Using RACE technology, 3.5 and 2.2 kb contigs were obtained for ABCB1 and ABCC2. Considering the elevated natural bioavailability of cadmium at Terra Nova Bay, responsiveness of ABCB1 and ABCC2 to this element was investigated under laboratory conditions. ABCB1 and ABCC2 mRNA levels were approximately four-fold higher in Cd-exposed fish compared to the controls. Induction of ABCB1 protein was also found by western blot. This study provides the first identification of five ABC genes in the liver of an Antarctic key species, some of which may be involved in cellular detoxification. - The presence of five partial sequences showing homology with ABC transporters and the sensitivity of ABCB1 and ABCC2 toward cadmium were determined in the liver of T. bernacchii.

  18. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  19. Construction of a T7 Human Lung Cancer cDNA Library

    Directory of Open Access Journals (Sweden)

    Wentao YUE

    2008-10-01

    Full Text Available Background and objective Currently, only a limited numbers of tumor markers for non small lung cancer (NSCLC diagnosis, new biomarker, such as serum autoantibody may improve the early detection of lung cancer. Our objective is construction human lung squamous carcinoma and adenocarcinoma T7 phage display cDNA library from the tissues of NSCLC patients. Methods mRNA was isolated from a pool of total RNA extract from NSCLC tissues obtained from 5 adenocarcinomas and 5 squamous carcinomas, and then mRNA was reverse transcribed into double stranded cDNA. After digestion, the cDNA was inserted into T7Select 10-3 vector. The phage display cDNA library was constructed by package reaction in vitro and plate proliferation. Plaque assay and PCR were used to evaluate the library.Results Two T7 phage display cDNA library were established. Plaque assay show the titer of lung squamas carcinoma library was 1.8×106 pfu, and the adenocarcinoma library was 5×106 pfu. The phage titer of the amplified library were 3.2×1010 pfu/mL and 2.5×1010 pfu/mL. PCR amplification of random plaque show insert ratio were 100% (24/24 in adenocarcinoma library and 95.8% in human lung squamas carcinoma library (23/24. Insert range from 300 bp to 1 500 bp. Conclusion Two phage display cDNA library from NSCLC were constructed.

  20. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    International Nuclear Information System (INIS)

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

    1987-01-01

    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  1. cDNA cloning of a snake venom metalloproteinase from the eastern diamondback rattlesnake (Crotalus adamanteus), and the expression of its disintegrin domain with anti-platelet effects

    Science.gov (United States)

    Suntravat, Montamas; Jia, Ying; Lucena, Sara E.; Sánchez, Elda E.; Pérez, John C.

    2013-01-01

    A 5′ truncated snake venom metalloproteinase was identified from a cDNA library constructed from venom glands of an eastern diamondback rattlesnake (Crotalus adamanteus). The 5′-rapid amplification of cDNA ends (RACE) was used to obtain the 1865 bp full-length cDNA sequence of a snake venom metalloproteinase (CamVMPII). CamVMPII encodes an open reading frame of 488 amino acids, which includes a signal peptide, a pro-domain, a metalloproteinase domain, a spacer, and an RGD-disintegrin domain. The predicted amino acid sequence of CamVMPII showed a 91%, 90%, 83%, and 82% sequence homology to the P-II class enzymes of C. adamanteus metalloproteinase 2, C. atrox CaVMP-II, Gloydius halys agkistin, and Protobothrops jerdonii jerdonitin, respectively. Disintegrins are potent inhibitors of both platelet aggregation and integrin-dependent cell adhesion. Therefore, the disintegrin domain (Cam-dis) of CamVMPII was amplified by PCR, cloned into a pET-43.1a vector, and expressed in Escherichia coli BL21. Affinity purified recombinantly modified Cam-dis (r-Cam-dis) with a yield of 8.5 mg/L culture medium was cleaved from the fusion tags by enterokinase cleavage. r-Cam-dis was further purified by two-step chromatography consisting of HiTrap™ Benzamidine FF column, followed by Talon Metal affinity column with a final yield of 1 mg/L culture. r-Cam-dis was able to inhibit all three processes of platelet thrombus formation including platelet adhesion with an estimated IC50 of 1 nM, collagen- and ADP-induced platelet aggregation with the estimated IC50s of 18 and 6 nM, respectively, and platelet function on clot retraction. It is a potent anti-platelet inhibitor, which should be further investigated for drug discovery to treat stroke patients or patients with thrombotic disorders. PMID:23313448

  2. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs

    Directory of Open Access Journals (Sweden)

    Sebastian Boltaña

    2017-02-01

    Full Text Available This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS and peptidoglycan (PGN. Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs, carrier proteins/membrane transport (approximately 15%, effectors/modulators and cell communication (approximately 11%, nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5% and intracellular transducers/signal transduction (approximately 5%. Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ that provides a platform enriched for the study

  3. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

    Science.gov (United States)

    Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

    2017-02-03

    This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene

  4. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

    Science.gov (United States)

    Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

    2005-04-01

    Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

  5. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  6. cDNA, deduced polypeptide structure and chromosomal assignment of human pulmonary surfactant proteolipid, SPL(pVal)

    International Nuclear Information System (INIS)

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.E.; Clark, J.C.; Pilot-Matias, T.; Meuth, J.; Fox, J.L.; Whitsett, J.A.

    1988-01-01

    In hyaline membrane disease of premature infants, lack of surfactant leads to pulmonary atelectasis and respiratory distress. Hydrophobic surfactant proteins of M/sub r/ = 5000-14,000 have been isolated from mammalian surfactants which enhance the rate of spreading and the surface tension lowering properties of phospholipids during dynamic compression. The authors have characterized the amino-terminal amino acid sequence of pulmonary proteolipids from ether/ethanol extracts of bovine, canine, and human surfactant. Two distinct peptides were identified and termed SPL(pVal) and SPL(Phe). An oligonucleotide probe based on the valine-rich amino-terminal amino acid sequence of SPL(pVal) was utilized to isolate cDNA and genomic DNA encoding the human protein, termed surfactant proteolipid SPL(pVal) on the basis of its unique polyvaline domain. The primary structure of a precursor protein of 20,870 daltons, containing the SPL(pVal) peptide, was deduced from the nucleotide sequence of the cDNAs. Hybrid-arrested translation and immunoprecipitation of labeled translation products of human mRNA demonstrated a precursor protein, the active hydrophobic peptide being produced by proteolytic processing. Two classes of cDNAs encoding SPL(pVal) were identified. Human SPL(pVal) mRNA was more abundant in the adult than in fetal lung. The SPL(pVal) gene locus was assigned to chromosome 8

  7. Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1--December 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-12-31

    The ultimate goal of this proposal is to create a cDNA map of the human genome. Mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach will generate 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  8. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  9. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    Science.gov (United States)

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  10. Microarrays in ecological research: A case study of a cDNA microarray for plant-herbivore interactions

    Directory of Open Access Journals (Sweden)

    Gase Klaus

    2004-09-01

    Full Text Available Abstract Background Microarray technology allows researchers to simultaneously monitor changes in the expression ratios (ERs of hundreds of genes and has thereby revolutionized most of biology. Although this technique has the potential of elucidating early stages in an organism's phenotypic response to complex ecological interactions, to date, it has not been fully incorporated into ecological research. This is partially due to a lack of simple procedures of handling and analyzing the expression ratio (ER data produced from microarrays. Results We describe an analysis of the sources of variation in ERs from 73 hybridized cDNA microarrays, each with 234 herbivory-elicited genes from the model ecological expression system, Nicotiana attenuata, using procedures that are commonly used in ecologic research. Each gene is represented by two independently labeled PCR products and each product was arrayed in quadruplicate. We present a robust method of normalizing and analyzing ERs based on arbitrary thresholds and statistical criteria, and characterize a "norm of reaction" of ERs for 6 genes (4 of known function, 2 of unknown with different ERs as determined across all analyzed arrays to provide a biologically-informed alternative to the use of arbitrary expression ratios in determining significance of expression. These gene-specific ERs and their variance (gene CV were used to calculate array-based variances (array CV, which, in turn, were used to study the effects of array age, probe cDNA quantity and quality, and quality of spotted PCR products as estimates of technical variation. Cluster analysis and a Principal Component Analysis (PCA were used to reveal associations among the transcriptional "imprints" of arrays hybridized with cDNA probes derived from mRNA from N. attenuata plants variously elicited and attacked by different herbivore species and from three congeners: N. quadrivalis, N. longiflora and N. clevelandii. Additionally, the PCA

  11. Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis

    Directory of Open Access Journals (Sweden)

    Paniego Norma

    2008-01-01

    Full Text Available Abstract Background Considering that sunflower production is expanding to arid regions, tolerance to abiotic stresses as drought, low temperatures and salinity arises as one of the main constrains nowadays. Differential organ-specific sunflower ESTs (expressed sequence tags were previously generated by a subtractive hybridization method that included a considerable number of putative abiotic stress associated sequences. The objective of this work is to analyze concerted gene expression profiles of organ-specific ESTs by fluorescence microarray assay, in response to high sodium chloride concentration and chilling treatments with the aim to identify and follow up candidate genes for early responses to abiotic stress in sunflower. Results Abiotic-related expressed genes were the target of this characterization through a gene expression analysis using an organ-specific cDNA fluorescence microarray approach in response to high salinity and low temperatures. The experiment included three independent replicates from leaf samples. We analyzed 317 unigenes previously isolated from differential organ-specific cDNA libraries from leaf, stem and flower at R1 and R4 developmental stage. A statistical analysis based on mean comparison by ANOVA and ordination by Principal Component Analysis allowed the detection of 80 candidate genes for either salinity and/or chilling stresses. Out of them, 50 genes were up or down regulated under both stresses, supporting common regulatory mechanisms and general responses to chilling and salinity. Interestingly 15 and 12 sequences were up regulated or down regulated specifically in one stress but not in the other, respectively. These genes are potentially involved in different regulatory mechanisms including transcription/translation/protein degradation/protein folding/ROS production or ROS-scavenging. Differential gene expression patterns were confirmed by qRT-PCR for 12.5% of the microarray candidate sequences. Conclusion

  12. Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

    Science.gov (United States)

    Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

    1995-06-01

    cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence