
Sample records for parameter galaxy-qso pairs

  1. Effects of pairing correlation on nuclear level density parameter and nucleon separation energy

    International Nuclear Information System (INIS)

    Rajesekaran, T.R.; Selvaraj, S.


    A systematic study of effects of pairing correlations on nuclear level density parameter 'a' and neutron separation energy S N is presented for 152 Gd using statistical theory of nuclei with deformation, collective and noncollective rotational degrees of freedom, shell effects, and pairing correlations

  2. Possibilities of paired comparison of receptor binding parameters obtained in a single experiment

    International Nuclear Information System (INIS)

    Mashilova, K.V.; Kiriakov, G.V.; Malin, K.M.; Rozhanets, V.V.


    The authors explore the use of comparing control and experimental groups on the basis of extrapolation parameters obtained from a single pair of experiments. One of the experiments study the parameters of specific binding of 3 H-D-ala-2-enkephelin-5-D-leucine in the striatum of different groups of rats. The analysis was done by the Cornish-Bowden method

  3. Semi-analytic calculations for the impact parameter dependence of electromagnetic multi-lepton pair production

    International Nuclear Information System (INIS)

    Gueclue, M.C.


    We provide a new general semi-analytic derivation of the impact parameter dependence of lowest order electromagnetic lepton-pair production in relativistic heavy-ion collisions. By using this result we have also calculated the related analytic multiple-pair production in the two-photon external-field model. We have compared our results with the equivalent-photon approximation and other calculations

  4. Innovation of Methods for Measurement and Modelling of Twisted Pair Parameters

    Directory of Open Access Journals (Sweden)

    Lukas Cepa


    Full Text Available The goal of this paper is to optimize a measurement methodology for the most accurate broadband modelling of characteristic impedance and other parameters for twisted pairs. Measured values and theirs comparison is presented in this article. Automated measurement facility was implemented at the Department of telecommunication of Faculty of electrical engineering of Czech technical university in Prague. Measurement facility contains RF switches allowing measurements up to 300 MHz or 1GHz. Measured twisted pair’s parameters can be obtained by measurement but for purposes of fundamental characteristics modelling is useful to define functions that model the properties of the twisted pair. Its primary and secondary parameters depend mostly on the frequency. For twisted pair deployment, we are interested in a frequency band range from 1 MHz to 100 MHz.

  5. Entanglement-assisted quantum parameter estimation from a noisy qubit pair: A Fisher information analysis

    Energy Technology Data Exchange (ETDEWEB)

    Chapeau-Blondeau, François, E-mail:


    Benefit from entanglement in quantum parameter estimation in the presence of noise or decoherence is investigated, with the quantum Fisher information to asses the performance. When an input probe experiences any (noisy) transformation introducing the parameter dependence, the performance is always maximized by a pure probe. As a generic estimation task, for estimating the phase of a unitary transformation on a qubit affected by depolarizing noise, the optimal separable probe and its performance are characterized as a function of the level of noise. By entangling qubits in pairs, enhancements of performance over that of the optimal separable probe are quantified, in various settings of the entangled pair. In particular, in the presence of the noise, enhancement over the performance of the one-qubit optimal probe can always be obtained with a second entangled qubit although never interacting with the process to be estimated. Also, enhancement over the performance of the two-qubit optimal separable probe can always be achieved by a two-qubit entangled probe, either partially or maximally entangled depending on the level of the depolarizing noise. - Highlights: • Quantum parameter estimation from a noisy qubit pair is investigated. • The quantum Fisher information is used to assess the ultimate best performance. • Theoretical expressions are established and analyzed for the Fisher information. • Enhanced performances are quantified with various entanglements of the pair. • Enhancement is shown even with one entangled qubit noninteracting with the process.

  6. New Values of Cross-Talk Parameters for Twisted Pair Model


    Milos Kozak; Lukas Cepa; Jiri Vodrazka


    Near-end Crosstalk (NEXT) and Far-end Crosstalk (FEXT) of unshielded twisted pair (UTP) cable are the main factors limiting the information capacity in data transmission. Crosstalk depends mostly on the frequency. Frequency dependent transfer functions and crosstalk attenuation may be obtained by measurement, but for the analytical description of the transmission channel's parameters is useful to define functions modelling the crosstalk. The paper describes the measuri...

  7. A pair of new moisture-dynamic diagnostic parameters for heavy rain location (United States)

    Yuan, Kai; Zhu, Zhiwei; Li, Ming


    In this study, the regional persistent heavy rain process occurred in the middle and lower reaches of the Yangtze River valley from 30 June 2016 to 7 July 2016 is analyzed. We find that the pure dynamic parameters [e.g., vorticity ( V) and divergence ( D)] and two-dimensional moisture-dynamic parameters [e.g., moist vorticity ( MV), moist divergence ( MD)] have difficulty in capturing the rainfall location during such a critical process. Given the poor performance of these traditional parameters, a pair of new parameters [namely, one-dimensional moist vorticity ( ODMV) and one-dimensional moist divergence ( ODMD)] based on low-level jet is proposed for diagnosing heavy rain location. The results show that (1) ODMV and ODMD have better relations with rain belt in terms of spatial distribution. Precipitation occurs in positive (negative) region of ODMV ( ODMD), and heavy rainfall accurately locates in the positive (negative) center of ODMV ( ODMD); (2) ODMV and ODMD also have good correlation with the precipitation in terms of temporal variation (significant at the 99% confidence level). When ODMV ( ODMD) is in strong positive (negative) phase, precipitation is large, and vice versa; (3) the threat score of ODMV and ODMD for the areal-mean rainfall is improved by 119% and 16%, respectively, compared to V/ D and MV/ MD. It is anticipated that the proposed new parameters would facilitate the skills of diagnosing and forecasting the heavy rainfall.

  8. Eliciting hyperparameters of prior distributions for the parameters of paired comparison models

    Directory of Open Access Journals (Sweden)

    Nasir Abbas


    Full Text Available Normal 0 false false false EN-US X-NONE AR-SA In the study of paired comparisons (PC, items may be ranked or issues may be prioritized through subjective assessment of certain judges. PC models are developed and then used to serve the purpose of ranking. The PC models may be studied through classical or Bayesian approach. Bayesian inference is a modern statistical technique used to draw conclusions about the population parameters. Its beauty lies in incorporating prior information about the parameters into the analysis in addition to current information (i.e. data. The prior and current information are formally combined to yield a posterior distribution about the population parameters, which is the work bench of the Bayesian statisticians. However, the problems the Bayesians face correspond to the selection and formal utilization of prior distribution. Once the type of prior distribution is decided to be used, the problem of estimating the parameters of the prior distribution (i.e. elicitation still persists. Different methods are devised to serve the purpose. In this study an attempt is made to use Minimum Chi-square (hence forth MCS for the elicitation purpose. Though it is a classical estimation technique, but is used here for the election purpose. The entire elicitation procedure is illustrated through a numerical data set.

  9. Plasmon-phonon pairing mechanism and superconducting state parameters in layered mercury cuprates

    International Nuclear Information System (INIS)

    Varshney, D.; Tosi, M.P.


    An effective two-dimensional dynamic interaction is developed which incorporated screening of holes by plasmons and by optical phonons to discuss the nature of the pairing mechanism leading to superconductivity in layered mercury cuprates. The system is treated as an ionic solid containing layers of charge carriers and a model dielectric function is set up which fulfils the appropriate sum rules on the electronic and ionic polarizabilities. The values of the coupling strength and of the Coulomb interaction parameter indicate that the superconductor is in the strong coupling regime with effective screening of the charge carriers. The superconducting transition temperature of optically doped HgBa 2 CuO 4+δ is estimated as 94 K from Kresin's strong coupling theory and the energy gap ratio is substantially larger than the BCS value. The value of the isotope exponent is severely reduced below the BCS value. The implications of the model and its analysis are discussed. (author)

  10. Influence of the cylindrical gear pairs parameters to the transverse contact ratio

    Directory of Open Access Journals (Sweden)

    Predrag S. Dobratić


    Full Text Available In the field of transmission and power transformation from the power engine to the working machine, gear pairs, are mostly used in mechanical engineering due to their compactness of the structure, high reliability and capacity. One way of improving the performance characteristics of gear pairs, and thus the gear transmitters, is to increase the number of simultaneously meshed pairs of teeth, or increasing the transverse contact ratio. To this end, this paper analyzes in detail the partial and simultaneous influence of the number of teeth and tooth profile shapes, moving through shifting coefficient and pressure angle, to the number of simultaneously meshed pairs of teeth. The obtained results allow us to define the optimum parameters of cylindrical gear pairs, in terms of the size of the transverse contact ratio. Introduction The kinematic indicator of the existence of the transmitting continuity of a rotary movement is the total contact ratio. In order to achieve the transmitting continuity of a rotary movement, the total contact ratio must be higher than one. Based on the total contact ratio, the information on the number of simultaneously meshed pairs of the teeth which rotate during the contact period is obtained. For example, if the  – one and two pairs of teeth alternately take turn, and if the  – two and three pairs of teeth alternately take turn, etc. It should be noted that the  is a necessary but not sufficient condition for achieving multiple meshes. The next condition to meet is the compatibility between the accuracy of teeth production, the teeth rigidity and the intensity of the total load of the teeth pair. The influence of the addendum coefficient on the transverse contact ratio is shown in the paper (Li, 2008. It is shown that changes in the addendum coefficient in conjunction with the corresponding values of the shifting coefficient and gear ratio can achieve the transverse contact ratio value higher than four. The paper

  11. Superconducting Fluctuations above T c and pair breaking parameters of two dimensional Niobium Nitride Films (United States)

    Shinozaki, B.; Ezaki, S.; Odou, T.; Makise, K.; Asano, T.


    Transport properties have been investigated for the epitaxial superconducting NbN thin films. We analysed the excess conductance σ’ ≡ σ(T) - σN by the sum of the Aslamazov-Larkin (AL) and Maki-Thompson (MT) terms for thermal fluctuations above T c, where the σN ≡1/R sq N is the normal state sheet conductance. We have found that the theoretical expression σ’theo (T) = σ’AL (T) + σ’MT (T,δ) can be well fitted to σ’exp (T) with use of the suitable value of the pair breaking parameter δ in the MT term relating to the inelastic scattering rate 1/τin(T) as δ = πħ/8k B Tτin. The rate 1/τin(T) given by the sum of 1/τfluc(T), 1/τe-e(T) and 1/τe-ph (T) is determined from the analysis of the magneto-conductance Δσ = σ(H) – σ(0) by the sum of AL, MT and the localization terms, where the first, second and third terms correspond to the rate due to the superconducting fluctuation effect, electron-electron and electron-phonon interactions, respectively. The R sq N dependence of δ is expressed by δ = δ0 + αR sq N, where the first term δ0 due to 1/τe-ph (T) and the second term due to the sum of 1/τfluc(T) and 1/τe-e(T). Although we obtained a reasonable value of Debye temperature ΘD ≈630 K from the δ0, the magnitude of the α is about 5 times larger than the theoretical value.

  12. The order parameter equations of superfluid Fermi-liquid with spin-triplet pairing near Tc in magnetic field

    International Nuclear Information System (INIS)

    Tarasov, A.N.


    The article is devoted to description of equilibrium properties of superfluid phases of 3 He in magnetic field at temperatures near the normal-superfluid point T c . The Landau Fermi-liquid (F-L) approach generalized to superfluid Fermi-liquids (SFLs) is used. Equations for the order parameter paramagnetic SFL with spin-triplet pairing in static and uniform (DC) moderately strong magnetic field are derived without taking into account strong-coupling (SC) effects. An integro-differential equation is deduced for the order parameter in the general case of spin-triplet pairing (spin of a pair is s = 1, orbital moment l of a pair is any odd number). It is valid in the approximation of small space inhomogeneities of the SFL for external DC magnetic field at temperatures near T c . In the case of spin-triplet p-wave pairing a Ginzburg-Landau (GL) equation is derived for the order parameter A αj (complex 3 x 3 matrix). Corrections to the coefficients in the GL eq. are resulted from taking into account the influence of moderately strong DC magnetic field and spin-exchange F-L interaction by the theory of permutations. In such fields these corrections can be of the same order of magnitude as the so-called > SC corrections to the GL eq. (or even exceed them) and are much higher than the particle-hole asymmetric contribution. The above corrections are connected with deformation of the order parameter in moderate magnetic fields and are of interest at description of 3 He - B at low pressures

  13. New de-embedding structures for extracting the electrical parameters of a through-silicon-via pair

    International Nuclear Information System (INIS)

    Zhou Jing; Wan Lixi; Li Jun; Wang Huijuan; Dai Fengwei; Cao Liqiang; Yu Daquan; Guidotti, Daniel


    Two innovative de-embedding methods are proposed for extracting an electrical model for a through-silicon-via (TSV) pair consisting of a ground-signal (GS) structure. In addition, based on microwave network theory, a new solution scheme is developed for dealing with multiple solutions of the transfer matrix during the process of de-embedding. A unique solution is determined based on the amplitude and the phase characteristic of S parameters. In the first de-embedding method, a typical “π“ type model of the TSV pair is developed, which illustrates the need to allow for frequency dependence in the equivalent TSV pair Spice model. This de-embedding method is shown to be effective for extracting the electrical properties of the TSVs. The feasibility of a second de-embedding method is also investigated. (semiconductor integrated circuits)

  14. Controlled finite momentum pairing and spatially varying order parameter in proximitized HgTe quantum wells (United States)

    Hart, Sean; Ren, Hechen; Kosowsky, Michael; Ben-Shach, Gilad; Leubner, Philipp; Bruene, Christoph; Buhmann, Hartmut; Molenkamp, Laurens; Halperin, Bertrand; Yacoby, Amir

    Conventional s-wave superconductivity arises from singlet pairing of electrons with opposite Fermi momenta, forming Cooper pairs with zero net momentum. Recent studies have focused on coupling s-wave superconductors to systems with an unusual configuration of electronic spin and momentum at the Fermi surface, where the nature of the paired state can be modified and the system may even undergo a topological phase transition. Here we present measurements on Josephson junctions based on HgTe quantum wells coupled to aluminum or niobium superconductors, and subject to a magnetic field in the plane of the quantum well. We observe that the in-plane magnetic field modulates the Fraunhofer interference pattern, and that this modulation depends both on electron density and on the direction of the in-plane field with respect to the junction. However, the orientation of the junction with respect to the underlying crystal lattice does not impact the measurements. These findings suggest that spin-orbit coupling plays a role in the observed behavior, and that measurements of Josephson junctions in the presence of an in-plane field can elucidate the Fermi surface properties of the weak link material. NSF DMR-1206016; STC Center for Integrated Quantum Materials under NSF Grant No. DMR-1231319; NSF GRFP under Grant DGE1144152, Microsoft Corporation Project Q.

  15. Modeling age differences in effects of pair repetition and proactive interference using a single parameter. (United States)

    Stephens, Joseph D W; Overman, Amy A


    In this article, we apply the REM model (Shiffrin & Steyvers, 1997) to age differences in associative memory. Using Criss and Shiffrin's (2005) associative version of REM, we show that in a task with pairs repeated across 2 study lists, older adults' reduced benefit of pair repetition can be produced by a general reduction in the diagnosticity of information stored in memory. This reduction can be modeled similarly well by reducing the overall distinctiveness of memory features, or by reducing the accuracy of memory encoding. We report a new experiment in which pairs are repeated across 3 study lists and extend the model accordingly. Finally, we extend the model to previously reported data using the same task paradigm, in which the use of a high-association strategy introduced proactive interference effects in young adults but not older adults. Reducing the diagnosticity of information in memory also reduces the proactive interference effect. Taken together, the modeling and empirical results reported here are consistent with the claim that some age differences that appear to be specific to associative information can be produced via general degradation of information stored in memory. The REM model provides a useful framework for examining age differences in memory as well as harmonizing seemingly conflicting prior modeling approaches for the associative deficit. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  16. Pairing and Blocking in High-K Isomers: Variation of the Collective Parameter gR

    Directory of Open Access Journals (Sweden)

    Stone N.J.


    Full Text Available Using the principle of additivity, the quasi-particle contribution to magnetism in high-K isomers of Lu - Re has been estimated. Based on these estimates band structure branching ratio data is used to explore the behavior of the collective contribution as the number and neutron/proton nature (Np, Nn, of the quasi-particle excitations, change. A striking systematic variation of the collective g-factor gR with the difference, Np – Nn, is revealed. Basic ideas of pairing, its quenching by quasi-particle excitation and the consequent changes to moment of inertia and collective magnetism are discussed. The new found systematic behaviour of gR opens a fresh window on these effects amenable to detailed theoretical investigation.

  17. Hot HB Stars in Globular Clusters: Physical Parameters and Consequences for Theory. VI; The Second Parameter Pair M 3 and M 13 (United States)

    Moehler, S.; Landsman, W. B.; Sweigart, A. V.; Grundahl, F.


    We present the results of spectroscopic analyses of hot horizontal branch (HB) stars in M 13 and M 3, which form a famous "second parameter" pair. F rom the spectra and Stromgren photometry we derived - for the first time in M 13 - atmospheric parameters (effective temperature and surface gravity). For stars with Stromgren temperatures between 10,000 and 12,000 K we found excellent agreement between the atmospheric parameters derived from Stromgren photometry and those derived from Balmer line profile fits. However, for cooler stars there is a disagreement in the parameters derived by the two methods, for which we have no satisfactory explanation. Stars hotter than 12,000 K show evidence for helium depletion and iron enrichment, both in M 3 and M 13. Accounting for the iron enrichment substantially improves the agreement with canonical evolutionary models, although the derived gravities and masses are still somewhat too low. This remaining discrepancy may be an indication that scaled-solar metal-rich model atmospheres do not adequately represent the highly non-solar abundance ratios found in blue HB stars affected by diffusion. We discuss the effects of an enhancement in the envelope helium abundance on the atmospheric parameters of the blue HB stars, as might be caused by deep mixing on the red giant branch or primordial pollution from an earlier generation of intermediate mass asymptotic giant branch stars. Key words. Stars: atmospheres - Stars: evolution - Stars: horizontal branch - Globular clusters: individual: M 3 - Globular clusters: individual: M 13

  18. Parameter dependence in the atmospheric decoherence of modal entangled photon pairs

    CSIR Research Space (South Africa)

    Ibrahim, AH


    Full Text Available of the concurrence as a function of t for K = 0.067 and ℓ = 1. The five curves are obtained with five different sets of dimension param- eters, shown in Table II, all of which produce the same value of K. We select K = 0.067, because it represents a TABLE II... parameters given in Table II agreement with the SPS results. Moreover, the evolution of the concurrence is fully described by the single param- eter W = w0/r0 and modes with larger OAM values are more robust in turbulence. On the other hand, for weak...

  19. Hot HB Stars in Globular Clusters - Physical Parameters and Consequences for Theory. VI. The Second Parameter Pair M3 and M13 (United States)

    Moehler, S.; Landsman, W. B.; Sweigart, A. V.; Grundahl, F.


    We present the results of spectroscopic analyses of hot horizontal branch (HB) stars in M13 and M3, which form a famous second parameter pair. From the spectra we derived - for the first time in M13 - atmospheric parameters (effective temperature and surface gravity) as well as abundances of helium, magnesium, and iron. Consistent with analyses of hot HB stars in other globular clusters we find evidence for helium depletion and iron enrichment in stars hotter than about 12,000 K in both M3 and M13. Accounting for the iron enrichment substantially improves the agreement with canonical evolutionary models, although the derived gravities and masses are still somewhat too low. This remaining discrepancy may be an indication that scaled-solar metal-rich model atmospheres do not adequately represent the highly non-solar abundance ratios found in blue HB stars with radiative levitation. We discuss the effects of an enhancement in the envelope helium abundance on the atmospheric parameters of the blue HB stars, as might be caused by deep mixing on the red giant branch or primordial pollution from an earlier generation of intermediate mass asymptotic giant branch stars.

  20. Impact-parameter dependence of the total probability for electromagnetic electron-positron pair production in relativistic heavy-ion collisions

    International Nuclear Information System (INIS)

    Hencken, K.; Trautmann, D.; Baur, G.


    We calculate the impact-parameter-dependent total probability P total (b) for the electromagnetic production of electron-positron pairs in relativistic heavy-ion collisions in lowest order. We study expecially impact parameters smaller than the Compton wavelength of the electron, where the equivalent-photon approximation cannot be used. Calculations with and without a form factor for the heavy ions are done; the influence is found to be small. The lowest-order results are found to violate unitarity and are used for the calculation of multiple-pair production probabilities with the help of the approximate Poisson distribution already found in earlier publications

  1. Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides (United States)

    Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.


    Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

  2. Pair Identity and Smooth Variation Rules Applicable for the Spectroscopic Parameters of H2O Transitions Involving High-J States (United States)

    Ma, Q.; Tipping, R. H.; Lavrentieva, N. N.


    Two basic rules (i.e. the pair identity and the smooth variation) applicable for H2O transitions involving high-J states have been discovered. The origins of these rules are the properties of the energy levels and wavefunctions of H2O states with the quantum number J above certain boundaries. As a result, for lines involving high-J states in individually defined groups, all their spectroscopic parameters (i.e. the transition wavenumber, intensity, pressure-broadened half-width, pressure-induced shift, and temperature exponent) must follow these rules. One can use these rules to screen spectroscopic data provided by databases and to identify possible errors. In addition, by using extrapolation methods within the individual groups, one is able to predict the spectroscopic parameters for lines in this group involving very high-J states. The latter are required in developing high-temperature molecular spectroscopic databases such as HITEMP.

  3. Reassessment of the recombination parameters of chromium in n- and p-type crystalline silicon and chromium-boron pairs in p-type crystalline silicon

    International Nuclear Information System (INIS)

    Sun, Chang; Rougieux, Fiacre E.; Macdonald, Daniel


    Injection-dependent lifetime spectroscopy of both n- and p-type, Cr-doped silicon wafers with different doping levels is used to determine the defect parameters of Cr i and CrB pairs, by simultaneously fitting the measured lifetimes with the Shockley-Read-Hall model. A combined analysis of the two defects with the lifetime data measured on both n- and p-type samples enables a significant tightening of the uncertainty ranges of the parameters. The capture cross section ratios k = σ n /σ p of Cr i and CrB are determined as 3.2 (−0.6, +0) and 5.8 (−3.4, +0.6), respectively. Courtesy of a direct experimental comparison of the recombination activity of chromium in n- and p-type silicon, and as also suggested by modelling results, we conclude that chromium has a greater negative impact on carrier lifetimes in p-type silicon than n-type silicon with similar doping levels.

  4. A computer program for calculation of parameters necessary for the computation of reliable pair distribution functions of non-crystalline materials from limited diffraction data. II

    International Nuclear Information System (INIS)

    Hansen, F.Y.


    The pair distribution function of non-crystalline materials may be obtained by a Fourier transform of the structure factor as calculated in part I of this series. The structure factor is often limited in the sense that it shows significant oscillations at the maximal wave vector transfers obtainable. The Fourier transform of such functions, therefore, introduces truncation errors in the transformed function. With this program a parametrization of the small distance part of the pair distribution function is obtained according to a method described which enables one to eliminate truncation error from the final pair distribution function. It is based on a least squares fit calculation of the small distance part of the pair distribution function obtained by a direct transform of the experimental structure factor and a model pair distribution function obtained from a model structure factor truncated at the same wave vector transfers as the experimental factor. The storage requirement depends on the number of structure factor data and the number of peaks used to resolve the small distance part of the pair distribution function. In the present set-up storage requirement is set to 15083 words, which is estimated to be satisfactory for a large number of cases. (Auth.)

  5. Mahonian pairs


    Sagan, Bruce E.; Savage, Carla D.


    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  6. Mesoscopic pairing without superconductivity (United States)

    Hofmann, Johannes


    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  7. Measurement of the polarization parameter for antiproton-proton annihilation into charged pion and kaon pairs between 1.0 and 2.2 GeV/c

    International Nuclear Information System (INIS)

    Carter, A.A.; Coupland, M.; Eisenhandler, E.; Franklyn, C.; Gibson, W.R.; Hojvat, C.; Jeremiah, D.R.; Kalmus, P.I.P.; Pritchard, T.W.; Atkinson, M.; Duke, P.J.; Williams, D.T.; Woulds, J.N.; Arnison, G.T.J.; Astbury, A.; Hill, D.; Jones, D.P.


    The polarization parameter P for the reactions anti pp→π - π + and anti pp→K - K + has been measured over essentially the full angular range at 11 laboratory momenta between 1.0 and 2.2 GeV/c, using a proton target polarized perpendicular to the scattering plane. The angles and momenta of both final state particles were determined from wire spark chambers, using the deflection caused by the polarized target magnet. Between 1000 and 5300 p - π + events, and 140 and 1300 K - K + events, were measured at each momentum. Differential cross sections for anti pp→π - π + were obtained. These are in excellent agreement with previous results. The polarization parameter for both channels is very close to +1 over much of the angular range. Legendre polynomial fits to the data are presented. (Auth.)

  8. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)


    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  9. Model for pairing phase transition in atomic nuclei

    International Nuclear Information System (INIS)

    Schiller, A.; Guttormsen, M.; Hjorth-Jensen, M.; Rekstad, J.; Siem, S.


    A model is developed which allows the investigation and classification of the pairing phase transition in atomic nuclei. The regions of the parameter space are discussed for which a pairing phase transition can be observed. The model parameters include number of particles, attenuation of pairing correlations with increasing seniority, single-particle level spacing, and pairing gap parameter

  10. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)


    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  11. Pairing induced superconductivity in holography (United States)

    Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad


    We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.

  12. QCD pairing in primordial nuggets (United States)

    Lugones, G.; Horvath, J. E.


    We analyze the problem of boiling and surface evaporation of quark nuggets in the cosmological quark-hadron transition. Recently, it has been shown that QCD pairing modifies the stability properties of strange quark matter. More specifically, strange quark matter in a color-flavor locked state was found to be absolutely stable for a much wider range of the parameters than ordinary unpaired strange quark matter (G. Lugones and J. E. Horvath, Phys. Rev. D, 66, 074017 (2002)). Assuming that primordial quark nuggets are actually formed we analyze the consequences of pairing on the rates of boiling and surface evaporation in order to determine whether they could have survived.

  13. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.


    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  14. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.


    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  15. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.


    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  16. Pair creation at large inherent angles

    International Nuclear Information System (INIS)

    Chen, P.; Tauchi, T.; Schroeder, D.V.


    In the next-generation linear colliders, the low-energy e + e - pairs created during the collision of high-energy e + e - beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al. At energies where the beamstrahlung parameter Υ lies approximately in the range 0.6 approx-lt Υ approx-lt 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. Since the central issue is the transverse momentum for particles with large angles, the authors notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. In this paper they reinvestigate the problem, following essentially the same equivalent photon approach, but with changes in specific details including the virtual photon spectrum. In addition, various assumptions are made more explicit. The formulas derived are then applied to the collider parameters designed by Palmer

  17. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  18. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.


    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  19. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.


    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  20. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi


    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  1. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James


    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  2. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  3. Pair plasma relaxation time scales. (United States)

    Aksenov, A G; Ruffini, R; Vereshchagin, G V


    By numerically solving the relativistic Boltzmann equations, we compute the time scale for relaxation to thermal equilibrium for an optically thick electron-positron plasma with baryon loading. We focus on the time scales of electromagnetic interactions. The collisional integrals are obtained directly from the corresponding QED matrix elements. Thermalization time scales are computed for a wide range of values of both the total-energy density (over 10 orders of magnitude) and of the baryonic loading parameter (over 6 orders of magnitude). This also allows us to study such interesting limiting cases as the almost purely electron-positron plasma or electron-proton plasma as well as intermediate cases. These results appear to be important both for laboratory experiments aimed at generating optically thick pair plasmas as well as for astrophysical models in which electron-positron pair plasmas play a relevant role.

  4. Dual origin of pairing in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)


    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  5. Dual origin of pairing in nuclei (United States)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.


    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  6. Statistical deprojection of galaxy pairs (United States)

    Nottale, Laurent; Chamaraux, Pierre


    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  7. Pairing interaction method in crystal field theory

    International Nuclear Information System (INIS)

    Dushin, R.B.


    Expressions, permitting to describe matrix elements of secular equation for metal-ligand pairs via parameters of the method of pairing interactions, genealogical coefficients and Clebsch-Gordan coefficients, are given. The expressions are applicable to any level or term of f n and d n configurations matrix elements for the terms of the maximum multiplicity of f n and d n configurations and also for the main levels of f n configurations are tabulated

  8. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.


    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  9. Pairing fluctuations in trapped Fermi gases

    International Nuclear Information System (INIS)

    Viverit, Luciano; Bruun, Georg M.; Minguzzi, Anna; Fazio, Rosario


    We examine the contribution of pairing fluctuations to the superfluid order parameter for harmonically trapped atomic Fermi gases in the BCS regime. In the limit of small systems we consider, both analytically and numerically, their space and temperature dependence. We predict a parity effect, i.e., that pairing fluctuations show a maximum or a minimum at the center of the trap, depending on the value of the last occupied shell being even or odd. We propose to detect pairing fluctuations by measuring the density-density correlation function after a ballistic expansion of the gas

  10. Thermodynamics of pairing phase transition in nuclei

    International Nuclear Information System (INIS)

    Karim, Afaque; Ahmad, Shakeb


    The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

  11. [Paired kidneys in transplant]. (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús


    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  12. String pair production in non homogeneous backgrounds

    Energy Technology Data Exchange (ETDEWEB)

    Bolognesi, S. [Department of Physics “E. Fermi” University of Pisa, and INFN - Sezione di Pisa,Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Rabinovici, E. [Racah Institute of Physics, The Hebrew University of Jerusalem,91904 Jerusalem (Israel); Tallarita, G. [Departamento de Ciencias, Facultad de Artes Liberales,Universidad Adolfo Ibáñez, Santiago 7941169 (Chile)


    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  13. String pair production in non homogeneous backgrounds

    International Nuclear Information System (INIS)

    Bolognesi, S.; Rabinovici, E.; Tallarita, G.


    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  14. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  15. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel


    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  16. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.


    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  17. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail:; Bauke, Heiko, E-mail:; Keitel, Christoph H.


    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  18. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.


    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  19. Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars

    International Nuclear Information System (INIS)

    Leinson, L.B.


    The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating

  20. Strong pairing approximation in comparison with the exact solutions to the pairing Hamiltonian

    Directory of Open Access Journals (Sweden)

    Lunyov A.V.


    Full Text Available Results of the Strong Pairing Approximation (SPA as a method with the exact particle number conservation are compared with those of the quasiparticle method (QM. It is shown that SPA comes to the same equations as QM for the gap parameter, chemical potential and one- and two-quasiparticle states. Calculations are performed for 14864Gd84 as an example, and compared with the exact solutions to the pairing Hamiltonian.

  1. Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm. (United States)

    Hao, Pei-Yi

    This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

  2. Coulomb pair-creation

    International Nuclear Information System (INIS)

    Hrasko, P.; Foeldy, L.; Toth, A.


    Electron-positron pair production in strong Coulomb fields is outlined. It is shown that the singular behaviour of the adiabatic basis can be removed if solutions of the time dependent external field Dirac equation are used as a basis to expand the fermion field operator. This latter 'asymptotic basis' makes it possible to introduce Feynman-propagator. Applying the reduction technique, the computation of all of the basic quantities can be reduced to the solution of an integral equation. The positron spectrum for separable potential model with Lorentzian time dependence and for potential jump is analyzed in the pole approximation. (author)

  3. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.


    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  4. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  5. Assessing Intimacy: The Pair Inventory. (United States)

    Schaefer, Mark T.; Olson, David H.


    Personal Assessment of Intimacy in Relationships (PAIR) provides systematic information in five types of intimacy: emotional, social, sexual, intellectual and recreational. PAIR can be used with couples in marital therapy and enrichment groups. (Author)

  6. The inverse problem for Schwinger pair production

    Directory of Open Access Journals (Sweden)

    F. Hebenstreit


    Full Text Available The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  7. On e(+)e(-) pair production by colliding electromagnetic pulses

    NARCIS (Netherlands)

    Narozhny, NB; Bulanov, SS; Mur, VD; Popov, VS


    Electron-positron pair production from vacuum in an electromagnetic field created by two counterpropagating focused laser pulses interacting with each other is analyzed. The dependence of the number of produced pairs on the intensity of a laser pulse and the focusing parameter is studied with a

  8. QSO Pairs across Active Galaxies

    Indian Academy of Sciences (India)


    Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

  9. Pairing in hadron structure

    International Nuclear Information System (INIS)

    Chela-Flores, J.


    A many-body approach to hadron structure is presented, in which we consider two parton species: spin-0 (b-partons), and spin-1/2 (f-partons). We extend a boson and a fermion pairing scheme for the b-, and f-partons respectively, into a Yang-Mills gauge theory. The main feature of this theory is that the gauge field is not identified with the usual gluon field variable in QCD. We study the confinement problem of the hadron constituents, and obtain, for low temperatures, partons that are confined by energy gaps. As the critical temperatures for the corresponding phase transitions are approached, the energy gap gradually disappears, and confinement is lost. The theory goes beyond the non-relativistic harmonic oscillator quark model, in the sense of giving physical reasons why a non-relativistic approximation is adequate in describing the internal dynamics of hadron structure. (author)

  10. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.


    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  11. General form of Darboux transformations for Lax pairs

    International Nuclear Information System (INIS)

    Zhou Zixiang.


    In this paper, the author finds all the Darboux transformations for general Lax pair with coefficients analytic to spectral parameter. The auto-Baecklund property of these Darboux transformations for n x n system is also verified. (author). 7 refs

  12. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert


    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  13. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.


    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  14. Experimental many-pairs nonlocality (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian


    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  15. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil


    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  16. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid


    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  17. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan


    Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  18. Sensitivity analysis of physiochemical interaction model: which pair ...

    African Journals Online (AJOL)

    ... of two model parameters at a time on the solution trajectory of physiochemical interaction over a time interval. Our aim is to use this powerful mathematical technique to select the important pair of parameters of this physical process which is cost-effective. Keywords: Passivation Rate, Sensitivity Analysis, ODE23, ODE45 ...

  19. Pair q-coherent states and their antibunching effects

    International Nuclear Information System (INIS)

    Wang Zhongqing; Li Junhong; An Guanglei; Chongqing Univ. of Posts and Telecommunications, Chongqing


    Using the properties of the q-deformed boson creation and annihilation operators and their inverse operators, two kind of q-deformed pair coherent states are introduced. Antibunching effects and correlation properties between two modes in the states are investigated. It is shown that q-deformed pair coherent states exhibit antibunching effects and the photons of the two modes are correlated. These nonclassical effects are influenced by the parameter q. These effects increase when |lnq| increases. (authors)

  20. Lepton pair production at ISR energies and QCD

    International Nuclear Information System (INIS)

    Altarelli, G.; Martinelli, G.


    Motivated by some recent results from the ISR we have considered all available data on the production of Drell-Yan pairs by high energy proton beams. We show that the lepton pair cross sections and qsub(T) distributions are correctly described by QCD using the known distributions of partons in the proton and acceptable values of the QCD scale Λ. No other free parameter is required. Within the accuracy of the data no appreciable intrinsic transverse momentum is needed. (orig.)

  1. Determination of constants of factorized pairing force from conservation laws

    International Nuclear Information System (INIS)

    Voronkov, Yu.P.; Mikhajlov, V.M.


    The constants of a factorized interaction in the particle-particle channel are evaluated on the basis of average field parameters and Cooper pairing. The relations between the constants of multipole particle-particle forces are derived for the spherical nuclei. The constants of the quadrupole pairing are obtained for deformed nuclei from the angular momentum conservation law. The calculated constants are compared with empiricalones

  2. Investigation of the paired-gear method in selectivity studies

    DEFF Research Database (Denmark)

    Sistiaga, Manu; Herrmann, Bent; Larsen, R.B.


    was repeated throughout the eight cases in this investigation. When using the paired-gear method, the distribution of the estimated L50 and SR is wider; the distribution of the estimated split parameter has a higher variability than the true split; the estimated mean L50 and SR can be biased; the estimated...... recommend that the methodology used to obtain selectivity estimates using the paired-gear method be reviewed....

  3. Wigner function and tomogram of the pair coherent state

    International Nuclear Information System (INIS)

    Meng, Xiang-Guo; Wang, Ji-Suo; Fan, Hong-Yi


    Using the entangled state representation of Wigner operator and the technique of integration within an ordered product (IWOP) of operators, the Wigner function of the pair coherent state is derived. The variations of the Wigner function with the parameters α and q in the ρ-γ phase space are discussed. The physical meaning of the Wigner function for the pair coherent state is given by virtue of its marginal distributions. The tomogram of the pair coherent state is calculated with the help of the Radon transform between the Wigner operator and the projection operator of the entangled state |η 1 ,η 2 ,τ 1 ,τ 2 >

  4. Orbitally limited pair-density-wave phase of multilayer superconductors (United States)

    Möckli, David; Yanase, Youichi; Sigrist, Manfred


    We investigate the magnetic field dependence of an ideal superconducting vortex lattice in the parity-mixed pair-density-wave phase of multilayer superconductors within a circular cell Ginzburg-Landau approach. In multilayer systems, due to local inversion symmetry breaking, a Rashba spin-orbit coupling is induced at the outer layers. This combined with a perpendicular paramagnetic (Pauli) limiting magnetic field stabilizes a staggered layer dependent pair-density-wave phase in the superconducting singlet channel. The high-field pair-density-wave phase is separated from the low-field BCS phase by a first-order phase transition. The motivating guiding question in this paper is: What is the minimal necessary Maki parameter αM for the appearance of the pair-density-wave phase of a superconducting trilayer system? To address this problem we generalize the circular cell method for the regular flux-line lattice of a type-II superconductor to include paramagnetic depairing effects. Then, we apply the model to the trilayer system, where each of the layers are characterized by Ginzburg-Landau parameter κ0 and a Maki parameter αM. We find that when the spin-orbit Rashba interaction compares to the superconducting condensation energy, the orbitally limited pair-density-wave phase stabilizes for Maki parameters αM>10 .

  5. Nuclear scissors mode with pairing

    International Nuclear Information System (INIS)

    Balbutsev, E. B.; Malov, L. A.; Schuck, P.; Urban, M.; Vinas, X.


    The coupled dynamics of the scissors mode and the isovector giant quadrupole resonance are studied using a generalized Wigner function moments method, taking into account pair correlations. Equations of motion for angular momentum, quadrupole moment, and other relevant collective variables are derived on the basis of the time-dependent Hartree-Fock-Bogolyubov equations. Analytical expressions for energy centroids and transition probabilities are found for the harmonic-oscillator model with the quadrupole-quadrupole residual interaction and monopole pairing force. Deformation dependences of energies and B(M1) values are correctly reproduced. The inclusion of pair correlations leads to a drastic improvement in the description of qualitative and quantitative characteristics of the scissors mode.

  6. Pairing mechanism in oxide superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.


    A useful way to learn about the pairing mechanism that is responsible for high T c superconductivity is to study properties of model Hamiltonians on small systems. The goal is to find the simplest model that can describe the essential physics of high T c superconductivity. The authors have used Monte Carlo simulation and exact diagonalization techniques to study properties of systems of up to 64 sites. Their results show that spin fluctuations and other spin related mechanisms induced by a Hubbard on-site repulsion U are not likely to give rise to pairing, neither in one nor in multiple band models. In contrast, charge fluctuations in a model with both strong U and V (repulsion between Cu and O) are shown to give rise to pairing and it is suggested that this model provides a plausible mechanism for high T c superconductivity

  7. Exclusive electroproduction of pion pairs

    International Nuclear Information System (INIS)

    Warkentin, N.; Schaefer, A.; Diehl, M.; Ivanov, D. Yu.


    We investigate electroproduction of pion pairs on the nucleon in the framework of QCD factorization for hard exclusive processes. We extend previous analyses by taking the hard-scattering coefficients at next-to-leading order in α s . The dynamics of the produced pion pair is described by two-pion distribution amplitudes, for which we perform a detailed theoretical and phenomenological analysis. In particular, we obtain constraints on these quantities by comparing our results with measurements of angular observables that are sensitive to the interference between two-pion production in the isoscalar and isovector channels. (orig.)

  8. Instantons in lepton pair production

    International Nuclear Information System (INIS)

    Brandenburg, A.; Ringwald, A.; Utermann, A.


    We consider QCD instanton-induced contributions to lepton pair production in hadron-hadron collisions. We relate these contributions to those known from deep inelastic scattering and demonstrate that they can be calculated reliably for sufficiently large momentum transfer. We observe that the instanton contribution to the angular distribution of the lepton pairs at finite momentum transfer strongly violates the Lam-Tung relation - a relation between coefficient functions of the angular distribution which is valid within the framework of ordinary perturbation theory. The drastic violation of this relation, as seen in experimental data, might be related to such instanton-induced effects. (Orig.)


    Energy Technology Data Exchange (ETDEWEB)

    Timokhin, A. N.; Harding, A. K., E-mail: [Astrophysics Science Division, NASA/Goddard Space Flight Center, Greenbelt, MD 20771 (United States)


    We study the efficiency of pair production in polar caps of young pulsars under a variety of conditions to estimate the maximum possible multiplicity of pair plasma in pulsar magnetospheres. We develop a semi-analytic model for calculation of cascade multiplicity which allows efficient exploration of the parameter space and corroborate it with direct numerical simulations. Pair creation processes are considered separately from particle acceleration in order to assess different factors affecting cascade efficiency, with acceleration of primary particles described by recent self-consistent non-stationary model of pair cascades. We argue that the most efficient cascades operate in the curvature radiation/synchrotron regime, the maximum multiplicity of pair plasma in pulsar magnetospheres is ∼few × 10{sup 5}. The multiplicity of pair plasma in magnetospheres of young energetic pulsars weakly depends on the strength of the magnetic field and the radius of curvature of magnetic field lines and has a stronger dependence on pulsar inclination angle. This result questions assumptions about very high pair plasma multiplicity in theories of pulsar wind nebulae.

  10. Separable pairing force for relativistic quasiparticle random-phase approximation

    International Nuclear Information System (INIS)

    Tian Yuan; Ma Zhongyu; Ring, Peter


    We have introduced a separable pairing force, which was adjusted to reproduce the pairing properties of the Gogny force in nuclear matter. This separable pairing force is able to describe in relativistic Hartree-Bogoliubov (RHB) calculations the pairing properties in the ground state of finite nuclei on almost the same footing as the original Gogny interaction. In this work we investigate excited states using the Relativistic Quasiparticle Random-Phase Approximation (RQRPA) with the same separable pairing force. For consistency the Goldstone modes and the convergence with various cutoff parameters in this version of RQRPA are studied. The first excited 2 + states for the chain of Sn isotopes with Z=50 and the chain of isotones with N=82 isotones are calculated in RQRPA together with the 3 - states of Sn isotopes. By comparing our results with experimental data and with the results of the original Gogny force we find that this simple separable pairing interaction is very successful in depicting the pairing properties of vibrational excitations.

  11. Guanidinium Pairing Facilitates Membrane Translocation

    Czech Academy of Sciences Publication Activity Database

    Allolio, Christoph; Baxová, Katarína; Vazdar, M.; Jungwirth, Pavel


    Roč. 120, č. 1 (2016), s. 143-153 ISSN 1520-6106 R&D Projects: GA ČR GA13-06181S Institutional support: RVO:61388963 Keywords : ab initio molecular dynamics * guanidinium * like charge pairing * membrane Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.177, year: 2016

  12. Pairing Linguistic and Music Intelligences (United States)

    DiEdwardo, MaryAnn Pasda


    This article describes how music in the language classroom setting can be a catalyst for developing reading, writing, and understanding skills. Studies suggest that pairing music and linguistic intelligences in the college classroom improves students' grades and abilities to compose theses statements for research papers in courses that emphasize…

  13. Conjugal Pairing in Escherichia Coli

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 13; Issue 8. Conjugal Pairing in Escherichia Coli. Joshua Lederberg. Classics Volume 13 Issue 8 August 2008 pp 793-794. Fulltext. Click here to view fulltext PDF. Permanent link: ...

  14. Rank error-correcting pairs

    DEFF Research Database (Denmark)

    Martinez Peñas, Umberto; Pellikaan, Ruud


    Error-correcting pairs were introduced as a general method of decoding linear codes with respect to the Hamming metric using coordinatewise products of vectors, and are used for many well-known families of codes. In this paper, we define new types of vector products, extending the coordinatewise ...

  15. 'Leonard pairs' in classical mechanics

    International Nuclear Information System (INIS)

    Zhedanov, Alexei; Korovnichenko, Alyona


    Leonard pairs (LP) are matrices with the property of mutual tri-diagonality. We introduce and study a classical analogue of LP. We show that corresponding classical 'Leonard' dynamical variables satisfy non-linear relations of the AW-type with respect to Poisson brackets. (author)

  16. On the pair creation effect in radiative charmonium transitions

    International Nuclear Information System (INIS)

    Lewin, K.


    Contribution to radiative charmonium decay amplitudes which come from Feynman diagrams containing creation of internal c anti c quark pair is investigated. The a im of the paper is calulation of this pair creation correction to the wave function overlap integral of the transition amplitude in a quasilocal semirelativistic approximation which works for charmed and heavier quark pairs. The application to the decay width of the spin flip transition psi(3685) → γchi(3415) givesa 12% correction to the nopair term using a meson radius near 0.5 Fm and a scale parameter Λ=400 MeV taken from fits inchar=monium spectroscopy. The error of the approximation is estimated to be smaller than 50%. The investigation indicates that also in the case of electroweak meson decays quatitative results cannot be expected from the no-pair contribution alone

  17. On Dual Gabor Frame Pairs Generated by Polynomials

    DEFF Research Database (Denmark)

    Christensen, Ole; Rae Young, Kim


    We provide explicit constructions of particularly convenient dual pairs of Gabor frames. We prove that arbitrary polynomials restricted to sufficiently large intervals will generate Gabor frames, at least for small modulation parameters. Unfortunately, no similar function can generate a dual Gabo...

  18. Amperean Pairing and the Pseudogap Phase of Cuprate Superconductors (United States)

    Lee, Patrick A.


    The enigmatic pseudogap phase in underdoped cuprate high-Tc superconductors has long been recognized as a central puzzle of the Tc problem. Recent data show that the pseudogap is likely a distinct phase, characterized by a medium range and quasistatic charge ordering. However, the origin of the ordering wave vector and the mechanism of the charge order is unknown. At the same time, earlier data show that precursive superconducting fluctuations are also associated with this phase. We propose that the pseudogap phase is a novel pairing state where electrons on the same side of the Fermi surface are paired, in strong contrast with conventional Bardeen-Cooper-Schrieffer theory which pairs electrons on opposite sides of the Fermi surface. In this state the Cooper pair carries a net momentum and belongs to a general class called pair density wave. The microscopic pairing mechanism comes from a gauge theory formulation of the resonating valence bond (RVB) picture, where spinons traveling in the same direction feel an attractive force in analogy with Ampere's effects in electromagnetism. We call this Amperean pairing. Charge order automatically appears as a subsidiary order parameter even when long-range pair order is destroyed by phase fluctuations. Our theory gives a prediction of the ordering wave vector which is in good agreement with experiment. Furthermore, the quasiparticle spectrum from our model explains many of the unusual features reported in photoemission experiments. The Fermi arc, the unusual way the tip of the arc terminates, and the relation of the spanning vector of the arc tips to the charge ordering wave vector also come out naturally. Finally, we propose an experiment that can directly test the notion of Amperean pairing.

  19. Parameter Estimation

    DEFF Research Database (Denmark)

    Sales-Cruz, Mauricio; Heitzig, Martina; Cameron, Ian


    of optimisation techniques coupled with dynamic solution of the underlying model. Linear and nonlinear approaches to parameter estimation are investigated. There is also the application of maximum likelihood principles in the estimation of parameters, as well as the use of orthogonal collocation to generate a set......In this chapter the importance of parameter estimation in model development is illustrated through various applications related to reaction systems. In particular, rate constants in a reaction system are obtained through parameter estimation methods. These approaches often require the application...... of algebraic equations as the basis for parameter estimation.These approaches are illustrated using estimations of kinetic constants from reaction system models....

  20. Odd-frequency pairing in superconducting heterostructures . (United States)

    Golubov, A. A.; Tanaka, Y.; Yokoyama, T.; Asano, Y.


    We present a general theory of the proximity effect in junctions between unconventional superconductors and diffusive normal metals (DN) or ferromagnets (DF). We consider all possible symmetry classes in a superconductor allowed by the Pauli principle: even-frequency spin-singlet even-parity state, even-frequency spin-triplet odd-parity state, odd-frequency spin-triplet even-parity state and odd-frequency spin-singlet odd-parity state. For each of the above states, symmetry and spectral properties of the induced pair amplitude in the DN (DF) are determined. The cases of junctions with spin-singlet s- and d-wave superconductors and spin-triplet p-wave superconductors are adressed in detail. We discuss the interplay between the proximity effect and midgap Andreev bound states arising at interfaces in unconventional (d- or p-wave) junctions. The most striking property is the odd-frequency symmetry of the pairing amplitude induced in DN (DF) in contacts with p-wave superconductors. This leads to zero-energy singularity in the density of states and to anomalous screening of an external magnetic field. Peculiarities of Josephson effect in d- or p-wave junctions are discussed. Experiments are suggested to detect an order parameter symmetry using heterostructures with unconventional superconductors.

  1. One Monopole-Antimonopole Pair Solutions

    International Nuclear Information System (INIS)

    Teh, Rosy; Wong, K.-M.


    We present new classical generalized one monopole-antimonopole pair solutions of the SU(2) Yang-Mills-Higgs theory with the Higgs field in the adjoint representation. We show that in general the one monopole-antimonopole solution need not be solved by imposing mθ-winding number to be integer greater than one. We also show that this solution can be solved when m = 1 by transforming the large distance asymptotic solutions to general solutions that depend on a parameter p. Secondly we show that these large distance asymptotic solutions can be further generalized to the Jacobi elliptic functions. We focus our numerical calculation on the Jacobi elliptic functions solution when the nφ-winding number is one and show that this generalized Jacobi elliptic 1-MAP solution possesses lower energy. All these solutions are numerical finite energy non-BPS solutions of the Yang-Mills-Higgs field theory.

  2. Inhomogeneous ensembles of radical pairs in chemical compasses (United States)

    Procopio, Maria; Ritz, Thorsten


    The biophysical basis for the ability of animals to detect the geomagnetic field and to use it for finding directions remains a mystery of sensory biology. One much debated hypothesis suggests that an ensemble of specialized light-induced radical pair reactions can provide the primary signal for a magnetic compass sensor. The question arises what features of such a radical pair ensemble could be optimized by evolution so as to improve the detection of the direction of weak magnetic fields. Here, we focus on the overlooked aspect of the noise arising from inhomogeneity of copies of biomolecules in a realistic biological environment. Such inhomogeneity leads to variations of the radical pair parameters, thereby deteriorating the signal arising from an ensemble and providing a source of noise. We investigate the effect of variations in hyperfine interactions between different copies of simple radical pairs on the directional response of a compass system. We find that the choice of radical pair parameters greatly influences how strongly the directional response of an ensemble is affected by inhomogeneity.

  3. Charge Aspects of Composite Pair Superconductivity (United States)

    Flint, Rebecca


    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.


    International Nuclear Information System (INIS)

    Moscibrodzka, M.; Gammie, C. F.; Dolence, J. C.; Shiokawa, H.


    Electron-positron pairs may be produced near accreting black holes by a variety of physical processes, and the resulting pair plasma may be accelerated and collimated into a relativistic jet. Here, we use a self-consistent dynamical and radiative model to investigate pair production by γγ collisions in weakly radiative accretion flows around a black hole of mass M and accretion rate M-dot . Our flow model is drawn from general relativistic magnetohydrodynamic simulations, and our radiation field is computed by a Monte Carlo transport scheme assuming the electron distribution function is thermal. We argue that the pair production rate scales as r -6 M -1 M-dot 6 . We confirm this numerically and calibrate the scaling relation. This relation is self-consistent in a wedge in M, M-dot parameter space. If M-dot is too low the implied pair density over the poles of the black hole is below the Goldreich-Julian density and γγ pair production is relatively unimportant; if M-dot is too high the models are radiatively efficient. We also argue that for a power-law spectrum the pair production rate should scale with the observables L X ≡ X-ray luminosity and M as L 2 X M -4 . We confirm this numerically and argue that this relation likely holds even for radiatively efficient flows. The pair production rates are sensitive to black hole spin and to the ion-electron temperature ratio which are fixed in this exploratory calculation. We finish with a brief discussion of the implications for Sgr A* and M87.

  5. Pair breaking and density of states in disordered superconductors

    International Nuclear Information System (INIS)

    Weinkauf, A.; Zittartz, J.


    It is shown that pair breaking occurs in a disordered superconductor due to spatial variations of the order parameter, although the system is time reversal invariant. The pair breaking effect is reflected by the occurence of some interesting fine structure in the one particle density of states. Discrete bound states and split-off impurity bands show up in the single impurity case and for very dilute alloys, respectively. For finite alloy concentrations the calculations are done within the CPA. Although principally important, the fine structure is concentrated in an energy range too narrow to be detected experimentally. (orig.) [de

  6. Energy gap in S- and D-wave pairing superconductors

    International Nuclear Information System (INIS)

    Dolgov, O.V.; Golubov, A.A.


    In this paper the ratio of 2Δ g /T c , where Δ g is the gap edge, T c is the critical temperature, is calculated in the framework of the model of strong electron-phonon coupling. Both isotropic and anisotropic pairing cases are considered. It is shown that the isotropic Eliashberg model can not account for the large values of the ratio 2Δ g /T c for the reasonable values of the electron-phonon coupling parameter λ while anisotropic pairing can resolve this problem

  7. Kinetic equations with pairing correlations

    International Nuclear Information System (INIS)

    Fauser, R.


    The Gorkov equations are derived for a general non-equilibrium system. The Gorkov factorization is generalized by the cumulant expansion of the 2-particle correlation and by a generalized Wick theorem in the case of a perturbation expansion. A stationary solution for the Green functions in the Schwinger-Keldysh formalism is presented taking into account pairing correlations. Especially the effects of collisional broadening on the spectral functions and Green functions is discussed. Kinetic equations are derived in the quasi-particle approximation and in the case of particles with width. Explicit expressions for the self-energies are given. (orig.)

  8. Endocrine factors of pair bonding. (United States)

    Stárka, L


    Throughout literature--fiction and poetry, fine arts and music--falling in love and enjoying romantic love plays a central role. While several psychosocial conceptions of pair attachment consider the participation of hormones, human endocrinology has dealt with this theme only marginally. According to some authors in addictology, falling in love shows some signs of hormonal response to stressors with changes in dopamine and serotonin signalling and neurotrophin (transforming growth factor b) concentration. Endorphins, oxytocin and vasopressin may play a role during the later phases of love. However, proof of hormonal events associated with love in humans has, until recently, been lacking.

  9. Pairs of dual periodic frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Goh, Say Song


    The time–frequency analysis of a signal is often performed via a series expansion arising from well-localized building blocks. Typically, the building blocks are based on frames having either Gabor or wavelet structure. In order to calculate the coefficients in the series expansion, a dual frame...... is needed. The purpose of the present paper is to provide constructions of dual pairs of frames in the setting of the Hilbert space of periodic functions L2(0,2π). The frames constructed are given explicitly as trigonometric polynomials, which allows for an efficient calculation of the coefficients...

  10. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...

  11. Ion pairing in ionic liquids

    International Nuclear Information System (INIS)

    Kirchner, Barbara; Malberg, Friedrich; Firaha, Dzmitry S; Hollóczki, Oldamur


    In the present article we briefly review the extensive discussion in literature about the presence or absence of ion pair-like aggregates in ionic liquids. While some experimental studies point towards the presence of neutral subunits in ionic liquids, many other experiments cannot confirm or even contradict their existence. Ion pairs can be detected directly in the gas phase, but no direct method is available to observe such association behavior in the liquid, and the corresponding indirect experimental proofs are based on such assumptions as unity charges at the ions. However, we have shown by calculating ionic liquid clusters of different sizes that assuming unity charges for ILs is erroneous, because a substantial charge transfer is taking place between the ionic liquid ions that reduce their total charge. Considering these effects might establish a bridge between the contradicting experimental results on this matter. Beside these results, according to molecular dynamics simulations the lifetimes of ion–ion contacts and their joint motions are far too short to verify the existence of neutral units in these materials. (topical review)

  12. Some advances in pairing theory

    International Nuclear Information System (INIS)

    Rowe, D.J.


    Two advances are reviewed in the application of pairing-force theory in the nuclear shell model. The first exploits a discovery that a wide range of two-nucleon interactions conserve seniority as a good quantum number. As a consequence, the eigenstates of a Hamiltonian with such an interaction belong to irreducible representations of a compact unitary-symplectic group. This makes it possible to extend the simply-solvable models with J=0 pairing forces to a much richer set of models and still obtain states uniquely classified by their seniority and angular momentum quantum numbers. Moreover, many of the low-lying energy levels of such models can be obtained algebraically; in technical terms, the models are in some cases completely solvable and in other cases partially solvable by algebraic methods. The second advance exploits the discovery that, in a coherent state representation, states of good nucleon number can be projected analytically from BCS vacuum and excited quasiparticle states. This makes it possible to perform calculations in a number-projected BCS basis without losing much of the advantage of working of the quasiparticle scheme. (Author)

  13. Pairing phase transition and thermodynamical quantities in 148,149Sm

    International Nuclear Information System (INIS)

    Razavi, R.; Behkami, A.N.; Dehghani, V.


    The nuclear level densities and entropies in 148,149 Sm have been calculated in the framework of the superconducting theory that includes modified nuclear pairing gap. For modified pairing gap parameter the smooth transition from the BCS to the Fermi type distributions is used. By applying modified pairing gap, the extracted S-shaped heat capacity as a function of nuclear temperature exhibits a physical and smoother behavior instead of the singular behavior predicted by the BCS equations at critical temperature

  14. BEC-BCS crossover in a (p+ip)-wave pairing Hamiltonian coupled to bosonic molecular pairs

    International Nuclear Information System (INIS)

    Dunning, Clare; Isaac, Phillip S.; Links, Jon; Zhao, Shao-You


    We analyse a (p+ip)-wave pairing BCS Hamiltonian, coupled to a single bosonic degree of freedom representing a molecular condensate, and investigate the nature of the BEC-BCS crossover for this system. For a suitable restriction on the coupling parameters, we show that the model is integrable and we derive the exact solution by the algebraic Bethe ansatz. In this manner we also obtain explicit formulae for correlation functions and compute these for several cases. We find that the crossover between the BEC state and the strong pairing p+ip phase is smooth for this model, with no intermediate quantum phase transition.

  15. Broken-pair, generalized seniority and interacting boson approximations in a spectroscopic study of Sn nuclei

    International Nuclear Information System (INIS)

    Bonsignori, K.; Allaart, K.; Egmond, A. van


    A broken-pair study of Sn nuclei is reported in which the model space includes two broken pair states. It is shown that for even Sn nuclei, with a rather simple Gaussian interaction and with single-particle-energies derived from data on odd nuclei, the main features of the excitation spectra up to about 3.5 MeV may be reproduced in this way. The idea of the generalized seniority scheme, that the composition of S-pair operator and that of the D-pair operator may be independent of the total number of pairs, is confirmed by the pair structures which result from energy minimization and diagonalization for each number of pairs separately. A general procedure is described to derive IBA parameters when the valence orbits are nondegenerate. Numerical results for Sn nuclei are given. (U.K.)

  16. Inventory parameters

    CERN Document Server

    Sharma, Sanjay


    This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

  17. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.


    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  18. Dynamical pairing correlations in rotating nuclei

    International Nuclear Information System (INIS)

    Szymanski, Z.


    When the atomic nucleus rotates fast enough the static pair correlations may be destroyed. In this situation the pair-vibrations become an important manifestation of the short-range attractive pairing force. The influence of this effect on nuclear properties at high spin is discussed. (orig.)

  19. Pairing mechanism in Bi-O superconductors: A finite-size chain calculation

    International Nuclear Information System (INIS)

    Aligia, A.A.; Nunez Regueiro, M.D.; Gagliano, E.R.


    We have studied the pairing mechanism in BiO 3 systems by calculating the binding energy of a pair of holes in finite Bi-O chains, for parameters that simulate three-dimensional behavior. In agreement with previous results using perturbation theory in the hopping t, for covalent Bi-O binding and parameters for which the parent compound has a disproportionate ground state, pairing induced by the presence of biexcitons is obtained for sufficiently large interatomic Coulomb repulsion. The analysis of appropriate correlation functions shows a rapid metallization of the system as t and the number of holes increase. This fact shrinks the region of parameters for which the finite-size calculations can be trusted without further study. The same model for other parameters yields pairing in two other regimes: bipolaronic and magnetic excitonic

  20. Coherent pair creation from beam-beam interaction

    International Nuclear Information System (INIS)

    Chen, Pisin.


    It has recently been recognized that in future linear colliders, there is a finite probability that the beamstrahlung photons will turn into e + e - pairs induced by the same beam-beam field, and this would potentially cause background problems. In this paper, we first review the probability of such a coherent pair creation process. It is seen that the constraint on the beamstrahlung parameter, Υ, is tight of these coherent pairs to be totally suppressed. We then point out that there exists a minimum energy for the pair-created particles, which scales as ∼1/5Υ. When combining this condition with the deflection angle for the low-energy particles, the constraint on the allowable Υ value is much relaxed. Finally, we calculate the effective cross section for producing the weak bosons by the low-energy e + e - pairs. It is shown that these cross sections are substantial for Υ > 1. We suggest that this effect can help to autoscan the particle spectrum in the high energy frontier. 10 refs., 2 figs

  1. Formation and interference of two pairs of vortex streets

    International Nuclear Information System (INIS)

    Kamemoto, Kyoji


    A series of theoretical analysis were made on the mechanism of the formation and interference of two pairs of vortex streets appearing behind a pair of two long bars placed perpendicularly to uniform flow. In the first part, the flow model used for this study is explained. It was assumed that two pairs of vortex sheets having the same interval (h) were placed at the distance of g in non-viscous flow. Then small disturbance was given to the flow, and the behavior of the vortex sheets in course of time was analyzed by solving a set of linear simultaneous differential equations. Eight fundamental modes of small displacement were obtained as the independent solutions of the equations. The fundamental modes and the associated parameters are presented. In the second part, a set of non-linear differential equations were derived by substituting the vortex sheets with vortex streets with finite intensity. The set of equations were solved numerically. The results of numerical solutions for various conditions are presented. Main conclusions drawn from this study are that the condition of the existence of two pairs of vortex sheets is g/h >= 1, and that the mutual interference between two pairs of vortex streets becomes conspicuous for g/h <= 2. Some discussions made by other researchers and the author are also presented at the end of this paper. (Aoki, K.)

  2. On the restoration of symmetry in paired Fermion systems

    International Nuclear Information System (INIS)

    Flocard, H.


    We consider the problem of symmetry restoration as treated by the method of variation after projection (VAP) on good quantum numbers. We show that for compact groups, the convergence of the connected-linked expansion of the VAP kernels over the physically relevant interval of integration of the pairing gauge angle is not guaranteed. We propose instead a method which generates approximations of increasing precision which are periodic with respect to the gauge angle while differing from truncations of the Fourier expansion of the VAP kernels. For the projection on good particle number in paired fermion systems, this new approach is shown to be equivalent to an expansion in powers of the pairing tensor. For the lowest order approximation, an analytical integration over the gauge angle is performed explicitly. It provides the algebraic forms of the single particle Hamiltonian and of the pairing field entering generalized Hartree endash Fock endash Bogoljubov equations. Contrary to most approximations, the validity of the expressions for the energy and mean values of operators thus obtained is not a priori restricted where the fluctuation of the operator associated with the broken symmetry is large. We also derive the first-order correction to the pairing-order parameter. We test the quality of the proposed method on a non-trivial soluble model. copyright 1997 Academic Press, Inc

  3. Importance of interlayer pair tunneling: A variational perspective

    International Nuclear Information System (INIS)

    Medhi, Amal; Basu, Saurabh


    We study the effect of interlayer pair tunneling in a bilayer superconductor where each layer is described by a two dimensional t-J model and the two layers are connected by the Josephson pair tunneling term. We study this model using a grand canonical variational Monte Carlo (GVMC) method, for which we develop a new algorithm to perform Monte Carlo simulation of a system with fluctuating particle number. The variational wavefunction is taken to be the product of two Gutzwiller projected d-wave BCS wavefunctions with variable particle densities, one for each layer. We calculate the energy of the above state as a function of the d-wave superconducting gap parameter, Δ. We find that the interlayer pair tunneling energy, E perpendicular shows interesting variation with Δ. E perpendicular tends to enhance the optimal value of Δ, thereby the superconducting pairing. However the magnitude of the tunneling energy is found to be too small to have any appreciable effect on the physical properties. While the result is supported by early experiments and hence may appear known to the community, the current work presents a new approach to the problem and confirms the diminished role of interlayer pair tunneling by directly calculating its contribution to superconducting condensation energy.

  4. Pair shell model description of collective motions

    International Nuclear Information System (INIS)

    Chen Hsitseng; Feng Dahsuan


    The shell model in the pair basis has been reviewed with a case study of four particles in a spherical single-j shell. By analyzing the wave functions according to their pair components, the novel concept of the optimum pairs was developed which led to the proposal of a generalized pair mean-field method to solve the many-body problem. The salient feature of the method is its ability to handle within the framework of the spherical shell model a rotational system where the usual strong configuration mixing complexity is so simplified that it is now possible to obtain analytically the band head energies and the moments of inertia. We have also examined the effects of pair truncation on rotation and found the slow convergence of adding higher spin pairs. Finally, we found that when the SDI and Q .Q interactions are of equal strengths, the optimum pair approximation is still valid. (orig.)

  5. Coexistence of pairing gaps in three-component Fermi gases

    International Nuclear Information System (INIS)

    Nummi, O H T; Kinnunen, J J; Toermae, P


    We study a three-component superfluid Fermi gas in a spherically symmetric harmonic trap using the Bogoliubov-deGennes method. We predict a coexistence phase in which two pairing field order parameters are simultaneously non-zero, in stark contrast to studies performed for trapped gases using local density approximation. We also discuss the role of atom number conservation in the context of a homogeneous system.

  6. Pairing-bag excitations in small-coherence-length superconductors

    International Nuclear Information System (INIS)

    Bishop, A.R.; Lomdahl, P.S.; Schrieffer, J.R.; Trugman, S.A.


    Localized baglike solutions in the pairing theory of superconductivity are studied. Starting from the Bogoliubov--de Gennes equations on a two-dimensional square lattice for half-filled negative-U Hubbard model, cigar- and star-shaped bags are numerically obtained, inside of which the order parameter is reduced, self-consistently trapping an added quasiparticle. These nonlinear excitations are important when the coherence length is small as for the new high-temperature superconductors. Several experimental consequences are discussed

  7. Solar Drift-Pair Bursts (United States)

    Stanislavsky, A.; Volvach, Ya.; Konovalenko, A.; Koval, A.


    In this paper a new sight on the study of solar bursts historically called drift pairs (DPs) is presented. Having a simple morphology on dynamic spectra of radio records (two short components separated in time, and often they are very similar) and discovered at the dawn of radio astronomy, their features remain unexplained totally up to now. Generally, the DPs are observed during the solar storms of type III bursts, but not every storm of type III bursts is linked with DPs. Detected by ground-based instruments at decameter and meter wavelengths, the DP bursts are limited in frequency bandwidth. They can drift from high frequencies to low ones and vice versa. Their frequency drift rate may be both lower and higher than typical rates of type III bursts at the same frequency range. The development of low-frequency radio telescopes and data processing provide additional possibilities in the research. In this context the fresh analysis of DPs, made from recent observations in the summer campaign of 2015, are just considered. Their study was implemented by updated tools of the UTR-2 radio telescope at 9-33 MHz. During 10-12 July of 2015, DPs forming the longest patterns on dynamic spectra are about 7% of the total number of recorded DPs. Their marvelous resemblance in frequency drift rates with the solar S-bursts is discussed.

  8. Production of magnetic monopole pairs

    International Nuclear Information System (INIS)

    Maher, R.L.


    Using a covariant photon propagator (developed by W.B. Campbell) to represent a photon exchange between a magnetic monopole and an electric charge, the first order production amplitudes in a Feynman-Dyson perturbation expansion and the resulting differential cross-sections are calculated for monopole pair creation from: (i) electron positron annihilation, (ii) photon scattering in the presence of a nucleus, and (iii) electron scattering in the presence of a nucleus. This theory does not specify the spin character of magnetic monopoles, so all processes are calculated twice: for spin zero monopoles and for spin one-half monopoles. In the first and last processes the differential cross-sections have sufficiently different dependences on the production angles (associated with the monopoles momenta), so that near threshold experiments could distinguish between whether monopoles are either spin one-half or spin zero entities. For the t'Hooft monopole mass estimate (5-8 x 10 3 GeV) very high energy particle and photon beam sources would be required to achieve threshold for these production processes

  9. New universality class for superconducting order parameter

    International Nuclear Information System (INIS)

    Dobroliubov, M.I.; Khlebnikov, S.Yu.


    We present a model of superconductivity with pairing due to Aharonov-Bohm forces. The gap is proportional to the first power of the small parameter (in which the self-consistent perturbation scheme is developed), as opposed to the BCS class of models where the gap is exponentially suppressed with the small parameter. (orig.)

  10. Report on Pairing-based Cryptography. (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily


    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  11. Z parameters

    International Nuclear Information System (INIS)

    Firestone, A.


    This paper presents results of studies of the Z Boson produced in e + e - annihilations in the DELPHI detector at the CERN LEP collider. Approximately 600 nb. -1 of useful data were collected in the first LEP running period in the last half of 1989. Results are presented on the mass and width of the Z Boson, on the partial widths of the Z decays into hadrons and into lepton pairs, on comparisons with the predictions of QCD, on the number of light neutrino generations, and on the searches for new particles. The authors find that M Z = 91.171 ± 0.030 (stat.) ± 0.030 (beam) GeV, Γ Z = 2.511 ± 0.065 GeV, Γ had. = 1741 ± 61 MeV, Γ lept. = 85.1 ± 2.9 MeV, Γ inv. = 515 ± 54 MeV, and N v = 2.97 ± 0.26 generations. The authors have set limits on the mass of the charged Higgs particle, and the authors find no evidence for new quarks, new heavy leptons, or any supersymmetric partners to the known particles. All the authors' results are consistent with the Standard Model of electroweak interactions plus QCD with exactly three generations of elementary fermions

  12. Bomb parameters

    International Nuclear Information System (INIS)

    Kerr, George D.; Young, Rebert W.; Cullings, Harry M.; Christry, Robert F.


    The reconstruction of neutron and gamma-ray doses at Hiroshima and Nagasaki begins with a determination of the parameters describing the explosion. The calculations of the air transported radiation fields and survivor doses from the Hiroshima and Nagasaki bombs require knowledge of a variety of parameters related to the explosions. These various parameters include the heading of the bomber when the bomb was released, the epicenters of the explosions, the bomb yields, and the tilt of the bombs at time of explosion. The epicenter of a bomb is the explosion point in air that is specified in terms of a burst height and a hypocenter (or the point on the ground directly below the epicenter of the explosion). The current reassessment refines the energy yield and burst height for the Hiroshima bomb, as well as the locations of the Hiroshima and Nagasaki hypocenters on the modern city maps used in the analysis of the activation data for neutrons and TLD data for gamma rays. (J.P.N.)

  13. An Entropic Approach for Pair Trading

    Directory of Open Access Journals (Sweden)

    Daisuke Yoshikawa


    Full Text Available In this paper, we derive the optimal boundary for pair trading. This boundary defines the points of entry into or exit from the market for a given stock pair. However, if the assumed model contains uncertainty, the resulting boundary could result in large losses. To avoid this, we develop a more robust strategy by accounting for the model uncertainty. To incorporate the model uncertainty, we use the relative entropy as a penalty function in the expected profit from pair trading.

  14. Magnetized pair Bose gas: relativistic superconductor

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.


    The magnetized Bose gas at temperatures above pair threshold is investigated. New magnetization laws are obtained for a wide range of field strengths, and the gas is shown to exhibit the Meissner effect. Some related results for the Fermi gas, a relativistic paramagnet, are also discussed. It is concluded that the pair gases, through the interplay between pair creation, temperature, field strength, statistics and/in the case of fermions/spin, have remarkable magnetic properties. 14 refs

  15. Pair production in small angle Bhabha scattering

    International Nuclear Information System (INIS)

    Arbuzov, A.B.; Kuraev, Eh.A.; Merenkov, N.P.; Trentadue, L.


    The radiative corrections due to a pair production in the small angle high energy e + e - Bhabha scattering are considered. The corrections due to the production of virtual pairs as well as real soft and hard ones are calculated analytically. The collinear and semi-collinear kinematical regions of the hard pair production are taken into account. The results in the leading and next-to-leading logarithmic approximations provide the accuracy of Ο (0.1%). The results of numerical calculations show that the effects of pairs production are to be taken into account in the precise luminosity determination at LEP. 9 refs., 3 figs., 2 tabs

  16. Heteroditopic receptors for ion-pair recognition. (United States)

    McConnell, Anna J; Beer, Paul D


    Ion-pair recognition is a new field of research emerging from cation and anion coordination chemistry. Specific types of heteroditopic receptor designs for ion pairs and the complexity of ion-pair binding are discussed to illustrate key concepts such as cooperativity. The importance of this area of research is reflected by the wide variety of potential applications of ion-pair receptors, including applications as membrane transport and salt solubilization agents and sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Finding Maximal Pairs with Bounded Gap

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Lyngsø, Rune B.; Pedersen, Christian N. S.


    . In this paper we present methods for finding all maximal pairs under various constraints on the gap. In a string of length n we can find all maximal pairs with gap in an upper and lower bounded interval in time O(n log n+z) where z is the number of reported pairs. If the upper bound is removed the time reduces...... to O(n+z). Since a tandem repeat is a pair where the gap is zero, our methods can be seen as a generalization of finding tandem repeats. The running time of our methods equals the running time of well known methods for finding tandem repeats....

  18. Isolated galaxies, pairs, and groups of galaxies

    International Nuclear Information System (INIS)

    Kuneva, I.; Kalinkov, M.


    The authors searched for isolated galaxies, pairs and groups of galaxies in the CfA survey (Huchra et al. 1983). It was assumed that the distances to galaxies are given by R = V/H sub o, where H sub o = 100 km s(exp -1) Mpc(exp -1) and R greater than 6 Mpc. The searching procedure is close to those, applied to find superclusters of galaxies (Kalinkov and Kuneva 1985, 1986). A sphere with fixed radius r (asterisk) is described around each galaxy. The mean spatial density in the sphere is m. Let G 1 be any galaxy and G 2 be its nearest neighbor at a distance R 2 . If R sub 2 exceeds the 95 percent quintile in the distribution of the distances of the second neighbors, then G 1 is an isolated galaxy. Let the midpoint of G 1 and G 2 be O 2 and r 2 =R 2 2. For the volume V 2 , defined with the radius r 2 , the density D 2 less than k mu, the galaxy G 2 is a single one and the procedure for searching for pairs and groups, beginning with this object is over and we have to pass to another object. Here the authors present the groups - isolated and nonisolated - with n greater than 3, found in the CfA survey in the Northern galactic hemisphere. The parameters used are k = 10 and r (asterisk) = 5 Mpc. Table 1 contains: (1) the group number, (2) the galaxy, nearest to the multiplet center, (3) multiplicity n, (4) the brightest galaxy if it is not listed in (2); (5) and (6) are R.A. and Dec. (1950), (7) - mean distance D in Mpc. Further there are the mean density rho (8) of the multiplet (galaxies Mpc (exp -3)), (9) the density rho (asterisk) for r (asterisk) = 5 Mpc and (10) the density rho sub g for the group with its nearest neighbor. The parenthesized digits for densities in the last three columns are powers of ten

  19. Pair plasma in pulsar magnetospheres

    International Nuclear Information System (INIS)

    Asseo, Estelle


    The main features of radiation received from pulsars imply that they are neutron stars which contain an extremely intense magnetic field and emit coherently in the radio domain. Most recent studies attribute the origin of the coherence to plasma instabilities arising in pulsar magnetospheres; they mainly concern the linear, or the nonlinear, character of the involved unstable waves. We briefly introduce radio pulsars and specify physical conditions in pulsar emission regions: geometrical properties, magnetic field, pair creation processes and repartition of relativistic charged particles. We point to the main ingredients of the linear theory, extensively explored since the 1970s: (i) a dispersion relation specific to the pulsar case; (ii) the characteristics of the waves able to propagate in relativistic pulsar plasmas; (iii) the different ways in which a two-humped distribution of particles may arise in a pulsar magnetosphere and favour the development of a two-stream instability. We sum up recent improvements of the linear theory: (i) the determination of a 'coupling function' responsible for high values of the wave field components and electromagnetic energy available; (ii) the obtention of new dispersion relations for actually anisotropic pulsar plasmas with relativistic motions and temperatures; (iii) the interaction between a plasma and a beam, both with relativistic motions and temperatures; (iv) the interpretation of observed 'coral' and 'conal' features, associated with the presence of boundaries and curved magnetic field lines in the emission region; (v) the detailed topology of the magnetic field in the different parts of the emission region and its relation to models recently proposed to interpret drifting subpulses observed from PSR 0943+10, showing 20 sub-beams of emission. We relate the nonlinear evolution of the two-stream instability and development of strong turbulence in relativistic pulsar plasmas to the emergence of relativistic solitons, able

  20. Electromagnetic lepton-pair production in relativistic collisions

    International Nuclear Information System (INIS)

    Albert, C.J.; Ernst, D.J.; Strayer, M.R.; Bottcher, C.


    Electromagnetic lepton-pair production in relativistic collisions is studied in an ab initio approach with no free parameters. After a semi-classical approximation to the relative motion of the two incident particles is made, the resulting second-order diagram is calculated using a Monte Carlo technique to evaluate the resulting seven-dimensional integral. We examine the case of electron-positron pair production in π - p collisions at p pi = 17 GeV. We find that a significant fraction of the measured pairs in this reaction are produced via the magnetic spin-flip current of the proton. Approaches, such as the equivalent photon approximation, which neglect this part of the current predict much too small a cross section. This feature is traced to the cuts imposed in taking the experimental data. Lepton-pair production in the scattering of 3 He, 4 He and 4 He, 4 He is proposed as a clean way of experimentally separating the spin-flip and non-flip processes; predictions are made for these systems

  1. Multiple electromagnetic pair production in ultrarelativistic heavy ion collisions

    International Nuclear Information System (INIS)

    Best, C.


    The problem of the unitary violation in the pair production in ultrarelativistic heavy ion collisions was studied by a consideration of the field-theoretical foundations. The quantum electrodynamics in an external field were thereby reduced to a Dirac-sea model, the equivalence of which to the non-radiative QED resulted from the equality of the generating functionals. The latter can both be expressed explicitely by means of the complet set of the solutions of the Dirac equation in an external field. This method is based solely on the path-integral approach, which makes it possible to discriminate clearly between the physically given correlation functions and their generating functional at the one hand and at the other hand between the models constructed to their interpretation. From the model expression for the pair production amplitudes and multiplicities could be calculated, for which only the knowledge of the one-particle S matrix is necessary. For the calculation of the multiplicities different forms of the perturbation theory were discussed. Finally an impact-parameter dependent Weizsaecker-Williams approximation for the calculation of arbitrary two-photon graphs was constructed and applied to the given problem. The results indicate that at small distances very high pair multiplicities are to be expected. Finally a new approach to the pair production in an external field was discussed, which is not based on the canonical field theory, but on the formalism of the Wigner functions. (orig./HSI) [de

  2. Inferring relationships between pairs of individuals from locus heterozygosities

    Directory of Open Access Journals (Sweden)

    Spinetti Isabella


    Full Text Available Abstract Background The traditional exact method for inferring relationships between individuals from genetic data is not easily applicable in all situations that may be encountered in several fields of applied genetics. This study describes an approach that gives affordable results and is easily applicable; it is based on the probabilities that two individuals share 0, 1 or both alleles at a locus identical by state. Results We show that these probabilities (zi depend on locus heterozygosity (H, and are scarcely affected by variation of the distribution of allele frequencies. This allows us to obtain empirical curves relating zi's to H for a series of common relationships, so that the likelihood ratio of a pair of relationships between any two individuals, given their genotypes at a locus, is a function of a single parameter, H. Application to large samples of mother-child and full-sib pairs shows that the statistical power of this method to infer the correct relationship is not much lower than the exact method. Analysis of a large database of STR data proves that locus heterozygosity does not vary significantly among Caucasian populations, apart from special cases, so that the likelihood ratio of the more common relationships between pairs of individuals may be obtained by looking at tabulated zi values. Conclusions A simple method is provided, which may be used by any scientist with the help of a calculator or a spreadsheet to compute the likelihood ratios of common alternative relationships between pairs of individuals.

  3. Higgs pair production: choosing benchmarks with cluster analysis

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Alexandra; Dall’Osso, Martino; Dorigo, Tommaso [Dipartimento di Fisica e Astronomia and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padova (Italy); Goertz, Florian [CERN,1211 Geneva 23 (Switzerland); Gottardo, Carlo A. [Physikalisches Institut, Universität Bonn,Nussallee 12, 53115 Bonn (Germany); Tosi, Mia [CERN,1211 Geneva 23 (Switzerland)


    New physics theories often depend on a large number of free parameters. The phenomenology they predict for fundamental physics processes is in some cases drastically affected by the precise value of those free parameters, while in other cases is left basically invariant at the level of detail experimentally accessible. When designing a strategy for the analysis of experimental data in the search for a signal predicted by a new physics model, it appears advantageous to categorize the parameter space describing the model according to the corresponding kinematical features of the final state. A multi-dimensional test statistic can be used to gauge the degree of similarity in the kinematics predicted by different models; a clustering algorithm using that metric may allow the division of the space into homogeneous regions, each of which can be successfully represented by a benchmark point. Searches targeting those benchmarks are then guaranteed to be sensitive to a large area of the parameter space. In this document we show a practical implementation of the above strategy for the study of non-resonant production of Higgs boson pairs in the context of extensions of the standard model with anomalous couplings of the Higgs bosons. A non-standard value of those couplings may significantly enhance the Higgs boson pair-production cross section, such that the process could be detectable with the data that the LHC will collect in Run 2.

  4. Cooper pairs' magnetic moment in MCFL color superconductivity

    International Nuclear Information System (INIS)

    Feng Bo; Ferrer, Efrain J.; Incera, Vivian de la


    We investigate the effect of the alignment of the magnetic moments of Cooper pairs of charged quarks that form at high density in three-flavor quark matter. The high-density phase of this matter in the presence of a magnetic field is known to be the Magnetic Color-Flavor-Locked (MCFL) phase of color superconductivity. We derive the Fierz identities of the theory and show how the explicit breaking of the rotational symmetry by the uniform magnetic field opens new channels of interactions and allows the formation of a new diquark condensate. The new order parameter is a spin-1 condensate proportional to the component in the field direction of the average magnetic moment of the pairs of charged quarks. The magnitude of the spin-1 condensate becomes comparable to the larger of the two scalar gaps in the region of large fields. The existence of the spin-1 condensate is unavoidable, as in the presence of a magnetic field there is no solution of the gap equations with nonzero scalar gaps and zero magnetic moment condensate. This is consistent with the fact that the extra condensate does not break any symmetry that has not already been broken by the known MCFL gaps. The spin-1 condensate enhances the condensation energy of pairs formed by charged quarks and the magnetization of the system. We discuss the possible consequences of the new order parameter on the issue of the chromomagnetic instability that appears in color superconductivity at moderate density.

  5. Stereo Pair: Wellington, New Zealand (United States)


    Wellington, the capital city of New Zealand, is located on the shores of Port Nicholson, a natural harbor at the south end of North Island. The city was founded in 1840 by British emigrants and now has a regional population of more than 400,000 residents. As seen here, the natural terrain imposes strong control over the urban growth pattern (urban features generally appear gray or white in this view). Rugged hills generally rising to 300 meters (1,000 feet) help protect the city and harbor from strong winter windsNew Zealand is seismically active and faults are readily seen in the topography. The Wellington Fault forms the straight northwestern (left) shoreline of the harbor. Toward the southwest (down) the fault crosses through the city, then forms linear canyons in the hills before continuing offshore at the bottom. Toward the northeast (upper right) the fault forms the sharp mountain front along the northern edge of the heavily populated Hutt Valley.This stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced true color Landsat7 satellite image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30 meter (99 foot) spatial resolution of most Landsat images and will provide a valuable complement for studying the historic and growing Landsat data archive. The Landsat 7 Thematic Mapper image used here was provided to the SRTM project by the United States Geological Survey, Earth Resources Observation Systems (EROS) data Center, Sioux Falls, South Dakota.Elevation data used in this image

  6. SRTM Stereo Pair: Fiji Islands (United States)


    image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.This image was acquired by SRTM aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. SRTM was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (about 200 feet) mast, installed additional C-band and X-band antennas, and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration (NASA), the National Imagery and Mapping Agency (NIMA) of the U.S. Department of Defense (DoD), and the German and Italian space agencies. It is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Earth Science Enterprise, Washington, DC.Size: 192 km (119 miles) x 142 km (88 miles) Location: 17.8 deg. South lat., 178.0 deg. East lon. Orientation: North at top Date Acquired: February 19, 2000 Image: NASA/JPL/NIMA

  7. Hole pairing induced by antiferromagnetic spin fluctuations

    International Nuclear Information System (INIS)

    Su, Z.B.; Yu Lu; Dong, J.M.; Tosatti, E.


    The effective interaction induced by antiferromagnetic spin fluctuations is considered in the random phase approximation in the context of the recently discovered high T c oxide superconductors. This effective attraction favours a triplet pairing of holes. The implications of such pairing mechanism are discussed in connection with the current experimental observations. (author). 30 refs, 2 figs

  8. Exploring Pair Programming Benefits for MIS Majors (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret


    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  9. Exclusive production of W pairs in CMS

    CERN Document Server



    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  10. Exclusive production of $W$ pairs in CMS


    Da Silveira, Gustavo Gil; CMS


    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  11. Becoming independent through au pair migration

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    . This article argues that, despite this critique, au pairing does play an important formative role for young Filipinas because it opens up for experiences abroad that enable them to be recognised as independent adults in Philippine society. Rather than autonomy, however, au pairs define their independence...

  12. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    ion plasma are discussed. It is shown that the temperature and/or mass difference of both species could produce drift wave in a pair-ion plasma. The results are discussed in the context of the fullerene pair-ion plasma experiment.

  13. A New Secure Pairing Protocol using Biometrics

    NARCIS (Netherlands)

    Buhan, I.R.


    Secure Pairing enables two devices, which share no prior context with each other, to agree upon a security association that they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping or to a

  14. Aerodynamic Interactions between Pairs of Vertical-Axis Wind Turbines (United States)

    Brownstein, Ian; Dabiri, John


    Increased power production has been observed in downstream vertical-axis wind turbines (VAWTs) when positioned offset from the wake of upstream turbines. This effect was found to exist in both laboratory and field environments with pairs of co- and counter-rotating turbines. It is hypothesized that the observed power production enhancement is due to flow acceleration adjacent to the upstream turbine caused by bluff body blockage, which increases the incident freestream velocity on appropriately positioned downstream turbines. This type of flow acceleration has been observed in computational and laboratory studies of VAWTs and will be further investigated here using 3D-PTV measurements around pairs of laboratory-scale VAWTs. These measurements will be used to understand the mechanisms behind the performance enhancement effect and seek to determine optimal separation distances and angles between turbines based on turbine design parameters. These results will lead to recommendations for optimizing the power production of VAWT wind farms which utilize this effect.

  15. Pair interaction of bilayer-coated nanoscopic particles

    International Nuclear Information System (INIS)

    Qi-Yi, Zhang


    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placed on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphiles, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery. (condensed matter: structure, thermal and mechanical properties)

  16. Higgs Pair Production as a Signal of Enhanced Yukawa Couplings

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, Martin [Heidelberg U.; Carena, Marcela [Chicago U., KICP; Carmona, Adrián [U. Mainz, PRISMA


    We present a non-trivial correlation between the enhancement of the Higgs-fermion couplings and the Higgs pair production cross section in two Higgs doublet models with a flavour symmetry. This symmetry suppresses flavour-changing neutral couplings of the Higgs boson and allows for a partial explanation of the hierarchy in the Yukawa sector. After taking into account the constraints from electroweak precision measurements, Higgs coupling strength measurements, and unitarity and perturbativity bounds, we identify an interesting region of parameter space leading to enhanced Yukawa couplings as well as enhanced di-Higgs gluon fusion production at the LHC reach. This effect is visible in both the resonant and non-resonant contributions to the Higgs pair production cross section. We encourage dedicated searches based on differential distributions as a novel way to indirectly probe enhanced Higgs couplings to light fermions.

  17. Topological superfluids with finite-momentum pairing and Majorana fermions. (United States)

    Qu, Chunlei; Zheng, Zhen; Gong, Ming; Xu, Yong; Mao, Li; Zou, Xubo; Guo, Guangcan; Zhang, Chuanwei


    Majorana fermions (MFs), quantum particles that are their own antiparticles, are not only of fundamental importance in elementary particle physics and dark matter, but also building blocks for fault-tolerant quantum computation. Recently MFs have been intensively studied in solid state and cold atomic systems. These studies are generally based on superconducting pairing with zero total momentum. On the other hand, finite total momentum Cooper pairings, known as Fulde-Ferrell (FF) Larkin-Ovchinnikov (LO) states, were widely studied in many branches of physics. However, whether FF and LO superconductors can support MFs has not been explored. Here we show that MFs can exist in certain types of gapped FF states, yielding a new quantum matter: topological FF superfluids/superconductors. We demonstrate the existence of such topological FF superfluids and the associated MFs using spin-orbit-coupled degenerate Fermi gases and derive their parameter regions. The implementation of topological FF superconductors in semiconductor/superconductor heterostructures is also discussed.

  18. Top-quark pair production near threshold

    International Nuclear Information System (INIS)

    Sumino, Y.; Fujii, K.; Hagiwara, K.; Murayama, H.; Ng, C.


    We present a novel formalism to calculate the total and the differential cross sections for heavy unstable top-quark pair production near threshold. Within the context of the nonrelativistic quark model, we introduce the running toponium width Γ FTHETA (E,p) in the Schroedinger equation for the three-point Green's function that governs the t bar t contribution to the e + e- annihilation process. The effect of the running of the width is found to be significant in two aspects: (i) it takes account of the phase-space volume for the decay process t bar t→bW + bar bW- and provides a consistent framework for calculating the differential cross sections; and (ii) it reduces the widths of the low-lying resonances to considerably less than 2Γ t (m t 2 ). Furthermore, the running of the width causes the total cross section to decrease significantly at c.m. energies below the first ''resonance'' enhancement, whereas it makes the ''peak'' cross section more distinct than is obtained in the fixed toponium width approximation. We use the two-loop-improved QCD potential in our calculation, and the α s (m Z ) Mbar S dependences of the total and differential cross sections are studied quantitatively, where M bar S denotes the modified minimal subtraction scheme. We find that the correlations in the α s and m t measurements are opposite in the total and differential cross sections, and the simultaneous measurements would lead to an accurate determination of both parameters

  19. A pure Hubbard model with demonstrable pairing adjacent to the Mott-insulating phase

    International Nuclear Information System (INIS)

    Champion, J D; Long, M W


    We introduce a Hubbard model on a particular class of geometries, and consider the effect of doping the highly spin-degenerate Mott-insulating state with a microscopic number of holes in the extreme strong-coupling limit. The geometry is quite general, with pairs of atomic sites at each superlattice vertex, and a highly frustrated inter-atomic connectivity: the one-dimensional realization is a chain of edge-sharing tetrahedra. The sole model parameter is the ratio of intra-pair to inter-pair hopping matrix elements. If the intra-pair hopping is negligible then introducing a microscopic number of holes results in a ferromagnetic Nagaoka groundstate. Conversely, if the intra-pair hopping is comparable with the inter-pair hopping then the groundstate is low spin with short-ranged spin correlations. We exactly solve the correlated motion of a pair of holes in such a state and find that, in 1d and 2d, they form a bound pair on a length scale that increases with diminishing binding energy. This result is pertinent to the long-standing problem of hole motion in the CuO 2 planes of the high-temperature superconductors: we have rigorously shown that, on our frustrated geometry, the holes pair up and a short-ranged low-spin state is generated by hole motion alone

  20. Physiological parameters

    International Nuclear Information System (INIS)

    Natera, E.S.


    The physiological characteristics of man depend on the intake, metabolism and excretion of stable elements from food, water, and air. The physiological behavior of natural radionuclides and radionuclides from nuclear weapons testing and from the utilization of nuclear energy is believed to follow the pattern of stable elements. Hence information on the normal physiological processes occurring in the human body plays an important role in the assessment of the radiation dose received by man. Two important physiological parameters needed for internal dose determination are the pulmonary function and the water balance. In the Coordinated Research Programme on the characterization of Asian population, five participants submitted data on these physiological characteristics - China, India, Japan, Philippines and Viet Nam. During the CRP, data on other pertinent characteristics such as physical and dietary were simultaneously being collected. Hence, the information on the physiological characteristics alone, coming from the five participants were not complete and are probably not sufficient to establish standard values for the Reference Asian Man. Nonetheless, the data collected is a valuable contribution to this research programme

  1. Bethe-Heitler pair creation in a bichromatic laser field

    International Nuclear Information System (INIS)

    Augustin, Sven


    Within this thesis, the non-linear creation of electron-positron pairs in the superposition of a nuclear Coulomb field and a two-colour laser field of high intensity is studied. Primarily, two complementary scenarios are investigated: On the one hand, if the two laser frequencies are commensurable, quantum interference may occur. This interference manifests in the total pair-creation rate and the angular distribution of the created particles, which are studied in the nuclear rest frame and the laboratory frame. Furthermore, the relative phase between the two laser modes allows to tune the strength of the terms arising from interference. Therefore, this parameter may be used to optimize the pair-creation yield. On the other hand, for incommensurable frequencies, a set-up of largely differing frequencies is considered. This way, a strong laser field in the non-perturbative regime assisted by a single highly-energetic γ-photon is described. Due to the assistance of the latter, a strong enhancement of the total pair-creation rate can be found depending on the laser intensity. Additionally, the influence of the γ-photon on the angular and energetic distribution of the created particles is investigated, again in the nuclear rest frame and the laboratory frame. Furthermore, the differences arising in the two former cases are directly compared by means of a continuous variation of the laser frequency ratio. This illustrates the strong modifications due to the interference in the commensurable case. Finally, for the special case of two modes with identical frequency, the total pair-creation rate is studied as a function of the ellipticity of the combined laser field. Here, the cases of a constant total field intensity and a constant maximum field intensity are compared.

  2. Exploring Pair Programming Benefits for MIS Majors

    Directory of Open Access Journals (Sweden)

    April H. Reed


    Full Text Available Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS and Software Engineering (SE majors have identified benefits such as technical productivity, program/design quality, academic performance, and increased satisfaction for their participants. In this paper, pair programming is studied with Management Information Systems (MIS majors, who (unlike CS and SE majors taking several programming courses typically take only one programming course and often struggle to develop advanced programming skills within that single course. The researchers conducted two pair programming experiments in an introductory software development course for MIS majors over three semesters to determine if pair programming could enhance learning for MIS students. The program results, researchers’ direct observations, and participants’ responses to a survey questionnaire were analyzed after each experiment. The results indicate that pair programming appears to be beneficial to MIS students’ technical productivity and program design quality, specifically the ability to create programs using high-level concepts. Additionally, results confirmed increased student satisfaction and reduced frustration, as the pairs worked collaboratively to produce a program while actively communicating and enjoying the process.

  3. Effect of pairing on nuclear dynamics

    International Nuclear Information System (INIS)

    Scamps, Guillaume


    Pairing correlations is an essential component for the description of the atomic nuclei. The effects of pairing on static property of nuclei are now well known. In this thesis, the effect of pairing on nuclear dynamics is investigated. Theories that includes pairing are benchmarked in a model case. The TDHF+BCS theory turns out to be a good compromise between the physics taken into account and the numerical cost. This TDHF+BCS theory was retained for realistic calculations. Nevertheless, the application of pairing in the BCS approximation may induce new problems due to (1) the particle number symmetry breaking, (2) the non-conservation of the continuity equation. These difficulties are analysed in detail and solutions are proposed. In this thesis, a 3 dimensional TDHF+BCS code is developed to simulate the nuclear dynamic. Applications to giant resonances show that pairing modify only the low lying peaks. The high lying collective components are only affected by the initial conditions. An exhaustive study of the giant quadrupole resonances with the TDHF+BCS theory is performed on more than 700 spherical or deformed nuclei. Is is shown that the TDHF+BCS theory reproduces well the collective energy of the resonance. After validation on the small amplitude limit problem, the approach was applied to study nucleon transfer in heavy ion reactions. A new method to extract transfer probabilities is introduced. It is demonstrated that pairing significantly increases the two-nucleon transfer probability. (author) [fr

  4. Nonrandom network connectivity comes in pairs

    Directory of Open Access Journals (Sweden)

    Felix Z. Hoffmann


    Full Text Available Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, Pij = Pji, the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

  5. Soliton pair creation at finite temperatures

    International Nuclear Information System (INIS)

    Grigoriev, D.Yu.; Rubakov, V.A.


    Creation of soliton-antisoliton pairs at finite temperature is considered within a (1+1)-dimensional model of a real scalar field. It is argued that at certain temperatures, the soliton pair creation in quantum theory can be investigated by studying classical field evolution in real time. The classical field equations are solved numerically, and the pair creation rate and average number of solitons are evaluated. No peculiar suppression of the rate is observed. Some results on the sphaleron transitions in (1+1)-dimensional abelian Higgs model are also presented. (orig.)

  6. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis


    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian


    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  7. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy


    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  8. Adatom pair distribution up to half coverage: O-Pd(100)


    Kappus, Wolfgang


    Using substrate mediated elastic interactions fitted previously to first principles (FP) calculations, adatom pair distributions are derived for O-Pd(100) evaluating a statistical BGY based integral equation. The evaluation method utilizes the superposition approximation, a temperature scaling scheme, and for one variant the particle-hole symmetry of a pair interaction lattice gas Hamiltonian. The elastic Hamiltonian is taken from a previous 3 parameter analytical model. The resulting adatom ...

  9. Pair production of Dirac particles in a d + 1-dimensional noncommutative space-time

    Energy Technology Data Exchange (ETDEWEB)

    Ousmane Samary, Dine [Perimeter Institute for Theoretical Physics, Waterloo, ON (Canada); University of Abomey-Calavi, International Chair in Mathematical Physics and Applications (ICMPA-UNESCO Chair), Cotonou (Benin); N' Dolo, Emanonfi Elias; Hounkonnou, Mahouton Norbert [University of Abomey-Calavi, International Chair in Mathematical Physics and Applications (ICMPA-UNESCO Chair), Cotonou (Benin)


    This work addresses the computation of the probability of fermionic particle pair production in d + 1-dimensional noncommutative Moyal space. Using Seiberg-Witten maps, which establish relations between noncommutative and commutative field variables, up to the first order in the noncommutative parameter θ, we derive the probability density of vacuum-vacuum pair production of Dirac particles. The cases of constant electromagnetic, alternating time-dependent, and space-dependent electric fields are considered and discussed. (orig.)

  10. Effects of disorder on the electron pairing

    International Nuclear Information System (INIS)

    Oviedo-Roa, R.; Wang, C.; Navarro, O.


    The electron pairing in randomly disordered lattices is studied by using an attractive Hubbard model, and by mapping the many-body problem onto a tight-binding one in a higher dimensional space, where a diagonal disorder is considered within the coherent-potential approximation. The results show an enhancement of the pair-binding energy as the self-energy difference increases in a binary alloy A x B 1-x . This fact suggests that the pairing process is highly sensitive to the one-particle localization condition. A ground-state phase diagram for on-site interaction disorder shows regions where pairing is avoided for ordered diatomic systems but not for disordered case

  11. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.


    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  12. Statistical mechanics of magnetized pair Fermi gas

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.


    Following previous work on the magnetized pair Bose gas this contribution presents the statistical mechanics of the charged relativistic Fermi gas with pair creation in d spatial dimensions. Initially, the gas in no external fields is studied. As a result, expansions for the various thermodynamic functions are obtained in both the μ/m→0 (neutrino) limit, and about the point μ/m =1, where μ is the chemical potential. The thermodynamics of a gas of quantum-number conserving massless fermions is also discussed. Then a complete study of the pair Fermi gas in a homogeneous magnetic field, is presented investigating the behavior of the magnetization over a wide range of field strengths. The inclusion of pairs leads to new results for the net magnetization due to the paramagnetic moment of the spins and the diamagnetic Landau orbits. 20 refs

  13. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram


    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are

  14. Projected entangled pair states: status and prospects

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, Frank [Universitaet Wien (Austria)


    We report on the progress made to extend the density matrix renormalization group to higher dimensions, discuss the underlying theory of projected entangled pair states (PEPS) and illustrate its potential on the hand of a few examples.

  15. Isovectorial pairing in solvable and algebraic models

    International Nuclear Information System (INIS)

    Lerma, Sergio; Vargas, Carlos E; Hirsch, Jorge G


    Schematic interactions are useful to gain some insight in the behavior of very complicated systems such as the atomic nuclei. Prototypical examples are, in this context, the pairing interaction and the quadrupole interaction of the Elliot model. In this contribution the interplay between isovectorial pairing, spin-orbit, and quadrupole terms in a harmonic oscillator shell (the so-called pairing-plus-quadrupole model) is studied by algebraic methods. The ability of this model to provide a realistic description of N = Z even-even nuclei in the fp-shell is illustrated with 44 Ti. Our calculations which derive from schematic and simple terms confirm earlier conclusions obtained by using realistic interactions: the SU(3) symmetry of the quadrupole term is broken mainly by the spin-orbit term, but the energies depends strongly on pairing.

  16. Three mirror pairs of fermion families

    International Nuclear Information System (INIS)

    Montvay, I.


    A simple model with three mirror pairs of fermion families is considered which allows for a substantial mixing between the mirror fermion partners without conflicting with known phenomenology. (orig.)

  17. Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method. (United States)

    Neese, Frank; Wennmohs, Frank; Hansen, Andreas


    Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500

  18. Spacings and pair correlations for finite Bernoulli convolutions

    International Nuclear Information System (INIS)

    Benjamini, Itai; Solomyak, Boris


    We consider finite Bernoulli convolutions with a parameter 1/2 N . These sequences are uniformly distributed with respect to the infinite Bernoulli convolution measure ν λ , as N → ∞. Numerical evidence suggests that for a generic λ, the distribution of spacings between appropriately rescaled points is Poissonian. We obtain some partial results in this direction; for instance, we show that, on average, the pair correlations do not exhibit attraction or repulsion in the limit. On the other hand, for certain algebraic λ the behaviour is totally different

  19. Boundary Lax pairs from non-ultra-local Poisson algebras

    International Nuclear Information System (INIS)

    Avan, Jean; Doikou, Anastasia


    We consider non-ultra-local linear Poisson algebras on a continuous line. Suitable combinations of representations of these algebras yield representations of novel generalized linear Poisson algebras or 'boundary' extensions. They are parametrized by a boundary scalar matrix and depend, in addition, on the choice of an antiautomorphism. The new algebras are the classical-linear counterparts of the known quadratic quantum boundary algebras. For any choice of parameters, the non-ultra-local contribution of the original Poisson algebra disappears. We also systematically construct the associated classical Lax pair. The classical boundary principal chiral model is examined as a physical example.

  20. Constructing pairs of dual bandlimited framelets with desired time localization

    DEFF Research Database (Denmark)

    Lemvig, Jakob


    combination of dilations of ψ with explicitly given coefficients. The result allows a simple construction procedure for pairs of dual wavelet frames whose generators have compact support in the Fourier domain and desired time localization. The construction is based on characteriszing equations for dual......For sufficiently small translation parameters, we prove that any bandlimited function ψ, for which the dilations of its Fourier transform form a partition of unity, generates a wavelet frame with a dual frame also having the wavelet structure. This dual frame is generated by a finite linear...

  1. Constructing pairs of dual bandlimited framelets with desired time localization

    DEFF Research Database (Denmark)

    Lemvig, Jakob

    combination of dilations of ψ with explicitly given coefficients. The result allows a simple construction procedure for pairs of dual wavelet frames whose generators have compact support in the Fourier domain and desired time localization. The construction is based on characteriszing equations for dual......For sufficiently small translation parameters, we prove that any bandlimited function ψ, for which the dilations of its Fourier transform form a partition of unity, generates a wavelet frame with a dual frame also having the wavelet structure. This dual frame is generated by a finite linear...

  2. Continuous unitary transformation approach to pairing interactions in statistical physics

    Directory of Open Access Journals (Sweden)



    Full Text Available We apply the flow equation method to the study of the fermion systems with pairing interactions which lead to the BCS instability signalled by the appearance of the off-diagonal order parameter. For this purpose we rederive the continuous Bogoliubov transformation in a fashion of renormalization group procedure where the low and high energy sectors are treated subsequently. We further generalize this procedure to the case of fermions interacting with the discrete boson mode. Andreev-type interactions are responsible for developing a gap in the excitation spectrum. However, the long-range coherence is destroyed due to strong quantum fluctuations.

  3. QCD angular correlations for muon pair production

    International Nuclear Information System (INIS)

    Kajantie, K.; Raitio, R.; Lindfors, J.


    Angular distributions of muons are discussed in the framework of a QCD treatment of muon pair production in hadron-hadron collisions. The predicted angular effects are independent of the infrared behavior of QCD. Measuring them will permit one to determine whether the origin of the large transverse momentum of the pair is in the quark transverse momenta or in a constituent-constituent subprocess. (author)

  4. Influence of quadrupole pairing on backbending

    International Nuclear Information System (INIS)

    Faessler, A.; Wakai, M.


    The backbending phenomenon is attributed to the Coriolis antipairing and the rotational alignment effects. We can consider both effects simultaneously by applying the cranked Hartree-Fock-Bogoliubov theory to the description of the rotational motion of nuclei. In usual treatments of the backbending, however, only the monopole pairing force is considered and pairing forces of other types are neglected. This may be the main reason for starting of the backbending at too small total angular momentum in theoretical results. (orig.) [de

  5. Transverse Momentum Distributions for Heavy Quark Pairs


    Berger, Edmond L.; Meng, Ruibin


    We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

  6. Ion pair formation in the vacuum ultraviolet region of NO studied by negative ion imaging spectroscopy

    International Nuclear Information System (INIS)

    Hikosaka, Y.; Kaneyasu, T.; Shigemasa, E.


    The pair formation of positive and negative fragment ions has been studied in the vacuum ultraviolet region of NO, with negative ion imaging spectroscopy. The negative ion yield curve obtained in the photon energy region of 19-25 eV exhibits many structures which are absent from the photoabsorption spectrum in the same region. The partial yields and asymmetry parameters associated with the dissociations into individual ion pair limits have been extracted from the negative ion images observed. On the basis of these quantities, the assignments for the structures exhibited on the negative ion yield curve are given and the dynamical properties on the ion pair dissociation are discussed

  7. Analysis and optimization of kinematic pair force in control rod drive mechanism

    International Nuclear Information System (INIS)

    Sun Zhenguo; Liu Sen; Ran Xiaobing; Dai Changnian; Li Yuezhong


    Function expressions of kinematic pair force with latch dimensions, friction coefficient, link angle and external load was obtained by theoretical analysis, and the expression was verified by the motion analysis software. Key parameters of kinematic pair were confirmed, and their effect trends with force of parts were obtained. They show that the available method of kinematic pair optimization is increasing the space of latch holes. Using the motion analysis software, the forces of parts before and after optimization was compared. The result shows that the forces of parts were improved after the optimization. (authors)

  8. Crossover from phonon-mediated to repulsion-induced superconducting pairing with large momentum

    International Nuclear Information System (INIS)

    Belyavsky, V.I.; Kopaev, Yu.V.; Nguyen, N.T.; Togushova, Yu.N.


    There are asymmetric and symmetric solutions of the self-consistency equation which takes into account both phonon-mediated and Coulomb pairing interactions. The first of them leads to the order parameter with a nodal line and, in the case of pairing with large momentum, exists at any repulsive and attractive strengths. The second one arises if the attraction exceeds a level depending on the repulsion strength and dominates the pairing in the strong attraction limit. The competition of attraction and repulsion results in unusual isotope-effect exponent observed in the cuprates

  9. Seniority zero pair coupled cluster doubles theory

    International Nuclear Information System (INIS)

    Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.


    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

  10. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma


    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  11. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs. (United States)

    Sloma, Michael F; Mathews, David H


    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  12. A counter-rotating vortex pair in inviscid fluid (United States)

    Habibah, Ummu; Fukumoto, Yasuhide


    We study the motion of a counter-rotating vortex pair with the circulations ±Γ move in incompressible fluid. The assumption is made that the core is very thin, that is the core radius σ is much smaller than the vortex radius d such that ɛ = σ/d ≪ 1. With this condition, the method of matched asymptotic expansion is employed. The solutions of the Navier-Stokes equations and the Biot-Savart law, regarding the inner and outer solutions respectively, are constructed in the form of a small parameter. An asymptotic expansion of the Biot-Savart law near the vortex core provides with the matching condition for an asymptotic expansion for limiting the Navier-Stokes equations for large radius r. The general formula of an anti-parallel vortex pair is established. At leading order O(ɛ0), we apply the special case in inviscid fluid, the Rankine vortex, a circular vortex of uniform vorticity. Furthermore at leading order O(ɛ5) we show the traveling speed of a vortex pair.

  13. Top quark pair production and modeling via QCD in CMS

    CERN Document Server

    Gonzalez Fernandez, Juan Rodrigo


    Measurements of the inclusive and differential top quark pair ($\\textrm{t}\\bar{\\textrm{t}}$) production cross section at centre-of-mass energies of 13 TeV and 5.02 TeV are presented, performed using CMS data collected in 2015 and 2016. The inclusive cross section is measured in the lepton+jets, dilepton and fully hadronic channels. Top quark pair differential cross sections are measured and are given as functions of various kinematic observables of (anti)top quark, the $\\textrm{t}\\bar{\\textrm{t}}$ system, and of the jets and leptons in the final state. Furthermore, the multiplicity and kinematic distributions of the additional jets produced in $\\textrm{t}\\bar{\\textrm{t}}$ events are also investigated and its modeling is compared for several generators. A new tune of parameters is developed for some of the generators. In addition, first measurements of top quark pair production with additional b quarks in the final state are presented. Furthermore, searches for four top quark production in CMS are also present...

  14. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos


    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  15. Radical-pair based avian magnetoreception (United States)

    Procopio, Maria; Ritz, Thorsten


    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  16. Pairing theory of high and low temperature superconductors

    International Nuclear Information System (INIS)

    Nam, Sang Boo


    A scenario which can account for all observed features of both high-Tc superconductors (HTS) and low-Tc superconductors (LTS) is discussed. This scenario is based on the fact that a finite pairing interaction energy range Td is required to have a finite value of Tc and that not all carriers participate in pairings, yielding multiconnected superconductors (MS). A new density of states, derived by keeping the order parameter zero outside of Td, is shown to account for the observed low energy states in HTS and for the temperature dependences in the specific heat, the penetration depth, the optical conductivity, and the tunneling conductance data. I argue that the notion of MS can account for the tunneling data along the a(or b)-, ab-, and c-axis, and the 1/2 flux quantum observed in HTS. The region occupied by unpaired carriers can be considered as a vortex with a fluxoid quantum number equal to 1 (VF), 0 (VZF), or -1 (VAF) when the magnetic flux around the vortex is greater than, equal to, or less than the effective flux produced by the supercurrent, respectively. The Hall anomaly depends on the relative strengths of the contributions via VF and VAF. The fact that the present scenario can account for all observed features of HTS and LTS suggests that the symmetry of the order parameter in HTS may not be different from one in LTS. (author)

  17. Isominkowskian theory of Cooper Pairs in superconductors

    International Nuclear Information System (INIS)

    Animalu, A.O.E.


    Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

  18. On pair-absorption in intrinsic vapours

    International Nuclear Information System (INIS)

    Hotop, R.; Niemax, K.; Schlueter, D.


    The bound-state pair-absorption bands Cs(6 2 S 1 sub(/) 2 ) + Cs(6 2 S 1 sub(/) 2 ) + hν → Cs(5 2 D 5 sub(/) 2 sub(,) 3 sub(/) 2 ) + Cs(6 2 P 1 sub(/) 2 ) and the K-K continuum-state pair-absorptions in the wavelength region 2.350 <= lambda <= 2.850 Angstroem have been investigated experimentally. In the case of the bound-state pair-absorption bands a theoretical approach for the absorption cross section at the band centre is given which is in good agreement with the experimental observation. Differences between our and the theoretical formulas given by the Stanford group are discussed. (orig.)

  19. Pair production by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.


    Solutions are obtained for the Dirac and Klein-Gordon equations with a one-dimensional symmetric potential well, having a flat bottom and arbitrary depth, width and field strengths at the walls. Quasi-stationary solutions describing a pair production by the well and the inverse process are obtained. It is shown that if the pair production probability is small, it is expressed in terms of the pair production probability on one wall and the particle oscillation frequency in the well. If the well has a supercritical depth, the lower continuum contains positron resonance scattering states at energies close to the real part of the quasi-stationary level energy (Zeldovich's effect). The qualitative dependence of the positron penetration coefficient through the wall on its energy and the well depth is an evidence that the solution of the so called one-particle Dirac equation describes in fact a many-particle system with a charge of 0 or 1

  20. Hadronic production of massive lepton pairs

    International Nuclear Information System (INIS)

    Berger, E.L.


    A review is presented of recent experimental and theoretical progress in studies of the production of massive lepton pairs in hadronic collisions. I begin with the classical Drell-Yan annihilation model and its predictions. Subsequently, I discuss deviations from scaling, the status of the proofs of factorization in the parton model, higher-order terms in the perturbative QCD expansion, the discrepancy between measured and predicted yields (K factor), high-twist terms, soft gluon effects, transverse-momentum distributions, implications for weak vector boson (W +- and Z 0 ) yields and production properties, nuclear A dependence effects, correlations of the lepton pair with hadrons in the final state, and angular distributions in the lepton-pair rest frame

  1. Charged topological black hole pair creation

    International Nuclear Information System (INIS)

    Mann, R.B.


    I examine the pair creation of black holes in space-times with a cosmological constant of either sign. I consider cosmological C-metrics and show that the conical singularities in this metric vanish only for three distinct classes of black hole metric, two of which have compact event horizons on each spatial slice. One class is a generalization of the Reissner-Nordstroem (anti-)de Sitter black holes in which the event horizons are the direct product of a null line with a 2-surface with topology of genus g. The other class consists of neutral black holes whose event horizons are the direct product of a null conoid with a circle. In the presence of a domain wall, black hole pairs of all possible types will be pair created for a wide range of mass and charge, including even negative mass black holes. I determine the relevant instantons and Euclidean actions for each case. (orig.)

  2. Theory of antiferromagnetic pairing in cuprate superconductors

    International Nuclear Information System (INIS)

    Plakida, N.M.


    A review of the antiferromagnetic exchange and spin-fluctuation pairing theory in the cuprate superconductors is given. We briefly discuss a phenomenological approach and a theory in the limit of weak Coulomb correlations. A microscopic theory in the strong correlation limit is presented in more detail. In particular, results of our recently developed theory for the effective p-d Hubbard model and the reduced t-J model are given. We have proved that retardation effects for the antiferromagnetic exchange interaction are unimportant that results in pairing of all charge carriers in the conduction band and high Tc proportional to the Fermi energy. The spin-fluctuation interaction caused by kinematic interaction gives an additional contribution to the d-wave pairing. Dependence of Tc on the hole concentration and the lattice constant (or pressure) and an oxygen isotope shift are discussed

  3. Holographic EPR pairs, wormholes and radiation (United States)

    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.


    As evidence for the ER = EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determines whether the causal structure of the string worldsheet is trivial or not turns out to be the emission of gluonic radiation by the dual quark and antiquark. In the strongly-coupled gauge theory, it is only when radiation is emitted that one obtains an unambiguous separation of the pair into entangled subsystems, and this is what is reflected on the gravity side by the existence of the worldsheet horizon.

  4. Drell-Yan lepton pair photoproduction

    International Nuclear Information System (INIS)

    Badalyan, R.G.; Grabskij, V.O.; Matinyan, S.G.


    The study of photon structure functions by spectra of massive lepton pairs (M l + l - ≥ 2 GeV) in photon fragmentation region in γp-interactions at high energies is suggested. In calculations of Drell-Yan lepton pair inclusive spectra in γp-interactions for photon structure functions there are used results obtained within QCD, data on γγ-interactions in e + e - → e + e - X on colliders as well as results from the analysis of vector meson non-diffractive photoproduction at high energies. It is shown that there exists a sufficienly wide kinematic region over variables X l + l - and M l + l - , wherein photon structure functions can be studied by spectra of Grell-Yan lepton pairs in the processes of their photoproduction. 31 refs.; 6 figs.; 1 tab

  5. Lax pairs: a novel type of separability

    International Nuclear Information System (INIS)

    Fokas, A S


    An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

  6. Top quark pair production in ATLAS

    CERN Document Server

    Moreno Llacer, M; The ATLAS collaboration


    Top-quark pairs are expected to be produced at the LHC, even at the lower beam energy and luminosity in the first years of running. Establishing the top-pair signal and measuring the production cross-section are important benchmarks for ATLAS, and will help understand the detector performance for events with high-pT leptons, high jet multiplicity, missing transverse energy. The prospects for early top physics measurements will be shown, with a particular emphasis on the progress achieved with data so far.

  7. Mass resolution for lepton pairs at Isabelle

    International Nuclear Information System (INIS)

    Baltay, C.; Paige, F.E.


    Experiments measuring e + e - and μ + μ-pairs will be the principal way of searching at ISABELLE for the Z 0 and for vector mesons made from new heavy quark-antiquark (Q anti Q ) pairs. Although the best possible mass resolution is clearly of benefit in such experiments, excessive resolution would lead to an unnecessarily large detector. It is believed that a mass resolution of a few percent is appropriate in searching both for the Z 0 and for new Q anti Q states. However, there are some interesting experiments which would require much better mass resolution, of order 1/4% FWHM. 9 references

  8. Ponderomotive effects in multiphoton pair production (United States)

    Kohlfürst, Christian; Alkofer, Reinhard


    The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

  9. Holographic EPR Pairs, Wormholes and Radiation


    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.


    As evidence for the ER=EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determi...

  10. Gluino-pair production at the Tevatron

    International Nuclear Information System (INIS)

    Beenakker, W.; Spira, M.; Zerwas, P.M.


    The next-to-leading order QCD corrections to the production of gluino pairs at the Tevatron are presented in this paper. Similar to the production of squark-antisquark pairs, the dependence of the cross section on the renormalization/factorization scale is reduced considerably by including the higher-order corrections. The cross section increases with respect to the lowest-order calculation which, in previous experimental analyses, had been evaluated at the scale of the invariant energy of the partonic subprocesses. (orig.)

  11. Facial expressions and pair bonds in hylobatids. (United States)

    Florkiewicz, Brittany; Skollar, Gabriella; Reichard, Ulrich H


    Facial expressions are an important component of primate communication that functions to transmit social information and modulate intentions and motivations. Chimpanzees and macaques, for example, produce a variety of facial expressions when communicating with conspecifics. Hylobatids also produce various facial expressions; however, the origin and function of these facial expressions are still largely unclear. It has been suggested that larger facial expression repertoires may have evolved in the context of social complexity, but this link has yet to be tested at a broader empirical basis. The social complexity hypothesis offers a possible explanation for the evolution of complex communicative signals such as facial expressions, because as the complexity of an individual's social environment increases so does the need for communicative signals. We used an intraspecies, pair-focused study design to test the link between facial expressions and sociality within hylobatids, specifically the strength of pair-bonds. The current study compared 206 hr of video and 103 hr of focal animal data for ten hylobatid pairs from three genera (Nomascus, Hoolock, and Hylobates) living at the Gibbon Conservation Center. Using video footage, we explored 5,969 facial expressions along three dimensions: repertoire use, repertoire breadth, and facial expression synchrony [FES]. We then used focal animal data to compare dimensions of facial expressiveness to pair bond strength and behavioral synchrony. Hylobatids in our study overlapped in only half of their facial expressions (50%) with the only other detailed, quantitative study of hylobatid facial expressions, while 27 facial expressions were uniquely observed in our study animals. Taken together, hylobatids have a large facial expression repertoire of at least 80 unique facial expressions. Contrary to our prediction, facial repertoire composition was not significantly correlated with pair bond strength, rates of territorial synchrony

  12. Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

    International Nuclear Information System (INIS)

    Takeuchi, Shin


    A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

  13. A family of integrable differential–difference equations, its bi-Hamiltonian structure and binary nonlinearization of the Lax pairs and adjoint Lax pairs

    International Nuclear Information System (INIS)

    Xu Xixiang


    Highlights: ► We deduce a family of integrable differential–difference equations. ► We present a discrete Hamiltonian operator involving two arbitrary real parameters. ► We establish the bi-Hamiltonian structure for obtained integrable family. ► Liouvolle integrability of the obtained family is demonstrated. ► Every equation in obtained family is factored through the binary nonlinearization. - Abstract: A family of integrable differential–difference equations is derived by the method of Lax pairs. A discrete Hamiltonian operator involving two arbitrary real parameters is introduced. When the parameters are suitably selected, a pair of discrete Hamiltonian operators is presented. Bi-Hamiltonian structure of obtained family is established by discrete trace identity. Then, Liouville integrability for the obtained family is proved. Ultimately, through the binary nonlinearization of the Lax pairs and adjoint Lax pairs, every differential–difference equation in obtained family is factored by an integrable symplectic map and a finite-dimensional integrable system in Liouville sense.

  14. Comparative study of the requantization of the time-dependent mean field for the dynamics of nuclear pairing (United States)

    Ni, Fang; Nakatsukasa, Takashi


    To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.

  15. Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques. (United States)

    Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda


    Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

  16. Joint Testlet Cognitive Diagnosis Modeling for Paired Local Item Dependence in Response Times and Response Accuracy

    Directory of Open Access Journals (Sweden)

    Peida Zhan


    Full Text Available In joint models for item response times (RTs and response accuracy (RA, local item dependence is composed of local RA dependence and local RT dependence. The two components are usually caused by the same common stimulus and emerge as pairs. Thus, the violation of local item independence in the joint models is called paired local item dependence. To address the issue of paired local item dependence while applying the joint cognitive diagnosis models (CDMs, this study proposed a joint testlet cognitive diagnosis modeling approach. The proposed approach is an extension of Zhan et al. (2017 and it incorporates two types of random testlet effect parameters (one for RA and the other for RTs to account for paired local item dependence. The model parameters were estimated using the full Bayesian Markov chain Monte Carlo (MCMC method. The 2015 PISA computer-based mathematics data were analyzed to demonstrate the application of the proposed model. Further, a brief simulation study was conducted to demonstrate the acceptable parameter recovery and the consequence of ignoring paired local item dependence.

  17. Pair Negotiation When Developing English Speaking Tasks (United States)

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena


    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  18. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    of charged particles in electromagnetic fields. The linear and nonlinear collective modes in electron-positron plasma have been investigated theoretically [3–6]. Recently, Oohara and Hatakeyama [7] have developed a novel method for generating a pair plasma con- sisting of only negative and positive ions with equal mass ...

  19. Klein tunneling phenomenon with pair creation process (United States)

    Wu, G. Z.; Zhou, C. T.; Fu, L. B.


    In this paper, we study the Klein tunneling phenomenon with electron-positron pair creation process. Pairs can be created from the vacuum by a supercritical single-well potential (for electrons). In the time region, the time-dependent growth pattern of the created pairs can be characterized by four distinct regimes which can be considered as four different statuses of the single well. We find that if positrons penetrate the single well by Klein tunneling in different statuses, the total number of the tunneling positrons will be different. If Klein tunneling begins at the initial stage of the first status i.e. when the sing well is empty, the tunneling process and the total number of tunneling positrons are similar to the traditional Klein tunneling case without considering the pair creation process. As the tunneling begins later, the total tunneling positron number increases. The number will finally settle to an asymptotic value when the tunneling begins later than the settling-down time t s of the single well which has been defined in this paper.

  20. Effective pair potentials for spherical nanoparticles

    International Nuclear Information System (INIS)

    Van Zon, Ramses


    An effective description for rigid spherical nanoparticles in a fluid of point particles is presented. The points inside the nanoparticles and the point particles are assumed to interact via spherically symmetric additive pair potentials, while the distribution of points inside the nanoparticles is taken to be spherically symmetric and smooth. The resulting effective pair interactions between a nanoparticle and a point particle, as well as between two nanoparticles, are then given by spherically symmetric potentials. If overlap between particles is allowed, as can occur for some forms of the pair potentials, the effective potential generally has non-analytic points. It is shown that for each effective potential the expressions for different overlapping cases can be written in terms of one analytic auxiliary potential. Even when only non-overlapping situations are possible, the auxiliary potentials facilitate the formulation of the effective potentials. Effective potentials for hollow nanoparticles (appropriate e.g. for buckyballs) are also considered and shown to be related to those for solid nanoparticles. For hollow nanoparticles overlap is more physical, since this covers the case of a smaller particle embedded in a larger, hollow nanoparticle. Finally, explicit expressions are given for the effective potentials derived from basic pair potentials of power law and exponential form, as well as from the commonly used London–van der Waals, Morse, Buckingham, and Lennard-Jones potentials. The applicability of the latter is demonstrated by comparison with an atomic description of nanoparticles with an internal face centered cubic structure

  1. Odd-frequency pairing in superconducting heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Golubov, A A [Faculty of Science and Technology and MESA Institute for Nanotechnology, University of Twente, 7500 AE Enschede (Netherlands); Tanaka, Y [Department of Applied Physics, Nagoya University, Nagoya, 464-8603 (Japan); Asano, Y [Department of Applied Physics, Hokkaido University, Sapporo 060-8628 (Japan); Tanuma, Y [Institute of Physics, Kanagawa University, 3-7-1, Rokkakubashi, Kanagawa-ku, Yokohama 221-8686 (Japan)], E-mail:


    We review the theory of odd-frequency pairing in superconducting heterostructures, where an odd-frequency pairing component is induced near interfaces. A general description of the superconducting proximity effect in a normal metal or a ferromagnet attached to an unconventional superconductor (S) is given within quasiclassical kinetic theory for various types of symmetry state in S. Various possible symmetry classes in a superconductor are considered which are consistent with the Pauli principle: even-frequency spin-singlet even-parity (ESE) state, even-frequency spin-triplet odd-parity (ETO) state, odd-frequency spin-triplet even-parity (OTE) state and odd-frequency spin-singlet odd-parity (OSO) state. As an example, we consider a junction between a diffusive normal metal (DN) and a p-wave superconductor (even-frequency spin-triplet odd-parity symmetry), where the pairing amplitude in DN belongs to an odd-frequency spin-triplet even-parity symmetry class. We also discuss the manifestation of odd-frequency pairing in conventional superconductor/normal (S/N) proximity systems and its relation to the classical McMillan-Rowell oscillations.

  2. Impact of Paired Tutoring and Mentoring. (United States)

    Bruce, Jennifer E.; Trammell, Jack


    Discusses a study that examines the effects of paired tutoring and mentoring on academic achievement of college freshmen in a probationary program. Results show that students with mentoring and tutoring services by the same person show greater academic gains as measured by compliance and academic achievement than do those students who were…

  3. Pair breaking and charge relaxation in superconductors

    International Nuclear Information System (INIS)

    Nielson, J.B.; Pethick, C.J.; Rammer, J.; Smith, H.


    We present a general formalism based on the quasiclassical Green's function for calculating charge imbalance in nonequilibrium superconductors. Our discussion is sufficiently general that it applies at arbitrary temperatures, and under conditions when the width of quasiparticle states are appreciable due to pair breaking processes, and when strong coupling effects are significant. As a first application we demonstrate in detail how in the limit of smallpair breaking and for a weak coupling superconductor the collision term in the formalism reduces to the one in the quasiparticle Boltzmann equation. We next treat the case of charge imbalance generated by tunnel injection, with pair breaking by phonons and magnetic impurities. Over the range of temperatures investigated exerimentally to date, the calculated charge imbalance is rather close to that evaluated using the Boltzmann equation, even if pair braeking is so strong as almost to destroy superconductivity. Finally we consider charge imbalance generated by the combined influence of a supercurrent and a temperature gradient. We give calculations for a dirty superconductor with scattering by phonons as the pair breaking mechanism, and the results give a reasonable account of the experimental data of Clarke, Fjordboge, and Lindelof. We carry out calculations for the case of impurity scattering along which are valid not only in the clean and dirty limits, but also for intermediate situations. These enable us to see how the large contribution to the charge imbalance found for energies close to the gap edge in the clean case is reduced with increasing impurity scattering

  4. Pseudopotential transformation of correlated-pair equations

    International Nuclear Information System (INIS)

    Szasz, L.; Brown, L.


    A pseudopotential transformation for correlated-pair equations is derived that yields solutions that are pseudowavefunctions, i.e., they do not have to be orthogonal to the core functions. The approximate solutions for the transformation will be much simpler to compute, but they do not involve a loss of accuracy

  5. Predictive labeling with dependency pairs using SAT

    NARCIS (Netherlands)

    Koprowski, A.; Middeldorp, A.; Pfenning, F.


    This paper combines predictive labeling with dependency pairs and reports on its implementation. Our starting point is the method of proving termination of rewrite systems using semantic labeling with infinite models in combination with lexicographic path orders. We replace semantic labeling with

  6. Multipole pair vibrations in superfluid 3He

    International Nuclear Information System (INIS)

    Baldo, M.; Giansiracusa, G.; Lombardo, U.; Pucci, R.; Petronio, G.


    Starting from a path integral formation of the 3 He superfluidity, the authors study the pair vibrations around the BCS solution. For both the BW and ABM states get a set of possible excitations. In particular it is shown that a new type of excitation is present for pure 1 = 2 spin singlet vibration. (Auth.)

  7. Pion-pair production by two photons

    International Nuclear Information System (INIS)

    Terazawa, Hidezumi.


    The cross section for pion-pair production by two photons is calculated approximately by using the low energy theorem previously derived from partially-conserved-axial-vector-current hypothesis and current algebra, and found to agree very well with the experimental data recently obtained by the Mark II, TPC/Two-Gamma and CLEO Collaborations. (author)

  8. Computing Hypercrossed Complex Pairings in Digital Images

    Directory of Open Access Journals (Sweden)

    Simge Öztunç


    Full Text Available We consider an additive group structure in digital images and introduce the commutator in digital images. Then we calculate the hypercrossed complex pairings which generates a normal subgroup in dimension 2 and in dimension 3 by using 8-adjacency and 26-adjacency.

  9. Phenomena, dynamics and instabilities of vortex pairs

    International Nuclear Information System (INIS)

    Williamson, C H K; Asselin, D J; Leweke, T; Harris, D M


    Our motivation for studying the dynamics of vortex pairs stems initially from an interest in the trailing wake vortices from aircraft and the dynamics of longitudinal vortices close to a vehicle surface. However, our motivation also comes from the fact that vortex–vortex interactions and vortex–wall interactions are fundamental to many turbulent flows. The intent of the paper is to present an overview of some of our recent work concerning the formation and structure of counter-rotating vortex pairs. We are interested in the long-wave and short-wave three-dimensional instabilities that evolve for an isolated vortex pair, but also we would like to know how vortex pairs interact with a wall, including both two-dimensional interactions, and also the influence of the surface on the three-dimensional instabilities. The emphasis of this presentation is on physical mechanisms by which vortices interact with each other and with surfaces, principally from an experimental approach, but also coupled with analytical studies. (paper)

  10. A Novel Approach for Collaborative Pair Programming (United States)

    Goel, Sanjay; Kathuria, Vanshi


    The majority of an engineer's time in the software industry is spent working with other programmers. Agile methods of software development like eXtreme Programming strongly rely upon practices like daily meetings and pair programming. Hence, the need to learn the skill of working collaboratively is of primary importance for software developers.…

  11. Pair production of intermediate vector bosons

    International Nuclear Information System (INIS)

    Mikaelian, K.O.


    The production of intermediate vector boson pairs W + W - , Z 0 Z 0 , W +- Z 0 and W +- γ in pp and p anti p collisions is discussed. The motivation is to detect the self-interactions among the four intermediate vector bosons

  12. Pairing the Adult Learner and Boutique Wineries (United States)

    Holyoke, Laura; Heath-Simpson, Delta


    This study explored connections between adult learners and their experiences in the context of small boutique wineries operating in the start-up phase of the organizational life cycle. The research objective was to gain insight regarding the pairing of adult learners with the entering of a specialty industry. Fourteen individuals from four…

  13. Plasma analog of particle-pair production

    International Nuclear Information System (INIS)

    Tsidulko, Yu.A.; Berk, H.L.


    It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws

  14. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    for FLP systems and their unique reactivity are discussed here. Keywords. Lewis .... we will concentrate on the design principles of such. FLPs and the ... Designs of frustrated Lewis pairs ..... 64 and neutral titanium (III) complex [Cp2TiOC6.

  15. Environmentally benign working pairs for adsorption refrigeration

    International Nuclear Information System (INIS)

    Cui Qun; Tao Gang; Chen Haijun; Guo Xinyue; Yao Huqing


    This paper begins from adsorption working pairs: water and ethanol were selected as refrigerants; 13x molecular sieve, silica gel, activated carbon, adsorbent NA and NB, proposed by authors, were selected as adsorbents, and the performance of adsorption working pairs in adsorption refrigeration cycle was studied. The adsorption isotherms of adsorbents (NA and NB) were obtained by high-vacuum gravimetric method. Desorption properties of adsorbents were analyzed and compared by thermal analysis method. The performance of adsorption refrigeration was studied on simulation device of adsorption refrigeration cycle. After presentation of adsorption isotherms, the thermodynamic performance for their use in adsorption refrigeration system was calculated. The results show: (1) the maximum adsorption capacity of water on adsorbent NA reaches 0.7 kg/kg, and the maximum adsorption capacity of ethanol on adsorbent NB is 0.68 kg/kg, which is three times that of ethanol on activated carbon, (2) the refrigeration capacity of NA-water working pair is 922 kJ/kg, the refrigeration capacity of NB-ethanol is 2.4 times that of activated carbon-methanol, (3) as environmental friendly and no public hazard adsorption working pair, NA-H 2 O and NB-ethanol can substitute activated carbon-methanol in adsorption refrigeration system using low-grade heat source

  16. Fermion pair physics at LEP2

    International Nuclear Information System (INIS)

    Georgios, Anagnostou


    Combined measurements of the 4 LEP collaborations for the fermion pair processes e + e - →f anti f are presented. The results show no significant deviations when compared with the Standard Model predictions and are used to set limits on contact interactions, Z' gauge bosons and low scale gravity models with large extra dimensions. (orig.)

  17. Frustrated Lewis pairs-assisted tritium labeling

    Czech Academy of Sciences Publication Activity Database

    Marek, Aleš; Široká, Sabina; Elbert, Tomáš


    Roč. 14, č. 5 (2016), s. 219 ISSN 2336-7202. [Sjezd českých a slovenských chemických společností /68./. 04.09.2016-07.09.2016, Praha] Institutional support: RVO:61388963 Keywords : frustrated Lewis pairs * one-pot synthesis * tritium -labeling Subject RIV: CC - Organic Chemistry

  18. Angular assymetries in a shielded pair line

    International Nuclear Information System (INIS)

    Fanchiotti, H.; Garcia Canal, C.A.; Vucetich, H.


    The capacitance matrix and surface charge density distribution of an unbalanced pair line with both longitudinal and balanced excitations is presented. In particular the case in which the axes of the inner wires are not restricted to lie on a line through the axis of the shield is discussed

  19. Recent progress in ATLAS top pair cross-sections: from precision measurements to rare processes

    CERN Multimedia

    CERN. Geneva


    High-precision top quark pair production cross-section measurements in proton-proton collisions at centre-of-mass energies of 7 and 8 TeV reach a precision of better than 4%, similar to that of recently achieved state-of-art NNLO+NNLL QCD calculations. These benchmark results can be used to extract physical parameters such as the top quark mass or constraints on new physics processes from the comparison between measurement and prediction. Inclusive, differential and fiducial cross section measurements for top pair production are also precision probes of QCD allowing to test latest Monte-Carlo generators. The large Run-1 data sample delivered by the LHC also allows the experiments to explore the production of top pair production in association with bosons.The seminar presents recent ATLAS results on cross-section measurements involving top quark pairs.

  20. Generation of narrow-band polarization-entangled photon pairs at a rubidium D1 line

    International Nuclear Information System (INIS)

    Tian Long; Li Shujing; Yuan Haoxiang; Wang Hai


    Using the process of cavity-enhanced spontaneous parametric down-conversion (SPDC), we generate a narrow-band polarization-entangled photon pair resonant on the rubidium (Rb) D1 line (795 nm). The degenerate single-mode photon pair is selected by multiple temperature controlled etalons. The linewidth of generated polarization-entangled photon pairs is 15 MHz which matches the typical atomic memory bandwidth. The measured Bell parameter for the polarization-entangled photons S = 2.73 ± 0.04 which violates the Bell-CHSH inequality by ∼18 standard deviations. The presented entangled photon pair source could be utilized in quantum communication and quantum computing based on quantum memories in atomic ensemble. (author)

  1. Binaries and triples among asteroid pairs (United States)

    Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián


    Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

  2. Nonlinear electrostatic structures in homogeneous and inhomogeneous pair-ion plasmas

    International Nuclear Information System (INIS)

    Mahmood, S.; Ur-Rehman, H.; Shah, A.; Haque, Q.


    The nonlinear electrostatic structures such as solitons, shocks were studied in homogeneous, unmagnetized pair-ion plasma. The dissipation in the system was taken through kinematic viscosities of both pair-ion species. The one dimensional (Korteweg-de Vries-Burgers) KdVB equation was derived using reductive perturbation method. The analytical solution of KdVB equation was obtained using tanh method. It was found that solitons and monotonic shocks structures were formed in such type of plasmas depending on the value of dissipation in the system. Both compressive and refractive structures of solitons and monotonic shocks were obtained depending on the temperatures of negative and positive ions. The oscillatory shock structures in pair-ion plasmas were also obtained and its necessary conditions of formation were discussed. The acoustic solitons were also investigated in inhomogeneous unmagnetized pair-ion plasmas. The Korteweg-de Vries (KdV) like equation with an additional term due to density gradients was obtained by employing the reductive perturbation technique. It was found that amplitude of both compressive and refractive solitons was found to be enhanced as the density gradient parameter was increased. The Landau damping rates of electrostatic ion waves were studied for non-Maxwellian or Lorentzian pair-ion plasmas. The Val sov equation was solved analytically for weak damping effects in pair-ion plasma. It was found that Landau damping rate of ion plasma wave was increased in Lorentzian case in comparison with Maxwellian pair-ion plasmas. The numerical results were obtained by taking into account the parameters of pair-ion plasmas produced in laboratory experiments in Japan. (orig./A.B.)

  3. Computational studies of a cut-wire pair and combined metamaterials

    International Nuclear Information System (INIS)

    Nguyen, Thanh Tung; Lievens, Peter; Lee, Young Pak; Vu, Dinh Lam


    The transfer-matrix method and finite-integration simulations show how the transmission properties of combined metamaterials, which consist of metallic cut-wire pairs and continuous wires, are affected by geometric parameters. The corresponding effective permittivity and permeability are retrieved from the complex scattering parameters using the standard retrieval procedure. The electromagnetic properties of the cut-wire pair as well as the left-handed behavior of the combined structure are understood by the effective medium theory. In addition, the dimensional dependence of transmission properties, the shapes of cut-wire pairs and continuous wire, and the impact of dielectric spacer are both examined. Finally, by expanding the results of previous research (Koschny et al 2003 Phys. Rev. Lett. 93 016608), we generalize the transmission picture of combined structures in terms of the correlation between electric and magnetic responses. (review)

  4. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs. (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko


    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  5. Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

    International Nuclear Information System (INIS)

    Friedmann, Tamar; Verlinde, Herman


    We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

  6. Neutron pair and proton pair transfer reactions between identical cores in the sulfur region

    International Nuclear Information System (INIS)

    Mermaz, M.C.


    Optical model and exact finite range distorted-wave Born approximation analyses were performed on neutron pair exchange between identical cores for 32 S and 34 S nuclei and on proton pair exchange between identical cores for 30 Si and 32 S. The extracted spectroscopic factors were compared with theoretical ones deduced from Hartree-Fock calculations on these pair of nuclei. The enhancement of the experimental cross sections with respect to the theoretical ones strongly suggests evidence for a nuclear Josephson effect. (author). 15 refs., 5 figs., 3 tabs

  7. Antimony-121 Moessbauer spectra of antimony(III) compounds with a stereochemically active lone pair

    International Nuclear Information System (INIS)

    Takeda, Masuo; Takahashi, Masashi; Ohyama, Ryuhichi


    The Sb-121 Moessbauer parameters at 20 K for 23 antimony(III) compounds were obtained and the data are discussed in terms of known crystal structures. The isomer shifts and quadrupole coupling constants depend strongly on the type of configuration around the Sb(III) atoms with stereochemically active lone pair electrons. (Auth.)

  8. Electron-positron pair production in ultrarelativistic atomic collisions: 6.4 TeV S16+ with Au, Pd and Al

    International Nuclear Information System (INIS)

    Datz, S.; Vane, C.R.; Dittner, P.F.; Krause, H.F.; Schuch, R.; Gao, H.; Hutton, R.


    Angular and momentum distributions have been measured for electron-positron pairs created in peripheral collisions of 6.4 TeV bare sulfur ions with thin targets of Al, Pd, and Au. Singly- and doubly-differential cross sections are presented for 1--17 MeV/c electrons and positrons detected independently and in coincidence as pairs. Various physical parameters are deduced from the coincident electron and positron data, including probability distributions for the pair transverse momentum, the pair total energy, and the positron fraction of the pair energy

  9. Paired peer learning through engineering education outreach (United States)

    Fogg-Rogers, Laura; Lewis, Fay; Edmonds, Juliet


    Undergraduate education incorporating active learning and vicarious experience through education outreach presents a critical opportunity to influence future engineering teaching and practice capabilities. Engineering education outreach activities have been shown to have multiple benefits; increasing interest and engagement with science and engineering for school children, providing teachers with expert contributions to engineering subject knowledge, and developing professional generic skills for engineers such as communication and teamwork. This pilot intervention paired 10 pre-service teachers and 11 student engineers to enact engineering outreach in primary schools, reaching 269 children. A longitudinal mixed methods design was employed to measure change in attitudes and Education Outreach Self-Efficacy in student engineers; alongside attitudes, Teaching Engineering Self-Efficacy and Engineering Subject Knowledge Confidence in pre-service teachers. Highly significant improvements were noted in the pre-service teachers' confidence and self-efficacy, while both the teachers and engineers qualitatively described benefits arising from the paired peer mentor model.

  10. Top quark pair production beyond NNLO

    Energy Technology Data Exchange (ETDEWEB)

    Muselli, Claudio [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Bonvini, Marco [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,1 Keble Road, OX1 3NP, Oxford (United Kingdom); Forte, Stefano [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Marzani, Simone [Center for Theoretical Physics, Massachusetts Institute of Technology,77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Ridolfi, Giovanni [Dipartimento di Fisica, Università di Genova and INFN - Sezione di Genova,Via Dodecaneso 33, I-16146 Genova (Italy)


    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N{sup 3}LO) in α{sub s}. We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N{sup 3}LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  11. Top quark pair production beyond NNLO

    International Nuclear Information System (INIS)

    Muselli, Claudio; Bonvini, Marco; Forte, Stefano; Marzani, Simone; Ridolfi, Giovanni


    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N 3 LO) in α s . We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N 3 LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  12. Photoproduction of Drell-Yan lepton pairs

    International Nuclear Information System (INIS)

    Jones, L.M.; Sullivan, J.D.; Willen, D.E.; Wyld, H.W.


    We investigate the Drell-Yan reaction γp → (μ + μ - ) X with an eye to experimental determination of the photon structure functions. Contributions to the process from both the nonhadronic anomaly and the vector-dominance piece are estimated: we find that the cross section from the anomaly dominates the vector-dominance contribution at large Q 2 . The background from Bethe-Heitler pairs is also calculated; it is somewhat suppressed by going to y=0, and further suppressed relative to the Drell-Yan contribution for fixed Q 2 by looking at high center-of-mass energies and at small Q/sub perpendicular/ for the pair. Overall we find that the absolute Drell-Yan cross sections in the regions of interest are very small; experimental study of the process will be difficult

  13. A search for resonant Z pair production

    Energy Technology Data Exchange (ETDEWEB)

    Boveia, Antonio [Univ. of California, Santa Barbara, CA (United States)


    I describe a search for anomalous production of Z pairs through a new massive resonance X in 2.5-2.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDFII Detector at the Fermilab Tevatron. I reconstruct Z pairs through their decays to electrons, muons, and quarks. To achieve perhaps the most efficient lepton reconstruction ever used at CDF, I apply a thorough understanding of the detector and new reconstruction software heavily revised for this purpose. In particular, I have designed and employ new general-purpose algorithms for tracking at large η in order to increase muon acceptance. Upon analyzing the unblinded signal samples, I observe no X → ZZ candidates and set upper limits on the production cross section using a Kaluza-Klein graviton-like acceptance.

  14. Magnetically-enhanced open string pair production (United States)

    Lu, J. X.


    We consider the stringy interaction between two parallel stacks of D3 branes placed at a separation. Each stack of D3 branes in a similar fashion carry an electric flux and a magnetic flux with the two sharing no common field strength index. The interaction amplitude has an imaginary part, giving rise to the Schwinger-like pair production of open strings. We find a significantly enhanced rate of this production when the two electric fluxes are almost identical and the brane separation is on the order of string scale. This enhancement will be largest if the two magnetic fluxes are opposite in direction. This novel enhancement results from the interplay of the non-perturbative Schwinger-type pair production due to the electric flux and the stringy tachyon due to the magnetic flux, and may have realistic physical applications.

  15. Radiation- and pair-loaded shocks (United States)

    Lyutikov, Maxim


    We consider the structure of mildly relativistic shocks in dense media, taking into account the radiation and pair loading, and diffusive radiation energy transfer within the flow. For increasing shock velocity (increasing post-shock temperature), the first important effect is the efficient energy redistribution by radiation within the shock that leads to the appearance of an isothermal jump, whereby the flow reaches the final state through a discontinuous isothermal transition. The isothermal jump, on scales much smaller than the photon diffusion length, consists of a weak shock and a quick relaxation to the isothermal conditions. Highly radiation-dominated shocks do not form isothermal jump. Pair production can mildly increase the overall shock compression ratio to ≈10 (4 for matter-dominated shocks and 7 of the radiation-dominated shocks).

  16. Dynamics and Instabilities of Vortex Pairs (United States)

    Leweke, Thomas; Le Dizès, Stéphane; Williamson, Charles H. K.


    This article reviews the characteristics and behavior of counter-rotating and corotating vortex pairs, which are seemingly simple flow configurations yet immensely rich in phenomena. Since the reviews in this journal by Widnall (1975) and Spalart (1998) , who studied the fundamental structure and dynamics of vortices and airplane trailing vortices, respectively, there have been many analytical, computational, and experimental studies of vortex pair flows. We discuss two-dimensional dynamics, including the merging of same-sign vortices and the interaction with the mutually induced strain, as well as three-dimensional displacement and core instabilities resulting from this interaction. Flows subject to combined instabilities are also considered, in particular the impingement of opposite-sign vortices on a ground plane. We emphasize the physical mechanisms responsible for the flow phenomena and clearly present the key results that are useful to the reader for predicting the dynamics and instabilities of parallel vortices.

  17. Space-Efficient Re-Pair Compression

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Prezza, Nicola


    Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

  18. Glass scintillator pair for compensation neutron logging

    International Nuclear Information System (INIS)

    Ji Changsong; Li Xuezhi; Yiu Guangduo


    Glass scintillator pair types ST 1604 and ST 1605 for compensation of neutron logging is developed. The neutron sensitive material used is multistick lithium glass scintillators 3 and 4 mm in diameter respectively. Thermoneutron detection efficiencies are 50-60% and 100% respectively. The detection efficiency for 60 Co γ ray is lower than 0.3%. The type ST 1604 and ST 1605 may also be used as high sensitive neutron detectors in an intensive γ ray field

  19. On $ \\phi $ -amicable pairs (with appendix)

    NARCIS (Netherlands)

    G.L. Cohen; H.J.J. te Riele (Herman)


    textabstractLet $\\phi(n)$ denote Euler's totient function, i.e., the number of positive integers~$pairs of positive integers $(a_0,a_1)$ with $a_0\\le a_1$ such that $\\phi(a_0)=\\phi(a_1)=(a_0+a_1)/k$ for some integer $k\\ge1$. We call these numbers $\\phi$--{\\it

  20. Signature scheme based on bilinear pairs (United States)

    Tong, Rui Y.; Geng, Yong J.


    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  1. Hadronic production of lepton pairs (experimental)

    International Nuclear Information System (INIS)

    Boucrot, J.


    Hadonic production of lepton pairs has become a good testground of Q.C.D. The large effects predicted in cross sections and in Psub(T) distributions are seen and may be one of the good indirect proofs of the existence of gluons. Detailed experimental results are available, and clearly it is necessary that higher order Q.C.D. corrections should be estimated

  2. W+- pairs and neutral currents at ISABELLE

    International Nuclear Information System (INIS)

    Mikaelian, K.O.


    A report is presented on two different types of processes which may form part of the weak interactions program. The first is the production of pairs of charged weak bosons in the process pp → W + W - X; the second involves searching for neutral current effects in the rate for ordinary lepton production, without measuring any charge asymmetry or helicities using the reaction pp → l + l - X

  3. Narrowband polarization entangled telecom photon pair source


    Kaiser , Florian; Issautier , Amandine; Alibart , Olivier; Martin , Anthony; Tanzilli , Sébastien


    Contributed Talk; International audience; During the last decade, quantum entanglement has paved the way out to of the lab modern applications such as quantum computation and communication. Today, small scale quantum networks exist already, but they are limited to a few 100 km distance, due to intrinsic fiber transmission losses and non perfect detectors. These networks are typically established using photon pair sources based on spontaneous parametric down conversion (SPDC). Widely used enta...

  4. Pairing from dynamically screened Coulomb repulsion in bismuth (United States)

    Ruhman, Jonathan; Lee, Patrick A.


    Recently, Prakash et al. have discovered bulk superconductivity in single crystals of bismuth, which is a semimetal with extremely low carrier density. At such low density, we argue that conventional electron-phonon coupling is too weak to be responsible for the binding of electrons into Cooper pairs. We study a dynamically screened Coulomb interaction with effective attraction generated on the scale of the collective plasma modes. We model the electronic states in bismuth to include three Dirac pockets with high velocity and one hole pocket with a significantly smaller velocity. We find a weak-coupling instability, which is greatly enhanced by the presence of the hole pocket. Therefore we argue that bismuth is the first material to exhibit superconductivity driven by retardation effects of Coulomb repulsion alone. By using realistic parameters for bismuth we find that the acoustic plasma mode does not play the central role in pairing. We also discuss a matrix element effect, resulting from the Dirac nature of the conduction band, which may affect Tc in the s -wave channel without breaking time-reversal symmetry.

  5. Lattice dynamics of impurity clusters : application to pairs

    International Nuclear Information System (INIS)

    Chandralekha Devi, N.; Behera, S.N.


    A general solution is obtained for the lattice dynamics of a cluster of n-impurity atoms using the double-time Green's function formalism. The cluster is characterized by n-mass defect and m-force constant change parameters. It is shown that this general solution for the Green's function for the n-impurity cluster can also be expressed in terms of the Green's function for the (n-1)-impurity cluster. As an application, the cluster impurity modes for a pair are calculated using the Debye model for the host lattice dynamics. The splitting of the high frequency local modes and nearly zero frequency resonant modes due to pairs show an oscillatory behaviour on varying the distance of separation between the two impurity atoms. These oscillations are most prominent for two similar impurities and get damped for two dissimilar impurities or if one of the impurities produces a force constant change. The predictions of the calculation provide qualitative explanation of the data obtained from the infrared measurements of the resonant modes in mixed crystal system of KBrsub(1-c)Clsub(c):Lisup(+) and KBrsub(1-c)Isub(c):Lisup(+). (author)

  6. Modelling the secular evolution of migrating planet pairs (United States)

    Michtchenko, T. A.; Rodríguez, A.


    The subject of this paper is the secular behaviour of a pair of planets evolving under dissipative forces. In particular, we investigate the case when dissipative forces affect the planetary semimajor axes and the planets move inwards/outwards the central star, in a process known as planet migration. To perform this investigation, we introduce fundamental concepts of conservative and dissipative dynamics of the three-body problem. Based on these concepts, we develop a qualitative model of the secular evolution of the migrating planetary pair. Our approach is based on the analysis of the energy and the orbital angular momentum exchange between the two-planet system and an external medium; thus no specific kind of dissipative forces is invoked. We show that, under the assumption that dissipation is weak and slow, the evolutionary routes of the migrating planets are traced by the Mode I and Mode II stationary solutions of the conservative secular problem. The ultimate convergence and the evolution of the system along one of these secular modes of motion are determined uniquely by the condition that the dissipation rate is sufficiently smaller than the proper secular frequency of the system. We show that it is possible to reassemble the starting configurations and the migration history of the systems on the basis of their final states and consequently to constrain the parameters of the physical processes involved.

  7. 3D2 pairing in asymmetric nuclear matter

    International Nuclear Information System (INIS)

    Alm, T.


    The superfluid 3 D 2 pairing instability in isospin-asymmetric nuclear matter is studied, using the Paris nucleon-nucleon interaction as an input. It is found that the critical temperature associated with the transition to the superfluid phase becomes strongly suppressed with increasing isospin asymmetry, and vanishes for asymmetry parameter values α (≡(n n -n p )/(n n +n p )) that are larger than several percent. It is shown that for neutron star models based on relativistic, field-theoretical equations of state, a large fraction of their interior may exist in a 3 D 2 -paired superfluid phase. The implications of such a 3 D 2 superfluid in massive neutron stars is discussed with respect to observable pulsar phenomena. Another interesting phenomenon, discussed in the paper, concerns the numerical finding of two critical superfluid temperatures for a given density in the case of isospin-asymmetric matter. Using the BCS cut-off ansatz, a mathematical expression for the critical temperature is derived which confirms this finding analytically. (orig.)

  8. Neutrino signal from pair-instability supernovae (United States)

    Wright, Warren P.; Gilmer, Matthew S.; Fröhlich, Carla; Kneller, James P.


    A very massive star with a carbon-oxygen core in the range of 64M ⊙Earth from two, one-dimensional pair-instability supernova simulations which bracket the mass range of stars which explode by this mechanism taking into account the full time and energy dependence of the neutrino emission and the flavor evolution through the outer layers of the star. We calculate the neutrino signals in five different detectors chosen to represent present or near future designs. We find the more massive progenitors explode as pair-instability supernova which can easily be detected in multiple different neutrino detectors at the "standard" supernova distance of 10 kpc producing several events in DUNE, JUNO, and Super-Kamiokande, while the lightest progenitors produce only a handful of events (if any) in the same detectors. The proposed Hyper-Kamiokande detector would detect neutrinos from a large pair-instability supernova as far as ˜50 kpc allowing it to reach the Megallanic Clouds and the several very high mass stars known to exist there.

  9. Exclusive production of W pairs in CMS

    Directory of Open Access Journals (Sweden)

    Silveira Da


    Full Text Available We report the results on the search for exclusive production of W pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at √s = 7 TeV. The analysis comprises the two-photon production of a W pairs, pp → pW+ W− p → p νe± νµ∓ p. Two events are observed in data for pT(ℓ > 4 GeV, |η(ℓ| 20 GeV, in agreement with the standard model prediction of 2.2 ± 0.4 signal events with 0.84 ± 0.15 background events. Moreover, a study of the tail of the lepton pair transverse momentum distribution is performed to search for an evidence of anomalous quartic gauge couplings in the γγ → W+ W− vertex. As no events are observed in data, it results in a model-independent upper limits for the anomalous W quartic gauge couplings aW0,C/Λ2, which are of the order of 10−4.

  10. Galactic Pairs in the Early Universe (United States)

    Kohler, Susanna


    In the spirit of Valentines Day, today well be exploring apparent pairs of galaxies in the distant, early universe. How can we tell whether these duos are actually paired galaxies, as opposed to disguised singles?Real Pair, or Trick of the Light?In the schematic timeline of the universe, the epoch of reionization is when the first galaxies and quasars began to form and evolve. [NASA]The statistics of merging galaxies throughout the universe reveal not only direct information about how galaxies interact, but also cosmological information about the structure of the universe. While weve observed many merging galaxy pairs at low redshift, however, its much more challenging to identify these duos in the early universe.A merging pair of galaxies at high redshift appears to us as a pair of unresolved blobs that lie close to each other in the sky. But spotting such a set of objects doesnt necessarily mean were looking at a merger! There are three possible scenarios to explain an observed apparent duo:Its a pair of galaxies in a stage of merger.Its a projection coincidence; the two galaxies arent truly near each other.Its a single galaxy being gravitationally lensed by a foreground object. This strong lensing produces the appearance of multiple galaxies.Hubble photometry of one of the three galaxy groups identified at z 8, with the galaxies in the image labeled with their corresponding approximate photometric redshifts. [Adapted from Chaikin et al. 2018]Hunting for Distant DuosIn a recent study led by Evgenii Chaikin (Peter the Great St. Petersburg Polytechnic University, Russia), a team of scientists has explored the Hubble Ultra Deep Field in search ofhigh-redshift galaxies merging during the epoch of reionization, when the first galaxies formed and evolved.Using an approach called the dropout technique, which leverages the visibility of the galaxies in different wavelength filters, Chaikin and collaborators obtain approximate redshifts for an initial sample of 7

  11. Pair formation by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.


    We obtain solutions of the Dirac and Klein-Gordon equations for a symmetric one-dimensional potential well with a flat bottom, and arbitrary depth, width, and field strength at the walls. Quasistationary solutions are found describing pair creation by the well, and the inverse process. It is shown that when the probability of pair creation by the well is small, it can be expressed in terms of the probability of pair creation at one of the walls and the oscillation frequency of the particle in the well. Among the states of the lower continuum, there are positron resonance scattering states for supercritical well depths. The energies of these states are close to the real part of the quasistationary energy level (the Zel'dovich effect). The qualitative dependence of the transmission coefficient of the positron through the well on its energy and the well width supports the idea that the solution of the so-called one-particle Dirac equation describes a many-particle system with charge 0 or 1

  12. Pair creation by dynamic field configurations

    International Nuclear Information System (INIS)

    Aoyama, H.


    This thesis deals with the dynamics of the classical configuration of a quantum field unstable due to pair creation. The effective action method is developed first to treat such problems for a simple two-field model. Physical quantities such as pair creation probabilities are related to a complex function called the effective configuration, which is defined to minimize the effective action. Unitarity of the S-matrix is verified at the lowest order of the weak-field approximation. At the same order, the real valued vacuum expectation value of the quantum field, named the real configuration, is constructed in terms of the effective configuration. An integro-differential equation for the real configuration is given and is used to show that the real configuration is causal, while the effective configuration is not. Two practical applications of the effective action method are discussed. The first deals with pair creation in an anisotropic universe, and the real geometry is given in terms of the effective geometry in the samll anisotropy limit. The second deals with expanding vacuum bubbles. Corresponding to three possible situations, three kinds of field equations of each of the effective configuration and the real configuration are obtained. The behavior of the bubble is also studied by a semi-classical method, and one of the three situations is suggested to be plausible

  13. Quantitative evaluation of pairs and RS steganalysis (United States)

    Ker, Andrew D.


    We give initial results from a new project which performs statistically accurate evaluation of the reliability of image steganalysis algorithms. The focus here is on the Pairs and RS methods, for detection of simple LSB steganography in grayscale bitmaps, due to Fridrich et al. Using libraries totalling around 30,000 images we have measured the performance of these methods and suggest changes which lead to significant improvements. Particular results from the project presented here include notes on the distribution of the RS statistic, the relative merits of different "masks" used in the RS algorithm, the effect on reliability when previously compressed cover images are used, and the effect of repeating steganalysis on the transposed image. We also discuss improvements to the Pairs algorithm, restricting it to spatially close pairs of pixels, which leads to a substantial performance improvement, even to the extent of surpassing the RS statistic which was previously thought superior for grayscale images. We also describe some of the questions for a general methodology of evaluation of steganalysis, and potential pitfalls caused by the differences between uncompressed, compressed, and resampled cover images.

  14. Pair-correlations in swimmer suspensions (United States)

    Nambiar, Sankalp; Subramanian, Ganesh


    Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

  15. Estimating Eulerian spectra from pairs of drifters (United States)

    LaCasce, Joe


    GPS-tracked surface drifters offer the possibility of sampling energetic variations at the ocean surface on scales of only 10s of meters, much less than that resolved by satellite. Here we investigate whether velocity differences between pairs of drifters can be used to estimate kinetic energy spectra. Theoretical relations between the spectrum and the second-order longitudinal structure function for 2D non-divergent flow are derived. The structure function is a natural statistic for particle pairs and is easily calculated. However it integrates contributions across wavenumber, and this tends to obscure the spectral dependencies when turbulent inertial ranges are of finite extent. Nevertheless, the transform from spectrum to structure function is robust, as illustrated with Eulerian data collected from aircraft. The inverse transform, from structure function to spectrum, is much less robust, yielding poor results in particular at large wavenumbers. This occurs because the transform involves a filter function which magnifies contributions from large pair separations, which tend to be noisy. Fitting the structure function to a polynomial improves the spectral estimate, but not sufficiently to distinguish correct inertial range dependencies. Thus with Lagrangian data, it is appears preferable to focus on structure functions, despite their shortcomings.

  16. Magnetic Pair Creation Transparency in Pulsars (United States)

    Story, Sarah; Baring, M. G.


    The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.

  17. Paired and interacting galaxies: Conference summary

    International Nuclear Information System (INIS)

    Norman, C.A.


    The author gives a summary of the conference proceedings. The conference began with the presentation of the basic data sets on pairs, groups, and interacting galaxies with the latter being further discussed with respect to both global properties and properties of the galactic nuclei. Then followed the theory, modelling and interpretation using analytic techniques, simulations and general modelling for spirals and ellipticals, starbursts and active galactic nuclei. Before the conference the author wrote down the three questions concerning pairs, groups and interacting galaxies that he hoped would be answered at the meeting: (1) How do they form, including the role of initial conditions, the importance of subclustering, the evolution of groups to compact groups, and the fate of compact groups; (2) How do they evolve, including issues such as relevant timescales, the role of halos and the problem of overmerging, the triggering and enhancement of star formation and activity in the galactic nuclei, and the relative importance of dwarf versus giant encounters; and (3) Are they important, including the frequency of pairs and interactions, whether merging and interactions are very important aspects of the life of a normal galaxy at formation, during its evolution, in forming bars, shells, rings, bulges, etc., and in the formation and evolution of active galaxies? Where possible he focuses on these three central issues in the summary

  18. Orthogonal expansions related to compact Gelfand pairs

    DEFF Research Database (Denmark)

    Berg, Christian; Peron, Ana P.; Porcu, Emilio


    . The functions of this class are the functions having a uniformly convergent expansion ∑ϕεZB(ϕ)(u)ϕ(x) for xεG,uεL, where the sum is over the space Z of positive definite spherical functions ϕ:G→C for the Gelfand pair, and (B(ϕ))ϕεZ is a family of continuous positive definite functions on L such that ∑ϕε......For a locally compact group G, let P(G) denote the set of continuous positive definite functions f:G→C. Given a compact Gelfand pair (G,K) and a locally compact group L, we characterize the class PK#(G,L) of functions fεP(G×L) which are bi-invariant in the G-variable with respect to K......(d)) and (U(q),U(q-1)) as well as for the product of these Gelfand pairs.The result generalizes recent theorems of Berg-Porcu (2016) and Guella-Menegatto (2016)....

  19. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation


    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.


    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  20. Wigner function for the generalized excited pair coherent state

    International Nuclear Information System (INIS)

    Meng Xiangguo; Wang Jisuo; Liang Baolong; Li Hongqi


    This paper introduces the generalized excited pair coherent state (GEPCS). Using the entangled state |η> representation of Wigner operator, it obtains the Wigner function for the GEPCS. In the ρ-γ phase space, the variations of the Wigner function distributions with the parameters q, α, k and l are discussed. The tomogram of the GEPCS is calculated with the help of the Radon transform between the Wigner operator and the projection operator of the entangled state |η 1 , η 2 , τ 1 , τ 2 >. The entangled states |η> and η 1 , η 2 , τ 1 , τ 2 > provide two good representative space for studying the Wigner functions and tomograms of various two-mode correlated quantum states

  1. Strong Convergence Theorems for a Pair of Strictly Pseudononspreading Mappings

    Directory of Open Access Journals (Sweden)

    Bin-Chao Deng


    Full Text Available Let H be a real Hilbert space. Let T1,T2:H→H be k1-, k2-strictly pseudononspreading mappings; let αn and βn be two real sequences in (0,1. For given x0∈H, the sequence xn is generated iteratively by xn+1=βnxn+1-βnTw1αnγfxn+I-μαnBTw2xn, ∀n∈N, where Twi=1−wiI+wiTi with i=1,2 and B:H→H is strongly monotone and Lipschitzian. Under some mild conditions on parameters αn and βn, we prove that the sequence xn converges strongly to the set FixT1∩FixT2 of fixed points of a pair of strictly pseudononspreading mappings T1 and T2.

  2. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski


    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  3. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree


    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  4. Calculation of the decay rate of tachyonic neutrinos against charged-lepton-pair and neutrino-pair Cerenkov radiation (United States)

    Jentschura, Ulrich D.; Nándori, István; Ehrlich, Robert


    We consider in detail the calculation of the decay rate of high-energy superluminal neutrinos against (charged) lepton pair Cerenkov radiation, and neutrino pair Cerenkov radiation, i.e., against the decay channels ν \\to ν {e}+ {e}- and ν \\to ν \\overline{ν } ν . Under the hypothesis of a tachyonic nature of neutrinos, these decay channels put constraints on the lifetime of high-energy neutrinos for terrestrial experiments as well as on cosmic scales. For the oncoming neutrino, we use the Lorentz-covariant tachyonic relation {E}ν =\\sqrt{{p}2-{m}ν 2}, where m ν is the tachyonic mass parameter. We derive both threshold conditions as well as on decay and energy loss rates, using the plane-wave fundamental bispinor solutions of the tachyonic Dirac equation. Various intricacies of rest frame versus lab frame calculations are highlighted. The results are compared to the observations of high-energy IceCube neutrinos of cosmological origin.

  5. Genetic parameters for ostrich incubation traits in South Africa ...

    African Journals Online (AJOL)

    Genetic parameters for ostrich incubation traits in South Africa. Z Brand, S Cloete, I Malecki, C Brown. Abstract. Data obtained from a pair-mated ostrich flock located at Oudtshoorn, South Africa, were used to estimate genetic parameters for egg weight (EWT), weight of day-old chicks (CWT), water loss to 21 (WL21) and 35 ...

  6. Parameter Estimation for Thurstone Choice Models

    Energy Technology Data Exchange (ETDEWEB)

    Vojnovic, Milan [London School of Economics (United Kingdom); Yun, Seyoung [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    We consider the estimation accuracy of individual strength parameters of a Thurstone choice model when each input observation consists of a choice of one item from a set of two or more items (so called top-1 lists). This model accommodates the well-known choice models such as the Luce choice model for comparison sets of two or more items and the Bradley-Terry model for pair comparisons. We provide a tight characterization of the mean squared error of the maximum likelihood parameter estimator. We also provide similar characterizations for parameter estimators defined by a rank-breaking method, which amounts to deducing one or more pair comparisons from a comparison of two or more items, assuming independence of these pair comparisons, and maximizing a likelihood function derived under these assumptions. We also consider a related binary classification problem where each individual parameter takes value from a set of two possible values and the goal is to correctly classify all items within a prescribed classification error. The results of this paper shed light on how the parameter estimation accuracy depends on given Thurstone choice model and the structure of comparison sets. In particular, we found that for unbiased input comparison sets of a given cardinality, when in expectation each comparison set of given cardinality occurs the same number of times, for a broad class of Thurstone choice models, the mean squared error decreases with the cardinality of comparison sets, but only marginally according to a diminishing returns relation. On the other hand, we found that there exist Thurstone choice models for which the mean squared error of the maximum likelihood parameter estimator can decrease much faster with the cardinality of comparison sets. We report empirical evaluation of some claims and key parameters revealed by theory using both synthetic and real-world input data from some popular sport competitions and online labor platforms.

  7. Torsion of the central pair microtubules in eukaryotic flagella due to bending-driven lateral buckling

    International Nuclear Information System (INIS)

    Li, C.; Ru, C.Q.; Mioduchowski, A.


    Inspired by recent interest in torsion of the central pair microtubules in eukaryotic flagella, a novel thin-walled elastic beam model is suggested to study critical condition under which uniform bending of a flagellum will cause lateral/torsional buckling of the central pair. The model is directed to the central pair itself and the role of all surrounding cross-linkings inside the flagellum is modeled as an equivalent surrounding elastic medium. The model predicts that bending-driven torsion of the central pair does occur when the radius of curvature of the bent flagellum reduces to a moderate critical value typically of tens of microns. In particular, this critical value is almost independent of the flagellum length, and more sensitive to the parameters defining the surrounding elastic medium than the shear modulus of microtubules. The predicted wavelengths of the torsional buckling mode are insensitive to the flagellum length and comparable to some known related experimental data. These results indicate that torsion of the central pair microtubules in flagella is inevitable as a result of bending-driven lateral buckling. This offers an entirely new insight into the ongoing research on the mechanism of the central pair torsion


    Energy Technology Data Exchange (ETDEWEB)

    Domingue, Donovan L.; Ronca, Joseph; Hill, Emily; Jacques, Allison [Georgia College and State University, CBX 82, Milledgeville, GA 31061 (United States); Cao, Chen [School of Space Science and Physics, Shandong University, Weihai, Weihai, Shandong 264209 (China); Xu, C. Kevin [Infrared Processing and Analysis Center, California Institute of Technology 100-22, Pasadena, CA 91125 (United States); Jarrett, Thomas H. [University of Cape Town, Private Bag X3, Rondebosch 7701, Republic of South Africa (South Africa)


    We present an analysis of dust properties of a sample of close major-merger galaxy pairs selected by K {sub s} magnitude and redshift. The pairs represent the two populations of spiral–spiral (S+S) and mixed morphology spiral–elliptical (S+E). The Code Investigating GALaxy Emission software is used to fit dust models to the Two Micron All Sky Survey, Wide-Field Infrared Survey Explorer , and Herschel flux density measurements, and to derive the parameters describing the polycyclic aromatic hydrocarbons contribution, interstellar radiation field, and photodissociation regions. Model fits verify our previous Spitzer Space Telescope analysis that S+S and S+E pairs do not have the same level of enhancement of star formation and differ in dust composition. The spirals of mixed-morphology galaxy pairs do not exhibit the enhancements in interstellar radiation field and therefore dust temperature for spirals in S+S pairs in contrast to what would be expected according to standard models of gas redistribution due to encounter torques. This suggests the importance of the companion environment/morphology in determining the dust properties of a spiral galaxy in a close major-merger pair.


    International Nuclear Information System (INIS)

    Domingue, Donovan L.; Ronca, Joseph; Hill, Emily; Jacques, Allison; Cao, Chen; Xu, C. Kevin; Jarrett, Thomas H.


    We present an analysis of dust properties of a sample of close major-merger galaxy pairs selected by K s magnitude and redshift. The pairs represent the two populations of spiral–spiral (S+S) and mixed morphology spiral–elliptical (S+E). The Code Investigating GALaxy Emission software is used to fit dust models to the Two Micron All Sky Survey, Wide-Field Infrared Survey Explorer , and Herschel flux density measurements, and to derive the parameters describing the polycyclic aromatic hydrocarbons contribution, interstellar radiation field, and photodissociation regions. Model fits verify our previous Spitzer Space Telescope analysis that S+S and S+E pairs do not have the same level of enhancement of star formation and differ in dust composition. The spirals of mixed-morphology galaxy pairs do not exhibit the enhancements in interstellar radiation field and therefore dust temperature for spirals in S+S pairs in contrast to what would be expected according to standard models of gas redistribution due to encounter torques. This suggests the importance of the companion environment/morphology in determining the dust properties of a spiral galaxy in a close major-merger pair.

  10. Top quark pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Baernreuther, Peter


    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 ({proportional_to}7.3 pb at the Tevatron to {proportional_to}800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair

  11. Top quark pair production at the LHC

    International Nuclear Information System (INIS)

    Baernreuther, Peter


    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 (∝7.3 pb at the Tevatron to ∝800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair production in quark anti

  12. CONDENSED MATTER: STRUCTURE, THERMAL AND MECHANICAL PROPERTIES: Pair interaction of bilayer-coated nanoscopic particles (United States)

    Zhang, Qi-Yi


    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placed on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphiles, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery.

  13. Advanced Twisted Pair Cables for Distributed Local Area Networks in Intelligent Structure Systems (United States)

    Semenov, Andrey


    The possibility of a significant increase in the length of cable communication channels of local area networks of automation and engineering support systems of buildings in the case of their implementation on balanced twisted pair cables is shown. Assuming a direct connection scheme and an effective speed of 100 Mbit/s, analytical relationships are obtained for the calculation of the maximum communication distance. The necessity of using in the linear part of such systems of twisted pair cables with U/UTP structure and interference parameters at the level of category 5e is grounded.

  14. Pairing and low temperature properties of 2 D Fermi-systems with attraction between particles

    International Nuclear Information System (INIS)

    Gorbar, E.V.; Gusynin, V.P.; Loktev, V.M.


    Proceeding from microscopic model Hamiltonian for the system of Fermi-particles with attraction the effective Lagrangian, admitting the analysis of its superconducting properties at arbitrary fermion concentration, is obtained.Exact solution for gap and chemical potential makes it possible to trace from local pair situation to Cooper pairing. The crucial parameter discriminating between the regions of exotic and normal superconducting behaviour is show to be that of the energy of the bound fermion state, which, however, rapidly disappears with fermion density increasing. The solutions of the equations for the case of finite temperatures are analysed. (author). 42 refs

  15. Older Galaxy Pair Has Surprisingly Youthful Glow (United States)


    [figure removed for brevity, see original site] Poster Version A pair of interacting galaxies might be experiencing the galactic equivalent of a mid-life crisis. For some reason, the pair, called Arp 82, didn't make their stars early on as is typical of most galaxies. Instead, they got a second wind later in life -- about 2 billion years ago -- and started pumping out waves of new stars as if they were young again. Arp 82 is an interacting pair of galaxies with a strong bridge and a long tail. NGC 2535 is the big galaxy and NGC 2536 is its smaller companion. The disk of the main galaxy looks like an eye, with a bright 'pupil' in the center and oval-shaped 'eyelids.' Dramatic 'beads on a string' features are visible as chains of evenly spaced star-formation complexes along the eyelids. These are presumably the result of large-scale gaseous shocks from a grazing encounter. The colors of this galaxy indicate that the observed stars are young to intermediate in age, around 2 million to 2 billion years old, much less than the age of the universe (13.7 billion years). The puzzle is: why didn't Arp 82 form many stars earlier, like most galaxies of that mass range? Scientifically, it is an oddball and provides a relatively nearby lab for studying the age of intermediate-mass galaxies. This picture is a composite captured by Spitzer's infrared array camera with light at wavelength 8 microns shown in red, NASA's Galaxy Evolution Explorer combined 1530 and 2310 Angstroms shown in blue, and the Southeastern Association for Research in Astronomy Observatory light at 6940 Angstroms shown in green.

  16. Augmenting Think-Pair-Share with Simulations (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS


    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  17. Paired structures and bipolar knowledge representation

    DEFF Research Database (Denmark)

    Montero, Javier; Bustince, Humberto; Franco, Camilo

    In this strictly positional paper we propose a general approach to bipolar knowledge representation, where the meaning of concepts can be modelled by examining their decomposition into opposite and neutral categories. In particular, it is the semantic relationship between the opposite categories...... and at the same time the type of neutrality rising in between opposites. Based on this first level of bipolar knowledge representation, paired structures in fact offer the means to characterize a specific bipolar valuation scale depending on the meaning of the concept that has to be verified. In this sense...

  18. Z Boson Pair-Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M


    Events stemming from the pair-production of Z bosons in e^+e^- collisions are studied using 217.4 pb^-1 of data collected with the L3 detector at centre-of-mass energies from 200 GeV up to 209 GeV. The special case of events with b quarks is also investigated. Combining these events with those collected at lower centre-of-mass energies, the Standard Model predictions for the production mechanism are verified. In addition, limits are set on anomalous couplings of neutral gauge bosons and on effects of extra space dimensions.

  19. Pair Negotiation When Developing English Speaking Tasks

    Directory of Open Access Journals (Sweden)

    Ingrid Liliana Bohórquez Suárez


    Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

  20. Production of supersymmetric pairs at antipp colliders

    International Nuclear Information System (INIS)

    Peschanski, R.


    Production and decay rates of squarks and gluinos at antipp colliders are shown to depend not only on the mass scale but on the ratio of squark to gluino mass. In the degenerate case which is shown to be natural in a large class of broken Supergravity models with minimal field content the predicted cross-sections are enhanced by a sizeable factor. This gives an improved bound on the squark mass (70 GeV) from the analysis of Cern monojets and indications for the search of squark decay modes of supersymmetric pairs at antipp colliders in the near future

  1. Pairing correlations in a fissioning potential well

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.


    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler box potential with a δ-function diaphragm to mimic scission

  2. Hadroproduction of massive lepton pairs and QCD

    International Nuclear Information System (INIS)

    Berger, E.L.


    A survey is presented of some current issues of interest in attempts to describe the production of massive lepton pairs in hadronic collisions at high energies. I concentrate on the interpretation of data in terms of the parton model and on predictions derived from quantum-chromodynamics (QCD), their reliability and their confrontation with experiment. Among topics treated are the connection with deep-inelastic lepton scattering, universality of structure functions, and the behavior of cross-sections as a function of transverse momentum

  3. Dimer pair correlations on the brick lattice

    International Nuclear Information System (INIS)

    Yokoi, C.S.O.; Nagle, J.F.; Sulinas, S.R.


    Using exact methods, pair-correlation functions are studied in the dimer model defined on a brick lattice. At long distances these functions exhibit strongly anisotropic algebraic decay and, near criticality, the length scales diverge differently in the two principal directions. The critical exponents are v /sub x/ =1/2 and v /sub y/ =1. These results are in agreement with deductions drawn from recent exact finite-size scaling calculations. We also interpret our results in the light of domain wall theories of commensurate-incommensurate transitions, and in particular we study the relation of the present model to the discrete version of the Pokrovsky-Talapov model introduced by Villain

  4. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    Energy Technology Data Exchange (ETDEWEB)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)


    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  5. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation (United States)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.


    Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  6. Frequent Pairs in Data Streams: Exploiting Parallelism and Skew

    DEFF Research Database (Denmark)

    Campagna, Andrea; Kutzkow, Konstantin; Pagh, Rasmus


    We introduce the Pair Streaming Engine (PairSE) that detects frequent pairs in a data stream of transactions. Our algorithm finds the most frequent pairs with high probability, and gives tight bounds on their frequency. It is particularly space efficient for skewed distribution of pair supports...... items mining in data streams. We show how to efficiently scale these approaches to handle large transactions. We report experimental results showcasing precision and recall of our method. In particular, we find that often our method achieves excellent precision, returning identical upper and lower...... bounds on the supports of the most frequent pairs....

  7. Multicritical phase diagrams of the Blume-Emery-Griffiths model with repulsive biquadratic coupling including metastable phases: the pair approximation and the path probability method with pair distribution

    International Nuclear Information System (INIS)

    Keskin, Mustafa; Erdinc, Ahmet


    As a continuation of the previously published work, the pair approximation of the cluster variation method is applied to study the temperature dependences of the order parameters of the Blume-Emery-Griffiths model with repulsive biquadratic coupling on a body centered cubic lattice. We obtain metastable and unstable branches of the order parameters besides the stable branches and phase transitions of these branches are investigated extensively. We study the dynamics of the model by the path probability method with pair distribution in order to make sure that we find and define the metastable and unstable branches of the order parameters completely and correctly. We present the metastable phase diagram in addition to the equilibrium phase diagram and also the first-order phase transition line for the unstable branches of the quadrupole order parameter is superimposed on the phase diagrams. It is found that the metastable phase diagram and the first-order phase boundary for the unstable quadrupole order parameter always exist at the low temperatures which are consistent with experimental and theoretical works

  8. Pair Production Constraints on Superluminal Neutrinos Revisited

    International Nuclear Information System (INIS)

    Brodsky, Stanley


    We revisit the pair creation constraint on superluminal neutrinos considered by Cohen and Glashow in order to clarify which types of superluminal models are constrained. We show that a model in which the superluminal neutrino is effectively light-like can evade the Cohen-Glashow constraint. In summary, any model for which the CG pair production process operates is excluded because such timelike neutrinos would not be detected by OPERA or other experiments. However, a superluminal neutrino which is effectively lightlike with fixed p 2 can evade the Cohen-Glashow constraint because of energy-momentum conservation. The coincidence involved in explaining the SN1987A constraint certainly makes such a picture improbable - but it is still intrinsically possible. The lightlike model is appealing in that it does not violate Lorentz symmetry in particle interactions, although one would expect Hughes-Drever tests to turn up a violation eventually. Other evasions of the CG constraints are also possible; perhaps, e.g., the neutrino takes a 'short cut' through extra dimensions or suffers anomalous acceleration in matter. Irrespective of the OPERA result, Lorentz-violating interactions remain possible, and ongoing experimental investigation of such possibilities should continue.

  9. Using Dictionary Pair Learning for Seizure Detection. (United States)

    Ma, Xin; Yu, Nana; Zhou, Weidong


    Automatic seizure detection is extremely important in the monitoring and diagnosis of epilepsy. The paper presents a novel method based on dictionary pair learning (DPL) for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. First, for the EEG data, wavelet filtering and differential filtering are applied, and the kernel function is performed to make the signal linearly separable. In DPL, the synthesis dictionary and analysis dictionary are learned jointly from original training samples with alternating minimization method, and sparse coefficients are obtained by using of linear projection instead of costly [Formula: see text]-norm or [Formula: see text]-norm optimization. At last, the reconstructed residuals associated with seizure and nonseizure sub-dictionary pairs are calculated as the decision values, and the postprocessing is performed for improving the recognition rate and reducing the false detection rate of the system. A total of 530[Formula: see text]h from 20 patients with 81 seizures were used to evaluate the system. Our proposed method has achieved an average segment-based sensitivity of 93.39%, specificity of 98.51%, and event-based sensitivity of 96.36% with false detection rate of 0.236/h.

  10. Generalized quantum interference of correlated photon pairs (United States)

    Kim, Heonoh; Lee, Sang Min; Moon, Han Seb


    Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source. PMID:25951143

  11. The leptoquark hunter's guide: pair production (United States)

    Diaz, Bastian; Schmaltz, Martin; Zhong, Yi-Ming


    Leptoquarks occur in many new physics scenarios and could be the next big discovery at the LHC. The purpose of this paper is to point out that a model-independent search strategy covering all possible leptoquarks is possible and has not yet been fully exploited. To be systematic we organize the possible leptoquark final states according to a leptoquark matrix with entries corresponding to nine experimentally distinguishable leptoquark decays: any of {light-jet, b-jet, top} with any of {neutrino, e/ μ, τ}. The 9 possibilities can be explored in a largely model-independent fashion with pair-production of leptoquarks at the LHC. We review the status of experimental searches for the 9 components of the leptoquark matrix, pointing out which 3 have not been adequately covered. We plead that experimenters publish bounds on leptoquark cross sections as functions of mass for as wide a range of leptoquark masses as possible. Such bounds are essential for reliable recasts to general leptoquark models. To demonstrate the utility of the leptoquark matrix approach we collect and summarize searches with the same final states as leptoquark pair production and use them to derive bounds on a complete set of Minimal Leptoquark models which span all possible flavor and gauge representations for scalar and vector leptoquarks.

  12. Cooperative interactions between paired domain and homeodomain. (United States)

    Jun, S; Desplan, C


    The Pax proteins are a family of transcriptional regulators involved in many developmental processes in all higher eukaryotes. They are characterized by the presence of a paired domain (PD), a bipartite DNA binding domain composed of two helix-turn-helix (HTH) motifs,the PAI and RED domains. The PD is also often associated with a homeodomain (HD) which is itself able to form homo- and hetero-dimers on DNA. Many of these proteins therefore contain three HTH motifs each able to recognize DNA. However, all PDs recognize highly related DNA sequences, and most HDs also recognize almost identical sites. We show here that different Pax proteins use multiple combinations of their HTHs to recognize several types of target sites. For instance, the Drosophila Paired protein can bind, in vitro, exclusively through its PAI domain, or through a dimer of its HD, or through cooperative interaction between PAI domain and HD. However, prd function in vivo requires the synergistic action of both the PAI domain and the HD. Pax proteins with only a PD appear to require both PAI and RED domains, while a Pax-6 isoform and a new Pax protein, Lune, may rely on the RED domain and HD. We propose a model by which Pax proteins recognize different target genes in vivo through various combinations of their DNA binding domains, thus expanding their recognition repertoire.

  13. Optimisation of a quantum pair space thruster

    Directory of Open Access Journals (Sweden)

    Valeriu DRAGAN


    Full Text Available The paper addresses the problem of propulsion for long term space missions. Traditionally a space propulsion unit has a propellant mass which is ejected trough a nozzle to generate thrust; this is also the case with inert gases energized by an on-board power unit. Unconventional methods for propulsion include high energy LASERs that rely on the momentum of photons to generate thrust. Anti-matter has also been proposed for energy storage. Although the momentum of ejected gas is significantly higher, the LASER propulsion offers the perspective of unlimited operational time – provided there is a power source. The paper will propose the use of the quantum pair formation for generating a working mass, this is different than conventional anti-matter thrusters since the material particles generated are used as propellant not as energy storage.Two methods will be compared: LASER and positron-electron, quantum pair formation. The latter will be shown to offer better momentum above certain energy levels.For the demonstrations an analytical solution is obtained and provided in the form of various coefficients. The implications are, for now, theoretical however the practicality of an optimized thruster using such particles is not to be neglected for long term space missions.

  14. Understanding Fomalhaut as a Cooper pair (United States)

    Feng, F.; Jones, H. R. A.


    Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

  15. Leptoquark pair production in hadronic interactions

    International Nuclear Information System (INIS)

    Bluemlein, J.; Boos, E.; Moskovskij Gosudarstvennyj Univ., Moscow; Kryukov, A.; Moskovskij Gosudarstvennyj Univ., Moscow


    The scalar and vector leptoquark pair production cross sections in hadronic collisions are calculated. In a model independent analysis we consider the most general C and P conserving couplings of gluons to both scalar and vector leptoquarks described by an effective low-energy Lagangian which obeys SU(3) c invariance. Analytrical expressions are derived for the differential and integral scattering cross sections including the case of anomalous vector leptoquark couplings, κ G and λ G , to the gluon field. Numerical predictions are given for the kinematic range of the TEVATRON and LHC. The pair production cross sections are also calculated for the resolved photon contributions to ep → e anti ΦΦX at HERA and LEP x LHC, and for the process γγ → Φ anti ΦX at possible future e + e - linear colliders and γγ colliders. Estimates of the search potential for scalar and vector leptoquarks at present and future high energy colliders are given. (orig.)

  16. Synergy between pair coupled cluster doubles and pair density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Garza, Alejandro J.; Bulik, Ireneusz W. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Henderson, Thomas M. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Scuseria, Gustavo E. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Chemistry Department, Faculty of Science, King Abdulaziz University, Jeddah 21589 (Saudi Arabia)


    Pair coupled cluster doubles (pCCD) has been recently studied as a method capable of accounting for static correlation with low polynomial cost. We present three combinations of pCCD with Kohn–Sham functionals of the density and on-top pair density (the probability of finding two electrons on top of each other) to add dynamic correlation to pCCD without double counting. With a negligible increase in computational cost, these pCCD+DFT blends greatly improve upon pCCD in the description of typical problems where static and dynamic correlations are both important. We argue that—as a black-box method with low scaling, size-extensivity, size-consistency, and a simple quasidiagonal two-particle density matrix—pCCD is an excellent match for pair density functionals in this type of fusion of multireference wavefunctions with DFT.

  17. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.


    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  18. Assessment of effect of Yb3+ ion pairs on a highly Yb-doped double-clad fibre laser (United States)

    Vallés, J. A.; Martín, J. C.; Berdejo, V.; Cases, R.; Álvarez, J. M.; Rebolledo, M. Á.


    Using a previously validated characterization method based on the careful measurement of the characteristic parameters and fluorescence emission spectra of a highly Yb-doped double-clad fibre, we evaluate the contribution of ion pair induced processes to the output power of a double-clad Yb-doped fibre ring laser. This contribution is proved to be insignificant, contrary to analysis by other authors, who overestimate the role of ion pairs.

  19. Quantifying inbreeding avoidance through extra-pair reproduction. (United States)

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin


    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  20. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    Energy Technology Data Exchange (ETDEWEB)

    Kadry, Heba, E-mail:; Abdel-Aty, Abdel-Haleem, E-mail:; Zakaria, Nordin, E-mail: [Computer and Information Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Cheong, Lee Yen [Fundamental and Applied Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia)


    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters.

  1. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    International Nuclear Information System (INIS)

    Kadry, Heba; Abdel-Aty, Abdel-Haleem; Zakaria, Nordin; Cheong, Lee Yen


    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters

  2. Inertial collapse of bubble pairs near a solid surface (United States)

    Alahyari Beig, Shahaboddin; Johnsen, Eric


    Cavitation occurs in a variety of applications ranging from naval structures to biomedical ultrasound. One important consequence is structural damage to neighboring surfaces following repeated inertial collapse of vapor bubbles. Although the mechanical loading produced by the collapse of a single bubble has been widely investigated, less is known about the detailed dynamics of the collapse of multiple bubbles. In such a problem, the bubble-bubble interactions typically affect the dynamics, e.g., by increasing the non-sphericity of the bubbles and amplifying/hindering the collapse intensity depending on the flow parameters. Here, we quantify the effects of bubble-bubble interactions on the bubble dynamics, as well as the pressures/temperatures produced by the collapse of a pair of gas bubbles near a rigid surface. We perform high-resolution simulations of this problem by solving the three-dimensional compressible Navier-Stokes equations for gas/liquid flows. The results are used to investigate the non-spherical bubble dynamics and characterize the pressure and temperature fields based on the relevant parameters entering the problem: stand-off distance, geometrical configuration (angle, relative size, distance), collapse strength. This research was supported in part by ONR Grant N00014-12-1-0751 and NSF Grant CBET 1253157.

  3. Enhanced stability of bound pairs at nonzero lattice momenta

    International Nuclear Information System (INIS)

    Kornilovitch, Pavel


    A two-body problem on the square lattice is analyzed. The interaction potential consists of strong on-site repulsion and nearest-neighbor attraction. The exact pairing conditions are derived for s-, p-, and d-symmetric bound states. The pairing conditions are strong functions of the total pair momentum K. It is found that the stability of pairs increases with K. At weak attraction, the pairs do not form at the Γ point but stabilize at lattice momenta close to the Brillouin zone boundary. The phase boundaries in the momentum space, which separate stable and unstable pairs, are calculated. It is found that the pairs are formed easier along the (π,0) direction than along the (π,π) direction. This might lead to the appearance of 'hot pairing spots' on the K x and K y axes

  4. Pair formation models for sexually transmitted infections : A primer

    NARCIS (Netherlands)

    Kretzschmar, MEE; Heijne, Janneke C M

    For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward

  5. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)


    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  6. Nuclear level densities with pairing and self-consistent ground-state shell effects

    CERN Document Server

    Arnould, M


    Nuclear level density calculations are performed using a model of fermions interacting via the pairing force, and a realistic single particle potential. The pairing interaction is treated within the BCS approximation with different pairing strength values. The single particle potentials are derived in the framework of an energy-density formalism which describes self-consistently the ground states of spherical nuclei. These calculations are extended to statistically deformed nuclei, whose estimated level densities include rotational band contributions. The theoretical results are compared with various experimental data. In addition, the level densities for several nuclei far from stability are compared with the predictions of a back-shifted Fermi gas model. Such a comparison emphasizes the possible danger of extrapolating to unknown nuclei classical level density formulae whose parameter values are tailored for known nuclei. (41 refs).

  7. VizieR Online Data Catalog: Dust properties of major-merger galaxy pairs (Domingue+, 2016) (United States)

    Domingue, D. L.; Cao, C.; Xu, C. K.; Jarrett, T. H.; Ronca, J.; Hill, E.; Jacques, A.


    We present an analysis of dust properties of a sample of close major-merger galaxy pairs selected by Ks magnitude and redshift. The pairs represent the two populations of spiral-spiral (S+S) and mixed morphology spiral-elliptical (S+E). The Code Investigating GALaxy Emission (CIGALE) software is used to fit dust models to the Two Micron All Sky Survey, Wide-Field Infrared Survey Explorer, and Herschel flux density measurements, and to derive the parameters describing the polycyclic aromatic hydrocarbons contribution, interstellar radiation field, and photodissociation regions. Model fits verify our previous Spitzer Space Telescope analysis that S+S and S+E pairs do not have the same level of enhancement of star formation and differ in dust composition. (1 data file).

  8. The energy of a moving quark-antiquark pair in an Script N = 4 SYM plasma (United States)

    Chernicoff, Mariano; García, J. Antonio; Güijosa, Alberto


    We make use of the AdS/CFT correspondence to determine the energy of an external quark-antiquark pair that moves through strongly-coupled thermal Script N = 4 super-Yang-Mills plasma, both in the rest frame of the plasma and in the rest frame of the pair. It is found that the pair feels no drag force, has an energy that reproduces the expected 1/L (or γ/L) behavior at small quark-antiquark separations, and becomes unbound beyond a certain screening length whose velocity-dependence we determine. We discuss the relation between the high-velocity limit of our results and the lightlike Wilson loop proposed recently as a definition of the jet-quenching parameter.

  9. Isovector pairing effect on the particle-number projection two-proton separation energy

    Energy Technology Data Exchange (ETDEWEB)

    Mokhtari, Djamila; Kerrouchi, Slimane [Laboratoire de Physique Theorique, Faculte de Physique, Algiers (Algeria); Fellah, Mohamed; Allal, Nassima-Hosni [Laboratoire de Physique Theorique, Faculte de Physique, Algiers (Algeria); Centre de Recherche Nucleaire d' Alger, Comena, Algiers (Algeria)


    The two-proton separation energy is studied by performing a particle-number projection with and without inclusion of the isovector neutron-proton (np) pairing correlations. It is numerically evaluated for even-even rare-earth nuclei such that the np pairing parameter is non-zero. It is shown that the two-proton separation energy values calculated using the two approaches join, for almost all the considered elements, for the highest values of (N-Z). However, the results including the np pairing correlations are closest to the experimental data when available. Moreover, the two methods lead to the same prediction of the two-proton drip-line position, except for the Dysprosium and the Tungsten.

  10. Booster parameter list

    International Nuclear Information System (INIS)

    Parsa, Z.


    The AGS Booster is designed to be an intermediate synchrotron injector for the AGS, capable of accelerating protons from 200 MeV to 1.5 GeV. The parameters listed include beam and operational parameters and lattice parameters, as well as parameters pertaining to the accelerator's magnets, vacuum system, radio frequency acceleration system, and the tunnel. 60 refs., 41 figs

  11. Lumped-parameter models

    Energy Technology Data Exchange (ETDEWEB)

    Ibsen, Lars Bo; Liingaard, M.


    A lumped-parameter model represents the frequency dependent soil-structure interaction of a massless foundation placed on or embedded into an unbounded soil domain. In this technical report the steps of establishing a lumped-parameter model are presented. Following sections are included in this report: Static and dynamic formulation, Simple lumped-parameter models and Advanced lumped-parameter models. (au)

  12. Quasi spin pairing and the structure of the Lipkin model

    International Nuclear Information System (INIS)

    Cambiaggio, M.C.; Plastino, A.


    By introducing the concepts of quasi-spin pairing and quasi-spin seniority, the Lipkin model is extended to a variable number of particles. The properties of quasi-spin pairing are seen to be quite similar to those of ordinary pairing. The quasi-spin seniority allows one to obtain a simple classification of excited multiplets. A 'pairing plus monopole' model is studied in connection with the Hartree-Fock theory. (orig.) [de

  13. Extensions of Bessel sequences to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young


    Tight frames in Hilbert spaces have been studied intensively for the past years. In this paper we demonstrate that it often is an advantage to use pairs of dual frames rather than tight frames. We show that in any separable Hilbert space, any pairs of Bessel sequences can be extended to a pair of...... be extended to a pair of dual frames. © 2012 Elsevier Inc. All rights reserved....

  14. Pair production by a superhard photon in a crystal

    International Nuclear Information System (INIS)

    Kalashnikov, N.P.; Kovalev, G.V.; Strikhanov, M.N.


    Electron-positron pair production by a hard photon moving almost parallelly to the crystallographic axis or monocrystal plane is considered. Calculation is conducted of the production differential by the energies of pair components and total cross section of pair production in the case when primary photon moved at a small angle THETA 0 m 2 /U [ru

  15. Evolution of closely linked gene pairs in vertebrate genomes

    NARCIS (Netherlands)

    Franck, E.; Hulsen, T.; Huynen, M.A.; Jong, de W.W.; Lunsen, N.H.; Madsen, O.


    The orientation of closely linked genes in mammalian genomes is not random: there are more head-to-head (h2h) gene pairs than expected. To understand the origin of this enrichment in h2h gene pairs, we have analyzed the phylogenetic distribution of gene pairs separated by less than 600 bp of

  16. (RN) pair production by photons in a hot Maxwellian plasma

    International Nuclear Information System (INIS)

    Haug, E.


    The production of electron-positron pairs by photons in the Coulomb Field of electrons and positrons (triplet production) in hot thermal plasmas is investigated. The pair production rate for this process is calculated as a function of the photon energy and compared with the rate of photon-nucleus pair production for semi-relativistic and relativistic plasma temperatures. (author)

  17. A Golub-Kahan-type reduction method for matrix pairs

    NARCIS (Netherlands)

    Hochstenbach, M.E.; Reichel, L.; Yu, X.


    We describe a novel method for reducing a pair of large matrices {A;B} to a pair of small matrices {H;K}. The method is an extension of Golub-Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

  18. A Golub-Kahan-type reduction method for matrix pairs

    NARCIS (Netherlands)

    Hochstenbach, M.E.; Reichel, L.; Yu, X.


    We describe a novel method for reducing a pair of large matrices {A,B} to a pair of small matrices {H,K}. The method is an extension of Golub–Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

  19. On extensions of wavelet systems to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young


    It is an open problem whether any pair of Bessel sequences with wavelet structure can be extended to a pair of dual frames by adding a pair of singly generated wavelet systems. We consider the particular case where the given wavelet systems are generated by the multiscale setup with trigonometric...

  20. QSO Pairs across Active Galaxies: Evidence of Blueshifts? D. Basu

    Indian Academy of Sciences (India)


    Dec 4, 2006 ... Abstract. Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spec- tra for both ...

  1. Modeling the secular evolution of migrating planet pairs (United States)

    Michtchenko, T. A.; Rodríguez, A.


    The secular regime of motion of multi-planetary systems is universal; in contrast with the 'accidental' resonant motion, characteristic only for specific configurations of the planets, secular motion is present everywhere in phase space, even inside the resonant region. The secular behavior of a pair of planets evolving under dissipative forces is the principal subject of this study, particularly, the case when the dissipative forces affect the planetary semi-major axes and the planets move inward/outward the central star, the process known as planet migration. Based on the fundamental concepts of conservative and dissipative dynamics of the three-body problem, we develop a qualitative model of the secular evolution of the migrating planetary pair. Our approach is based on analysis of the energy and the orbital angular momentum exchange between the two-planet system and an external medium; thus no specific kind of dissipative forces is invoked. We show that, under assumption that dissipation is weak and slow, the evolutionary routes of the migrating planets are traced by the Mode I and Mode II stationary solutions of the conservative secular problem. The ultimate convergence and the evolution of the system along one of these secular modes of motion is determined uniquely by the condition that the dissipation rate is sufficiently smaller than the proper secular frequency of the system. We show that it is possible to reassemble the starting configurations and migration history of the systems on the basis of their final states and consequently to constrain the parameters of the physical processes involved.

  2. Sharp corners as sources of spiral pairs

    International Nuclear Information System (INIS)

    Biton, Y.; Rabinovitch, A.; Braunstein, D.; Friedman, M.; Aviram, I.


    It is demonstrated that using the FitzHugh-Nagumo model, stimulation of excitable media inside a region possessing sharp corners, can lead to the appearance of sources of spiral-pairs of sustained activity. The two conditions for such source creation are: The corners should be less than 120 deg. and the range of stimulating amplitudes should be small, occurring just above the threshold value and decreasing with the corner angle. The basic mechanisms driving the phenomenon are discussed. These include: A. If the corner angle is below 120 deg., the wave generated inside cannot emerge at the corner tip, resulting in the creation of two free edges which start spiraling towards each other. B. Spiraling must be strong enough; otherwise annihilation of the rotating arms would occur too soon to create a viable source. C. The intricacies of the different radii involved are elucidated. Possible applications in heart stimulation and in chemical reactions are considered.

  3. Neutron area monitor with TLD pairs

    International Nuclear Information System (INIS)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R.


    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene cylinder, as moderator. When neutrons collide with the moderator lose their energy reaching the TLD with thermal energies where the ambient dose equivalent is calculated. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLDs in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields. (Author)

  4. Radiative corrections for the leptonic pair production

    Energy Technology Data Exchange (ETDEWEB)

    Elend, H H


    The one-photon bremsstrahlung correction for symmetrical lepton pair production is newly calculated. For this, from all the Feynman diagrams, the subset is picked out for this process which essentially contributes to the symmetrical case. The matrix element square value for the chosen sub-set is expressed by the Bethe-Heitler matrix element square value provided with certain kinematic factors (Huld relationship), where a) a development after the energy of the Bremsquantum, assumed to be small, is carried out and the series is cut off after the second term beyond the infrared section, b) a high-energy approximation is made. Furthermore, c) the structure of the target nucleus and of the recoil transfered to it is neglected, d) the integration on the phase space of the bremsquantitum is carried out with a peaking approximation. All these approximations are individually discussed, and the validity limits which they set for the bremsstrahlung in the result are accurately given.

  5. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J


    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  6. Na Cl ion pair association in water-DMSO mixtures: Effect of ion pair ...

    Indian Academy of Sciences (India)

    The 12-6-1 potential model predicts running coordination numbers closest to experimental data. Keywords. ... value of interaction energy minimum between the Na. + and Cl. − ..... ion pair mostly remains as a CIP, a fair amount of SAIP is also ...

  7. Asteroid clusters similar to asteroid pairs (United States)

    Pravec, P.; Fatka, P.; Vokrouhlický, D.; Scheeres, D. J.; Kušnirák, P.; Hornoch, K.; Galád, A.; Vraštil, J.; Pray, D. P.; Krugly, Yu. N.; Gaftonyuk, N. M.; Inasaridze, R. Ya.; Ayvazian, V. R.; Kvaratskhelia, O. I.; Zhuzhunadze, V. T.; Husárik, M.; Cooney, W. R.; Gross, J.; Terrell, D.; Világi, J.; Kornoš, L.; Gajdoš, Š.; Burkhonov, O.; Ehgamberdiev, Sh. A.; Donchev, Z.; Borisov, G.; Bonev, T.; Rumyantsev, V. V.; Molotov, I. E.


    We studied the membership, size ratio and rotational properties of 13 asteroid clusters consisting of between 3 and 19 known members that are on similar heliocentric orbits. By backward integrations of their orbits, we confirmed their cluster membership and estimated times elapsed since separation of the secondaries (the smaller cluster members) from the primary (i.e., cluster age) that are between 105 and a few 106 years. We ran photometric observations for all the cluster primaries and a sample of secondaries and we derived their accurate absolute magnitudes and rotation periods. We found that 11 of the 13 clusters follow the same trend of primary rotation period vs mass ratio as asteroid pairs that was revealed by Pravec et al. (2010). We generalized the model of the post-fission system for asteroid pairs by Pravec et al. (2010) to a system of N components formed by rotational fission and we found excellent agreement between the data for the 11 asteroid clusters and the prediction from the theory of their formation by rotational fission. The two exceptions are the high-mass ratio (q > 0.7) clusters of (18777) Hobson and (22280) Mandragora for which a different formation mechanism is needed. Two candidate mechanisms for formation of more than one secondary by rotational fission were published: the secondary fission process proposed by Jacobson and Scheeres (2011) and a cratering collision event onto a nearly critically rotating primary proposed by Vokrouhlický et al. (2017). It will have to be revealed from future studies which of the clusters were formed by one or the other process. To that point, we found certain further interesting properties and features of the asteroid clusters that place constraints on the theories of their formation, among them the most intriguing being the possibility of a cascade disruption for some of the clusters.


    Directory of Open Access Journals (Sweden)

    Editorial Foreword


    Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain

  9. Exotic superfluidity and pairing phenomena in atomic Fermi gases in mixed dimensions. (United States)

    Zhang, Leifeng; Che, Yanming; Wang, Jibiao; Chen, Qijin


    Atomic Fermi gases have been an ideal platform for simulating conventional and engineering exotic physical systems owing to their multiple tunable control parameters. Here we investigate the effects of mixed dimensionality on the superfluid and pairing phenomena of a two-component ultracold atomic Fermi gas with a short-range pairing interaction, while one component is confined on a one-dimensional (1D) optical lattice whereas the other is in a homogeneous 3D continuum. We study the phase diagram and the pseudogap phenomena throughout the entire BCS-BEC crossover, using a pairing fluctuation theory. We find that the effective dimensionality of the non-interacting lattice component can evolve from quasi-3D to quasi-1D, leading to strong Fermi surface mismatch. Upon pairing, the system becomes effectively quasi-two dimensional in the BEC regime. The behavior of T c bears similarity to that of a regular 3D population imbalanced Fermi gas, but with a more drastic departure from the regular 3D balanced case, featuring both intermediate temperature superfluidity and possible pair density wave ground state. Unlike a simple 1D optical lattice case, T c in the mixed dimensions has a constant BEC asymptote.

  10. Sexually dimorphic activation of dopaminergic areas depends on affiliation during courtship and pair formation

    Directory of Open Access Journals (Sweden)

    Mai eIwasaki


    Full Text Available For many species, dyadic interaction during courtship and pair bonding engage intense emotional states that control approach or avoidance behavior. Previous studies have shown that one component of a common social brain network (SBN, dopaminergic areas, are highly engaged during male songbird courtship of females. We tested whether the level of activity in dopaminergic systems of both females and males during courtship is related to their level of affiliation. In order to objectively quantify affiliative behaviors, we developed a system for tracking the position of both birds during free interaction sessions. During a third successive daily interaction session, there was a range of levels of affiliation among bird pairs, as quantified by several position and movement parameters. Because both positive and negative social interactions were present, we chose to characterize affiliation strength by pair valence. As a potential neural system involved in regulating pair valence, the level of activity of the dopaminergic group A11 (within the central gray was selectively reduced in females of positive valence pairs. Further, activation of non-dopaminergic neurons in VTA was negatively related to valence, with this relationship strongest in ventral VTA of females. Together, these results suggest that inhibition of fear or avoidance networks may be associated with development of close affiliation, and highlight the importance of negative as well as positive emotional states in the process of courtship, and in development of long-lasting social bonds.

  11. A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library. (United States)

    Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S


    Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

  12. Demographic mechanisms of inbreeding adjustment through extra-pair reproduction. (United States)

    Reid, Jane M; Duthie, A Bradley; Wolak, Matthew E; Arcese, Peter


    One hypothesis explaining extra-pair reproduction is that socially monogamous females mate with extra-pair males to adjust the coefficient of inbreeding (f) of extra-pair offspring (EPO) relative to that of within-pair offspring (WPO) they would produce with their socially paired male. Such adjustment of offspring f requires non-random extra-pair reproduction with respect to relatedness, which is in turn often assumed to require some mechanism of explicit pre-copulatory or post-copulatory kin discrimination. We propose three demographic processes that could potentially cause mean f to differ between individual females' EPO and WPO given random extra-pair reproduction with available males without necessarily requiring explicit kin discrimination. Specifically, such a difference could arise if social pairings formed non-randomly with respect to relatedness or persisted non-randomly with respect to relatedness, or if the distribution of relatedness between females and their sets of potential mates changed during the period through which social pairings persisted. We used comprehensive pedigree and pairing data from free-living song sparrows (Melospiza melodia) to quantify these three processes and hence investigate how individual females could adjust mean offspring f through instantaneously random extra-pair reproduction. Female song sparrows tended to form social pairings with unrelated or distantly related males slightly less frequently than expected given random pairing within the defined set of available males. Furthermore, social pairings between more closely related mates tended to be more likely to persist across years than social pairings between less closely related mates. However, these effects were small and the mean relatedness between females and their sets of potential extra-pair males did not change substantially across the years through which social pairings persisted. Our framework and analyses illustrate how demographic and social structuring within

  13. Half-integer flux quantum effect in cuprate superconductors - a probe of pairing symmetry

    International Nuclear Information System (INIS)

    Tsuei, C.C.; Kirtley, J.R.; Gupta, A.; Sun, J.Z.; Moler, K.A.; Wang, J.H.


    Based on macroscopic quantum coherence effects arising from pair tunneling and flux quantization, a series of tricrystal experiments have been designed and carried out to test the order parameter symmetry in high-T c cuprate superconductors. By using a scanning SQUID microscope, we have directly and non-invasively observed the spontaneously generated half-integer flux quantum effect in controlled-orientation tricrystal cuprate superconducting systems. The presence or absence of the half-integer flux quantum effect as a function of the tricrystal geometry allows us to prove that the order parameter symmetry in the YBCO and Tl2201 systems is consistent with that of the d x 2 -y 2 pair state. (orig.)

  14. Electromagnetic heavy-lepton pair production in relativistic heavy-ion collisions

    Energy Technology Data Exchange (ETDEWEB)

    Senguel, M.Y. [Atakent Mahallesi, 3. Etap, Halkali-Kuecuekcekmece, Istanbul (Turkey); Gueclue, M.C.; Mercan, Oe.; Karakus, N.G. [istanbul Technical University, Faculty of Science and Letters, Istanbul (Turkey)


    We calculate the cross sections of electromagnetic productions of muon- and tauon-pair productions from the ultra-relativistic heavy ion collisions. Since the Compton wavelengths of muon and tauon are comparable to the radius of the colliding ions, nuclear form factors play important roles for calculating the cross sections. Recent measurement (Abrahamyan et al., Phys Rev Lett 108:112502, 2012) indicates that the neutrons are differently distributed from the protons; therefore this affects the cross section of the heavy-lepton pair production. In order to see the effects of the neutron distributions in the nucleus, we used analytical expression of the Fourier transforms of the Wood-Saxon distribution. Cross section calculations show that the Wood-Saxon distribution function is more sensitive to the parameter R compared to the parameter a. (orig.)

  15. Cross section measurement of the bottom-quark-pair associated top-quark-pair production in the semi-leptonic channel with the CMS experiment

    Energy Technology Data Exchange (ETDEWEB)

    Heidemann, Fabian; Erdmann, Martin; Fischer, Robert [III. Physikalisches Institut A, RWTH Aachen University (Germany)


    We present a cross section measurement of the top-quark-pair-production with two bottom quarks which is the dominant background process to top-quark-pair associated Higgs Boson production. The semi-leptonic channel of top-quark decays is used due to its combination of a relatively large branching ratio and small QCD contamination. The analysis method relies on Standard Model Monte Carlo simulations of all relevant physics processes. Template distributions are created with Boosted Decision Tree classifiers on the simulated data. Subsequently, the composition of these templates is fitted to the data distribution to obtain the signal strength relative to the Standard Model prediction. A Bayesian interference method is used to perform the fit, in which systematic uncertainties are incorporated as nuisance parameters.

  16. Two-site Hubbard molecule with a spinless electron-positron pair

    KAUST Repository

    Cossu, Fabrizio


    We determine the eigenvalues of the two-site Hubbard molecule with one electron and one positron to describe the characteristics of electron-positron interactions in solids. While the effect of hopping is, in general, opposite to the effect of on-site interaction, we find a complex scenario for the electron-positron pair with a non-vanishing potential drop. We give analytical solutions and discuss the combined effects of the model parameters.

  17. Two-site Hubbard molecule with a spinless electron-positron pair

    KAUST Repository

    Cossu, Fabrizio; Schuster, Cosima; Schwingenschlö gl, Udo


    We determine the eigenvalues of the two-site Hubbard molecule with one electron and one positron to describe the characteristics of electron-positron interactions in solids. While the effect of hopping is, in general, opposite to the effect of on-site interaction, we find a complex scenario for the electron-positron pair with a non-vanishing potential drop. We give analytical solutions and discuss the combined effects of the model parameters.

  18. Disorder parameter of confinement

    International Nuclear Information System (INIS)

    Nakamura, N.; Ejiri, S.; Matsubara, Y.; Suzuki, T.


    The disorder parameter of confinement-deconfinement phase transition based on the monopole action determined previously in SU(2) QCD are investigated. We construct an operator which corresponds to the order parameter defined in the abelian Higgs model. The operator shows proper behaviors as the disorder parameter in the numerical simulations of finite temperature QCD. (orig.)

  19. Investigation of tau pair production at PETRA

    International Nuclear Information System (INIS)

    Kuester, H.


    The reaction e + e - -> tau + tau - has been measured at center of mass energies around 34 GeV. The selection is sensitive to 93% of the tau pair decays, thus making possible a high identification efficiency of proportional 70% over a large solid angle. The total cross section has been measured to Rsub(tau) = sigmasub(tautau)/sigmasub(point) = .94 +- .06(stat.) +- .06(syst.). In the differential cross section a charge asymmetry of Asub(tau) = (-(9.0 +- 6.6)% was observed, corresponding to a tau axial vector coupling to the weak neutral current of asub(tau) = -.94 +- 0.69. Moreover, final states from the decays tau -> πν, tau -> eνν, and tau -> μνν have been isolated and branching ratios into these channels have been determined. From the inclusive momentum spectra of the observed decay products (including the channel tau -> rhoν) the forward backward asymmetry of tau polarization has been determined to Asub(p,tau) = -(1 +- 22)% which corresponds to vsub(tau) = -.1 +- 2.9. Tests on factorization are discussed. (orig.) [de

  20. Perpendicular relativistic shocks in magnetized pair plasma (United States)

    Plotnikov, Illya; Grassi, Anna; Grech, Mickael


    Perpendicular relativistic (γ0 = 10) shocks in magnetized pair plasmas are investigated using two dimensional Particle-in-Cell simulations. A systematic survey, from unmagnetized to strongly magnetized shocks, is presented accurately capturing the transition from Weibel-mediated to magnetic-reflection-shaped shocks. This transition is found to occur for upstream flow magnetizations 10-3 10-2, it leaves place to a purely electromagnetic precursor following from the strong emission of electromagnetic waves at the shock front. Particle acceleration is found to be efficient in weakly magnetized perpendicular shocks in agreement with previous works, and is fully suppressed for σ > 10-2. Diffusive Shock Acceleration is observed only in weakly magnetized shocks, while a dominant contribution of Shock Drift Acceleration is evidenced at intermediate magnetizations. The spatial diffusion coefficients are extracted from the simulations allowing for a deeper insight into the self-consistent particle kinematics and scale with the square of the particle energy in weakly magnetized shocks. These results have implications for particle acceleration in the internal shocks of AGN jets and in the termination shocks of Pulsar Wind Nebulae.

  1. Development of pair distribution function analysis

    International Nuclear Information System (INIS)

    Vondreele, R.; Billinge, S.; Kwei, G.; Lawson, A.


    This is the final report of a 3-year LDRD project at LANL. It has become more and more evident that structural coherence in the CuO 2 planes of high-T c superconducting materials over some intermediate length scale (nm range) is important to superconductivity. In recent years, the pair distribution function (PDF) analysis of powder diffraction data has been developed for extracting structural information on these length scales. This project sought to expand and develop this technique, use it to analyze neutron powder diffraction data, and apply it to problems. In particular, interest is in the area of high-T c superconductors, although we planned to extend the study to the closely related perovskite ferroelectric materials andother materials where the local structure affects the properties where detailed knowledge of the local and intermediate range structure is important. In addition, we planned to carry out single crystal experiments to look for diffuse scattering. This information augments the information from the PDF

  2. cgHeliParm : analysis of dsDNA helical parameters for coarse-grained MARTINI molecular dynamics simulations

    NARCIS (Netherlands)

    Faustino, Ignacio; Marrink, S. J.


    Summary: We introduce cgHeliParm, a python program that provides the conformational analysis of Martini-based coarse-grained double strand DNA molecules. The software calculates the helical parameters such as base, base pair and base pair step parameters. cgHeliParm can be used for the analysis of

  3. Efficient Implementation of the Pairing on Mobilephones Using BREW (United States)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  4. Observing Pair-Work Task in an English Speaking Class

    Directory of Open Access Journals (Sweden)

    Diana Achmad


    Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

  5. Topological Nodal Cooper Pairing in Doped Weyl Metals (United States)

    Li, Yi; Haldane, F. D. M.


    We generalize the concept of Berry connection of the single-electron band structure to that of a two-particle Cooper pairing state between two Fermi surfaces with opposite Chern numbers. Because of underlying Fermi surface topology, the pairing Berry phase acquires nontrivial monopole structure. Consequently, pairing gap functions have topologically protected nodal structure as vortices in the momentum space with the total vorticity solely determined by the pair monopole charge qp. The nodes of gap function behave as the Weyl-Majorana points of the Bogoliubov-de Gennes pairing Hamiltonian. Their relation with the connection patterns of the surface modes from the Weyl band structure and the Majorana surface modes inside the pairing gap is also discussed. Under the approximation of spherical Fermi surfaces, the pairing symmetry are represented by monopole harmonic functions. The lowest possible pairing channel carries angular momentum number j =|qp|, and the corresponding gap functions are holomorphic or antiholomorphic functions on Fermi surfaces. After projected on the Fermi surfaces with nontrivial topology, all the partial-wave channels of pairing interactions acquire the monopole charge qp independent of concrete pairing mechanism.

  6. Pulsar Pair Cascades in Magnetic Fields with Offset Polar Caps (United States)

    Harding, Alice K.; Muslimov, Alex G.


    Neutron star magnetic fields may have polar caps (PC) that are offset from the dipole axis, through field-line sweepback near the light cylinder or non-symmetric currents within the star. The effects of such offsets on electron-positron pair cascades are investigated, using simple models of dipole magnetic fields with small distortions that shift the PCs by different amounts or directions. Using a Monte Carlo pair cascade simulation, we explore the changes in the pair spectrum, multiplicity and energy flux across the PC, as well as the trends in pair flux and pair energy flux with spin-down luminosity, L(sub sd). We also give an estimate of the distribution of heating flux from returning positrons on the PC for different offsets. We find that even modest offsets can produce significant increases in pair multiplicity, especially for pulsars that are near or beyond the pair death lines for centered PCs, primarily because of higher accelerating fields. Pair spectra cover several decades in energy, with the spectral range of millisecond pulsars (MSPs) two orders of magnitude higher than for normal pulsars, and PC offsets allow significant extension of all spectra to lower pair energies. We find that the total PC pair luminosity L(sub pair) is proportional to L(sub sd), with L(sub pair) approximates 10(exp -3) L(sub sd) for normal pulsars and L(sub pair) approximates 10(exp -2) L(sub sd) for MSPs. Remarkably, the total PC heating luminosity for even large offsets increases by less than a factor of two, even though the PC area increases by much larger factors, because most of the heating occurs near the magnetic axis.

  7. Paired quantum Hall states on noncommutative two-tori

    Energy Technology Data Exchange (ETDEWEB)

    Marotta, Vincenzo [Dipartimento di Scienze Fisiche, Universita di Napoli ' Federico II' and INFN, Sezione di Napoli, Compl. universitario M. Sant' Angelo, Via Cinthia, 80126 Napoli (Italy); Naddeo, Adele, E-mail: naddeo@sa.infn.i [CNISM, Unita di Ricerca di Salerno and Dipartimento di Fisica ' E. R. Caianiello' , Universita degli Studi di Salerno, Via Salvador Allende, 84081 Baronissi (Italy)


    By exploiting the notion of Morita equivalence for field theories on noncommutative tori and choosing rational values of the noncommutativity parameter theta (in appropriate units), a one-to-one correspondence between an Abelian noncommutative field theory (NCFT) and a non-Abelian theory of twisted fields on ordinary space can be established. Starting from this general result, we focus on the conformal field theory (CFT) describing a quantum Hall fluid (QHF) at paired states fillings nu=m/(pm+2) Cristofano et al. (2000) , recently obtained by means of m-reduction procedure, and show that it is the Morita equivalent of a NCFT. In this way we extend the construction proposed in Marotta and Naddeo (2008) for the Jain series nu=m/(2pm+1) . The case m=2 is explicitly discussed and the role of noncommutativity in the physics of quantum Hall bilayers is emphasized. Our results represent a step forward the construction of a new effective low energy description of certain condensed matter phenomena and help to clarify the relationship between noncommutativity and quantum Hall fluids.

  8. Unconventional superconductivity in iron pnictides: Magnon mediated pairing (United States)

    kar, Raskesh; Paul, Bikash Chandra; Misra, Anirban


    We study the phenomenon of unconventional superconductivity in iron pnictides on the basis of localized-itinerant model. In this proposed model, superconductivity arises from the itinerant part of electrons, whereas antiferromagnetism arises from the localized part. The itinerant electrons move over the sea of localized electrons in antiferromagnetic alignment and interact with them resulting in excitation of magnons. We find that triplet pairing of itinerant electrons via magnons is possible in checkerboard antiferromagnetic spin configuration of the substances CaFe2As2 and BaFe2As2 in pure form for umklapp scattering with scattering wave vector Q =(1 , 1) , in the unit of π/a where a being one orthorhombic crystal parameter, which is the nesting vector between two Fermi surfaces. The interaction potential figured out in this way, increases with the decrease in nearest neighbour (NN) exchange couplings. Under ambient pressure, with stripe antiferromagnetic spin configuration, a very small value of coupling constant is obtained which does not give rise to superconductivity. The critical temperature of superconductivity of the substances CaFe2As2 and BaFe2As2 in higher pressure checkerboard antiferromagnetic spin configuration are found to be 12.12 K and 29.95 K respectively which are in agreement with the experimental results.

  9. General mirror pairs for gauged linear sigma models

    Energy Technology Data Exchange (ETDEWEB)

    Aspinwall, Paul S.; Plesser, M. Ronen [Departments of Mathematics and Physics, Duke University,Box 90320, Durham, NC 27708-0320 (United States)


    We carefully analyze the conditions for an abelian gauged linear σ-model to exhibit nontrivial IR behavior described by a nonsingular superconformal field theory determining a superstring vacuum. This is done without reference to a geometric phase, by associating singular behavior to a noncompact space of (semi-)classical vacua. We find that models determined by reflexive combinatorial data are nonsingular for generic values of their parameters. This condition has the pleasant feature that the mirror of a nonsingular gauged linear σ-model is another such model, but it is clearly too strong and we provide an example of a non-reflexive mirror pair. We discuss a weaker condition inspired by considering extremal transitions, which is also mirror symmetric and which we conjecture to be sufficient. We apply these ideas to extremal transitions and to understanding the way in which both Berglund-Hübsch mirror symmetry and the Vafa-Witten mirror orbifold with discrete torsion can be seen as special cases of the general combinatorial duality of gauged linear σ-models. In the former case we encounter an example showing that our weaker condition is still not necessary.

  10. General mirror pairs for gauged linear sigma models

    International Nuclear Information System (INIS)

    Aspinwall, Paul S.; Plesser, M. Ronen


    We carefully analyze the conditions for an abelian gauged linear σ-model to exhibit nontrivial IR behavior described by a nonsingular superconformal field theory determining a superstring vacuum. This is done without reference to a geometric phase, by associating singular behavior to a noncompact space of (semi-)classical vacua. We find that models determined by reflexive combinatorial data are nonsingular for generic values of their parameters. This condition has the pleasant feature that the mirror of a nonsingular gauged linear σ-model is another such model, but it is clearly too strong and we provide an example of a non-reflexive mirror pair. We discuss a weaker condition inspired by considering extremal transitions, which is also mirror symmetric and which we conjecture to be sufficient. We apply these ideas to extremal transitions and to understanding the way in which both Berglund-Hübsch mirror symmetry and the Vafa-Witten mirror orbifold with discrete torsion can be seen as special cases of the general combinatorial duality of gauged linear σ-models. In the former case we encounter an example showing that our weaker condition is still not necessary.

  11. Improved contraction schemes for projected entangled pair states

    Energy Technology Data Exchange (ETDEWEB)

    Lubasch, Michael; Cirac, Juan Ignacio; Banuls, Mari-Carmen [Max Planck Institute of Quantum Optics, Hans-Kopfermann-Strasse 1, 85748 Garching (Germany)


    Projected Entangled Pair States (PEPS) represent the natural generalization of Matrix Product States (MPS) in higher dimensions. The strength of MPS in the numerical simulation of 1D quantum many-body systems is well established, as they are the variational class of states underlying the Density Matrix Renormalization Group and the latter is nowadays considered numerically exact for systems comprising hundreds of quantum particles. In algorithms based on MPS or PEPS, the bond dimension D of the state determines the number of variational parameters and the computational cost. While bond dimensions on the order of hundreds and thousands are feasible with MPS, standard 2D PEPS algorithms are limited to values in the range 2 to 6 due to the much worse scaling of the computational cost with D. Recently, a new algorithm based on an alternative contraction has been proposed that reduces this cost significantly. It resorts to the single-layer picture where the contraction is done in ket and bra separately. We investigate the advantages and disadvantages of this algorithm which can be understood in terms of the PEPS's boundary approximation.

  12. A geometric measure of dark energy with pairs of galaxies. (United States)

    Marinoni, Christian; Buzzi, Adeline


    Observations indicate that the expansion of the Universe is accelerating, which is attributed to a ‘dark energy’ component that opposes gravity. There is a purely geometric test of the expansion of the Universe (the Alcock–Paczynski test), which would provide an independent way of investigating the abundance (Ω(X)) and equation of state (W(X)) of dark energy. It is based on an analysis of the geometrical distortions expected from comparing the real-space and redshift-space shape of distant cosmic structures, but it has proved difficult to implement. Here we report an analysis of the symmetry properties of distant pairs of galaxies from archival data. This allows us to determine that the Universe is flat. By alternately fixing its spatial geometry at Ω(k)≡0 and the dark energy equation-of-state parameter at W(X)≡-1, and using the results of baryon acoustic oscillations, we can establish at the 68.3% confidence level that and -0.85>W(X)>-1.12 and 0.60<Ω(X)<0.80.

  13. Two-temperature accretion disks in pair equilibrium

    International Nuclear Information System (INIS)

    Kusunose, Masaaki; Takahara, Fumio.


    We investigate two-temperature accretion disks with electron-positron pair production, taking account of the bremsstrahlung and Comptonization of soft photons produced by the cyclotron higher harmonics. The properties of the disks are qualitatively the same as those of disks in which bremsstrahlung is the only photon source. For an accretion rate higher than a critical value, M cr , no steady solutions exist for a certain range of radial distance from a central black hole. The critical value increases only slightly with the input of soft photons; the increment is 45%, i.e., M cr ∼ 0.43 M Edd , for the viscosity parameter α = 0.1, where M Edd ≡ L Edd /c 2 = 4πGM BH m p /(σ T c) with M BH being the mass of the central black hole. Furthermore, the disks are unstable against perturbations of the proton temperature. For α ∼ 0.1, the equipartition magnetic field, and a range of accretion rates, emission spectra obey the power law with a spectral index of -0.7 to -0.6, which coincides with the observed universal X-ray spectra of Seyfert galaxies. Brief comments on the model of the γ-ray flare of Cyg X-1 are also given. (author)

  14. New calculations and measurements of the Coulomb cross-section for the production of direct electron pairs by high energy nuclei (United States)

    Derrickson, J. H.; Dake, S.; Dong, B. L.; Eby, P. B.; Fountain, W. F.; Fuki, M.; Gregory, J. C.; Hayashi, T.; Iyono, A.; King, D. T.


    Recently, new calculations were made of the direct Coulomb pair cross section that rely less in arbitrary parameters. More accurate calculations of the cross section down to low pair energies were made. New measurements of the total direct electron pair yield, and the energy and angular distribution of the electron pairs in emulsion were made for O-16 at 60 and 200 GeV/amu at S-32 at 200 GeV/amu which give satisfactory agreement with the new calculations. These calculations and measurements are presented along with previous accelerator measurements made of this effect during the last 40 years. The microscope scanning criteria used to identify the direct electron pairs is described. Prospects for application of the pair method to cosmic ray energy measurements in the region 10 (exp 13) to 10 (exp 15) eV/amu are discussed.

  15. Full one-loop QCD and electroweak corrections to sfermion pair production in γγ collisions

    International Nuclear Information System (INIS)

    Xing Lirong; Zhang Renyou; Jiang Yi; Han Liang; Li Gang; Ma Wengan


    We have calculated the full one-loop electroweak (EW) and QCD corrections to the third generation scalar-fermion pair production processes e + e - →γγ→f i -tildef i -tilde(f=t,b,τ) at an electron-positron linear collider(LC) in the minimal supersymmetric standard model (MSSM). We analyze the dependence of the radiative corrections on the parameters such as the colliding energy √(s-circumflex) and the SUSY fundamental parameters A f , tanβ, μ, M SUSY and so forth. The numerical results show that the EW corrections to the squark-, stau-pair production processes and QCD corrections to the squark-pair production processes give substantial contributions in some parameter space. The EW relative corrections to squark-pair production processes can be comparable with QCD corrections at high energies. Therefore, these EW and QCD corrections cannot be neglected in precise measurement of sfermion pair productions via γγ collision at future linear colliders


    Directory of Open Access Journals (Sweden)

    Editorial, Foreword


    Full Text Available September 18th, 2016Deggendorf, Germany by: Artificial Intelligence Center Department of Computer Science Faculty of Electrical Engineering Czech Technical University in PragueTechnicka 2, Prague 6, 166 27, Czech RepublicGuest editors:Jan Faigl (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueJiří Vokřínek (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueScientific comittee:D. Belter (Poznań University of Technology, PolandW. Dorner (Technische Hochschule Deggendorf, GermanyJ. Faigl (Czech Technical University in PragueT. Krajník (University of Lincoln, United KingdomA. Komenda (Czech Technical University in PragueG. Kupris (Technische Hochschule Deggendorf, GermanyM. Rollo (Czech Technical University in PragueM. Saska (Czech Technical University in PragueJ. Vokřínek (Czech Technical University in PragueV. Vonásek (Czech Technical University in PragueK. Walas (Poznań University of Technology, Poland Foreword:The third year of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR continues in joining young researchers and students interested in robotics and artificial intelligence. In 2016, we follow the schema of the last year as a joint event with the RoboTour competition in Deggendorf, Germany. Thanks to the great collaboration with Gerald Kupris and Wolfgang Donner from Technische Hochschule Deggendorf and support from Czech Technical University under project No. SVK 26/16/F3 and Bayerisches Staatsministerium der Finanzen, für Landesentwicklung und Heimat, we have been able to provide accommodations and travel support to participants and an invited speaker. Fourteen papers have accepted and listed in the conference program. The papers have been authored by students from Central Europe

  17. Hidden Pair of Supermassive Black Holes (United States)

    Kohler, Susanna


    Could a pair of supermassive black holes (SMBHs) be lurking at the center of the galaxy Mrk 231? A recent study finds that this may be the case and the unique spectrum of this galaxy could be the key to discovering more hidden binary SMBH systems.Where Are the Binary Supermassive Black Holes?Its believed that most, if not all, galaxies have an SMBH at their centers. As two galaxies merge, the two SMBHs should evolve into a closely-bound binary system before they eventually merge. Given the abundance of galaxy mergers, we would expect to see the kinematic and visual signatures of these binary SMBHs among observed active galactic nuclei yet such evidence for sub-parsec binary SMBH systems remains scarce and ambiguous. This has led researchers to wonder: is there another way that we might detect these elusive systems?A collaboration led by Chang-Shuo Yan (National Astronomical Observatories, Chinese Academy of Sciences) thinks that there is. The group suggests that these systems might have distinct signatures in their optical-to-UV spectra, and they identify a system that might be just such a candidate: Mrk 231.A Binary CandidateProposed model of Mrk 231. Two supermassive black holes, each with their own mini-disk, orbit each other in the center of a circumbinary disk. The secondary black hole has cleared gap in the circumbinary disk as a result of its orbit around the primary black hole. [Yan et al. 2015]Mrk 231 is a galaxy with a disturbed morphology and tidal tails strong clues that it might be in the final stages of a galactic merger. In addition to these signs, Mrk 231 also has an unusual spectrum for a quasar: its continuum emission displays an unexpected drop in the near-UV band.Yan and her collaborators propose that the odd behavior of Mrk 231s spectrum can be explained if the center of the galaxy houses a pair of SMBHs each with its own mini accretion disk surrounded by a circumbinary accretion disk. As the secondary SMBH orbits the primary SMBH (with a

  18. Stereo Pair, Salt Lake City, Utah (United States)


    The 2002 Winter Olympics are hosted by Salt Lake City at several venues within the city, in nearby cities, and within the adjacent Wasatch Mountains. This image pair provides a stereoscopic map view of north central Utah that includes all of these Olympic sites. In the south, next to Utah Lake, Provo hosts the ice hockey competition. In the north, northeast of the Great Salt Lake, Ogden hosts curling and the nearby Snowbasin ski area hosts the downhill events. In between, southeast of the Great Salt Lake, Salt Lake City hosts the Olympic Village and the various skating events. Further east, across the Wasatch Mountains, the Park City ski resort hosts the bobsled, ski jumping, and snowboarding events. The Winter Olympics are always hosted in mountainous terrain. This view shows the dramatic landscape that makes the Salt Lake City region a world-class center for winter sports.This stereoscopic image was generated by draping a Landsat satellite image over a Shuttle Radar Topography Mission digital elevation model. Two differing perspectives were then calculated, one for each eye. They can be seen in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing or by downloading and printing the image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of Earth's surface in its full three dimensions.Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter (98-foot) resolution of most Landsat images and will substantially help in analyzing the large and growing Landsat image archive, managed by the U.S. Geological Survey (USGS).Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on Feb. 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR

  19. Paired Straight Hearth Furnace - Transformational Ironmaking Process

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Wei-Kao [McMaster Univ., Hamilton, ON (Canada); Debski, Paul [Andritz Metals Inc.,Canonsburg, PA (United States)


    The U. S. steel industry has reduced its energy intensity per ton of steel shipped by 33% since 1990. However, further significant gains in energy efficiency will require the development of new, transformational iron and steelmaking processes. The Paired Straight Hearth Furnace (PSH) process is an emerging alternative high productivity, direct reduced iron (DRI) technology that may achieve very low fuel rates and has the potential to replace blast furnace ironmaking. The PSH furnace can operate independently or may be coupled with other melting technologies to produce liquid hot metal that is both similar to blast furnace iron and suitable as a feedstock for basic oxygen steelmaking furnaces. The PSH process uses non-metallurgical coal as a reductant to convert iron oxides such as iron ore and steelmaking by-product oxides to DRI pellets. In this process, a multi-layer, nominally 120mm tall bed of composite “green balls” made from oxide, coal and binder is built up and contained within a moving refractory hearth. The pellet bed absorbs radiant heat energy during exposure to the high temperature interior refractory surfaces of the PSH while generating a strongly reducing gas atmosphere in the bed that yields a highly metalized DRI product. The PSH concept has been well tested in static hearth experiments. A moving bed design is being developed. The process developers believe that if successful, the PSH process has the potential to replace blast furnaces and coke ovens at a fraction of the operating and capital cost while using about 30% less energy relative to current blast furnace technology. DRI output could also feed electric arc furnaces (EAFs) by displacing a portion of the scrap charge.

  20. Affected sib pair tests in inbred populations. (United States)

    Liu, W; Weir, B S


    The affected-sib-pair (ASP) method for detecting linkage between a disease locus and marker loci was first established 50 years ago, and since then numerous modifications have been made. We modify two identity-by-state (IBS) test statistics of Lange (Lange, 1986a, 1986b) to allow for inbreeding in the population. We evaluate the power and false positive rates of the modified tests under three disease models, using simulated data. Before estimating false positive rates, we demonstrate that IBS tests are tests of both linkage and linkage disequilibrium between marker and disease loci. Therefore, the null hypothesis of IBS tests should be no linkage and no LD. When the population inbreeding coefficient is large, the false positive rates of Lange's tests become much larger than the nominal value, while those of our modified tests remain close to the nominal value. To estimate power with a controlled false positive rate, we choose the cutoff values based on simulated datasets under the null hypothesis, so that both Lange's tests and the modified tests generate same false positive rate. The powers of Lange's z-test and our modified z-test are very close and do not change much with increasing inbreeding. The power of the modified chi-square test also stays stable when the inbreeding coefficient increases. However, the power of Lange's chi-square test increases with increasing inbreeding, and is larger than that of our modified chi-square test for large inbreeding coefficients. The power is high under a recessive disease model for both Lange's tests and the modified tests, though the power is low for additive and dominant disease models. Allowing for inbreeding is therefore appropriate, at least for diseases known to be recessive.

  1. Adiabatic pair creation in heavy-ion and laser fields

    International Nuclear Information System (INIS)

    Pickl, P.; Durr, D.


    The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)

  2. A study of electron-positron pair equilibria in models of compact X- and gamma-ray sources

    International Nuclear Information System (INIS)

    Bjoernsson, G.


    Thermal electron-positron pair equilibria in two temperature models of compact x ray and gamma ray sources are studied. The pairs are assumed to be heated by Coulomb interaction with the much hotter protons and cooled by bremsstrahlung emission, Compton scattering, and annihilation. Two parameters, the proton optical depth and the compactness, characterize each equilibrium state. It is shown that a careful account of the energy balance is very important when the stability properties of the pair equilibria in a spherical plasma cloud are determined. The equilibria are found to be unstable in a very limited range of compactness and proton optical depth. This particular instability is unlikely to be the cause of the observed variability of the compact sources and implies that it is possible to build up high pair densities by a thermal mechanism in two temperature environments. The most important result considers the effects of pairs on the structure of geometrically and effectively optically thin accretion disks. A new approach for solving for the equilibrium structure of the disks is presented. In effect, the pair equilibrium states are projected into the space spanned by the disk structure parameters. This allows a direct visualization of all possible disk solutions at once. Each solution profile needs to be calculated only once and a complete disk solution is obtained by a simple radial coordinate transformation. The disk solutions are thus seen to be scale free in terms of the radial coordinate as well as in terms of the mass of the central object and the accretion rate. Two particular disk solutions are given. It is shown that including electron-positron pairs in the disk structure calculations leads to a breakdown of the thin disk assumptions and that more detailed disk modeling is required before electron-positron pairs can be self-consistently included

  3. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation) (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.


    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  4. Improving slowness estimate stability and visualization using limited sensor pair correlation on seismic arrays (United States)

    Gibbons, Steven J.; Näsholm, S. P.; Ruigrok, E.; Kværna, T.


    Seismic arrays enhance signal detection and parameter estimation by exploiting the time-delays between arriving signals on sensors at nearby locations. Parameter estimates can suffer due to both signal incoherence, with diminished waveform similarity between sensors, and aberration, with time-delays between coherent waveforms poorly represented by the wave-front model. Sensor-to-sensor correlation approaches to parameter estimation have an advantage over direct beamforming approaches in that individual sensor-pairs can be omitted without necessarily omitting entirely the data from each of the sensors involved. Specifically, we can omit correlations between sensors for which signal coherence in an optimal frequency band is anticipated to be poor or for which anomalous time-delays are anticipated. In practice, this usually means omitting correlations between more distant sensors. We present examples from International Monitoring System seismic arrays with poor parameter estimates resulting when classical f-k analysis is performed over the full array aperture. We demonstrate improved estimates and slowness grid displays using correlation beamforming restricted to correlations between sufficiently closely spaced sensors. This limited sensor-pair correlation (LSPC) approach has lower slowness resolution than would ideally be obtained by considering all sensor-pairs. However, this ideal estimate may be unattainable due to incoherence and/or aberration and the LSPC estimate can often exploit all channels, with the associated noise-suppression, while mitigating the complications arising from correlations between very distant sensors. The greatest need for the method is for short-period signals on large aperture arrays although we also demonstrate significant improvement for secondary regional phases on a small aperture array. LSPC can also provide a robust and flexible approach to parameter estimation on three-component seismic arrays.

  5. Nucleon-pair approximation to the nuclear shell model

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Y.M., E-mail: [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Arima, A. [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Musashi Gakuen, 1-26-1 Toyotamakami Nerima-ku, Tokyo 176-8533 (Japan)


    Atomic nuclei are complex systems of nucleons–protons and neutrons. Nucleons interact with each other via an attractive and short-range force. This feature of the interaction leads to a pattern of dominantly monopole and quadrupole correlations between like particles (i.e., proton–proton and neutron–neutron correlations) in low-lying states of atomic nuclei. As a consequence, among dozens or even hundreds of possible types of nucleon pairs, very few nucleon pairs such as proton and neutron pairs with spin zero, two (in some cases spin four), and occasionally isoscalar spin-aligned proton–neutron pairs, play important roles in low-energy nuclear structure. The nucleon-pair approximation therefore provides us with an efficient truncation scheme of the full shell model configurations which are otherwise too large to handle for medium and heavy nuclei in foreseeable future. Furthermore, the nucleon-pair approximation leads to simple pictures in physics, as the dimension of nucleon-pair subspace is always small. The present paper aims at a sound review of its history, formulation, validity, applications, as well as its link to previous approaches, with the focus on the new developments in the last two decades. The applicability of the nucleon-pair approximation and numerical calculations of low-lying states for realistic atomic nuclei are demonstrated with examples. Applications of pair approximations to other problems are also discussed.

  6. Considerations on Velocities and Accelerations in Higher Pairs Mechanisms

    Directory of Open Access Journals (Sweden)

    Florina-Carmen Ciornei


    Full Text Available The paper proposes a method for finding the velocities and accelerations in the pairs from a mechanism with higher pairs in the case when the curvature radii of the curves achieving the higher pair are finite. There are obtained the characteristic equations of the motion in the higher pair for the case that one of the curves has zero curvature radius, condition characteristic to the knife edge follower. The relations are required to justify the difference between the particular cases of knife edge follower and flat face follower. The methodology is exemplified through an actual example.

  7. Exotic Paired States with Anisotropic Spin-Dependent Fermi Surfaces

    International Nuclear Information System (INIS)

    Feiguin, Adrian E.; Fisher, Matthew P. A.


    We propose a model for realizing exotic paired states in cold Fermi gases by using a spin-dependent optical lattice to engineer mismatched Fermi surfaces for each hyperfine species. The BCS phase diagram shows a stable paired superfluid state with coexisting pockets of momentum space with gapless unpaired carriers, similar to the Sarma state in polarized mixtures, but in our case the system is unpolarized. We propose the possible existence of an exotic 'Cooper-pair Bose-metal' phase, which has a gap for single fermion excitations but gapless and uncondensed 'Cooper-pair' excitations residing on a 'Bose surface' in momentum space.

  8. Alexander-equivalent Zariski pairs of irreducible sextics

    DEFF Research Database (Denmark)

    Eyral, Christophe; Oka, Mutsuo


    The existence of Alexander-equivalent Zariski pairs dealing with irreducible curves of degree 6 was proved by Degtyarev. However, no explicit example of such a pair is available (only the existence is known) in the literature. In this paper, we construct the first concrete example.......The existence of Alexander-equivalent Zariski pairs dealing with irreducible curves of degree 6 was proved by Degtyarev. However, no explicit example of such a pair is available (only the existence is known) in the literature. In this paper, we construct the first concrete example....

  9. Pairing from strong repulsion in triangular lattice Hubbard model (United States)

    Zhang, Shang-Shun; Zhu, Wei; Batista, Cristian D.


    We propose a pairing mechanism between holes in the dilute limit of doped frustrated Mott insulators. Hole pairing arises from a hole-hole-magnon three-body bound state. This pairing mechanism has its roots on single-hole kinetic energy frustration, which favors antiferromagnetic (AFM) correlations around the hole. We demonstrate that the AFM polaron (hole-magnon bound state) produced by a single hole propagating on a field-induced polarized background is strong enough to bind a second hole. The effective interaction between these three-body bound states is repulsive, implying that this pairing mechanism is relevant for superconductivity.

  10. Butterflyfishes as a System for Investigating Pair Bonding

    KAUST Repository

    Nowicki, Jessica


    For many animals, affiliative relationships such as pair bonds form the foundation of society, and are highly adaptive. Animal systems amenable for comparatively studying pair bonding are important for identifying underlying biological mechanisms, but mostly exist in mammals. Better establishing fish systems will enable comparison of pair bonding mechanisms across taxonomically distant lineages that may reveal general underlying principles. We examined the utility of wild butterflyfishes (f: Chaetodontidae; g: Chaetodon) for comparatively studying pair bonding. Stochastic character mapping inferred that within the family, pairing is ancestral, with at least seven independent transitions to group formation and seven transition to solitary behavior from the late Miocene to recent. In six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping, we then verified social systems at Lizard Island, Australia. In situ observations confirmed that Chaetodon baronessa, C. lunulatus, and C. vagabundus are predominantly pair bonding, whereas C. rainfordi, C. plebeius, and C. trifascialis are predominantly solitary. Even in the predominantly pair bonding species, C. lunulatus, a proportion of adults (15 %) are solitary. Importantly, inter- and intra-specific differences in social systems do not co-vary with other previously established attributes (geographic occurrence, parental care, diet, or territoriality). Hence, the proposed butterflyfish populations are promising for comparative analyses of pair bonding and its mechanistic underpinnings. Avenues for further developing the system are proposed, including determining whether the utility of these species applies across their geographic disruptions.

  11. AGT, Burge pairs and minimal models

    International Nuclear Information System (INIS)

    Bershtein, M.; Foda, O.


    We consider the AGT correspondence in the context of the conformal field theory M p,p ′ ⊗M H , where M p,p ′ is the minimal model based on the Virasoro algebra V p,p ′ labeled by two co-prime integers {p,p ′ }, 1pairs {Y 1 ι ,Y 2 ι } that satisfy Y 2,σ ι,⊺ −Y 1,σ+r ι −1 ι,⊺ ≥1−s ι , and Y 1,σ ι,⊺ −Y 2,σ+p−r ι −1 ι,⊺ ≥1−p ′ +s ι , where Y i,σ ι,⊺ is the σ-column of Y i ι , i∈{1,2}, we obtain a well-defined expression that we identify with B n p,p ′ ,H . We check the correctness of this expression for 1. Any 1-point B 1 p,p ′ ,H on the torus, when the operator insertion is the identity, and 2. The 6-point B 3 3,4,H on the sphere that involves six Ising magnetic operators.

  12. Darboux invariants of integrable equations with variable spectral parameters

    International Nuclear Information System (INIS)

    Shin, H J


    The Darboux transformation for integrable equations with variable spectral parameters is introduced. Darboux invariant quantities are calculated, which are used in constructing the Lax pair of integrable equations. This approach serves as a systematic method for constructing inhomogeneous integrable equations and their soliton solutions. The structure functions of variable spectral parameters determine the integrability and nonlinear coupling terms. Three cases of integrable equations are treated as examples of this approach

  13. Study of correlations between photoproduced pairs of charmed particles at Experiment E831/FOCUS

    Energy Technology Data Exchange (ETDEWEB)

    Castromonte Flores, Cesar Manuel [Brazilian Center for Physics Research, Rio de Janeiro (Brazil)


    The authors present the study of the charm-pair correlations produced in photon-nucleon interactions at $\\langle$Eγ$\\rangle$ = 175 GeV/c, by the Fermilab fixed target experiment E831/FOCUS. The E831/FOCUS experiment produced and reconstructed over one million charm particles. This high statistics allows the reconstruction of more than 7000 charm-pair mesons D$\\bar{D}$, 10 times the statistic of former experiments, and also allows to get, for the first time, about 600 totally reconstructed charm-pairs in the DDs and DΛc channels. They were able to study, with some detail, the kinematical correlations between the charm and anticharm particle forming a pair, in the square transverse momentum (pT2), azimuthal angle difference (ΔΦ), rapidity difference (Δy) and the charm-pair mass variables. They observe some correlation for the longitudinal momenta, and a significant correlation for the transverse momenta of the charm and anticharm particles. They compare the experimental distributions with theoretical predictions based on the photon-gluon fusion model (PGF), for the production of c$\\bar{c}$ quarks, and the standard Lund hadronization model. These models are implemented by the PYTHIA Monte Carlo event generator. The PYTHIA program allows the inclusion, in the simulation, of non-perturbative effects that have been shown to be important for charm production. In order to compare data and simulation, they have generated two Monte Carlo samples, the first one set to favor the production of D$\\bar{D}$ pairs (MCDD2), and the second one set to favor the production of DDsand DΛc pairs, where each one uses different functions and parameters values for the theoretical models in the simulation. They observe, for the correlation distributions, that the set of parameters used by the MCDD2 model together with the intrinsic transverse momentum (k$\\perp$) of the partons inside the

  14. Tiling array-CGH for the assessment of genomic similarities among synchronous unilateral and bilateral invasive breast cancer tumor pairs

    Directory of Open Access Journals (Sweden)

    Ringnér Markus


    Full Text Available Abstract Background Today, no objective criteria exist to differentiate between individual primary tumors and intra- or intermammary dissemination respectively, in patients diagnosed with two or more synchronous breast cancers. To elucidate whether these tumors most likely arise through clonal expansion, or whether they represent individual primary tumors is of tumor biological interest and may have clinical implications. In this respect, high resolution genomic profiling may provide a more reliable approach than conventional histopathological and tumor biological factors. Methods 32 K tiling microarray-based comparative genomic hybridization (aCGH was used to explore the genomic similarities among synchronous unilateral and bilateral invasive breast cancer tumor pairs, and was compared with histopathological and tumor biological parameters. Results Based on global copy number profiles and unsupervised hierarchical clustering, five of ten (p = 1.9 × 10-5 unilateral tumor pairs displayed similar genomic profiles within the pair, while only one of eight bilateral tumor pairs (p = 0.29 displayed pair-wise genomic similarities. DNA index, histological type and presence of vessel invasion correlated with the genomic analyses. Conclusion Synchronous unilateral tumor pairs are often genomically similar, while synchronous bilateral tumors most often represent individual primary tumors. However, two independent unilateral primary tumors can develop synchronously and contralateral tumor spread can occur. The presence of an intraductal component is not informative when establishing the independence of two tumors, while vessel invasion, the presence of which was found in clustering tumor pairs but not in tumor pairs that did not cluster together, supports the clustering outcome. Our data suggest that genomically similar unilateral tumor pairs may represent a more aggressive disease that requires the addition of more severe treatment modalities, and

  15. Pairing in the BCS and LN approximations using continuum single particle level density

    International Nuclear Information System (INIS)

    Id Betan, R.M.; Repetto, C.E.


    Understanding the properties of drip line nuclei requires to take into account the correlations with the continuum spectrum of energy of the system. This paper has the purpose to show that the continuum single particle level density is a convenient way to consider the pairing correlation in the continuum. Isospin mean-field and isospin pairing strength are used to find the Bardeen–Cooper–Schrieffer (BCS) and Lipkin–Nogami (LN) approximate solutions of the pairing Hamiltonian. Several physical properties of the whole chain of the Tin isotope, as gap parameter, Fermi level, binding energy, and one- and two-neutron separation energies, were calculated and compared with other methods and with experimental data when they exist. It is shown that the use of the continuum single particle level density is an economical way to include explicitly the correlations with the continuum spectrum of energy in large scale mass calculation. It is also shown that the computed properties are in good agreement with experimental data and with more sophisticated treatment of the pairing interaction.

  16. Probability of primordial black hole pair creation in a modified gravitational theory

    International Nuclear Information System (INIS)

    Paul, B. C.; Paul, Dilip


    We compute the probability for quantum creation of an inflationary universe with and without a pair of black holes in a modified gravity. The action of the modified theory of gravity contains αR 2 and δR -1 terms in addition to a cosmological constant (Λ) in the Einstein-Hilbert action. The probabilities for the creation of universe with a pair of black holes have been evaluated considering two different kinds of spatial sections, one which accommodates a pair of black holes and the other without black hole. We adopt a technique prescribed by Bousso and Hawking to calculate the above creation probability in a semiclassical approximation using the Hartle-Hawking boundary condition. We note a class of new and physically interesting instanton solutions characterized by the parameters in the action. These instantons may play an important role in the creation of the early universe. We also note that the probability of creation of a universe with a pair of black holes is strongly suppressed with a positive cosmological constant when δ=(4Λ 2 /3) for α>0 but it is more probable for α<-(1/6Λ). In the modified gravity considered here instanton solutions are permitted even without a cosmological constant when one begins with a negative δ

  17. Comparability of results from pair and classical model formulations for different sexually transmitted infections.

    Directory of Open Access Journals (Sweden)

    Jimmy Boon Som Ong

    Full Text Available The "classical model" for sexually transmitted infections treats partnerships as instantaneous events summarized by partner change rates, while individual-based and pair models explicitly account for time within partnerships and gaps between partnerships. We compared predictions from the classical and pair models over a range of partnership and gap combinations. While the former predicted similar or marginally higher prevalence at the shortest partnership lengths, the latter predicted self-sustaining transmission for gonorrhoea (GC and Chlamydia (CT over much broader partnership and gap combinations. Predictions on the critical level of condom use (C(c required to prevent transmission also differed substantially when using the same parameters. When calibrated to give the same disease prevalence as the pair model by adjusting the infectious duration for GC and CT, and by adjusting transmission probabilities for HIV, the classical model then predicted much higher C(c values for GC and CT, while C(c predictions for HIV were fairly close. In conclusion, the two approaches give different predictions over potentially important combinations of partnership and gap lengths. Assuming that it is more correct to explicitly model partnerships and gaps, then pair or individual-based models may be needed for GC and CT since model calibration does not resolve the differences.

  18. Pair production of neutralinos and charginos at the LHC: The role of Higgs bosons exchange

    International Nuclear Information System (INIS)

    Arhrib, Abdesslam; Benbrik, Rachid; Chabab, Mohamed; Chen, Chuan-Hung


    We analyze the effects of the s-channel Higgs bosons exchange on the charginos-pair and neutralinos-pair production in proton-proton collision at the CERN Large Hadron Collider (LHC) in the following channels: pp→χ-tilde + χ-tilde - /χ-tilde 0 χ-tilde 0 +X, within the minimal supersymmetric standard model (MSSM). Assuming the usual GUT relation between M 1 and M 2 at the weak scale, we found that substantial enhancement can be obtained through s-channel Higgs bosons exchange in the mixed regime where M 2 ∼|μ| with moderate to large tanβ at the resonance of the heavy Higgs bosons. By combining the phenomenological constraints on neutralinos and charginos, we may still find regions of parameter space where charginos-pair and neutralinos-pair production at the LHC from bb initial state can be large and observable at LHC. We also compute the full complete set of electroweak (EW) contributions to pp→gg→χ-tilde + χ-tilde - /χ-tilde 0 χ-tilde 0 +X at the one-loop level in the general MSSM. The analytical-computation of the complete tree-level amplitude for bb→χ-tilde + χ-tilde - /χ-tilde 0 χ-tilde 0 +X, including s-channel Higgs exchange, is given.

  19. Studding the phenomenon of pair production of tracks on plastic detectors during radon measurements

    International Nuclear Information System (INIS)

    Shweikani, R.; Jourbi, B.


    Previous studies showed the appearance of many pairs of alpha tracks on the surface of the solid state nuclear track detectors (CR39) when exposed to radon. So the aim of this study was to judge whether this is a statistical or a physical phenomenon. Therefore, a theoretical function representing the probability of forming pairs of tracks on the detector was developed. A statistical studying was done for two sets of (1) mm thickness of CR39 detectors, the first set was exposed in the radon calibration chamber (RCC) with stable radon concentration (170 kBq/m 3 ) for different detectors positions inside and outside the exposure chamber (EC). While the second set was exposed to 241 Am source (1667 Bq) for different exposure times. The results show that the concentration of the single tracks on the detectors in case of covered EC was lower than the same situation without cover. In addition, the concentrations of the single tracks in various exposure situations inside and outside the EC were associated to the effective volumes that each detector sees. Finally, no considerable deference was found between pairs concentration in the two exposure cases (Radon chamber and 241 Am source), and both were lower than the theoretical values which calculated using the theoretical function. This means that pairs formation phenomena is a statistical phenomenon and there is no physical parameters related to radon gas or its daughter's behavior. (author)

  20. Study on adsorption refrigeration performance of MIL-101-isobutane working pair

    International Nuclear Information System (INIS)

    Ma, Liejun; Yang, Huan; Wu, Qi; Yin, Yu; Liu, Zongjian; Cui, Qun; Wang, Haiyan


    Rising concerns about pro-environment and energy conservation bring about the escalating interests in adsorption cooling systems using renewable energy. Adsorption chillers with common refrigerants (water, ethanol, methanol, etc.) face the problem that advanced technologies and intricate design considerations are required to maintain high vacuum. This paper aims at the parameters optimization of adsorption system being operated with the novel working pair, MIL-101-isobutane, under typical conditions of ice making and air-condition. Adsorption isotherms and dynamic of isobutane on MIL-101 are discussed simultaneously. When the hot water inlet temperature, cooling water temperature and desorption time are 95 °C, 30 °C and 30 min, respectively, the cooling capacity is 45.7 kJ/kg, which is 1.7 times as much as that of activated carbon–isobutane pair. Structural stability of MIL-101 subjected to 500 times adsorption/desorption cycles has been successfully verified by XRD (X-ray diffraction). - Highlights: • Adsorption isotherms and kinetic of isobutane on MIL-101 were studied. • A single bed adsorption chiller with MIL-101-isobutane pair was built. • System performed better than that using activated carbon–isobutane pair. • Stability of MIL-101 subjected to 500 ad/desorption cycles has been verified.

  1. Recovering a Probabilistic Knowledge Structure by Constraining Its Parameter Space (United States)

    Stefanutti, Luca; Robusto, Egidio


    In the Basic Local Independence Model (BLIM) of Doignon and Falmagne ("Knowledge Spaces," Springer, Berlin, 1999), the probabilistic relationship between the latent knowledge states and the observable response patterns is established by the introduction of a pair of parameters for each of the problems: a lucky guess probability and a careless…

  2. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.


    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  3. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions. (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej


    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  4. Cosmological Parameters 2000


    Primack, Joel R.


    The cosmological parameters that I emphasize are the age of the universe $t_0$, the Hubble parameter $H_0 \\equiv 100 h$ km s$^{-1}$ Mpc$^{-1}$, the average matter density $\\Omega_m$, the baryonic matter density $\\Omega_b$, the neutrino density $\\Omega_\

  5. AGT, Burge pairs and minimal models

    Energy Technology Data Exchange (ETDEWEB)

    Bershtein, M. [Landau Institute for Theoretical Physics,Chernogolovka (Russian Federation); Institute for Information Transmission Problems,Moscow (Russian Federation); National Research University Higher School of Economics, International Laboratory of Representation Theory and Mathematical Physics, Independent University of Moscow, Moscow (Russian Federation); Foda, O. [Mathematics and Statistics, University of Melbourne,Parkville, VIC 3010 (Australia)


    We consider the AGT correspondence in the context of the conformal field theory M{sup p,p{sup ′}}⊗M{sup H}, where M{sup p,p{sup ′}} is the minimal model based on the Virasoro algebra V{sup p,p{sup ′}} labeled by two co-prime integers {p,p"′}, 1pairs {Y_1"ι,Y_2"ι} that satisfy Y{sub 2,σ}{sup ι,⊺}−Y{sub 1,σ+r{sub ι−1}{sup ι,⊺}}≥1−s{sub ι}, and Y{sub 1,σ}{sup ι,⊺}−Y{sub 2,σ+p−r{sub ι−1}{sup ι,⊺}}≥1−p{sup ′}+s{sub ι}, where Y{sub i,σ}{sup ι,⊺} is the σ-column of Y{sub i}{sup ι}, i∈{1,2}, we obtain a well-defined expression that we identify with B{sub n}{sup p,p{sup ′,H}}. We check the correctness of this expression for 1. Any 1-point B{sub 1}{sup p,p{sup ′,H}} on the torus, when the operator insertion is the identity, and 2. The 6-point B{sub 3}{sup 3,4,H} on the sphere that involves six Ising magnetic operators.

  6. Galaxy pairs as a probe for mergers at z ~ 2

    DEFF Research Database (Denmark)

    Man, A.W.S.; Zirm, Andrew Wasmuth; Toft, Sune


    In this work I investigate the redshift evolution of pair fraction of a sample of 196 massive galaxies from z = 0 to 3, selected from the COSMOS field. We find that on average a massive galaxy undergoes ~ 1.1 \\pm 0.5 major merger since z = 3. I will review the current limitations of using the pair...

  7. Inflation of the screening length induced by Bjerrum pairs

    NARCIS (Netherlands)

    Zwanikken, J.W.; van Roij, R.H.H.G.


    Within a modified Poisson–Boltzmann theory we study the effect of Bjerrum pairs on the typical length scale 1/¯κ over which electric fields are screened in electrolyte solutions, taking into account a simple association–dissociation equilibrium between free ions and Bjerrum pairs. At low densities

  8. Theory of pairing symmetry in the vortex states

    NARCIS (Netherlands)

    Yokoyama, Takehito; Ichioka, Yukio; Yanaka, Yukio; Golubov, Alexandre Avraamovitch


    We investigate pairing symmetry in an Abrikosov vortex and vortex lattice. It is shown that the Cooper pair wave function at the center of an Abrikosov vortex with vorticity m has a different parity with respect to frequency from that in the bulk if m is an odd number, while it has the same parity

  9. Proton-neutron correlations in a broken-pair model

    International Nuclear Information System (INIS)

    Akkermans, J.N.L.


    In this thesis nuclear-structure calculations are reported which were performed with the broken-pair model. The model which is developed, is an extension of existing broken-pair models in so far that it includes both proton and neutron valence pairs. The relevant formalisms are presented. In contrast to the number-non-conserving model, a proton-neutron broken-pair model is well suited to study the correlations which are produced by the proton-neutron interaction. It is shown that the proton-neutron force has large matrix elements which mix the proton- with neutron broken-pair configurations. This occurs especially for Jsup(PI)=2 + and 3 - pairs. This property of the proton-neutron force is used to improve the spectra of single-closed shell nuclei, where particle-hole excitations of the closed shell are a special case of broken-pair configurations. Using Kr and Te isotopes it is demonstrated that the proton-neutron force gives rise to correlated pair structures, which remain remarkably constant with varying nucleon numbers. (Auth.)

  10. Finding Question-Answer Pairs from Online Forums

    DEFF Research Database (Denmark)

    Cong, Gao; Wang, Long; Lin, Chin-Yew


    Online forums contain a huge amount of valuable user generated content. In this paper we address the problem of extracting question-answer pairs from forums. Question-answer pairs extracted from forums can be used to help Question Answering services (e.g. Yahoo! Answers) among other applications...

  11. Observing Pair-Work Task in an English Speaking Class (United States)

    Achmad, Diana; Yusuf, Yunisrina Qismullah


    This paper reports on students' pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger)…

  12. Observation of charmonium pairs produced exclusively in pp collisions

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Affolder, A.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Cartelle, P. Alvarez; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Anderson, J.; Andreassen, R.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Gutierrez, O. Aquines; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Badalov, A.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Belogurov, S.; Belous, K.; Belyaev, I.; Onderwater, G.; Pellegrino, A.

    A search is performed for the central exclusive production of pairs of charmonia produced in proton-proton collisions. Using data corresponding to an integrated luminosity of 3 fb(-1) collected at centre-of-mass energies of 7 and 8 TeV, J/psi J/psi and J/psi psi (2S) pairs are observed, which have

  13. Teleportation of Quantum States through Mixed Entangled Pairs

    Institute of Scientific and Technical Information of China (English)

    ZHENG Shi-Biao


    @@ We describe a protocol for quantum state teleportation via mixed entangled pairs. With the help of an ancilla,near-perfect teleportation might be achieved. For pure entangled pairs, perfect teleportation might be achieved with a certain probability without using an ancilla. The protocol is generalized to teleportation of multiparticle states and quantum secret sharing.

  14. minimal pairs of polytopes and their number of vertices

    African Journals Online (AJOL)

    Preferred Customer

    Using this operation we give a new algorithm to reduce and find a minimal pair of polytopes from the given ... Key words/phrases: Pairs of compact convex sets, Blaschke addition, Minkowski sum, mnimality ... product K(X)×K(X) by K2. (X).

  15. Pairing renormalization and regularization within the local density approximation

    International Nuclear Information System (INIS)

    Borycki, P.J.; Dobaczewski, J.; Nazarewicz, W.; Stoitsov, M.V.


    We discuss methods used in mean-field theories to treat pairing correlations within the local density approximation. Pairing renormalization and regularization procedures are compared in spherical and deformed nuclei. Both prescriptions give fairly similar results, although the theoretical motivation, simplicity, and stability of the regularization procedure make it a method of choice for future applications

  16. Solving the Airline Crew Pairing Problem using Subsequence Generation

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Lusby, Richard Martin; Ryan, David M.


    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However, ...

  17. Solving the Airline Crew Pairing Problem using Subsequence Generation

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Ryan, David; Lusby, Richard Martin


    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However, ...

  18. Intruder level and deformation in SD-pair shell model

    International Nuclear Information System (INIS)

    Luo Yan'an; Ning Pingzhi; Pan Feng


    The influence of intruder level on nuclear deformation is studied within the framework of the nucleon-pair shell model truncated to an SD-pair subspace. The results suggest that the intruder level has a tendency to reduce the deformation and plays an important role in determining the onset of rotational behavior. (authors)

  19. Extending the Extensional Lambda Calculus with Surjective Pairing is Conservative

    DEFF Research Database (Denmark)

    Støvring, Kristian


    We answer Klop and de Vrijer's question whether adding surjective-pairing axioms to the extensional lambda calculus yields a conservative extension. The answer is positive. As a byproduct we obtain a "syntactic" proof that the extensional lambda calculus with surjective pairing is consistent....

  20. Relativistic quasiparticle random phase approximation with a separable pairing force

    International Nuclear Information System (INIS)

    Tian Yuan; Ma Zhongyu; Ring Peter


    In our previous work, we introduced a separable pairing force for relativistic Hartree-Bogoliubov calculations. This force was adjusted to reproduce the pairing properties of the Gogny force in nuclear matter. By using the well known techniques of Talmi and Moshinsky it can be expanded in a series of separable terms and converges quickly after a few terms. It was found that the pairing properties can be depicted on almost the same footing as the original pairing interaction, not only in nuclear matter, but also in finite nuclei. In this study, we construct a relativistic quasiparticle random phase approximation (RQRPA) with this separable pairing interaction and calculate the excitation energies of the first excited 2 + states and reduced B(E2; 0 + →2 + ) transition rates for a chain of Sn isotopes in RQRPA. Compared with the results of the full Gogny force, we find that this simple separable pairing interaction can describe the pairing properties of the excited vibrational states as well as the original pairing interaction. (authors)

  1. Pair production of arbitrary spin particles by electromagnetic fields

    International Nuclear Information System (INIS)

    Kruglov, S.I.


    The exact solutions of the wave equation for arbitrary spin particles in the field of the soliton-like electric impulse were obtained. The differential probability of pair production of particles by electromagnetic fields has been evaluated on the basis of the exact solutions. As a particular case, the particle pair production in the constant and uniform electric field were studied

  2. Quantitative measures of entanglement in pair-coherent states

    International Nuclear Information System (INIS)

    Agarwal, G S; Biswas, Asoka


    The pair-coherent states for a two-mode radiation field are known to belong to a family of states with non-Gaussian wavefunction. The nature of quantum entanglement between the two modes and some features of non-classicality are studied for such states. The existing criterion for inseparability are examined in the context of pair-coherent states

  3. Pair Formation of Hard Core Bosons in Flat Band Systems (United States)

    Mielke, Andreas


    Hard core bosons in a large class of one or two dimensional flat band systems have an upper critical density, below which the ground states can be described completely. At the critical density, the ground states are Wigner crystals. If one adds a particle to the system at the critical density, the ground state and the low lying multi particle states of the system can be described as a Wigner crystal with an additional pair of particles. The energy band for the pair is separated from the rest of the multi-particle spectrum. The proofs use a Gerschgorin type of argument for block diagonally dominant matrices. In certain one-dimensional or tree-like structures one can show that the pair is localised, for example in the chequerboard chain. For this one-dimensional system with periodic boundary condition the energy band for the pair is flat, the pair is localised.

  4. Inflation of the screening length induced by Bjerrum pairs. (United States)

    Zwanikken, Jos; van Roij, René


    Within a modified Poisson-Boltzmann theory we study the effect of Bjerrum pairs on the typical length scale [Formula: see text] over which electric fields are screened in electrolyte solutions, taking into account a simple association-dissociation equilibrium between free ions and Bjerrum pairs. At low densities of Bjerrum pairs, this length scale is well approximated by the Debye length [Formula: see text], with ρ(s) the free-ion density. At high densities of Bjerrum pairs, however, we find [Formula: see text], which is significantly larger than 1/κ due to the enhanced effective permittivity of the electrolyte, caused by the polarization of Bjerrum pairs. We argue that this mechanism may explain the recently observed anomalously large colloid-free zones between an oil-dispersed colloidal crystal and a colloidal monolayer at the oil-water interface.

  5. An Intelligent Model for Pairs Trading Using Genetic Algorithms. (United States)

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An


    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  6. Pair truncation for rotational nuclei: j=17/2 model

    International Nuclear Information System (INIS)

    Halse, P.; Jaqua, L.; Barrett, B.R.


    The suitability of the pair condensate approach for rotational states is studied in a single j=17/2 shell of identical nucleons interacting through a quadrupole-quadrupole Hamiltonian. The ground band and a K=2 excited band are both studied in detail. A direct comparison of the exact states with those constituting the SD and SDG subspaces is used to identify the important degrees of freedom for these levels. The range of pairs necessary for a good description is found to be highly state dependent; S and D pairs are the major constituents of the low-spin ground-band levels, while G pairs are needed for those in the γ band. Energy spectra are obtained for each truncated subspace. SDG pairs allow accurate reproduction of the binding energy and K=2 excitation energy, but still give a moment of inertia which is about 30% too small even for the lowest levels

  7. Overdensity of galaxies in the environment of quasar pairs (United States)

    Sandrinelli, A.; Falomo, R.; Treves, A.; Scarpa, R.; Uslenghi, M.


    We report on a study of the galaxy environments of low redshift physical quasars pairs. We selected 20 pairs having projected separation Survey images, we evaluated the galaxy overdensity around these quasars in pairs and then compare it with that of a sample of isolated quasars with same redshift and luminosity. It is found that on average there is a systematic larger overdensity of galaxies around quasars in pairs with respect to that of isolated quasars. This may represent a significant link between nuclear activity and galaxy environment. However, at odds with that, the closest quasar pairs seem to inhabit poorer environments. Implications of present results and perspectives for future work are briefly discussed.

  8. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs. (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju


    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  9. Dynamical Cooper pairing in non-equilibrium electron-phonon systems

    Energy Technology Data Exchange (ETDEWEB)

    Knap, Michael [Technical University of Munich (Germany); Harvard University (United States); Babadi, Mehrtash; Refael, Gil [Caltech (United States); Martin, Ivar [Argonne National Laboratory (United States); Demler, Eugene [Harvard University (United States)


    Ultrafast laser pulses have been used to manipulate complex quantum materials and to induce dynamical phase transitions. One of the most striking examples is the transient enhancement of superconductivity in several classes of materials upon irradiating them with high intensity pulses of terahertz light. Motivated by these experiments we analyze the Cooper pairing instabilities in non-equilibrium electron-phonon systems. We demonstrate that the light induced non-equilibrium state of phonons results in a simultaneous increase of the superconducting coupling constant and the electron scattering. We analyze the competition between these effects and show that in a broad range of parameters the dynamic enhancement of Cooper pair formation dominates over the increase in the scattering rate. This opens the possibility of transient light induced superconductivity at temperatures that are considerably higher than the equilibrium transition temperatures. Our results pave new pathways for engineering high-temperature light-induced superconducting states.

  10. Calculations of energy levels and electromagnetic properties for tellurium pair isotopes, by unified method

    International Nuclear Information System (INIS)

    Teixeira, R.R.P.


    Calculations with the Unified Model (vibrator coupled to two particles), of the energy levels and the eletromagnetic properties have been performed and compared with the twelve pair isotopes from tellurium with A between 112 and 134. The results were analysed using as particles interaction: pairing and SDI (Surface Delta Interaction). The SDI and 3 fonons collective states were used in the fittings, and a syntematic comparison between the theoretical and experimental results was made. The dependence of the results with the model parameters was determined, through large variation sof them. Calculations using 4 fonons have been made, and the importance of the introduced variations in the results was discussed. Calculations have been made in the VAX Computer of the Pelletron at IFUSP. (author) [pt

  11. Modulation instability of ion thermal waves in a pair-ion plasma containing charged dust impurities

    International Nuclear Information System (INIS)

    Sabry, R.


    Modulation instability of ion thermal waves (ITWs) is investigated in a plasma composed of positive and negative ions as well as a fraction of stationary charged (positive or negative) dust impurities. For this purpose, a linear dispersion relation and a nonlinear Schroedinger equation are derived. The latter admits localized envelope solitary wave solutions of bright (pulses) and dark (holes, voids) type. The envelope soliton depends on the intrinsic plasma parameters. It is found that modulation instability of ITWs is significantly affected by the presence of positively/negatively charged dust grains. The findings of this investigation should be useful in understanding the stable electrostatic wave packet acceleration mechanisms in pair-ion plasma, and also enhances our knowledge on the occurrence of instability associated to the existence of charged dust impurities in pair-ion plasmas. Our results should be of relevance for laboratory plasmas.

  12. Quench Property of Twisted-Pair MgB$_2$ Superconducting Cables in Helium Gas

    CERN Document Server

    Spurrell, J; Falorio, I; Pelegrin, J; Ballarino, A; Yang, Y


    CERN's twisted-pair superconducting cable is a novel design which offers filament transposition, low cable inductance and is particularly suited for tape conductors such as 2G YBCO coated conductors, Ag-sheathed Bi2223 tapes and Ni/Monel-sheathed MgB2 tapes. A typical design of such twistedpair cables consists of multiple superconducting tapes intercalated with thin copper tapes as additional stabilizers. The copper tapes are typically not soldered to the superconducting tapes so that sufficient flexibility is retained for the twisting of the tape assembly. The electrical and thermal contacts between the copper and superconducting tapes are an important parameter for current sharing, cryogenic stability and quench propagation. Using an MgB2 twisted-pair cable assembly manufactured at CERN, we have carried out minimum quench energy (MQE) and propagation velocity (vp) measurements with point-like heat deposition localized within a tape. Furthermore, different contacts between the copper and superconductor aroun...

  13. Pair creation, motion, and annihilation of topological defects in two-dimensional nematic liquid crystals (United States)

    Cortese, Dario; Eggers, Jens; Liverpool, Tanniemola B.


    We present a framework for the study of disclinations in two-dimensional active nematic liquid crystals and topological defects in general. The order tensor formalism is used to calculate exact multiparticle solutions of the linearized static equations inside a planar uniformly aligned state so that the total charge has to vanish. Topological charge conservation then requires that there is always an equal number of q =1 /2 and q =-1 /2 charges. Starting from a set of hydrodynamic equations, we derive a low-dimensional dynamical system for the parameters of the static solutions, which describes the motion of a half-disclination pair or of several pairs. Within this formalism, we model defect production and annihilation, as observed in experiments. Our dynamics also provide an estimate for the critical density at which production and annihilation rates are balanced.

  14. Nonthermal electron-positron pairs and cold matter in the central engines of active galactic nuclei (United States)

    Zdziarski, Andrzej A.


    The nonthermal e(+/-) pair model of the central engine of active galactic nuclei (AGNs) is discussed. The model assumes that nonthermal e(+/-) pairs are accelerated to highly relativistic energies in a compact region close to the central black hole and in the vicinity of some cold matter. The model has a small number of free parameters and explains a large body of AGN observations from EUV to soft gamma-rays. In particular, the model explains the existence of the UV bump, the soft X-rays excess, the canonical hard X-ray power law, the spectral hardening above about 10 keV, and some of the variability patterns in the soft and hard X-rays. In addition, the model explains the spectral steepening above about 50 keV seen in NGC 4151.

  15. Multiplying and detecting propagating microwave photons using inelastic Cooper-pair tunneling (United States)

    Leppäkangas, Juha; Marthaler, Michael; Hazra, Dibyendu; Jebari, Salha; Albert, Romain; Blanchet, Florian; Johansson, Göran; Hofheinz, Max


    The interaction between propagating microwave fields and Cooper-pair tunneling across a DC-voltage-biased Josephson junction can be highly nonlinear. We show theoretically that this nonlinearity can be used to convert an incoming single microwave photon into an outgoing n -photon Fock state in a different mode. In this process, the electrostatic energy released in a Cooper-pair tunneling event is transferred to the outgoing Fock state, providing energy gain. The created multiphoton Fock state is frequency entangled and highly bunched. The conversion can be made reflectionless (impedance matched) so that all incoming photons are converted to n -photon states. With realistic parameters, multiplication ratios n >2 can be reached. By two consecutive multiplications, the outgoing Fock-state number can get sufficiently large to accurately discriminate it from vacuum with linear postamplification and power measurement. Therefore, this amplification scheme can be used as a single-photon detector without dead time.

  16. Properties of entangled photon pairs generated in one-dimensional nonlinear photonic-band-gap structures

    International Nuclear Information System (INIS)

    Perina, Jan Jr.; Centini, Marco; Sibilia, Concita; Bertolotti, Mario; Scalora, Michael


    We have developed a rigorous quantum model of spontaneous parametric down-conversion in a nonlinear 1D photonic-band-gap structure based upon expansion of the field into monochromatic plane waves. The model provides a two-photon amplitude of a created photon pair. The spectra of the signal and idler fields, their intensity profiles in the time domain, as well as the coincidence-count interference pattern in a Hong-Ou-Mandel interferometer are determined both for cw and pulsed pumping regimes in terms of the two-photon amplitude. A broad range of parameters characterizing the emitted down-converted fields can be used. As an example, a structure composed of 49 layers of GaN/AlN is analyzed as a suitable source of photon pairs having high efficiency

  17. Magnetic S-parameter

    DEFF Research Database (Denmark)

    Sannino, Francesco


    We propose a direct test of the existence of gauge duals for nonsupersymmetric asymptotically free gauge theories developing an infrared fixed point by computing the S-parameter in the electric and dual magnetic description. In particular we show that at the lower bound of the conformal window...... the magnetic S-parameter, i.e. the one determined via the dual magnetic gauge theory, assumes a simple expression in terms of the elementary magnetic degrees of freedom. The results further support our recent conjecture of the existence of a universal lower bound on the S parameter and indicates...

  18. Tricritical behaviour in the phase transition induced by electron-hole pairing

    International Nuclear Information System (INIS)

    Crisan, M.


    The electron-hole pairing, which is possible in metals or semiconductors, can give condensed phases with two order parameters. If the coupling between the two order parameters is considered, the free energy functional is similar with the free energy of a n-component spin system with cubic anisotropy. Using the Wagner hypothesis (tricritical scaling) the non-linear scaling fields have been calculated. In order to perform the calculation of the nonlinear fields we used the method given by Rudnick and Nelson to solve the recursion relations for the 4-epsilon-dimensional system with n=6 components. The present calculation in the frame-work of the renormalization-group approach confirms the result obtained in the mean-field theory that the coupling of the two order parameters induces a first order phase transition. (author)

  19. Reply to Farrall. LOD wars: The affected-sib-pair paradigm strikes back!

    Energy Technology Data Exchange (ETDEWEB)

    Greenberg, D.A. [Mount Sinai Medical Center, New York, NY (United States); Hodge, S.E. [Columbia Univ., New York, NY (United States); Vieland, V.J. [Univ. of Iowa College of Medicine, Iowa City, IA (United States); Spence, M.A. [Univ. of California, Irvine, CA (United States)


    Farrall, in his comments about our previous letter, eloquently points out some of the advantages of affected-sib-pair (ASP) analysis. It may surprise him to learn that we do not disagree with most of his comments, but we do feel that a few of them could be potentially misleading. Farrall says that {open_quotes}ASP tests are nonparametric{close_quote} in the limited sense that the investigator does not have to declare (or have prior knowledge of) an explicit set of genetic parameters before undertaking a meaningful analysis. He could have added that one does not have the option of changing genetic parameters. One does not have to declare genetic parameters, because the design of the test is such that certain assumptions are inherent in the method. These assumptions are not obvious - and even may not be known - in the nonparametric methods. However, they are still there. 4 refs.

  20. Model parameter updating using Bayesian networks

    International Nuclear Information System (INIS)

    Treml, C.A.; Ross, Timothy J.


    This paper outlines a model parameter updating technique for a new method of model validation using a modified model reference adaptive control (MRAC) framework with Bayesian Networks (BNs). The model parameter updating within this method is generic in the sense that the model/simulation to be validated is treated as a black box. It must have updateable parameters to which its outputs are sensitive, and those outputs must have metrics that can be compared to that of the model reference, i.e., experimental data. Furthermore, no assumptions are made about the statistics of the model parameter uncertainty, only upper and lower bounds need to be specified. This method is designed for situations where a model is not intended to predict a complete point-by-point time domain description of the item/system behavior; rather, there are specific points, features, or events of interest that need to be predicted. These specific points are compared to the model reference derived from actual experimental data. The logic for updating the model parameters to match the model reference is formed via a BN. The nodes of this BN consist of updateable model input parameters and the specific output values or features of interest. Each time the model is executed, the input/output pairs are used to adapt the conditional probabilities of the BN. Each iteration further refines the inferred model parameters to produce the desired model output. After parameter updating is complete and model inputs are inferred, reliabilities for the model output are supplied. Finally, this method is applied to a simulation of a resonance control cooling system for a prototype coupled cavity linac. The results are compared to experimental data.

  1. Effects of Worked Examples, Example-Problem Pairs, and Problem-Example Pairs Compared to Problem Solving

    NARCIS (Netherlands)

    Van Gog, Tamara; Kester, Liesbeth; Paas, Fred


    Van Gog, T., Kester, L., & Paas, F. (2010, August). Effects of worked examples, example-problem pairs, and problem-example pairs compared to problem solving. Paper presented at the Biannual EARLI SIG meeting of Instructional design and Learning and instruction with computers, Ulm, Germany.

  2. On the combination of the Cooper pair and the Ogg pair in the high-Tc oxide superconductor

    International Nuclear Information System (INIS)

    Zhang Liyuan.


    In this paper it is argued that the superconductivity of the high-T c oxide superconductor (HTOS) can be explained by the combinating mechanism of the Cooper pair and the Ogg pair. The properties of the superconducting state of the HTOS have been calculated under this mechanism, and the theoretical results are overall consistent with the experiment. (author). 37 refs

  3. A computer program for calculation of reliable pair distribution functions of non-crystalline materials from limited diffraction data. III

    International Nuclear Information System (INIS)

    Hansen, F.Y.


    This program calculates the final pair distribution functions of non-crystalline materials on the basis of the experimental structure factor as calculated in part I and the parameters of the small distance part of the pair distribution function as calculated in part II. In this way, truncation error may be eliminated from the final pair distribution function. The calculations with this program depend on the results of calculations with the programs described in parts I and II. The final pair distribution function is calculated by a Fourier transform of a combination of an experimental structure factor and a model structure factor. The storage requirement depends on the number of data points in the structure factor, the number of data points in the final pair distribution function and the number of peaks necessary to resolve the small distance part of the pair distribution function. In the present set-up a storage requirement is set to 8860 words which is estimated to be satisfactory for a large number of cases. (Auth.)

  4. On changing the size of the atmosphere of a vortex pair embedded in a periodic external shear flow

    International Nuclear Information System (INIS)

    Ryzhov, E.A.


    The dynamics of fluid particles in the vicinity of a self-propagating vortex pair, embedded in a nonstationary shear flow, is studied. When the shear flow is steady, the vicinity of the pair, which is called as a vortex atmosphere, consists of closed stream-lines, which coincide with fluid particles' trajectories. When the shear flow is nonstationary, the trajectories' behaviour changes drastically, then chaotic advection occurs. It is shown in the Letter that the vortex pair propagation velocity varies with the parameters (amplitude, and frequency) of the nonstationary shear flow. It is demonstrated, that changing of the mean velocity leads to changing of the size of the atmosphere. -- Highlights: → A three-layered model of an inviscid incompressible geophysical flow is formulated. → A vortex pair is studied in the middle layer when a periodic shear flow is superimposed. → Dynamics of fluid particles inside the vortex atmosphere of the pair on it is studied. → When the external flow is nonstationary, then chaotic advection of fluid particles emerges. → Vortex pair's mean velocity of self-propelling changes depending on amplitude and frequency.

  5. Transition from Sign-Reversed to Sign-Preserved Cooper-Pairing Symmetry in Sulfur-Doped Iron Selenide Superconductors. (United States)

    Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun


    An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.

  6. Merging a Pair of Supermassive Black Holes (United States)

    Kohler, Susanna


    hydrodynamically, simulating the final stages of the galaxy merger.When the separation of the two SMBHs is small enough, the authors extract a spherical region of 5 kpc from around the pair and evolve this as an N-body simulation.Finally, the separation of the SMBHs becomes so small (0.01 pc) that gravitational-wave emission is the dominant loss of energy driving the inspiral. The authors add post-Newtonian terms into the N-body simulation to account for this.Time evolution of the separation between the SMBHs, beginning with the hydrodynamical simulation (blue), then transitioning to the direct N-body calculation (red), and ending with the introduction of post-Newtonian terms (green) to account for gravitational-wave emission. [Adapted from Khan et al. 2016]Successful CoalescenceKhan and collaborators complex approach allows them to simulate the entire process of the merger and SMBH coalescence, resulting in several key determinations.First, they demonstrate that the SMBHs can coalesce on timescales of only tens of Myr, which is roughly two orders of magnitude smaller than what was typically estimated before. They find that gas dissipation before the merger is instrumental in creating the conditions that allow for this rapid orbital decay.The authors also demonstrate that the gravitational potential of the galaxy merger remnant is triaxial throughout the merger. Khan and collaborators simulations confirm that this non-spherical potential solves the final parsec problem by sending stars on plunging orbits around the SMBHs. These more distant stars cause the SMBHs to lose angular momentum through dynamical friction and continue their inspiral, even when the stars immediately surrounding the SMBHs have been depleted.This simulation isan important step toward a better understanding of SMBH mergers. Its outcomes are especially promising for future gravitational-wave campaigns, as the short SMBH coalescence timescales indicate that these mergers could indeed be observable

  7. Electronic pairing mechanism due to band modification with increasing pair number

    International Nuclear Information System (INIS)

    Mizia, J.


    It is shown that a shift of an electron band with electron occupation number n, which is changing during the transition to the superconducting state, can lower the total energy of the system. In fact it will bring a negative contribution to the pairing potential, which is proportional to the product of the electron band shift with occupation number and the charge transfer during the transition to the superconducting state. The shift of the electron band comes from the change of stresses and the change of correlation effects in the CuO 2 plane with n, that in turn is caused by the changing oxygen concentration. This model explains the phenomenological success of Hirsch's model, which gives no explanation how the band shift in energy can give rise to superconductivity. (orig.)

  8. The interaction of counter-rotating strained vortex pairs with a third vortex

    International Nuclear Information System (INIS)

    Higgins, Keith; Ooi, Andrew; Chong, M S; Ruetten, Markus


    The vortex dynamics caused by the interaction of counter-rotating Burgers vortex pairs with a third Burgers vortex in a straining flow is investigated numerically. These interactions blend vortex merging and cancellation effects, and the aim is to investigate how the third vortex might influence the evolution of the vortex pair. Many different choices of initial conditions for the pair and third vortex exist, so attention is restricted to a class of initial conditions in which the vortex pair initially moves in the general direction of vortex 3, and the distance from vortex 3 to the line of free propagation of the vortex pair is the 'offset' parameter δ. A series of calculations with 0≤δ≤4 reveals three types of intermediate-time vortex dynamics that are called merging, swapping and switching. The evolution of the vortex core separation and core vorticity level diagnostics are used to determine the points of transition from merging to swapping and switching. In the longer term, vortex merging, cancellation and straining reduces the three vortices to a single vortex. Other diagnostics of interest are also monitored, including the spatial distributions of the rate of viscous dissipation and terms contributing to the vorticity transport equation. During the merging phase for the case with δ=0, double-peak and double-trough structures are observed in the dissipation-rate contours. In addition, the diffusion of vorticity dominates the vortex-stretching effect near vortex 1 during its absorbtion by vortex 3. Finally, the dynamics of the three vortices are also examined by computing a co-rotating angular velocity and stream function. A series of peaks in the co-rotating angular velocity is found to be associated with the conservation of angular momentum and interactions with a 'ghost' vortex in the co-rotating stream function.

  9. The Electrostatic Instability for Realistic Pair Distributions in Blazar/EBL Cascades (United States)

    Vafin, S.; Rafighi, I.; Pohl, M.; Niemiec, J.


    This work revisits the electrostatic instability for blazar-induced pair beams propagating through the intergalactic medium (IGM) using linear analysis and PIC simulations. We study the impact of the realistic distribution function of pairs resulting from the interaction of high-energy gamma-rays with the extragalactic background light. We present analytical and numerical calculations of the linear growth rate of the instability for the arbitrary orientation of wave vectors. Our results explicitly demonstrate that the finite angular spread of the beam dramatically affects the growth rate of the waves, leading to the fastest growth for wave vectors quasi-parallel to the beam direction and a growth rate at oblique directions that is only a factor of 2–4 smaller compared to the maximum. To study the nonlinear beam relaxation, we performed PIC simulations that take into account a realistic wide-energy distribution of beam particles. The parameters of the simulated beam-plasma system provide an adequate physical picture that can be extrapolated to realistic blazar-induced pairs. In our simulations, the beam looses only 1% of its energy, and we analytically estimate that the beam would lose its total energy over about 100 simulation times. An analytical scaling is then used to extrapolate the parameters of realistic blazar-induced pair beams. We find that they can dissipate their energy slightly faster by the electrostatic instability than through inverse-Compton scattering. The uncertainties arising from, e.g., details of the primary gamma-ray spectrum are too large to make firm statements for individual blazars, and an analysis based on their specific properties is required.

  10. UPSILON'(10.01) resonance parameters

    International Nuclear Information System (INIS)

    Niczyporuk, B.; Zeludziewicz, T.; Chen, K.W.; Hartung, R.


    The resonance parameters of the UPSILON'(10.01) were measured using the LENA detector at the DORIS e + e - storage ring. We obtained a mass of M(UPSILON') = (10 013.6 +- 1.2 +- 10.0) MeV and an electronic width of GAMMAsub(ee)(UPSILON') = (0.53 +- 0.07sup(+0.09)sub(-0.05) keV. The upper limit set to the μ-pair branching ratio is 3.8% which implies a lower limit on the total UPSILON' widUPSILON parameters we obtain a mass difference M(UPSILON') - M(UPSILON) = (552.0 +- 1.3 +- 10.0) MeV and GAMMAsub(ee)UPSILON')/ = 0.43 +- 0.07sup(+0.05)sub(-0.00). (orig.)


    Indian Academy of Sciences (India)


  12. Reassessment of safeguards parameters

    Energy Technology Data Exchange (ETDEWEB)

    Hakkila, E.A.; Richter, J.L.; Mullen, M.F.


    The International Atomic Energy Agency is reassessing the timeliness and goal quantity parameters that are used in defining safeguards approaches. This study reviews technology developments since the parameters were established in the 1970s and concludes that there is no reason to relax goal quantity or conversion time for reactor-grade plutonium relative to weapons-grade plutonium. For low-enriched uranium, especially in countries with advanced enrichment capability there may be an incentive to shorten the detection time.

  13. Twin photon pairs in a high-Q silicon microresonator

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Steven; Lu, Xiyuan [Department of Physics and Astronomy, University of Rochester, Rochester, New York 14627 (United States); Jiang, Wei C. [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Lin, Qiang, E-mail: [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Department of Electrical and Computer Engineering, University of Rochester, Rochester, New York 14627 (United States)


    We report the generation of high-purity twin photon pairs through cavity-enhanced non-degenerate four-wave mixing (FWM) in a high-Q silicon microdisk resonator. Twin photon pairs are created within the same cavity mode and are consequently expected to be identical in all degrees of freedom. The device is able to produce twin photons at telecommunication wavelengths with a pair generation rate as large as (3.96 ± 0.03) × 10{sup 5} pairs/s, within a narrow bandwidth of 0.72 GHz. A coincidence-to-accidental ratio of 660 ± 62 was measured, the highest value reported to date for twin photon pairs, at a pair generation rate of (2.47 ± 0.04) × 10{sup 4} pairs/s. Through careful engineering of the dispersion matching window, we have reduced the ratio of photons resulting from degenerate FWM to non-degenerate FWM to less than 0.15.

  14. Parietal lesion effects on cued recall following pair associate learning. (United States)

    Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A


    We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Pairing gaps from nuclear mean-field models

    International Nuclear Information System (INIS)

    Bender, M.; Rutz, K.; Maruhn, J.A.


    We discuss the pairing gap, a measure for nuclear pairing correlations, in chains of spherical, semi-magic nuclei in the framework of self-consistent nuclear mean-field models. The equations for the conventional BCS model and the approximate projection-before-variation Lipkin-Nogami method are formulated in terms of local density functionals for the effective interaction. We calculate the Lipkin-Nogami corrections of both the mean-field energy and the pairing energy. Various definitions of the pairing gap are discussed as three-point, four-point and five-point mass-difference formulae, averaged matrix elements of the pairing potential, and single-quasiparticle energies. Experimental values for the pairing gap are compared with calculations employing both a delta pairing force and a density-dependent delta interaction in the BCS and Lipkin-Nogami model. Odd-mass nuclei are calculated in the spherical blocking approximation which neglects part of the the core polarization in the odd nucleus. We find that the five-point mass difference formula gives a very robust description of the odd-even staggering, other approximations for the gap may differ from that up to 30% for certain nuclei. (orig.)

  16. The coevolution of long-term pair bonds and cooperation. (United States)

    Song, Z; Feldman, M W


    The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

  17. High Level Rule Modeling Language for Airline Crew Pairing (United States)

    Mutlu, Erdal; Birbil, Ş. Ilker; Bülbül, Kerem; Yenigün, Hüsnü


    The crew pairing problem is an airline optimization problem where a set of least costly pairings (consecutive flights to be flown by a single crew) that covers every flight in a given flight network is sought. A pairing is defined by using a very complex set of feasibility rules imposed by international and national regulatory agencies, and also by the airline itself. The cost of a pairing is also defined by using complicated rules. When an optimization engine generates a sequence of flights from a given flight network, it has to check all these feasibility rules to ensure whether the sequence forms a valid pairing. Likewise, the engine needs to calculate the cost of the pairing by using certain rules. However, the rules used for checking the feasibility and calculating the costs are usually not static. Furthermore, the airline companies carry out what-if-type analyses through testing several alternate scenarios in each planning period. Therefore, embedding the implementation of feasibility checking and cost calculation rules into the source code of the optimization engine is not a practical approach. In this work, a high level language called ARUS is introduced for describing the feasibility and cost calculation rules. A compiler for ARUS is also implemented in this work to generate a dynamic link library to be used by crew pairing optimization engines.

  18. Safeguards systems parameters

    International Nuclear Information System (INIS)

    Avenhaus, R.; Heil, J.


    In this paper analyses are made of the values of those parameters that characterize the present safeguards system that is applied to a national fuel cycle; those values have to be fixed quantitatively so that all actions of the safeguards authority are specified precisely. The analysis starts by introducing three categories of quantities: The design parameters (number of MBAs, inventory frequency, variance of MUF, verification effort and false-alarm probability) describe those quantities whose values have to be specified before the safeguards system can be implemented. The performance criteria (probability of detection, expected detection time, goal quantity) measure the effectiveness of a safeguards system; and the standards (threshold amount and critical time) characterize the magnitude of the proliferation problem. The means by which the values of the individual design parameters can be determined with the help of the performance criteria; which qualitative arguments can narrow down the arbitrariness of the choice of values of the remaining parameters; and which parameter values have to be fixed more or less arbitrarily, are investigated. As a result of these considerations, which include the optimal allocation of a given inspection effort, the problem of analysing the structure of the safeguards system is reduced to an evaluation of the interplay of only a few parameters, essentially the quality of the measurement system (variance of MUF), verification effort, false-alarm probability, goal quantity and probability of detection

  19. Analysis of Food Pairing in Regional Cuisines of India.

    Directory of Open Access Journals (Sweden)

    Anupam Jain

    Full Text Available Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  20. Analysis of Food Pairing in Regional Cuisines of India. (United States)

    Jain, Anupam; N K, Rakhi; Bagler, Ganesh


    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  1. Analysis of Food Pairing in Regional Cuisines of India (United States)

    Bagler, Ganesh


    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food. PMID:26430895

  2. Preferred and avoided codon pairs in three domains of life

    Directory of Open Access Journals (Sweden)

    Tenson Tanel


    Full Text Available Abstract Background Alternative synonymous codons are not used with equal frequencies. In addition, the contexts of codons – neighboring nucleotides and neighboring codons – can have certain patterns. The codon context can influence both translational accuracy and elongation rates. However, it is not known how strong or conserved the codon context preferences in different organisms are. We analyzed 138 organisms (bacteria, archaea and eukaryotes to find conserved patterns of codon pairs. Results After removing the effects of single codon usage and dipeptide biases we discovered a set of neighboring codons for which avoidances or preferences were conserved in all three domains of life. Such biased codon pairs could be divided into subtypes on the basis of the nucleotide patterns that influence the bias. The most frequently avoided type of codon pair was nnUAnn. We discovered that 95.7% of avoided nnUAnn type patterns contain out-frame UAA or UAG triplets on the sense and/or antisense strand. On average, nnUAnn codon pairs are more frequently avoided in ORFeomes than in genomes. Thus we assume that translational selection plays a major role in the avoidance of these codon pairs. Among the preferred codon pairs, nnGCnn was the major type. Conclusion Translational selection shapes codon pair usage in protein coding sequences by rules that are common to all three domains of life. The most frequently avoided codon pairs contain the patterns nnUAnn, nnGGnn, nnGnnC, nnCGCn, GUCCnn, CUCCnn, nnCnnA or UUCGnn. The most frequently preferred codon pairs contain the patterns nnGCnn, nnCAnn or nnUnCn.

  3. A nucleon-pair and boson coexistent description of nuclei (United States)

    Dai, Lianrong; Pan, Feng; Draayer, J. P.


    We study a mixture of s-bosons and like-nucleon pairs with the standard pairing interaction outside an inert core. Competition between the nucleon-pairs and s-bosons is investigated in this scenario. The robustness of the BCS-BEC coexistence and crossover phenomena are examined through an analysis of pf-shell nuclei with realistic single-particle energies, in which two configurations with Pauli blocking of nucleon-pair orbits due to the formation of the s-bosons is taken into account. When the nucleon-pair orbits are considered to be independent of the s-bosons, the BCS-BEC crossover becomes smooth, with the number of the s-bosons noticeably more than that of the nucleon-pairs near the half-shell point, a feature that is demonstrated in the pf-shell for several values of the standard pairing interaction strength. As a further test of the robustness of the BCS-BEC coexistence and crossover phenomena in nuclei, results are given for values of even-even 102-130Sn with 100Sn taken as a core and valence neutron pairs confined within the 1d 5/2, 0g 7/2, 1d 3/2, 2s 1/2, 1h 11/2 orbits in the nucleon-pair orbit and the s-boson independent approximation. The results indicate that the B(E2) values are reproduced well. Supported by National Natural Science Foundation of China (11375080, 11675071), the U.S. National Science Foundation (OCI-0904874 and ACI-1516338), U. S. Department of Energy (DE-SC0005248), the Southeastern Universities Research Association, the China-U. S. Theory Institute for Physics with Exotic Nuclei (CUSTIPEN) (DE-SC0009971), and the LSU-LNNU joint research program (9961) is acknowledged

  4. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  5. Using pairs of physiological models to estimate temporal variation in amphibian body temperature. (United States)

    Roznik, Elizabeth A; Alford, Ross A


    Physical models are often used to estimate ectotherm body temperatures, but designing accurate models for amphibians is difficult because they can vary in cutaneous resistance to evaporative water loss. To account for this variability, a recently published technique requires a pair of agar models that mimic amphibians with 0% and 100% resistance to evaporative water loss; the temperatures of these models define the lower and upper boundaries of possible amphibian body temperatures for the location in which they are placed. The goal of our study was to develop a method for using these pairs of models to estimate parameters describing the distributions of body temperatures of frogs under field conditions. We radiotracked green-eyed treefrogs (Litoria serrata) and collected semi-continuous thermal data using both temperature-sensitive radiotransmitters with an automated datalogging receiver, and pairs of agar models placed in frog locations, and we collected discrete thermal data using a non-contact infrared thermometer when frogs were located. We first examined the accuracy of temperature-sensitive transmitters in estimating frog body temperatures by comparing transmitter data with direct temperature measurements taken simultaneously for the same individuals. We then compared parameters (mean, minimum, maximum, standard deviation) characterizing the distributions of temperatures of individual frogs estimated from data collected using each of the three methods. We found strong relationships between thermal parameters estimated from data collected using automated radiotelemetry and both types of thermal models. These relationships were stronger for data collected using automated radiotelemetry and impermeable thermal models, suggesting that in the field, L. serrata has a relatively high resistance to evaporative water loss. Our results demonstrate that placing pairs of thermal models in frog locations can provide accurate estimates of the distributions of temperatures

  6. Hybrid TLC-pair meter for the Sphinx Project (United States)

    Wada, T.; Yamamoto, I.; Takahashi, N.; Misaki, A.


    The chief aims in THE SPHINX PROJECT are research of super lepton physics and new detector experiments. At the second phase of THE SPHINX PROJECT, a hybrid TLC-PAIR METER was designed for measuring high energy neutrino sources (E upsilon * TeV), searching high energy muon sources (E mu TeV) and measuring muon group (E mu 1 TeV). The principle of PAIR METER has been already proposed. In this TLC-PAIR METER, electromagnetic shower induced by cosmic ray muons are detected using TL (Thermoluminescence) sheets with position counters.

  7. Hybrid TLC-pair meter for the Sphinx Project

    International Nuclear Information System (INIS)

    Wada, T.; Yamamoto, I.; Takahashi, N.; Misaki, A.


    The chief aims in the Sphinx Project are research on super lepton physics and new detector experiments. In the second phase of the Sphinx Project, a hybrid TLC-pair meter was designed for measuring for high energy neutrino sources (E upsilon * TeV), searching high energy muon sources (E mu TeV), and measuring muon groups (E mu 1 TeV). The principle of the pair meter has been already proposed. In this TLC pair meter, electromagnetic showers induced by cosmic ray muons are detected using thermoluminescene sheets with position counters

  8. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.


    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  9. ΛΛ pairing in NΛ composite matter

    International Nuclear Information System (INIS)

    Tanigawa, Tomonori; Matsuzaki, Masayuki; Chiba, Satoshi


    ΛΛ pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. Λ hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological ΛΛ interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the ΛΛ pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  10. ΛΛ pairing in NΛ composite matter

    International Nuclear Information System (INIS)

    Tanigawa, Tomonori; Matsuzaki, Masayuki; Chiba, Satoshi


    ΛΛ pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. Λ hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological ΛΛ interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the ΛΛ pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  11. Pair production by a constant external field in noncommutative QED

    International Nuclear Information System (INIS)

    Chair, N.; Sheikh-Jabbari, M.M.


    In this paper we study QED on the noncommutative space in the constant electro-magnetic field background. Using the explicit solutions of the noncommutative version of Dirac equation in such background, we show that there are well-defined in and out-going asymptotic states and also there is a causal Green's function. We calculate the pair production rate in this case. We show that at tree level noncommutativity will not change the pair production and the threshold electric field. We also calculate the pair production rate considering the first loop corrections. In this case we show that the threshold electric field is decreased by the noncommutativity effects. (author)

  12. {lambda}{lambda} pairing in N{lambda} composite matter

    Energy Technology Data Exchange (ETDEWEB)

    Tanigawa, Tomonori [Japan Society for the Promotion of Science, Tokyo (Japan); Matsuzaki, Masayuki [Japan Atomic Energy Research Inst., Tokyo (Japan); Chiba, Satoshi [Fukuoka Univ. of Education, Dept. of Physics, Munakata, Fukuoka (Japan)


    {lambda}{lambda} pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. {lambda} hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological {lambda}{lambda} interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the {lambda}{lambda} pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  13. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier


    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  14. Alpha-transfer reactions and the pairing-vibration model

    International Nuclear Information System (INIS)

    Betts, R.R.


    The pairing-vibration model with isospin is extended to include α-transfer reactions. Selection rules and expressions for transition strengths are derived and compared with experimental results for A = 40--66 nuclei. The selection rules are found to be followed quite well in the examples studied. The systematics of ground-state transition strengths are qualitatively quite well reproduced although the quantitative agreement is poor. When the changing nature of the pairing quanta is incorporated using two-particle transfer data the agreement becomes quantitatively good. Evidence is presented for clustering other than that due to pairing in 40 Ca and 44 Ti

  15. QED peripheral mechanism of pair production at colliders

    International Nuclear Information System (INIS)

    Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.


    Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.

  16. Competing order parameters in Fermi systems with engineered band dispersion (United States)

    Wu, Chien-Te; Boyack, Rufus; Anderson, Brandon; Levin, K.

    We explore a variety of competing phases in 2D and 3D Fermi gases in the presence of novel dispersion relations resulting from a shaken optical lattice. We incorporate spin imbalance along with attractive interactions. In 3D, at the mean field level we present phase diagrams reflecting the stability of alternative order parameters in the pairing (including LOFF) and charge density wave channels. We perform analogous studies in 2D, where we focus on the competition between different paired phases. Important in this regard is that our 2D studies are consistent with the Mermin Wagner theorem, so that, while there is competition, conventional superfluidity cannot occur

  17. Study of the pair-interaction function in some normal metals; Etude de l'interaction de paire dans quelques metaux normaux

    Energy Technology Data Exchange (ETDEWEB)

    Pick, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires


    The pair interaction function has been derived for the following metals: Li, Na, K, Al. It is obtained via a second order perturbation expansion of the wave functions of the conduction electrons using a self-consistent pseudo-potential. Exchange and correlations between those electrons have been ignored. Such an interaction is only valid at constant volume and depends on a single experimental parameter, namely the ionic volume. Its main features are a pronounced minimum in the vicinity of the nearest neighbours, especially marked in alkaline metals, and an asymptotic decrease of the form cos(2k{sub F}r)/r{sup 3}. This interaction gives the correct crystalline structure of these metals at 0 K as well as a good approximation of the phonon spectrum of an alkaline. The validity of the perturbation technique is discussed. We prove that the pair interaction function is correctly given to second order in the pseudo-potential despite the various approximations and errors involved by such a method. (author) [French] L'interaction de paire effective entre ions a ete calculee dans les metaux Li, Na, K et Al. Elle est obtenue par un developpement en serie de perturbation des fonctions d'onde des electrons de conduction. Le developpement est pousse au deuxieme ordre et utilise un pseudo-potentiel self-consistant. Les phenomenes d'echange et de correlations entre ces electrons ont ete negliges. L'interaction calculee n'a de sens qu'a volume constant. Elle depend d'un seul parametre experimental, le volume ionique. Elle se caracterise par un minimum prononce de l'energie de paire pour les proches voisins, surtout marque chez les alcalins. Elle decroit asymptotiquement en cos(2k{sub F}r)/r{sup 3}. Elle permet de predire la structure cristalline la plus stable a 0 K; elle donne le spectre de phonons des alcalins avec une assez bonne precision. Par ailleurs, la validite de la methode de perturbation du deuxieme ordre est discutee. On montre qu'elle donne correctement l

  18. Using Single Colors and Color Pairs to Communicate Basic Tastes

    Directory of Open Access Journals (Sweden)

    Andy T. Woods


    Full Text Available Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty with specific colors (e.g., red, green, black, and white. In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  19. Using Single Colors and Color Pairs to Communicate Basic Tastes. (United States)

    Woods, Andy T; Spence, Charles


    Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty) with specific colors (e.g., red, green, black, and white). In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word) would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  20. Observation of muon-electron pairs in neutrino reactions

    International Nuclear Information System (INIS)

    Hoffmann, D.


    The present thesis describes the observation of muon-electron pairs in neutrino reactions. This experiment was performed using an optical multiplate spark chamber in the broad band neutrino beam of the CERN proton synchrotron. (orig.) [de

  1. Complexation of Nitrous Oxide by Frustrated Lewis Pairs

    NARCIS (Netherlands)

    Otten, Edwin; Neu, Rebecca C.; Stephan, Douglas W.


    Frustrated Lewis pairs comprised of a basic yet sterically encumbered phosphine with boron Lewis acids bind nitrous oxide to give intact PNNOB linkages. The synthesis, structure, and bonding of these species are described.

  2. Crystal structure and pair potentials: A molecular-dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Parrinello, M.; Rahman, A.


    With use of a Lagrangian which allows for the variation of the shape and size of the periodically repeating molecular-dynamics cell, it is shown that different pair potentials lead to different crystal structures.

  3. Model of pair aggregation on the Bethe lattice

    DEFF Research Database (Denmark)

    Baillet, M.V.-P.; Pacheco, A.F.; Gómez, J.B.


    We extend a recent model of aggregation of pairs of particles, analyzing the case in which the supporting framework is a Bethe lattice. The model exhibits a critical behavior of the percolation theory type....

  4. The pairing theory - its physical basis and its consequences

    International Nuclear Information System (INIS)

    Schrieffer, J.R.


    The key developments which set the scene for the microscopic theory of superconductivity are discussed and the physical reasoning which lead to the pairing theory is presented. Consequences of the BCS theory are reviewed. (orig.)

  5. Sensitivity of Electron Transfer Mediated Decay to Ion Pairing. (United States)

    Pohl, Marvin N; Richter, Clemens; Lugovoy, Evgeny; Seidel, Robert; Slavíček, Petr; Aziz, Emad F; Abel, Bernd; Winter, Bernd; Hergenhahn, Uwe


    Ion pairing in electrolyte solutions remains a topic of discussion despite a long history of research. Very recently, nearest-neighbor mediated electronic de-excitation processes of core hole vacancies (electron transfer mediated decay, ETMD) were proposed to carry a spectral fingerprint of local solvation structure and in particular of contact ion pairs. Here, for the first time, we apply electron-electron coincidence detection to a liquid microjet, and record ETMD spectra of Li 1s vacancies in aqueous solutions of lithium chloride (LiCl) in direct comparison to lithium acetate (LiOAc). A change in the ETMD spectrum dependent on the electrolyte anion identity is observed for 4.5 M salt concentration. We discuss these findings within the framework of the formation and presence of contact ion pairs and the unique sensitivity of ETMD spectroscopy to ion pairing.

  6. Programmable trigger for electron pairs in ring image Cherenkov counters

    International Nuclear Information System (INIS)

    Glab, J.; Baur, R.; Manner, R.


    This paper describes a programmable trigger processor for the recognition of Cherenkov rings in a RICH counter. It identifies open electron pairs and suppresses close conversion and Dalitz pairs within 20 μs. More generally, the system can be used for correlating pixel images with pattern masks in order to locate all relatively well defined patterns of a certain type. The trigger processor consists of a systolic processor array of 160 x 176, i.e., 28,160 identical processing elements (PEs) that filter out open electron pairs, and a pseudo adder array that determines whether there was at least one such pair. The processor array is assembled of 20 x 22 VLSI chips containing 8 x 8 PEs each. The semi-custom chip has been developed in 2 μ CMOS standard cell technology

  7. Butterflyfishes as a System for Investigating Pair Bonding

    KAUST Repository

    Nowicki, Jessica; O'Connell, Lauren; Cowman, Peter F; Walker, Stefan; Coker, Darren James; Pratchett, Morgan


    from the late Miocene to recent. In six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping, we then verified social systems at Lizard Island, Australia. In situ

  8. Nuclear pairing reduction due to rotation and blocking

    International Nuclear Information System (INIS)

    Wu, X.; Zhang, Z. H.; Zeng, J. Y.; Lei, Y. A.


    Nuclear pairing gaps of normally deformed and superdeformed nuclei are investigated using the particle-number-conserving (PNC) formalism for the cranked shell model, in which the blocking effects are treated exactly. Both rotational frequency ω dependence and seniority (number of unpaired particles) ν dependence of the pairing gap Δ-tilde are investigated. For the ground-state bands of even-even nuclei, PNC calculations show that, in general, Δ-tilde decreases with increasing ω, but the ω dependence is much weaker than that calculated by the number-projected Hartree-Fock-Bogolyubov approach. For the multiquasiparticle bands (seniority ν>2), the pairing gaps stay almost ω independent. As a function of the seniority ν, the bandhead pairing gaps Δ-tilde(ν,ω=0) decrease slowly with increasing ν. Even for the highest seniority ν bands identified so far, Δ-tilde(ν,ω=0) remains greater than 70% of Δ-tilde(ν=0,ω=0).

  9. Pair distribution function and structure factor of spherical particles

    International Nuclear Information System (INIS)

    Howell, Rafael C.; Proffen, Thomas; Conradson, Steven D.


    The availability of neutron spallation-source instruments that provide total scattering powder diffraction has led to an increased application of real-space structure analysis using the pair distribution function. Currently, the analytical treatment of finite size effects within pair distribution refinement procedures is limited. To that end, an envelope function is derived which transforms the pair distribution function of an infinite solid into that of a spherical particle with the same crystal structure. Distributions of particle sizes are then considered, and the associated envelope function is used to predict the particle size distribution of an experimental sample of gold nanoparticles from its pair distribution function alone. Finally, complementing the wealth of existing diffraction analysis, the peak broadening for the structure factor of spherical particles, expressed as a convolution derived from the envelope functions, is calculated exactly for all particle size distributions considered, and peak maxima, offsets, and asymmetries are discussed

  10. Hot accretion disks with electron-positron pairs

    International Nuclear Information System (INIS)

    White, T.R.; Lightman, A.P.


    The hot thermal accretion disks of the 1970s are studied and consideration is given to the effects of electron-positron pairs, which were originally neglected. It is found that disks cooled by internally produced photons have a critical accretion rate above which equilibrium is not possible in a radial annulus centered around r = 10 GM/c-squared, where M is the mass of the central object. This confirms and extends previous work by Kusunose and Takahara. Above the critical rate, pairs are created more rapidly than they can be destroyed. Below the critical rate, there are two solutions to the disk structure, one with a high pair density and one with a low pair density. Depending on the strength of the viscosity, the critical accretion rate corresponds to a critical luminosity of about 3-10 percent of the Eddington limit. 32 refs

  11. Electron Waiting Times of a Cooper Pair Splitter (United States)

    Walldorf, Nicklas; Padurariu, Ciprian; Jauho, Antti-Pekka; Flindt, Christian


    Electron waiting times are an important concept in the analysis of quantum transport in nanoscale conductors. Here we show that the statistics of electron waiting times can be used to characterize Cooper pair splitters that create spatially separated spin-entangled electrons. A short waiting time between electrons tunneling into different leads is associated with the fast emission of a split Cooper pair, while long waiting times are governed by the slow injection of Cooper pairs from a superconductor. Experimentally, the waiting time distributions can be measured using real-time single-electron detectors in the regime of slow tunneling, where conventional current measurements are demanding. Our work is important for understanding the fundamental transport processes in Cooper pair splitters and the predictions may be verified using current technology.

  12. Electron Waiting Times of a Cooper Pair Splitter

    DEFF Research Database (Denmark)

    Walldorf, Nicklas; Padurariu, Ciprian; Jauho, Antti-Pekka


    Electron waiting times are an important concept in the analysis of quantum transport in nanoscale conductors. Here we show that the statistics of electron waiting times can be used to characterize Cooper pair splitters that create spatially separated spin-entangled electrons. A short waiting time...... between electrons tunneling into different leads is associated with the fast emission of a split Cooper pair, while long waiting times are governed by the slow injection of Cooper pairs from a superconductor. Experimentally, the waiting time distributions can be measured using real-time single......-electron detectors in the regime of slow tunneling, where conventional current measurements are demanding. Our work is important for understanding the fundamental transport processes in Cooper pair splitters and the predictions may be verified using current technology....

  13. Pairs Trading to the Commodities Futures Market Using Cointegration Method

    Directory of Open Access Journals (Sweden)

    Cüneyt Ungever


    Full Text Available This paper investigates pairs trading strategy by using the cointegration method among the 10 most popular agricultural future markets. It is found that only in 2 pairs shows trading signal. The pairs trading strategy is performed in two stages that are the formation period and the trading period with daily futures data from 2004 to 2015. After the formation period was constructed, it is assumed that the cointegration error continues to hold the trading period same as it does for the formation period. The pairs trading strategy is created by the long position cotton and the short position coffee and also long position cotton and short position the livecattle. It is found that the profitability of this strategy worked well in both formation period and trading period.

  14. Discontinuous Galerkin time-domain analysis of power/ground plate pairs with wave port excitation

    KAUST Repository

    Li, Ping; Jiang, Li Jun; Bagci, Hakan


    In this work, a discontinuous Galerkin time-domain method is developed to analyze the power/ground plate pairs taking into account arbitrarily shaped antipads. To implement proper source excitations over the antipads, the magnetic surface current expanded by the electric eigen-modes supported by the corresponding antipad is employed as the excitation. For irregularly shaped antipads, the eigen-modes are obtained by numerical approach. Accordingly, the methodology for the S-parameter extraction is derived based on the orthogonal properties of the different modes. Based on the approach, the transformation between different modes can be readily evaluated.

  15. Anomalous maximum and minimum for the dissociation of a geminate pair in energetically disordered media (United States)

    Govatski, J. A.; da Luz, M. G. E.; Koehler, M.


    We study the geminated pair dissociation probability φ as function of applied electric field and temperature in energetically disordered nD media. Regardless nD, for certain parameters regions φ versus the disorder degree (σ) displays anomalous minimum (maximum) at low (moderate) fields. This behavior is compatible with a transport energy which reaches a maximum and then decreases to negative values as σ increases. Our results explain the temperature dependence of the persistent photoconductivity in C60 single crystals going through order-disorder transitions. They also indicate how an energetic disorder spatial variation may contribute to higher exciton dissociation in multicomponent donor/acceptor systems.

  16. Nonperturbative electromagnetic muon-pair production with capture in peripheral relativistic heavy-ion collisions

    International Nuclear Information System (INIS)

    Wells, J.C.


    We discuss preliminary calculations of impact-parameter-dependent probabilities and cross sections for muon-pair production with capture of the negative muon into the K-shell of the target caused by the time-dependent electromagnetic fields generated in peripheral relativistic heavy-ion collisions. Our approach is nonperturbative in that we calculate probabilities by solving the time-dependent Dirac equation on a three-dimensional Cartesian lattice using the basis-spline collocation method. Use of the axial gauge for the electromagnetic potentials produces an interaction easier to implement on the lattice than the Lorentz gauge. 19 refs., 5 figs

  17. Nonlinear optical effects and third-harmonic generation in superconductors: Cooper pairs versus Higgs mode contribution (United States)

    Cea, T.; Castellani, C.; Benfatto, L.


    The recent observation of a transmitted THz pulse oscillating at three times the frequency of the incident light paves the way to a powerful protocol to access resonant excitations in a superconductor. Here we show that this nonlinear optical process is dominated by light-induced excitation of Cooper pairs, while the collective amplitude (Higgs) fluctuations of the superconducting order parameter give in general a negligible contribution. We also predict a nontrivial dependence of the signal on the direction of the light polarization with respect to the lattice symmetry, which can be tested in systems such as, e.g., cuprate superconductors.

  18. Susy-QCD corrections to neutrlino pair production in association with a jet

    Energy Technology Data Exchange (ETDEWEB)

    Cullen, Gavin [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Greiner, Nicolas; Heinrich, Gudrun [Max-Planck-Institut fuer Physik, Muenchen (Germany)


    We present the NLO Susy-QCD corrections to the production of a pair of the lightest neutralinos plus one jet at the LHC, appearing as a monojet signature in combination with missing energy. We fully include all non-resonant diagrams, i.e. we do not assume that production and decay factorise. We derive a parameter point based on the p19MSSM which is compatible with current experimental bounds and show distributions based on missing transverse energy and jet observables. Our results are produced with the program GoSam for automated one-loop calculations in combination with MadDipole/- MadGraph for the real radiation part.

  19. Discontinuous Galerkin time-domain analysis of power/ground plate pairs with wave port excitation

    KAUST Repository

    Li, Ping


    In this work, a discontinuous Galerkin time-domain method is developed to analyze the power/ground plate pairs taking into account arbitrarily shaped antipads. To implement proper source excitations over the antipads, the magnetic surface current expanded by the electric eigen-modes supported by the corresponding antipad is employed as the excitation. For irregularly shaped antipads, the eigen-modes are obtained by numerical approach. Accordingly, the methodology for the S-parameter extraction is derived based on the orthogonal properties of the different modes. Based on the approach, the transformation between different modes can be readily evaluated.

  20. Equation of state for electron gas in the presence of electron-positron pairs

    Energy Technology Data Exchange (ETDEWEB)

    Sugimoto, D; Nomoto, K [Tokyo Univ. (Japan). Coll. of General Education


    Fermi-Dirac integrals for partially relativistic, partially degenerate, electron gas are tabulated, especially for the region of electron-positron pair-creation in equilibrium with radiation field. Electrons are treated to be non-interacting particles. Independent entries for the table are non-dimensional temperature and a degeneracy parameter which is related directly with matter density. Thermodynamical quantities and their partial derivatives with respect to density and temperature are also given in table, which are intended for use in computing stellar evolution by means of a Henyey-type technique. This table is a supplement to one published earlier, in which only electrons were taken into account explicitly.