Characterization of paralogous protein families in rice
Directory of Open Access Journals (Sweden)
Zhu Wei
2008-02-01
Full Text Available Abstract Background High gene numbers in plant genomes reflect polyploidy and major gene duplication events. Oryza sativa, cultivated rice, is a diploid monocotyledonous species with a ~390 Mb genome that has undergone segmental duplication of a substantial portion of its genome. This, coupled with other genetic events such as tandem duplications, has resulted in a substantial number of its genes, and resulting proteins, occurring in paralogous families. Results Using a computational pipeline that utilizes Pfam and novel protein domains, we characterized paralogous families in rice and compared these with paralogous families in the model dicotyledonous diploid species, Arabidopsis thaliana. Arabidopsis, which has undergone genome duplication as well, has a substantially smaller genome (~120 Mb and gene complement compared to rice. Overall, 53% and 68% of the non-transposable element-related rice and Arabidopsis proteins could be classified into paralogous protein families, respectively. Singleton and paralogous family genes differed substantially in their likelihood of encoding a protein of known or putative function; 26% and 66% of singleton genes compared to 73% and 96% of the paralogous family genes encode a known or putative protein in rice and Arabidopsis, respectively. Furthermore, a major skew in the distribution of specific gene function was observed; a total of 17 Gene Ontology categories in both rice and Arabidopsis were statistically significant in their differential distribution between paralogous family and singleton proteins. In contrast to mammalian organisms, we found that duplicated genes in rice and Arabidopsis tend to have more alternative splice forms. Using data from Massively Parallel Signature Sequencing, we show that a significant portion of the duplicated genes in rice show divergent expression although a correlation between sequence divergence and correlation of expression could be seen in very young genes. Conclusion
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Paralogous Genes as a Tool to Study the Regulation of Gene Expression
DEFF Research Database (Denmark)
Hoffmann, Robert D
The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...
Investigating the effect of paralogs on microarray gene-set analysis
LENUS (Irish Health Repository)
Faure, Andre J
2011-01-24
Abstract Background In order to interpret the results obtained from a microarray experiment, researchers often shift focus from analysis of individual differentially expressed genes to analyses of sets of genes. These gene-set analysis (GSA) methods use previously accumulated biological knowledge to group genes into sets and then aim to rank these gene sets in a way that reflects their relative importance in the experimental situation in question. We suspect that the presence of paralogs affects the ability of GSA methods to accurately identify the most important sets of genes for subsequent research. Results We show that paralogs, which typically have high sequence identity and similar molecular functions, also exhibit high correlation in their expression patterns. We investigate this correlation as a potential confounding factor common to current GSA methods using Indygene http:\\/\\/www.cbio.uct.ac.za\\/indygene, a web tool that reduces a supplied list of genes so that it includes no pairwise paralogy relationships above a specified sequence similarity threshold. We use the tool to reanalyse previously published microarray datasets and determine the potential utility of accounting for the presence of paralogs. Conclusions The Indygene tool efficiently removes paralogy relationships from a given dataset and we found that such a reduction, performed prior to GSA, has the ability to generate significantly different results that often represent novel and plausible biological hypotheses. This was demonstrated for three different GSA approaches when applied to the reanalysis of previously published microarray datasets and suggests that the redundancy and non-independence of paralogs is an important consideration when dealing with GSA methodologies.
Orthology and paralogy constraints: satisfiability and consistency
Lafond, Manuel; El-Mabrouk, Nadia
2014-01-01
Background A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family G . But is a given set C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for G ? While previous studies have focused on full sets of constraints, here we consider the general case where C does not necessarily involve a ...
Hoffmann, Robert D; Palmgren, Michael
2016-06-13
Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.
Gene conversion homogenizes the CMT1A paralogous repeats
Directory of Open Access Journals (Sweden)
Hurles Matthew E
2001-12-01
Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.
Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun
2015-01-01
Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Feng-Xia Tian
Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin
2017-12-06
Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these
Orthology and paralogy constraints: satisfiability and consistency.
Lafond, Manuel; El-Mabrouk, Nadia
2014-01-01
A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family G. But is a given set C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for G? While previous studies have focused on full sets of constraints, here we consider the general case where C does not necessarily involve a constraint for each pair of genes. The problem is subdivided in two parts: (1) Is C satisfiable, i.e. can we find an event-labeled gene tree G inducing C? (2) Is there such a G which is consistent, i.e., such that all displayed triplet phylogenies are included in a species tree? Previous results on the Graph sandwich problem can be used to answer to (1), and we provide polynomial-time algorithms for satisfiability and consistency with a given species tree. We also describe a new polynomial-time algorithm for the case of consistency with an unknown species tree and full knowledge of pairwise orthology/paralogy relationships, as well as a branch-and-bound algorithm in the case when unknown relations are present. We show that our algorithms can be used in combination with ProteinOrtho, a sequence similarity-based orthology detection tool, to extract a set of robust orthology/paralogy relationships.
The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain
Directory of Open Access Journals (Sweden)
Nadia Bayou
2008-01-01
We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.
Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie
2016-11-01
After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
Directory of Open Access Journals (Sweden)
Bee Katharine J
2008-04-01
Full Text Available Abstract Background Brd2 belongs to the bromodomain-extraterminal domain (BET family of transcriptional co-regulators, and functions as a pivotal histone-directed recruitment scaffold in chromatin modification complexes affecting signal-dependent transcription. Brd2 facilitates expression of genes promoting proliferation and is implicated in apoptosis and in egg maturation and meiotic competence in mammals; it is also a susceptibility gene for juvenile myoclonic epilepsy (JME in humans. The brd2 ortholog in Drosophila is a maternal effect, embryonic lethal gene that regulates several homeotic loci, including Ultrabithorax. Despite its importance, there are few systematic studies of Brd2 developmental expression in any organism. To help elucidate both conserved and novel gene functions, we cloned and characterized expression of brd2 cDNAs in zebrafish, a vertebrate system useful for genetic analysis of development and disease, and for study of the evolution of gene families and functional diversity in chordates. Results We identify cDNAs representing two paralogous brd2 loci in zebrafish, brd2a on chromosome 19 and brd2b on chromosome 16. By sequence similarity, syntenic and phylogenetic analyses, we present evidence for structural divergence of brd2 after gene duplication in fishes. brd2 paralogs show potential for modular domain combinations, and exhibit distinct RNA expression patterns throughout development. RNA in situ hybridizations in oocytes and embryos implicate brd2a and brd2b as maternal effect genes involved in egg polarity and egg to embryo transition, and as zygotic genes important for development of the vertebrate nervous system and for morphogenesis and differentiation of the digestive tract. Patterns of brd2 developmental expression in zebrafish are consistent with its proposed role in Homeobox gene regulation. Conclusion Expression profiles of zebrafish brd2 paralogs support a role in vertebrate developmental patterning and
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.
Goodstadt, Leo; Ponting, Chris P
2006-09-29
Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46%) of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a fast and robust
Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.
Directory of Open Access Journals (Sweden)
Leo Goodstadt
2006-09-01
Full Text Available Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46% of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a
Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M
2014-01-01
The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.
DEFF Research Database (Denmark)
Jiang, Lu; Ingvardsen, Christina Rønn; Lübberstedt, Thomas
2008-01-01
the isolation and characterization of the Pic19R gene family members from the inbred line FAP1360A, which shows complete resistance to SCMV. Two primer pairs were designed based on the conserved regions among the known Pic19 paralogs and used for rapid amplification of cDNA ends of FAP1360A. Six full-length c...... of the Pic19R family indicated that the Pic19R-1 paralog is identical to the known Rxo1 gene conferring resistance to rice bacterial streak disease and none of the other Pic19R paralogs seems to be involved in resistance to SCMV...
Preston, Jill C.; Kellogg, Elizabeth A.
2006-01-01
Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
The impact of paralogy on phylogenomic studies - a case study on annelid relationships.
Directory of Open Access Journals (Sweden)
Torsten H Struck
Full Text Available Phylogenomic studies based on hundreds of genes derived from expressed sequence tags libraries are increasingly used to reveal the phylogeny of taxa. A prerequisite for these studies is the assignment of genes into clusters of orthologous sequences. Sophisticated methods of orthology prediction are used in such analyses, but it is rarely assessed whether paralogous sequences have been erroneously grouped together as orthologous sequences after the prediction, and whether this had an impact on the phylogenetic reconstruction using a super-matrix approach. Herein, I tested the impact of paralogous sequences on the reconstruction of annelid relationships based on phylogenomic datasets. Using single-partition analyses, screening for bootstrap support, blast searches and pruning of sequences in the supermatrix, wrongly assigned paralogous sequences were found in eight partitions and the placement of five taxa (the annelids Owenia, Scoloplos, Sthenelais and Eurythoe and the nemertean Cerebratulus including the robust bootstrap support could be attributed to the presence of paralogous sequences in two partitions. Excluding these sequences resulted in a different, weaker supported placement for these taxa. Moreover, the analyses revealed that paralogous sequences impacted the reconstruction when only a single taxon represented a previously supported higher taxon such as a polychaete family. One possibility of a priori detection of wrongly assigned paralogous sequences could combine 1 a screening of single-partition analyses based on criteria such as nodal support or internal branch length with 2 blast searches of suspicious cases as presented herein. Also possible are a posteriori approaches in which support for specific clades is investigated by comparing alternative hypotheses based on differences in per-site likelihoods. Increasing the sizes of EST libraries will also decrease the likelihood of wrongly assigned paralogous sequences, and in the case
Identifying pathogenicity of human variants via paralog-based yeast complementation.
Directory of Open Access Journals (Sweden)
Fan Yang
2017-05-01
Full Text Available To better understand the health implications of personal genomes, we now face a largely unmet challenge to identify functional variants within disease-associated genes. Functional variants can be identified by trans-species complementation, e.g., by failure to rescue a yeast strain bearing a mutation in an orthologous human gene. Although orthologous complementation assays are powerful predictors of pathogenic variation, they are available for only a few percent of human disease genes. Here we systematically examine the question of whether complementation assays based on paralogy relationships can expand the number of human disease genes with functional variant detection assays. We tested over 1,000 paralogous human-yeast gene pairs for complementation, yielding 34 complementation relationships, of which 33 (97% were novel. We found that paralog-based assays identified disease variants with success on par with that of orthology-based assays. Combining all homology-based assay results, we found that complementation can often identify pathogenic variants outside the homologous sequence region, presumably because of global effects on protein folding or stability. Within our search space, paralogy-based complementation more than doubled the number of human disease genes with a yeast-based complementation assay for disease variation.
Dos Santos, Helena G; Siltberg-Liberles, Jessica
2016-09-19
One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Joana Pereira
Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.
Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho
2014-01-01
The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.
Directory of Open Access Journals (Sweden)
Mara Sangiovanni
2013-12-01
Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.
Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali
2010-07-01
Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.
Gu, Xun; Wang, Yufeng; Gu, Jianying
2002-06-01
The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Directory of Open Access Journals (Sweden)
Xin Yin
2017-07-01
Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.
Tang, Ke-Yi; Wang, Xin; Wan, Qiu-Hong; Fang, Sheng-Guo
2018-04-01
The β-defensin, one of the antimicrobial peptides (AMPs), is a significant component of the innate immune with a broad range of antimicrobial activities. Differing from the widely-studied mammals and birds, limited information about β-defensins has been reported in reptiles, especially in crocodilians. As a same ancient species as dinosaurs and the most endangered species of 23 crocodilians, the survival of Chinese alligator (Alligator sinensis) means a powerful immune system and possible involvement of AMPs in its immune resistance. In this study, we identified 20 novel Alligator sinensisβ-defensin genes (AsBDs) from a 390 kb region using bioinformatic and experimental approaches, and successfully distinguished six orthologous AsBDs to birds and nine paralogous AsBDs undergoing gene duplication events. The amino acid alignment shows that the AsBD paralogs, like α-defensins, encode a significantly longer pro-piece comparing with the orthologs. The calculation of non-synonymous (d N ) and synonymous (d S ) substitutions in the mature peptide reveals that the AsBD paralogs experience a significantly higher selective pressure (d N /d S ) than the orthologs, but a similar evolutionary force to α-defensins. The gene expression result indicates that the AsBD paralogs have a significantly higher expression level than the orthologos in gastrointestinal tract where the host is vulnerable to enteric pathogenic bacteria, as observed in α-defensins. These three pieces of evidence demonstrate that the AsBD paralogs do play an important role in maintaining long-term survival of this endangered reptile. Thus, this survey of AsBDs on the genomic structure, evolutionary characteristics, and expression pattern provides a genetic and immunological foundation for further investigating their antimicrobial function and alternative antibiotics potentiality. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sharma, Bharti; Guo, Chunce; Kong, Hongzhi; Kramer, Elena M
2011-08-01
• The petals of the lower eudicot family Ranunculaceae are thought to have been derived many times independently from stamens. However, investigation of the genetic basis of their identity has suggested an alternative hypothesis: that they share a commonly inherited petal identity program. This theory is based on the fact that an ancient paralogous lineage of APETALA3 (AP3) in the Ranunculaceae appears to have a conserved, petal-specific expression pattern. • Here, we have used a combination of approaches, including RNAi, comparative gene expression and molecular evolutionary studies, to understand the function of this petal-specific AP3 lineage. • Functional analysis of the Aquilegia locus AqAP3-3 has demonstrated that the paralog is required for petal identity with little contribution to the identity of the other floral organs. Expanded expression studies and analyses of molecular evolutionary patterns provide further evidence that orthologs of AqAP3-3 are primarily expressed in petals and are under higher purifying selection across the family than the other AP3 paralogs. • Taken together, these findings suggest that the AqAP3-3 lineage underwent progressive subfunctionalization within the order Ranunculales, ultimately yielding a specific role in petal identity that has probably been conserved, in stark contrast with the multiple independent origins predicted by botanical theories. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Directory of Open Access Journals (Sweden)
Matthew A Carrigan
Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
Directory of Open Access Journals (Sweden)
Shu-Ting Pan
2016-06-01
Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Directory of Open Access Journals (Sweden)
Nathanson Lubov
2011-09-01
Full Text Available Abstract Background A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are intriguing because the newly sequenced pea aphid genome harbors an extraordinary number of lineage-specific gene duplications relative to other insect genomes. Though many of their duplicated genes may be involved in their complex life cycle, duplications in nutrient amino acid transporters appear to be associated rather with their essential amino acid poor diet and the intracellular symbiosis aphids rely on to compensate for dietary deficits. Past work has shown that some duplicated amino acid transporters are highly expressed in the specialized cells housing the symbionts, including a paralog of an aphid-specific expansion homologous to the Drosophila gene slimfast. Previous data provide evidence that these bacteriocyte-expressed transporters mediate amino acid exchange between aphids and their symbionts. Results We report that some nutrient amino acid transporters show male-biased expression. Male-biased expression characterizes three paralogs in the aphid-specific slimfast expansion, and the male-biased expression is conserved across two aphid species for at least two paralogs. One of the male-biased paralogs has additionally experienced an accelerated rate of non-synonymous substitutions. Conclusions This is the first study to document male-biased slimfast expression. Our data suggest that the male-biased aphid slimfast paralogs diverged from their ancestral function to fill a functional role in males. Furthermore, our results provide evidence that members of the slimfast expansion are maintained in the aphid genome not only for the previously hypothesized role in mediating amino acid exchange between the symbiotic partners, but also for sex-specific roles.
International Nuclear Information System (INIS)
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
Paralogs hnRNP L and hnRNP LL exhibit overlapping but distinct RNA binding constraints.
Directory of Open Access Journals (Sweden)
Sarah A Smith
Full Text Available HnRNP (heterogeneous nuclear ribonucleoprotein proteins are a large family of RNA-binding proteins that regulate numerous aspects of RNA processing. Interestingly, several paralogous pairs of hnRNPs exist that exhibit similar RNA-binding specificity to one another, yet have non-redundant functional targets in vivo. In this study we systematically investigate the possibility that the paralogs hnRNP L and hnRNP LL have distinct RNA binding determinants that may underlie their lack of functional redundancy. Using a combination of RNAcompete and native gel analysis we find that while both hnRNP L and hnRNP LL preferentially bind sequences that contain repeated CA dinucleotides, these proteins differ in their requirement for the spacing of the CAs. Specifically, hnRNP LL has a more stringent requirement for a two nucleotide space between CA repeats than does hnRNP L, resulting in hnRNP L binding more promiscuously than does hnRNP LL. Importantly, this differential requirement for the spacing of CA dinucleotides explains the previously observed differences in the sensitivity of hnRNP L and LL to mutations within the CD45 gene. We suggest that overlapping but divergent RNA-binding preferences, as we show here for hnRNP L and hnRNP LL, may be commonplace among other hnRNP paralogs.
Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization
Directory of Open Access Journals (Sweden)
Xi-Yin Wang
2011-01-01
Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.
Signals of historical interlocus gene conversion in human segmental duplications.
Directory of Open Access Journals (Sweden)
Beth L Dumont
Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.
A phylogenomic gene cluster resource: The phylogeneticallyinferred groups (PhlGs) database
Energy Technology Data Exchange (ETDEWEB)
Dehal, Paramvir S.; Boore, Jeffrey L.
2005-08-25
We present here the PhIGs database, a phylogenomic resource for sequenced genomes. Although many methods exist for clustering gene families, very few attempt to create truly orthologous clusters sharing descent from a single ancestral gene across a range of evolutionary depths. Although these non-phylogenetic gene family clusters have been used broadly for gene annotation, errors are known to be introduced by the artifactual association of slowly evolving paralogs and lack of annotation for those more rapidly evolving. A full phylogenetic framework is necessary for accurate inference of function and for many studies that address pattern and mechanism of the evolution of the genome. The automated generation of evolutionary gene clusters, creation of gene trees, determination of orthology and paralogy relationships, and the correlation of this information with gene annotations, expression information, and genomic context is an important resource to the scientific community.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.
Directory of Open Access Journals (Sweden)
Hui Song
Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.
Directory of Open Access Journals (Sweden)
Michael B Walker
Full Text Available Arrangements of genes along chromosomes are a product of evolutionary processes, and we can expect that preferable arrangements will prevail over the span of evolutionary time, often being reflected in the non-random clustering of structurally and/or functionally related genes. Such non-random arrangements can arise by two distinct evolutionary processes: duplications of DNA sequences that give rise to clusters of genes sharing both sequence similarity and common sequence features and the migration together of genes related by function, but not by common descent. To provide a background for distinguishing between the two, which is important for future efforts to unravel the evolutionary processes involved, we here provide a description of the extent to which ancestrally related genes are found in proximity.Towards this purpose, we combined information from five genomic datasets, InterPro, SCOP, PANTHER, Ensembl protein families, and Ensembl gene paralogs. The results are provided in publicly available datasets (http://cgd.jax.org/datasets/clustering/paraclustering.shtml describing the extent to which ancestrally related genes are in proximity beyond what is expected by chance (i.e. form paraclusters in the human and nine other vertebrate genomes, as well as the D. melanogaster, C. elegans, A. thaliana, and S. cerevisiae genomes. With the exception of Saccharomyces, paraclusters are a common feature of the genomes we examined. In the human genome they are estimated to include at least 22% of all protein coding genes. Paraclusters are far more prevalent among some gene families than others, are highly species or clade specific and can evolve rapidly, sometimes in response to environmental cues. Altogether, they account for a large portion of the functional clustering previously reported in several genomes.
Pathogenomic inference of virulence-associated genes in Leptospira interrogans.
Lehmann, Jason S; Fouts, Derrick E; Haft, Daniel H; Cannella, Anthony P; Ricaldi, Jessica N; Brinkac, Lauren; Harkins, Derek; Durkin, Scott; Sanka, Ravi; Sutton, Granger; Moreno, Angelo; Vinetz, Joseph M; Matthias, Michael A
2013-01-01
Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.
Baskar, Venkidasamy; Park, Se Won
2015-07-01
Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.
Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi
2001-01-01
Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under
Directory of Open Access Journals (Sweden)
Zhining Sa
2017-08-01
Full Text Available Side effects from targeted drugs remain a serious concern. One reason is the nonselective binding of a drug to unintended proteins such as its paralogs, which are highly homologous in sequences and have similar structures and drug-binding pockets. To identify targetable differences between paralogs, we analyzed two types (type-I and type-II of functional divergence between two paralogs in the known target protein receptor family G-protein coupled receptors (GPCRs at the amino acid level. Paralogous protein receptors in glucagon-like subfamily, glucagon receptor (GCGR and glucagon-like peptide-1 receptor (GLP-1R, exhibit divergence in ligands and are clinically validated drug targets for type 2 diabetes. Our data showed that type-II amino acids were significantly enriched in the binding sites of antagonist MK-0893 to GCGR, which had a radical shift in physicochemical properties between GCGR and GLP-1R. We also examined the role of type-I amino acids between GCGR and GLP-1R. The divergent features between GCGR and GLP-1R paralogs may be helpful in their discrimination, thus enabling the identification of binding sites to reduce undesirable side effects and increase the target specificity of drugs.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Nahas, John V; Iosue, Christine L; Shaik, Noor F; Selhorst, Kathleen; He, Bin Z; Wykoff, Dennis D
2018-05-10
Convergent evolution is often due to selective pressures generating a similar phenotype. We observe relatively recent duplications in a spectrum of Saccharomycetaceae yeast species resulting in multiple phosphatases that are regulated by different nutrient conditions - thiamine and phosphate starvation. This specialization is both transcriptional and at the level of phosphatase substrate specificity. In Candida glabrata , loss of the ancestral phosphatase family was compensated by the co-option of a different histidine phosphatase family with three paralogs. Using RNA-seq and functional assays, we identify one of these paralogs, CgPMU3 , as a thiamine phosphatase. We further determine that the 81% identical paralog CgPMU2 does not encode thiamine phosphatase activity; however, both are capable of cleaving the phosphatase substrate, 1-napthyl-phosphate. We functionally demonstrate that members of this family evolved novel enzymatic functions for phosphate and thiamine starvation, and are regulated transcriptionally by either nutrient condition, and observe similar trends in other yeast species. This independent, parallel evolution involving two different families of histidine phosphatases suggests that there were likely similar selective pressures on multiple yeast species to recycle thiamine and phosphate. In this work, we focused on duplication and specialization, but there is also repeated loss of phosphatases, indicating that the expansion and contraction of the phosphatase family is dynamic in many Ascomycetes. The dynamic evolution of the phosphatase gene families is perhaps just one example of how gene duplication, co-option, and transcriptional and functional specialization together allow species to adapt to their environment with existing genetic resources. Copyright © 2018, G3: Genes, Genomes, Genetics.
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Pathogenomic inference of virulence-associated genes in Leptospira interrogans.
Directory of Open Access Journals (Sweden)
Jason S Lehmann
Full Text Available Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.
Directory of Open Access Journals (Sweden)
Hewitt Jane E
2010-11-01
Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.
miR-92a family and their target genes in tumorigenesis and metastasis
Energy Technology Data Exchange (ETDEWEB)
Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)
2014-04-15
The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.
miR-92a family and their target genes in tumorigenesis and metastasis
International Nuclear Information System (INIS)
Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang
2014-01-01
The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis
Directory of Open Access Journals (Sweden)
Choi Beom-Soon
2008-12-01
Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between
Functional studies of heading date-related gene TaPRR73, a paralog of Ppd1 in common wheat
Directory of Open Access Journals (Sweden)
Wenping eZhang
2016-06-01
Full Text Available Photoperiod response-related genes play a crucial role in duration of the plant growth. In this study, we focused on TaPRR73, a paralog of Green Revolution gene Ppd1 (TaPRR37. We found that overexpression of the truncated TaPRR73 form lacking part of the N-terminal PR domain in transgenic rice promoted heading under long day conditions. Association analysis in common wheat verified that TaPRR73 was an important agronomic photoperiod response gene that significantly affected heading date and plant height; expression analysis proved that specific alleles of TaPRR73-A1 had highly expressed levels in earlier heading lines; the distribution of haplotypes indicated that one of these alleles had been selected in breeding programs. Our results demonstrated that TaPRR73 contributed to regulation of heading date in wheat and could be useful in wheat breeding and in broadening adaptation of the crop to new regions.
Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.
Directory of Open Access Journals (Sweden)
Todd J Treangen
2011-01-01
Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.
Don't throw the baby out with the bathwater: identifying and mapping paralogs in salmonids.
Dufresne, France
2016-01-01
Many eukaryotic genomes contain a large fraction of gene duplicates (or paralogs) as a result of ancient or recent whole-genome duplications (Ohno 1970; Jaillon et al. 2004; Kellis et al. 2004). Identifying paralogs with NGS data is a pervasive problem in both ancient polyploids and neopolyploids. Likewise, paralogs are often treated as a nuisance that has to be detected and removed (Everett et al. 2012). In this issue of Molecular Ecology Resources, Waples et al. (2015) show that exclusion might not be necessary and how we may miss out on important genomic information in doing so. They present a novel statistical approach to detect paralogs based on the segregation of RAD loci in haploid offspring and test their method by constructing linkage maps with and without these duplicated loci in chum salmon, Oncorhynchus keta (Fig.1). Their linkage map including the resolved paralogs shows that these are mostly located in the distal regions of several linkage groups. Particularly intriguing is their finding that these homoeologous regions appear impoverished in transposable elements (TE). Given the role that TE play in genome remodelling, it is noteworthy that these elements are of low abundance in regions showing residual tetrasomic inheritance. This raises the question whether re-diploidization is constrained in these regions and whether they might have a role to play in salmonid speciation. This study provides an original approach to identifying duplicated loci in species with a pedigree, as well as providing a dense linkage map for chum salmon, and interesting insights into the retention of gene duplicates in an ancient polyploid. © 2015 John Wiley & Sons Ltd.
Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi
2015-02-15
WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine
2014-01-01
Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Directory of Open Access Journals (Sweden)
Florian Jabbour
Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Contrasting patterns in the evolution of the Rab GTPase family in Archaeplastida
Directory of Open Access Journals (Sweden)
Romana Petrželková
2014-12-01
Full Text Available Rab GTPases are a vast group of proteins serving a role of master regulators in membrane trafficking in eukaryotes. Previous studies delineated some 23 Rab and Rab-like paralogs ancestral for eukaryotes and mapped their current phylogenetic distribution, but the analyses relied on a limited sampling of the eukaryotic diversity. Taking advantage of the recent growth of genome and transcriptome resources for phylogenetically diverse plants and algae, we reanalyzed the evolution of the Rab family in eukaryotes with the primary plastid, collectively constituting the presumably monophyletic supergroup Archaeplastida. Our most important novel findings are as follows: (i the ancestral set of Rabs in Archaeplastida included not only the paralogs Rab1, Rab2, Rab5, Rab6, Rab7, Rab8, Rab11, Rab18, Rab23, Rab24, Rab28, IFT27, and RTW (=Rabl2, as suggested previously, but also Rab14 and Rab34, because Rab14 exists in glaucophytes and Rab34 is present in glaucophytes and some green algae; (ii except in embryophytes, Rab gene duplications have been rare in Archaeplastida. Most notable is the independent emergence of divergent, possibly functionally novel, in-paralogs of Rab1 and Rab11 in several archaeplastidial lineages; (iii recurrent gene losses have been a significant factor shaping Rab gene complements in archaeplastidial species; for example, the Rab21 paralog was lost at least six times independently within Archaeplastida, once in the lineage leading to the “core” eudicots; (iv while the glaucophyte Cyanophora paradoxa has retained the highest number of ancestral Rab paralogs among all archaeplastidial species studied so far, rhodophytes underwent an extreme reduction of the Rab gene set along their stem lineage, resulting in only six paralogs (Rab1, Rab2, Rab6, Rab7, Rab11, and Rab18 present in modern red algae. Especially notable is the absence of Rab5, a virtually universal paralog essential for the endocytic pathway, suggesting that endocytosis
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO and orthologous genes related by speciation events (PAOs, SMOs/APAOs. Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Gene duplications in prokaryotes can be associated with environmental adaptation.
Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn
2010-10-20
Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate
Genomic assessment of the evolution of the prion protein gene family in vertebrates.
Harrison, Paul M; Khachane, Amit; Kumar, Manish
2010-05-01
Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long
Analysis of the reptile CD1 genes: evolutionary implications.
Yang, Zhi; Wang, Chunyan; Wang, Tao; Bai, Jianhui; Zhao, Yu; Liu, Xuhan; Ma, Qingwei; Wu, Xiaobing; Guo, Ying; Zhao, Yaofeng; Ren, Liming
2015-06-01
CD1, as the third family of antigen-presenting molecules, is previously only found in mammals and chickens, which suggests that the chicken and mammalian CD1 shared a common ancestral gene emerging at least 310 million years ago. Here, we describe CD1 genes in the green anole lizard and Crocodylia, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles. Although the reptilian CD1 protein structures are predicted to be similar to human CD1d and chicken CD1.1, CD1 isotypes are not found to be orthologous between mammals, birds, and reptiles according to phylogenetic analyses, suggesting an independent diversification of CD1 isotypes during the speciation of mammals, birds, and reptiles. In the green anole lizard, although the single CD1 locus and MHC I gene are located on the same chromosome, there is an approximately 10-Mb-long sequence in between, and interestingly, several genes flanking the CD1 locus belong to the MHC paralogous region on human chromosome 19. The CD1 genes in Crocodylia are located in two loci, respectively linked to the MHC region and MHC paralogous region (corresponding to the MHC paralogous region on chromosome 19). These results provide new insights for studying the origin and evolution of CD1.
Expansion and contraction of the DUP240 multigene family in Saccharomyces cerevisiae populations.
Leh-Louis, Véronique; Wirth, Bénédicte; Potier, Serge; Souciet, Jean-Luc; Despons, Laurence
2004-01-01
The influence of duplicated sequences on chromosomal stability is poorly understood. To characterize chromosomal rearrangements involving duplicated sequences, we compared the organization of tandem repeats of the DUP240 gene family in 15 Saccharomyces cerevisiae strains of various origins. The DUP240 gene family consists of 10 members of unknown function in the reference strain S288C. Five DUP240 paralogs on chromosome I and two on chromosome VII are arranged as tandem repeats that are highl...
Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families.
Voloshanenko, Oksana; Gmach, Philipp; Winter, Jan; Kranz, Dominique; Boutros, Michael
2017-11-01
Signaling pathway modules are often encoded by several closely related paralogous genes that can have redundant roles and are therefore difficult to analyze by loss-of-function analysis. A typical example is the Wnt signaling pathway, which in mammals is mediated by 19 Wnt ligands that can bind to 10 Frizzled (FZD) receptors. Although significant progress in understanding Wnt-FZD receptor interactions has been made in recent years, tools to generate systematic interaction maps have been largely lacking. Here we generated cell lines with multiplex mutant alleles of FZD1 , FZD2 , and FZD7 and demonstrate that these cells are unresponsive to canonical Wnt ligands. Subsequently, we performed genetic rescue experiments with combinations of FZDs and canonical Wnts to create a functional ligand-receptor interaction map. These experiments showed that whereas several Wnt ligands, such as Wnt3a, induce signaling through a broad spectrum of FZD receptors, others, such as Wnt8a, act through a restricted set of FZD genes. Together, our results map functional interactions of FZDs and 10 Wnt ligands and demonstrate how multiplex targeting by clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 can be used to systematically elucidate the functions of multigene families.-Voloshanenko, O., Gmach, P., Winter, J., Kranz, D., Boutros, M. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families. © The Author(s).
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Differential paralog divergence modulates genome evolution across yeast species.
Directory of Open Access Journals (Sweden)
Monica R Sanchez
2017-02-01
Full Text Available Evolutionary outcomes depend not only on the selective forces acting upon a species, but also on the genetic background. However, large timescales and uncertain historical selection pressures can make it difficult to discern such important background differences between species. Experimental evolution is one tool to compare evolutionary potential of known genotypes in a controlled environment. Here we utilized a highly reproducible evolutionary adaptation in Saccharomyces cerevisiae to investigate whether experimental evolution of other yeast species would select for similar adaptive mutations. We evolved populations of S. cerevisiae, S. paradoxus, S. mikatae, S. uvarum, and interspecific hybrids between S. uvarum and S. cerevisiae for ~200-500 generations in sulfate-limited continuous culture. Wild-type S. cerevisiae cultures invariably amplify the high affinity sulfate transporter gene, SUL1. However, while amplification of the SUL1 locus was detected in S. paradoxus and S. mikatae populations, S. uvarum cultures instead selected for amplification of the paralog, SUL2. We measured the relative fitness of strains bearing deletions and amplifications of both SUL genes from different species, confirming that, converse to S. cerevisiae, S. uvarum SUL2 contributes more to fitness in sulfate limitation than S. uvarum SUL1. By measuring the fitness and gene expression of chimeric promoter-ORF constructs, we were able to delineate the cause of this differential fitness effect primarily to the promoter of S. uvarum SUL1. Our data show evidence of differential sub-functionalization among the sulfate transporters across Saccharomyces species through recent changes in noncoding sequence. Furthermore, these results show a clear example of how such background differences due to paralog divergence can drive changes in genome evolution.
Gene duplications in prokaryotes can be associated with environmental adaptation
Directory of Open Access Journals (Sweden)
Lempicki Richard A
2010-10-01
Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive
Decoding the Divergent Subcellular Location of Two Highly Similar Paralogous LEA Proteins
Directory of Open Access Journals (Sweden)
Marie-Hélène Avelange-Macherel
2018-05-01
Full Text Available Many mitochondrial proteins are synthesized as precursors in the cytosol with an N-terminal mitochondrial targeting sequence (MTS which is cleaved off upon import. Although much is known about import mechanisms and MTS structural features, the variability of MTS still hampers robust sub-cellular software predictions. Here, we took advantage of two paralogous late embryogenesis abundant proteins (LEA from Arabidopsis with different subcellular locations to investigate structural determinants of mitochondrial import and gain insight into the evolution of the LEA genes. LEA38 and LEA2 are short proteins of the LEA_3 family, which are very similar along their whole sequence, but LEA38 is targeted to mitochondria while LEA2 is cytosolic. Differences in the N-terminal protein sequences were used to generate a series of mutated LEA2 which were expressed as GFP-fusion proteins in leaf protoplasts. By combining three types of mutation (substitution, charge inversion, and segment replacement, we were able to redirect the mutated LEA2 to mitochondria. Analysis of the effect of the mutations and determination of the LEA38 MTS cleavage site highlighted important structural features within and beyond the MTS. Overall, these results provide an explanation for the likely loss of mitochondrial location after duplication of the ancestral gene.
International Nuclear Information System (INIS)
Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded
2011-01-01
During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently
Directory of Open Access Journals (Sweden)
Roger Andrew J
2003-06-01
Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.
Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.
Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G
2015-07-14
Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.
Directory of Open Access Journals (Sweden)
Brenner Sydney
2008-06-01
Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate
A strong deletion bias in nonallelic gene conversion.
Directory of Open Access Journals (Sweden)
Raquel Assis
Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.
McGlothlin, Joel W; Chuckalovcak, John P; Janes, Daniel E; Edwards, Scott V; Feldman, Chris R; Brodie, Edmund D; Pfrender, Michael E; Brodie, Edmund D
2014-11-01
Members of a gene family expressed in a single species often experience common selection pressures. Consequently, the molecular basis of complex adaptations may be expected to involve parallel evolutionary changes in multiple paralogs. Here, we use bacterial artificial chromosome library scans to investigate the evolution of the voltage-gated sodium channel (Nav) family in the garter snake Thamnophis sirtalis, a predator of highly toxic Taricha newts. Newts possess tetrodotoxin (TTX), which blocks Nav's, arresting action potentials in nerves and muscle. Some Thamnophis populations have evolved resistance to extremely high levels of TTX. Previous work has identified amino acid sites in the skeletal muscle sodium channel Nav1.4 that confer resistance to TTX and vary across populations. We identify parallel evolution of TTX resistance in two additional Nav paralogs, Nav1.6 and 1.7, which are known to be expressed in the peripheral nervous system and should thus be exposed to ingested TTX. Each paralog contains at least one TTX-resistant substitution identical to a substitution previously identified in Nav1.4. These sites are fixed across populations, suggesting that the resistant peripheral nerves antedate resistant muscle. In contrast, three sodium channels expressed solely in the central nervous system (Nav1.1-1.3) showed no evidence of TTX resistance, consistent with protection from toxins by the blood-brain barrier. We also report the exon-intron structure of six Nav paralogs, the first such analysis for snake genes. Our results demonstrate that the molecular basis of adaptation may be both repeatable across members of a gene family and predictable based on functional considerations. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Directory of Open Access Journals (Sweden)
Qian Yan
Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Directory of Open Access Journals (Sweden)
Paul D Thomas
Full Text Available A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011 has proposed a metric for the "functional similarity" between two genes that uses only the Gene Ontology (GO annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the "ortholog conjecture" (or, more properly, the "ortholog functional conservation hypothesis". First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1 that GO annotations are often incomplete, potentially in a biased manner, and subject to an "open world assumption" (absence of an annotation does not imply absence of a function, and 2 that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the
Roles of ATR1 paralogs YMR279c and YOR378w in boron stress tolerance
International Nuclear Information System (INIS)
Bozdag, Gonensin Ozan; Uluisik, Irem; Gulculer, Gulce Sila; Karakaya, Huseyin C.; Koc, Ahmet
2011-01-01
Highlights: → ATR1 paralog YMR279c plays role in boron detoxification. → YMR279c overexpression lowers cytoplasmic boron levels. → ATR1 paralog YOR378w has no roles in boron stress response. -- Abstract: Boron is a necessary nutrient for plants and animals, however excess of it causes toxicity. Previously, Atr1 and Arabidopsis Bor1 homolog were identified as the boron efflux pump in yeast, which lower the cytosolic boron concentration and help cells to survive in the presence of toxic amount of boron. In this study, we analyzed ATR1 paralogs, YMR279c and YOR378w, to understand whether they participate in boron stress tolerance in yeast. Even though these genes share homology with ATR1, neither their deletion rendered cells boron sensitive nor their expression was significantly upregulated by boron treatment. However, expression of YMR279, but not YOR378w, from the constitutive GAPDH promoter on a high copy plasmid provided remarkable boron resistance by decreasing intracellular boron levels. Thus our results suggest the presence of a third boron exporter, YMR279c, which functions similar to ATR1 and provides boron resistance in yeast.
Directory of Open Access Journals (Sweden)
Wei Liu
2018-01-01
Full Text Available Terpenes are the largest and most diverse class of secondary metabolites in plants and play a very important role in plant adaptation to environment. 3-Hydroxy-3-methylglutaryl coenzyme A reductase (HMGR is a rate-limiting enzyme in the process of terpene biosynthesis in the cytosol. Previous study found the HMGR genes underwent gene expansion in Gossypium raimondii, but the characteristics and evolution of the HMGR gene family in Gossypium genus are unclear. In this study, genome-wide identification and comparative study of HMGR gene family were carried out in three Gossypium species with genome sequences, i.e., G. raimondii, Gossypium arboreum, and Gossypium hirsutum. In total, nine, nine and 18 HMGR genes were identified in G. raimondii, G. arboreum, and G. hirsutum, respectively. The results indicated that the HMGR genes underwent gene expansion and a unique gene cluster containing four HMGR genes was found in all the three Gossypium species. The phylogenetic analysis suggested that the expansion of HMGR genes had occurred in their common ancestor. There was a pseudogene that had a 10-bp deletion resulting in a frameshift mutation and could not be translated into functional proteins in G. arboreum and the A-subgenome of G. hirsutum. The expression profiles of the two pseudogenes showed that they had tissue-specific expression. Additionally, the expression pattern of the pseudogene in the A-subgenome of G. hirsutum was similar to its paralogous gene in the D-subgenome of G. hirsutum. Our results provide useful information for understanding cytosolic terpene biosynthesis in Gossypium species.
Directory of Open Access Journals (Sweden)
Palmer Jeffrey D
2006-09-01
Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and
Rice, Danny W; Palmer, Jeffrey D
2006-01-01
Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the
Function of Rad51 paralogs in eukaryotic homologous recombinational repair
International Nuclear Information System (INIS)
Liu, N.; Skowronek, K.
2003-01-01
Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR
Zhang, Jin; Liu, Bobin; Li, Jianbo; Zhang, Li; Wang, Yan; Zheng, Huanquan; Lu, Mengzhu; Chen, Jun
2015-03-14
Heat shock proteins (Hsps) are molecular chaperones that are involved in many normal cellular processes and stress responses, and heat shock factors (Hsfs) are the transcriptional activators of Hsps. Hsfs and Hsps are widely coordinated in various biological processes. Although the roles of Hsfs and Hsps in stress responses have been well characterized in Arabidopsis, their roles in perennial woody species undergoing various environmental stresses remain unclear. Here, a comprehensive identification and analysis of Hsf and Hsp families in poplars is presented. In Populus trichocarpa, we identified 42 paralogous pairs, 66.7% resulting from a whole genome duplication. The gene structure and motif composition are relatively conserved in each subfamily. Microarray and quantitative real-time RT-PCR analyses showed that most of the Populus Hsf and Hsp genes are differentially expressed upon exposure to various stresses. A coexpression network between Populus Hsf and Hsp genes was generated based on their expression. Coordinated relationships were validated by transient overexpression and subsequent qPCR analyses. The comprehensive analysis indicates that different sets of PtHsps are downstream of particular PtHsfs and provides a basis for functional studies aimed at revealing the roles of these families in poplar development and stress responses.
Bello, María A.; Cubas, Pilar; Álvarez, Inés; Sanjuanbenito, Guillermo; Fuertes-Aguilar, Javier
2017-01-01
Homologs of the CYC/TB1 gene family have been independently recruited many times across the eudicots to control aspects of floral symmetry The family Asteraceae exhibits the largest known diversification in this gene paralog family accompanied by a parallel morphological floral richness in its specialized head-like inflorescence. In Asteraceae, whether or not CYC/TB1 gene floral symmetry function is preserved along organismic and gene lineages is unknown. In this study, we used phylogenetic, structural and expression analyses focused on the highly derived genus Anacyclus (tribe Anthemidae) to address this question. Phylogenetic reconstruction recovered eight main gene lineages present in Asteraceae: two from CYC1, four from CYC2 and two from CYC3-like genes. The species phylogeny was recovered in most of the gene lineages, allowing the delimitation of orthologous sets of CYC/TB1 genes in Asteraceae. Quantitative real-time PCR analysis indicated that in Anacyclus three of the four isolated CYC2 genes are more highly expressed in ray flowers. The expression of the four AcCYC2 genes overlaps in several organs including the ligule of ray flowers, as well as in anthers and ovules throughout development. PMID:28487706
Directory of Open Access Journals (Sweden)
Dan-Dan Zhang
Full Text Available Lepidopteran pheromone receptors (PRs, for which orthologies are evident among closely related species, provide an intriguing example of gene family evolution in terms of how new functions may arise. However, only a limited number of PRs have been functionally characterized so far and thus evolutionary scenarios suffer from elements of speculation. In this study we investigated the turnip moth Agrotis segetum, in which female moths produce a mixture of chemically related pheromone components that elicit specific responses from receptor cells on male antennae. We cloned nine A. segetum PR genes and the Orco gene by degenerate primer based RT-PCR. The nine PR genes, named as AsegOR1 and AsegOR3-10, fall into four distinct orthologous clusters of known lepidopteran PRs, of which one contains six paralogues. The paralogues are under relaxed selective pressure, contrasting with the purifying selection on other clusters. We identified the receptors AsegOR9, AsegOR4 and AsegOR5, specific for the respective homologous pheromone components (Z-5-decenyl, (Z-7-dodecenyl and (Z-9-tetradecenyl acetates, by two-electrode voltage clamp recording from Xenopus laevis oocytes co-expressing Orco and each PR candidate. These receptors occur in three different orthologous clusters. We also found that the six paralogues with high sequence similarity vary dramatically in ligand selectivity and sensitivity. Different from AsegOR9, AsegOR6 showed a relatively large response to the behavioural antagonist (Z-5-decenol, and a small response to (Z-5-decenyl acetate. AsegOR1 was broadly tuned, but most responsive to (Z-5-decenyl acetate, (Z-7-dodecenyl acetate and the behavioural antagonist (Z-8-dodecenyl acetate. AsegOR8 and AsegOR7, which differ from AsegOR6 and AsegOR1 by 7 and 10 aa respectively, showed much lower sensitivities. AsegOR10 showed only small responses to all the tested compounds. These results suggest that new receptors arise through gene duplication, and
Directory of Open Access Journals (Sweden)
Roberta eAcri-Nunes-Miranda
2014-03-01
Full Text Available The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The ‘orchid code’ model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG- and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. Athens. The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like are exclusively expressed in gynostemium and ovary, however no
Czech Academy of Sciences Publication Activity Database
Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.
2015-01-01
Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015
Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng
2015-01-01
The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.
Energy Technology Data Exchange (ETDEWEB)
Volkov, Oleg A.; Kinch, Lisa; Ariagno, Carson; Deng, Xiaoyi; Zhong, Shihua; Grishin, Nick; Tomchick, Diana R.; Chen, Zhe; Phillips, Margaret A.
2016-12-15
Catalytically inactive enzyme paralogs occur in many genomes. Some regulate their active counterparts but the structural principles of this regulation remain largely unknown. We report X-ray structures of
Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana
2014-01-01
The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for
Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P
2016-05-01
In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
Tracking the evolution of a cold stress associated gene family in cold tolerant grasses
DEFF Research Database (Denmark)
Sandve, Simen R; Rudi, Heidi; Asp, Torben
2008-01-01
to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...
Evolution and Functional Diversification of the GLI Family of Transcription Factors in Vertebrates
Directory of Open Access Journals (Sweden)
Amir Ali Abbasi
2009-05-01
Full Text Available Background: In vertebrates the “SONIC HEDGEHOG” signalling pathway has been implicated in cell-fate determination, proliferation and the patterning of many different cell types and organs. As the GLI family members (GLI1, GLI2 and GLI3 are key mediators of hedgehog morphogenetic signals, over the past couple of decades they have been extensively scrutinized by genetic, molecular and biochemical means. Thus, a great deal of information is currently available about the functional aspects of GLI proteins in various vertebrate species. To address the roles of GLI genes in diversifying the repertoire of the Hh signalling and deploying them for the vertebrate specifications, in this study we have examined the evolutionary patterns of vertebrate GLI sequences within and between species. Results: Phylogenetic tree analysis suggests that the vertebrate GLI1, GLI2 and GLI3 genes diverged after the separation of urochordates from vertebrates and before the tetrapods-bony fishes split. Lineage specific duplication events were also detected. Estimation of mode and strength of selection acting on GLI orthologs demonstrated that all members of the GLI gene family experienced more relaxed selection in teleost fish than in the mammalian lineage. Furthermore, the GLI1 gene appeared to have been exposed to different functional constraints in fish and tetrapod lineages, whilst a similar level of functional constraints on GLI2 and GLI3 was suggested by comparable average non-synonymous (Ka substitutions across the lineages. A relative rate test suggested that the majority of the paralogous copies of the GLI family analyzed evolved with similar evolutionary rates except GLI1 which evolved at a significantly faster rate than its paralogous counterparts in tetrapods. Conclusions: Our analysis shows that sequence evolutionary patterns of GLI family members are largely correlated with the reported similarities and differences in the functionality of GLI proteins
Walker, Kimberly A; Griggs, Lauren A; Obrist, Markus; Bode, Addys; Summers, R Patrick; Miller, Virginia L
2016-06-15
The Yersinia enterocolitica Ysa type III secretion system (T3SS) is associated with intracellular survival, and, like other characterized T3SSs, it is tightly controlled. Expression of the ysa genes is only detected following growth at low temperatures (26°C) and in high concentrations of sodium chloride (290 mM) in the medium. The YsrSTR phosphorelay (PR) system is required for ysa expression and likely responds to NaCl. During our investigations into the Ysr PR system, we discovered that genes YE3578 and YE3579 are remarkably similar to ysrR and ysrS, respectively, and are probably a consequence of a gene duplication event. The amino acid differences between YE3578 and ysrR are primarily clustered into two short regions. The differences between YE3579 and ysrS are nearly all located in the periplasmic sensing domain; the cytoplasmic domains are 98% identical. We investigated whether these paralogs were capable of activating ysa gene expression. We found that the sensor paralog, named DygS, is capable of compensating for loss of ysrS, but the response regulator paralog, DygR, cannot complement a ysrR gene deletion. In addition, YsrR, but not DygR, interacts with the histidine phosphorelay protein YsrT. Thus, DygS likely activates ysa gene expression in response to a signal other than NaCl and provides an example of a phosphorelay system in which two sensor kinases feed into the same regulatory pathway. All organisms need mechanisms to promote survival in changing environments. Prokaryotic phosphorelay systems are minimally comprised of a histidine kinase (HK) that senses an extracellular stimulus and a response regulator (RR) but can contain three or more proteins. Through gene duplication, a unique hybrid HK was created. We show that, while the hybrid appears to retain all of the phosphorelay functions, it responds to a different signal than the original. Both HKs transmit the signal to the same RR, which activates a promoter that transcribes a set of genes
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Richardson, Dale N.; Wiehe, Thomas
Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.
Identification of the gene for Nance-Horan syndrome (NHS).
Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J
2004-10-01
The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.
SPOCS: Software for Predicting and Visualizing Orthology/Paralogy Relationships Among Genomes
Energy Technology Data Exchange (ETDEWEB)
Curtis, Darren S.; Phillips, Aaron R.; Callister, Stephen J.; Conlan, Sean; McCue, Lee Ann
2013-10-15
At the rate that prokaryotic genomes can now be generated, comparative genomics studies require a flexible method for quickly and accurately predicting orthologs among the rapidly changing set of genomes available. SPOCS implements a graph-based ortholog prediction method to generate a simple tab-delimited table of orthologs and in addition, html files that provide a visualization of the predicted ortholog/paralog relationships to which gene/protein expression metadata may be overlaid. AVAILABILITY AND IMPLEMENTATION: A SPOCS web application is freely available at http://cbb.pnnl.gov/portal/tools/spocs.html. Source code for Linux systems is also freely available under an open source license at http://cbb.pnnl.gov/portal/software/spocs.html; the Boost C++ libraries and BLAST are required.
Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.
Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C
2010-02-01
The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.
Roquin Paralogs Differentially Regulate Functional NKT Cell Subsets.
Drees, Christoph; Vahl, J Christoph; Bortoluzzi, Sabrina; Heger, Klaus D; Fischer, Julius C; Wunderlich, F Thomas; Peschel, Christian; Schmidt-Supprian, Marc
2017-04-01
NKT cells represent a small subset of glycolipid-recognizing T cells that are heavily implicated in human allergic, autoimmune, and malignant diseases. In the thymus, precursor cells recognize self-glycolipids by virtue of their semi-invariant TCR, which triggers NKT cell lineage commitment and maturation. During their development, NKT cells are polarized into the NKT1, NKT2, and NKT17 subsets, defined through their cytokine-secretion patterns and the expression of key transcription factors. However, we have largely ignored how the differentiation into the NKT cell subsets is regulated. In this article, we describe the mRNA-binding Roquin-1 and -2 proteins as central regulators of murine NKT cell fate decisions. In the thymus, T cell-specific ablation of the Roquin paralogs leads to a dramatic expansion of NKT17 cells, whereas peripheral mature NKT cells are essentially absent. Roquin-1/2-deficient NKT17 cells show exaggerated lineage-specific expression of nearly all NKT17-defining proteins tested. We show through mixed bone marrow chimera experiments that NKT17 polarization is mediated through cell-intrinsic mechanisms early during NKT cell development. In contrast, the loss of peripheral NKT cells is due to cell-extrinsic factors. Surprisingly, Roquin paralog-deficient NKT cells are, in striking contrast to conventional T cells, compromised in their ability to secrete cytokines. Altogether, we show that Roquin paralogs regulate the development and function of NKT cell subsets in the thymus and periphery. Copyright © 2017 by The American Association of Immunologists, Inc.
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L
2015-06-05
The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD
Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise
2003-06-01
Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cbeta. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units.
DEFF Research Database (Denmark)
Goldstone, J.V.; Jönsson, M.E.; Behrendt, Lars
2009-01-01
Enzymes in the cytochrome P450 1 family oxidize many common environmental toxicants. We identified a new CYP1, termed CYP1D1, in zebrafish. Phylogenetically, CYP1D1 is paralogous to CYP1A and the two share 45% amino acid identity and similar gene structure. In adult zebrafish, CYP1D1 is most high...
Elusive Origins of the Extra Genes in Aspergillus oryzae
Khaldi, Nora; Wolfe, Kenneth H.
2008-01-01
The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939
Elusive origins of the extra genes in Aspergillus oryzae.
Directory of Open Access Journals (Sweden)
Nora Khaldi
Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions
Reyes-Rivera, Jorge; Rodríguez-Alonso, Gustavo; Petrone, Emilio; Vasco, Alejandra; Vergara-Silva, Francisco; Shishkova, Svetlana; Terrazas, Teresa
2017-01-01
The vascular cambium is a lateral meristem that produces secondary xylem (i.e., wood) and phloem. Different Cactaceae species develop different types of secondary xylem; however, little is known about the mechanisms underlying wood formation in the Cactaceae. The KNOTTED HOMEOBOX (KNOX) gene family encodes transcription factors that regulate plant development. The role of class I KNOX genes in the regulation of the shoot apical meristem, inflorescence architecture, and secondary growth is established in a few model species, while the functions of class II KNOX genes are less well understood, although the Arabidopsis thaliana class II KNOX protein KNAT7 is known to regulate secondary cell wall biosynthesis. To explore the involvement of the KNOX genes in the enormous variability of wood in Cactaceae, we identified orthologous genes expressed in species with fibrous ( Pereskia lychnidiflora and Pilosocereus alensis ), non-fibrous ( Ariocarpus retusus ), and dimorphic ( Ferocactus pilosus ) wood. Both class I and class II KNOX genes were expressed in the cactus cambial zone, including one or two class I paralogs of KNAT1 , as well as one or two class II paralogs of KNAT3 - KNAT4 - KNAT5 . While the KNOX gene SHOOTMERISTEMLESS ( STM) and its ortholog ARK1 are expressed during secondary growth in the Arabidopsis and Populus stem, respectively, we did not find STM orthologs in the Cactaceae cambial zone, which suggests possible differences in the vascular cambium genetic regulatory network in these species. Importantly, while two class II KNOX paralogs from the KNAT7 clade were expressed in the cambial zone of A. retusus and F. pilosus , we did not detect KNAT7 ortholog expression in the cambial zone of P. lychnidiflora . Differences in the transcriptional repressor activity of secondary cell wall biosynthesis by the KNAT7 orthologs could therefore explain the differences in wood development in the cactus species.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise
2003-01-01
Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cβ. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units. PMID:12805615
Directory of Open Access Journals (Sweden)
Anton S. Sulima
2017-11-01
Full Text Available During the initial step of the symbiosis between legumes (Fabaceae and nitrogen-fixing bacteria (rhizobia, the bacterial signal molecule known as the Nod factor (nodulation factor is recognized by plant LysM motif-containing receptor-like kinases (LysM-RLKs. The fifth chromosome of barrel medic (Medicago truncatula Gaertn. contains a cluster of paralogous LysM-RLK genes, one of which is known to participate in symbiosis. In the syntenic region of the pea (Pisum sativum L. genome, three genes have been identified: PsK1 and PsSym37, two symbiosis-related LysM-RLK genes with known sequences, and the unsequenced PsSym2 gene which presumably encodes a LysM-RLK and is associated with increased selectivity to certain Nod factors. In this work, we identified a new gene encoding a LysM-RLK, designated as PsLykX, within the Sym2 genomic region. We sequenced the first exons (corresponding to the protein receptor domain of PsSym37, PsK1, and PsLykX from a large set of pea genotypes of diverse origin. The nucleotide diversity of these fragments was estimated and groups of haplotypes for each gene were revealed. Footprints of selection pressure were detected via comparative analyses of SNP distribution across the first exons of these genes and their homologs MtLYK2, MtLYK3, and MtLYK4 from M. truncatula retrieved from the Medicago Hapmap project. Despite the remarkable similarity among all the studied genes, they exhibited contrasting selection signatures, possibly pointing to diversification of their functions. Signatures of balancing selection were found in LysM1-encoding parts of PsSym37 and PsK1, suggesting that the diversity of these parts may be important for pea LysM-RLKs. The first exons of PsSym37 and PsK1 displayed signatures of purifying selection, as well as MtLYK2 of M. truncatula. Evidence of positive selection affecting primarily LysM domains was found in all three investigated M. truncatula genes, as well as in the pea gene PsLykX. The data
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Directory of Open Access Journals (Sweden)
Radko Komers
Full Text Available Diabetes is among the most common causes of end-stage renal disease, although its pathophysiology is incompletely understood. We performed next-generation sequencing-based transcriptome analysis of renal gene expression changes in the OVE26 murine model of diabetes (age 15 weeks, relative to non-diabetic control, in the presence and absence of short-term (seven-day treatment with the angiotensin receptor blocker, losartan (n = 3-6 biological replicates per condition. We detected 1438 statistically significant changes in gene expression across conditions. Of the 638 genes dysregulated in diabetes relative to the non-diabetic state, >70% were downregulation events. Unbiased functional annotation of genes up- and down-regulated by diabetes strongly associated (p52-fold, encoded by the cationic amino acid transporter Slc7a12, and the gene product most highly downregulated by diabetes (>99%--encoded by the "pseudogene" Gm6300--are adjacent in the murine genome, are members of the SLC7 gene family, and are likely paralogous. Therefore, diabetes activates a near-total genetic switch between these two paralogs. Other individual-level changes in gene expression are potentially relevant to diabetic pathophysiology, and novel pathways are suggested. Genes unaffected by diabetes alone but exhibiting increased renal expression with losartan produced a signature consistent with malignant potential.
Directory of Open Access Journals (Sweden)
Tai-Sung Lee
2008-01-01
Full Text Available The concept of conservation of amino acids is widely used to identify important alignment positions of orthologs. The assumption is that important amino acid residues will be conserved in the protein family during the evolutionary process. For paralog alignment, on the other hand, the opposite concept can be used to identify residues that are responsible for specificity. Assuming that the function-specific or ligand-specific residue positions will have higher diversity since they are under evolutionary pressure to fit the target specificity, these function-specific or ligand-specific residues positions will have a lower degree of conservation than other positions in a highly conserved paralog alignment. This study assessed the ability of reverse conservation analysis to identify function-specific and ligand-specific residue positions in closely related paralog. Reverse conservation analysis of paralog alignments successfully identified all six previously reported substrate recognition sites (SRSs in cytochrome P450 family 2 (CYP 2. Further analysis of each subfamily identified the specificity-determining residues (SDRs that have been experimentally found. New potential SDRs were also predicted and await confirmation by further experiments or modeling calculations. This concept may be also applied to identify SDRs in other protein families.
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Conlon, J Michael
2008-10-01
Frogs belonging to the extensive family Ranidae represent a valuable source of antimicrobial peptides with therapeutic potential but there is currently no consistent system of nomenclature to describe these peptides. Terminology based solely on species name does not reflect the evolutionary relationships existing between peptides encoded by orthologous and paralogous genes. On the basis of limited structural similarity, at least 14 well-established peptide families have been identified (brevinin-1, brevinin-2, esculentin-1, esculentin-2, japonicin-1, japonicin-2, nigrocin-2, palustrin-1, palustrin-2, ranacyclin, ranalexin, ranatuerin-1, ranatuerin-2, temporin). It is proposed that terms that are synonymous with these names should no longer be used. Orthologous peptides from different species may be characterized by the initial letter of that species, set in upper case, with paralogs belonging to the same peptide family being assigned letters set in lower case, e.g. brevinin-1Pa, brevinin-1Pb, etc. When two species begin with the same initial letter, two letters may be used, e.g. P for pipiens and PL for palustris. Species names and assignments to genera may be obtained from Amphibian Species of the World Electronic Database, accessible at http://research.amnh.org/herpetology/amphibia/index.php. American Museum of Natural History, New York, USA.
Aagaard, Jan E.; Vacquier, Victor D.; MacCoss, Michael J.; Swanson, Willie J.
2010-01-01
Identifying fertilization molecules is key to our understanding of reproductive biology, yet only a few examples of interacting sperm and egg proteins are known. One of the best characterized comes from the invertebrate archeogastropod abalone (Haliotis spp.), where sperm lysin mediates passage through the protective egg vitelline envelope (VE) by binding to the VE protein vitelline envelope receptor for lysin (VERL). Rapid adaptive divergence of abalone lysin and VERL are an example of positive selection on interacting fertilization proteins contributing to reproductive isolation. Previously, we characterized a subset of the abalone VE proteins that share a structural feature, the zona pellucida (ZP) domain, which is common to VERL and the egg envelopes of vertebrates. Here, we use additional expressed sequence tag sequencing and shotgun proteomics to characterize this family of proteins in the abalone egg VE. We expand 3-fold the number of known ZP domain proteins present within the VE (now 30 in total) and identify a paralog of VERL (vitelline envelope zona pellucida domain protein [VEZP] 14) that contains a putative lysin-binding motif. We find that, like VERL, the divergence of VEZP14 among abalone species is driven by positive selection on the lysin-binding motif alone and that these paralogous egg VE proteins bind a similar set of sperm proteins including a rapidly evolving 18-kDa paralog of lysin, which may mediate sperm–egg fusion. This work identifies an egg coat paralog of VERL under positive selection and the candidate sperm proteins with which it may interact during abalone fertilization. PMID:19767347
Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping
2018-04-23
The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Gene conversion limits divergence of mammalian TLR1 and TLR6
Directory of Open Access Journals (Sweden)
Dunoyer-Geindre Sylvie
2007-08-01
Full Text Available Abstract Background Toll-like receptors (TLR recognize pathogen-associated molecular patterns and are important mediators of the innate immune system. TLR1 and TLR6 are paralogs and located in tandem on the same chromosome in mammals. They form heterodimers with TLR2 and bind lipopeptide components of gram-positive and gram-negative bacterial cell walls. To identify conserved stretches in TLR1 and TLR6, that may be important for their function, we compared their protein sequences in nine mammalian species(Homo sapiens, Pan troglodytes, Macaca mulatta, Mus musculus, Rattus norvegicus; Erinaceus europaeus, Bos Taurus, Sus scrofa and Canis familiaris. Results The N-terminal sequences of the orthologous proteins showed greater similarity than corresponding paralog sequences. However, we identified a region of 300 amino acids towards the C-terminus of TLR1 and TLR6, where paralogs had a greater degree of sequence identity than orthologs. Preservation of DNA sequence identity of paralogs in this region was observed in all nine mammalian species investigated, and is due to independent gene conversion events. The regions having undergone gene conversion in each species are almost identical and encode the leucine-rich repeat motifs 16 to 19, the C-terminal cap motif, the transmembrane domain and most of the intracellular Toll/interleukin-1 receptor (TIR domain. Conclusion Our results show that, for a specific conserved region, divergence of TLR1 and TLR6 is limited by gene conversion, most likely because of the need for co-evolution with multiple intracellular and extracellular binding partners. Thus, gene conversion provides a mechanism for limiting the divergence of functional regions of protein paralogs, while allowing other domains to evolve diversified functions.
Directory of Open Access Journals (Sweden)
Thomas Ann
2009-07-01
Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate
Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.
Zhu, Xinyu; Chen, Caoyi; Wang, Baohua
2012-04-01
Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.
Biewer, M; Lechner, S; Hasselmann, M
2016-01-01
Studying the fate of duplicated genes provides informative insight into the evolutionary plasticity of biological pathways to which they belong. In the paralogous sex-determining genes complementary sex determiner (csd) and feminizer (fem) of honey bee species (genus Apis), only heterozygous csd initiates female development. Here, the full-length coding sequences of the genes csd and fem of the phylogenetically basal dwarf honey bee Apis florea are characterized. Compared with other Apis species, remarkable evolutionary changes in the formation and localization of a protein-interacting (coiled-coil) motif and in the amino acids coding for the csd characteristic hypervariable region (HVR) are observed. Furthermore, functionally different csd alleles were isolated as genomic fragments from a random population sample. In the predicted potential specifying domain (PSD), a high ratio of πN/πS=1.6 indicated positive selection, whereas signs of balancing selection, commonly found in other Apis species, are missing. Low nucleotide diversity on synonymous and genome-wide, non-coding sites as well as site frequency analyses indicated a strong impact of genetic drift in A. florea, likely linked to its biology. Along the evolutionary trajectory of ~30 million years of csd evolution, episodic diversifying selection seems to have acted differently among distinct Apis branches. Consistently low amino-acid differences within the PSD among pairs of functional heterozygous csd alleles indicate that the HVR is the most important region for determining allele specificity. We propose that in the early history of the lineage-specific fem duplication giving rise to csd in Apis, A. florea csd stands as a remarkable example for the plasticity of initial sex-determining signals.
Churova, Maria V; Meshcheryakova, Olga V; Ruchev, Mikhail; Nemova, Nina N
2017-09-01
This study was conducted to characterize the features of muscle-specific genes expression during development of brown trout Salmo trutta inhabiting the river Krivoy ruchey (Kola Peninsula, Russia). Gene expression levels of myogenic regulatory factors (MRFs - MyoD1 paralogs (MyoD1a, MyoD1b, MyoD1c), Myf5, myogenin), myostatin paralogs (MSTN-1a, MSTN-1b, MSTN-2a), fast skeletal myosin heavy chain (MyHC) were measured in the white muscles of brown trout parr of ages 0+ (under-yearling), 1+ (yearling) and 2+ (two year old) and smolts of age 2+. Multidirectional changes in MyoD1 and MSTN paralogs expression along with myogenin, Myf 5 and MyHC expression levels in white muscles in parr of trout with age were revealed. The expression of MyoD1c, myogenin, MSTN-2a was the highest in 0+ parr and then decreased. MyoD1a/b expression levels didn't differ between age groups. The simultaneous elevation of MyHC, Myf5, MSTN-1a, and MSTN-1b was found in trout yearlings. In smolts, expression levels of MSTN paralogs, MyHC, Myf5, MyoD1a was lower than in parr. But in contrast, the MyoD1c and myogenin mRNA levels was higher in smolts. The study revealed that there are definite patterns in simultaneous muscle-specific genes expression in age groups of parr and smolts. As MyoD and MSTN paralogs expression changed differently in dependence on age and stage, it was suggested that paralogs of the same gene complementarily control myogenesis during development. Copyright © 2017 Elsevier Inc. All rights reserved.
Armesto, Paula; Infante, Carlos; Cousin, Xavier; Ponce, Marian; Manchado, Manuel
2015-04-01
In the present work, seven genes encoding Na(+),K(+)-ATPase (NKA) β-subunits in the teleost Solea senegalensis are described for the first time. Sequence analysis of the predicted polypeptides revealed a high degree of conservation with those of other vertebrate species and maintenance of important motifs involved in structure and function. Phylogenetic analysis clustered the seven genes into four main clades: β1 (atp1b1a and atp1b1b), β2 (atp1b2a and atp1b2b), β3 (atp1b3a and atp1b3b) and β4 (atp1b4). In juveniles, all paralogous transcripts were detected in the nine tissues examined albeit with different expression patterns. The most ubiquitous expressed gene was atp1b1a whereas atp1b1b was mainly detected in osmoregulatory organs (gill, kidney and intestine), and atp1b2a, atp1b2b, atp1b3a, atp1b3b and atp1b4 in brain. An expression analysis in three brain regions and pituitary revealed that β1-type transcripts were more abundant in pituitary than the other β paralogs with slight differences between brain regions. Quantification of mRNA abundance in gills after a salinity challenge showed an activation of atp1b1a and atp1b1b at high salinity water (60 ppt) and atp1b3a and atp1b3b in response to low salinity (5 ppt). Transcriptional analysis during larval development showed specific expression patterns for each paralog. Moreover, no differences in the expression profiles between larvae cultivated at 10 and 35 ppt were observed except for atp1b4 with higher mRNA levels at 10 than 35 ppt at 18 days post hatch. Whole-mount in situ hybridization analysis revealed that atp1b1b was mainly localized in gut, pronephric tubule, gill, otic vesicle, and chordacentrum of newly hatched larvae. All these data suggest distinct roles of NKA β subunits in tissues, during development and osmoregulation with β1 subunits involved in the adaptation to hyperosmotic conditions and β3 subunits to hypoosmotic environments. Copyright © 2014 Elsevier Inc. All rights reserved.
Cao, Yunpeng; Han, Yahui; Meng, Dandan; Li, Dahui; Jin, Qing; Lin, Yi; Cai, Yongping
2017-01-01
The ethylene-insensitive3/ethylene-insensitive3-like ( EIN3/EIL ) proteins are a type of nuclear-localized protein with DNA-binding activity in plants. Although the EIN3/EIL gene family has been studied in several plant species, little is known about comprehensive study of the EIN3/EIL gene family in Rosaceae. In this study, ten, five, four, and five EIN3/EIL genes were identified in the genomes of pear ( Pyrus bretschneideri ), mei ( Prunus mume ), peach ( Prunus persica ) and strawberry ( Fragaria vesca ), respectively. Twenty-eight chromosomal segments of EIL/EIN3 gene family were found in four Rosaceae species, and these segments could form seven orthologous or paralogous groups based on interspecies or intraspecies gene colinearity (microsynteny) analysis. Moreover, the highly conserved regions of microsynteny were found in four Rosaceae species. Subsequently it was found that both whole genome duplication and tandem duplication events significantly contributed to the EIL/EIN3 gene family expansion. Gene expression analysis of the EIL/EIN3 genes in the pear revealed subfunctionalization for several PbEIL genes derived from whole genome duplication. It is noteworthy that according to environmental selection pressure analysis, the strong purifying selection should dominate the maintenance of the EIL/EIN3 gene family in four Rosaceae species. These results provided useful information on Rosaceae EIL/EIN3 genes, as well as insights into the evolution of this gene family in four Rosaceae species. Furthermore, high level of microsynteny in the four Rosaceae plants suggested that a large-scale genome duplication event in the EIL/EIN3 gene family was predated to speciation.
Directory of Open Access Journals (Sweden)
Yunpeng Cao
2017-05-01
Full Text Available The ethylene-insensitive3/ethylene-insensitive3-like (EIN3/EIL proteins are a type of nuclear-localized protein with DNA-binding activity in plants. Although the EIN3/EIL gene family has been studied in several plant species, little is known about comprehensive study of the EIN3/EIL gene family in Rosaceae. In this study, ten, five, four, and five EIN3/EIL genes were identified in the genomes of pear (Pyrus bretschneideri, mei (Prunus mume, peach (Prunus persica and strawberry (Fragaria vesca, respectively. Twenty-eight chromosomal segments of EIL/EIN3 gene family were found in four Rosaceae species, and these segments could form seven orthologous or paralogous groups based on interspecies or intraspecies gene colinearity (microsynteny analysis. Moreover, the highly conserved regions of microsynteny were found in four Rosaceae species. Subsequently it was found that both whole genome duplication and tandem duplication events significantly contributed to the EIL/EIN3 gene family expansion. Gene expression analysis of the EIL/EIN3 genes in the pear revealed subfunctionalization for several PbEIL genes derived from whole genome duplication. It is noteworthy that according to environmental selection pressure analysis, the strong purifying selection should dominate the maintenance of the EIL/EIN3 gene family in four Rosaceae species. These results provided useful information on Rosaceae EIL/EIN3 genes, as well as insights into the evolution of this gene family in four Rosaceae species. Furthermore, high level of microsynteny in the four Rosaceae plants suggested that a large-scale genome duplication event in the EIL/EIN3 gene family was predated to speciation.
Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2018-06-08
Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
Czech Academy of Sciences Publication Activity Database
Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr
2017-01-01
Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016
Kannan, Lavanya; Li, Hua; Rubinstein, Boris; Mushegian, Arcady
2013-12-19
The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral ("high ancestrality"). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes.
Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua
2016-10-01
In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.
Kleene, Kenneth C
2005-01-01
This review proposes that the peculiar patterns of gene expression in spermatogenic cells are the consequence of powerful evolutionary forces known as sexual selection. Sexual selection is generally characterized by intense competition of males for females, an enormous variety of the strategies to maximize male reproductive success, exaggerated male traits at all levels of biological organization, co-evolution of sexual traits in males and females, and conflict between the sexual advantage of the male trait and the reproductive fitness of females and the individual fitness of both sexes. In addition, spermatogenesis is afflicted by selfish genes that promote their transmission to progeny while causing deleterious effects. Sexual selection, selfish genes, and genetic conflict provide compelling explanations for many atypical features of gene expression in spermatogenic cells including the gross overexpression of certain mRNAs, transcripts encoding truncated proteins that cannot carry out basic functions of the proteins encoded by the same genes in somatic cells, the large number of gene families containing paralogous genes encoding spermatogenic cell-specific isoforms, the large number of testis-cancer-associated genes that are expressed only in spermatogenic cells and malignant cells, and the overbearing role of Sertoli cells in regulating the number and quality of spermatozoa.
Directory of Open Access Journals (Sweden)
Ribeiro Daniela A
2011-12-01
Full Text Available Abstract Background Acidithiobacillus ferrooxidans is an acidophilic, chemolithoautotrophic bacterium that has been successfully used in metal bioleaching. In this study, an analysis of the A. ferrooxidans ATCC 23270 genome revealed the presence of three sHSP genes, Afe_1009, Afe_1437 and Afe_2172, that encode proteins from the HSP20 family, a class of intracellular multimers that is especially important in extremophile microorganisms. Results The expression of the sHSP genes was investigated in A. ferrooxidans cells submitted to a heat shock at 40°C for 15, 30 and 60 minutes. After 60 minutes, the gene on locus Afe_1437 was about 20-fold more highly expressed than the gene on locus Afe_2172. Bioinformatic and phylogenetic analyses showed that the sHSPs from A. ferrooxidans are possible non-paralogous proteins, and are regulated by the σ32 factor, a common transcription factor of heat shock proteins. Structural studies using homology molecular modeling indicated that the proteins encoded by Afe_1009 and Afe_1437 have a conserved α-crystallin domain and share similar structural features with the sHSP from Methanococcus jannaschii, suggesting that their biological assembly involves 24 molecules and resembles a hollow spherical shell. Conclusion We conclude that the sHSPs encoded by the Afe_1437 and Afe_1009 genes are more likely to act as molecular chaperones in the A. ferrooxidans heat shock response. In addition, the three sHSPs from A. ferrooxidans are not recent paralogs, and the Afe_1437 and Afe_1009 genes could be inherited horizontally by A. ferrooxidans.
Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q
2016-01-01
An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT
Directory of Open Access Journals (Sweden)
Khlestkina E.
2012-08-01
Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Rooting gene trees without outgroups: EP rooting.
Sinsheimer, Janet S; Little, Roderick J A; Lake, James A
2012-01-01
Gene sequences are routinely used to determine the topologies of unrooted phylogenetic trees, but many of the most important questions in evolution require knowing both the topologies and the roots of trees. However, general algorithms for calculating rooted trees from gene and genomic sequences in the absence of gene paralogs are few. Using the principles of evolutionary parsimony (EP) (Lake JA. 1987a. A rate-independent technique for analysis of nucleic acid sequences: evolutionary parsimony. Mol Biol Evol. 4:167-181) and its extensions (Cavender, J. 1989. Mechanized derivation of linear invariants. Mol Biol Evol. 6:301-316; Nguyen T, Speed TP. 1992. A derivation of all linear invariants for a nonbalanced transversion model. J Mol Evol. 35:60-76), we explicitly enumerate all linear invariants that solely contain rooting information and derive algorithms for rooting gene trees directly from gene and genomic sequences. These new EP linear rooting invariants allow one to determine rooted trees, even in the complete absence of outgroups and gene paralogs. EP rooting invariants are explicitly derived for three taxon trees, and rules for their extension to four or more taxa are provided. The method is demonstrated using 18S ribosomal DNA to illustrate how the new animal phylogeny (Aguinaldo AMA et al. 1997. Evidence for a clade of nematodes, arthropods, and other moulting animals. Nature 387:489-493; Lake JA. 1990. Origin of the metazoa. Proc Natl Acad Sci USA 87:763-766) may be rooted directly from sequences, even when they are short and paralogs are unavailable. These results are consistent with the current root (Philippe H et al. 2011. Acoelomorph flatworms are deuterostomes related to Xenoturbella. Nature 470:255-260).
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
Ishibashi, Misaki; Nabe, Takeshi; Nitta, Yoko; Tsuruta, Hiroki; Iduhara, Miho; Uno, Yuichi
2018-03-01
Fra a 1 protein in strawberry causes oral allergic syndrome. Over 39 Fra a 1 paralogs have been identified in strawberry genome. Fra a 1.01 is major accumulating protein in edible organs. Strawberry fruits contain allergenic proteins that cause oral allergic syndrome. The hypothesized major allergen is Fra a 1, an ortholog of the birch pollen allergen protein Bet v 1. We organized Fra a 1 genes and analyzed their localizations at the transcriptional and translational levels. In total, 15 new Fra a 1 proteins were identified from the genomic database, increasing the total number of Fra a 1 to 30 proteins encoded by 39 genes. Fra a 1.02 was mostly expressed in receptacles, and Fra a 1.01 in achenes, when analyzed by RNA sequencing. Immunoblotting showed that the Fra a 1.01 protein was broadly accumulated in strawberry organs, while the Fra a 1.02 protein was mostly expressed in receptacles. Recombinant Fra a 1.01 strongly reacted with human IgE. The mRNA and protein expression levels of Fra a 1 did not correlate, indicating the importance of protein levels when evaluating the abundance of allergens in strawberry. Based on the localizations, accumulation levels and reactivity to human IgE, we determined that Fra a 1.01 was the most important allergen, followed by Fra a 1.02, and then other Fra a 1 proteins. The information obtained here will be useful for selecting the target Fra a 1 paralogs when breeding hypoallergenic strawberry.
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Directory of Open Access Journals (Sweden)
Adam M. Reitzel
2016-08-01
Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for
A Theory of Utility Conditionals: Paralogical Reasoning from Decision-Theoretic Leakage
Bonnefon, Jean-Francois
2009-01-01
Many "if p, then q" conditionals have decision-theoretic features, such as antecedents or consequents that relate to the utility functions of various agents. These decision-theoretic features leak into reasoning processes, resulting in various paralogical conclusions. The theory of utility conditionals offers a unified account of the various forms…
2013-01-01
Background The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. Results We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. Conclusion While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral (“high ancestrality”). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes. Reviewers This article was reviewed by Martijn A Huynen, Toni Gabaldón and Fyodor Kondrashov. PMID:24354654
Hou, Xiao-Jin; Li, Si-Bei; Liu, Sheng-Rui; Hu, Chun-Gen; Zhang, Jin-Zhi
2014-01-01
MYB family genes are widely distributed in plants and comprise one of the largest transcription factors involved in various developmental processes and defense responses of plants. To date, few MYB genes and little expression profiling have been reported for citrus. Here, we describe and classify 177 members of the sweet orange MYB gene (CsMYB) family in terms of their genomic gene structures and similarity to their putative Arabidopsis orthologs. According to these analyses, these CsMYBs were categorized into four groups (4R-MYB, 3R-MYB, 2R-MYB and 1R-MYB). Gene structure analysis revealed that 1R-MYB genes possess relatively more introns as compared with 2R-MYB genes. Investigation of their chromosomal localizations revealed that these CsMYBs are distributed across nine chromosomes. Sweet orange includes a relatively small number of MYB genes compared with the 198 members in Arabidopsis, presumably due to a paralog reduction related to repetitive sequence insertion into promoter and non-coding transcribed region of the genes. Comparative studies of CsMYBs and Arabidopsis showed that CsMYBs had fewer gene duplication events. Expression analysis revealed that the MYB gene family has a wide expression profile in sweet orange development and plays important roles in development and stress responses. In addition, 337 new putative microsatellites with flanking sequences sufficient for primer design were also identified from the 177 CsMYBs. These results provide a useful reference for the selection of candidate MYB genes for cloning and further functional analysis forcitrus. PMID:25375352
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Expanded functional diversity of shaker K(+ channels in cnidarians is driven by gene expansion.
Directory of Open Access Journals (Sweden)
Timothy Jegla
Full Text Available The genome of the cnidarian Nematostella vectensis (starlet sea anemone provides a molecular genetic view into the first nervous systems, which appeared in a late common ancestor of cnidarians and bilaterians. Nematostella has a surprisingly large and diverse set of neuronal signaling genes including paralogs of most neuronal signaling molecules found in higher metazoans. Several ion channel gene families are highly expanded in the sea anemone, including three subfamilies of the Shaker K(+ channel gene family: Shaker (Kv1, Shaw (Kv3 and Shal (Kv4. In order to better understand the physiological significance of these voltage-gated K(+ channel expansions, we analyzed the function of 18 members of the 20 gene Shaker subfamily in Nematostella. Six of the Nematostella Shaker genes express functional homotetrameric K(+ channels in vitro. These include functional orthologs of bilaterian Shakers and channels with an unusually high threshold for voltage activation. We identified 11 Nematostella Shaker genes with a distinct "silent" or "regulatory" phenotype; these encode subunits that function only in heteromeric channels and serve to further diversify Nematostella Shaker channel gating properties. Subunits with the regulatory phenotype have not previously been found in the Shaker subfamily, but have evolved independently in the Shab (Kv2 family in vertebrates and the Shal family in a cnidarian. Phylogenetic analysis indicates that regulatory subunits were present in ancestral cnidarians, but have continued to diversity at a high rate after the split between anthozoans and hydrozoans. Comparison of Shaker family gene complements from diverse metazoan species reveals frequent, large scale duplication has produced highly unique sets of Shaker channels in the major metazoan lineages.
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
Energy Technology Data Exchange (ETDEWEB)
Merson, Rebeka R., E-mail: rmerson@ric.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Biology Department, Rhode Island College, 500 Mt. Pleasant Ave., Providence, RI 02908 (United States); Karchner, Sibel I.; Hahn, Mark E. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)
2009-08-13
The aryl hydrocarbon receptor (AHR) mediates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. In some mammalian cell lines, TCDD induces G1 cell cycle arrest, which depends on an interaction between the AHR and the retinoblastoma tumor suppressor (RB). Mammals possess one AHR, whereas fishes possess two or more AHR paralogs that differ in the domains important for AHR-RB interactions in mammals. To test the hypothesis that fish AHR paralogs differ in their ability to interact with RB, we cloned RB cDNA from Atlantic killifish, Fundulus heteroclitus, and studied the interactions of killifish RB protein with killifish AHR1 and AHR2. In coimmunoprecipitation experiments, in vitro-expressed killifish RB coprecipitated with both AHR1 and AHR2. Consistent with these results, both killifish AHR1 and AHR2 interacted with RB in mammalian two-hybrid assays. These results suggest that both fish AHR1 and AHR2 paralogs may have the potential to influence cell proliferation through interactions with RB.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.
Directory of Open Access Journals (Sweden)
Nemanja Vukašinović
Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.
Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan
2003-08-01
It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.
Analysis of gene expression profile microarray data in complex regional pain syndrome.
Tan, Wulin; Song, Yiyan; Mo, Chengqiang; Jiang, Shuangjian; Wang, Zhongxing
2017-09-01
The aim of the present study was to predict key genes and proteins associated with complex regional pain syndrome (CRPS) using bioinformatics analysis. The gene expression profiling microarray data, GSE47603, which included peripheral blood samples from 4 patients with CRPS and 5 healthy controls, was obtained from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) in CRPS patients compared with healthy controls were identified using the GEO2R online tool. Functional enrichment analysis was then performed using The Database for Annotation Visualization and Integrated Discovery online tool. Protein‑protein interaction (PPI) network analysis was subsequently performed using Search Tool for the Retrieval of Interaction Genes database and analyzed with Cytoscape software. A total of 257 DEGs were identified, including 243 upregulated genes and 14 downregulated ones. Genes in the human leukocyte antigen (HLA) family were most significantly differentially expressed. Enrichment analysis demonstrated that signaling pathways, including immune response, cell motion, adhesion and angiogenesis were associated with CRPS. PPI network analysis revealed that key genes, including early region 1A binding protein p300 (EP300), CREB‑binding protein (CREBBP), signal transducer and activator of transcription (STAT)3, STAT5A and integrin α M were associated with CRPS. The results suggest that the immune response may therefore serve an important role in CRPS development. In addition, genes in the HLA family, such as HLA‑DQB1 and HLA‑DRB1, may present potential biomarkers for the diagnosis of CRPS. Furthermore, EP300, its paralog CREBBP, and the STAT family genes, STAT3 and STAT5 may be important in the development of CRPS.
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A
2015-06-08
The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Genomewide identification and expression analysis of the ARF gene ...
Indian Academy of Sciences (India)
Figure 1. Phylogenetic relation of apple ARF genes. The phylogenetic tree was constructed based on a complete protein sequence align- ment of MdARFs by the neighbour-joining method with bootstrapping analysis (1000 replicates). The scale bar represents 0.05 amino acid substitutions per site. Paralogous gene pairs ...
Suthanthiram, Backiyarani; Subbaraya, Uma; Marimuthu Somasundram, Saraswathi; Muthu, Mayilvaganan
2016-01-01
The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1) MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2) MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3) MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4) cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or repressors in a
Directory of Open Access Journals (Sweden)
Raja Kaliyappan
Full Text Available The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1 MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2 MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3 MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4 cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or
Palmitoylation of POTE family proteins for plasma membrane targeting
International Nuclear Information System (INIS)
Das, Sudipto; Ise, Tomoko; Nagata, Satoshi; Maeda, Hiroshi; Bera, Tapan K.; Pastan, Ira
2007-01-01
The POTE gene family is composed of 13 paralogs and likely evolved by duplications and remodeling of the human genome. One common property of POTE proteins is their localization on the inner aspect of the plasma membrane. To determine the structural elements required for membrane localization, we expressed mutants of different POTEs in 293T cells as EGFP fusion proteins. We also tested their palmitoylation by a biotin-switch assay. Our data indicate that the membrane localizations of different POTEs are mediated by similar 3-4 short cysteine rich repeats (CRRs) near the amino-terminuses and that palmitoylation on paired cysteine residues in each CRR motif is responsible for the localization. Multiple palmitoylation in the small CRRs can result in the strong association of whole POTEs with plasma membrane
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou
2011-11-01
Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.
COGNAT: a web server for comparative analysis of genomic neighborhoods.
Klimchuk, Olesya I; Konovalov, Kirill A; Perekhvatov, Vadim V; Skulachev, Konstantin V; Dibrova, Daria V; Mulkidjanian, Armen Y
2017-11-22
In prokaryotic genomes, functionally coupled genes can be organized in conserved gene clusters enabling their coordinated regulation. Such clusters could contain one or several operons, which are groups of co-transcribed genes. Those genes that evolved from a common ancestral gene by speciation (i.e. orthologs) are expected to have similar genomic neighborhoods in different organisms, whereas those copies of the gene that are responsible for dissimilar functions (i.e. paralogs) could be found in dissimilar genomic contexts. Comparative analysis of genomic neighborhoods facilitates the prediction of co-regulated genes and helps to discern different functions in large protein families. We intended, building on the attribution of gene sequences to the clusters of orthologous groups of proteins (COGs), to provide a method for visualization and comparative analysis of genomic neighborhoods of evolutionary related genes, as well as a respective web server. Here we introduce the COmparative Gene Neighborhoods Analysis Tool (COGNAT), a web server for comparative analysis of genomic neighborhoods. The tool is based on the COG database, as well as the Pfam protein families database. As an example, we show the utility of COGNAT in identifying a new type of membrane protein complex that is formed by paralog(s) of one of the membrane subunits of the NADH:quinone oxidoreductase of type 1 (COG1009) and a cytoplasmic protein of unknown function (COG3002). This article was reviewed by Drs. Igor Zhulin, Uri Gophna and Igor Rogozin.
Directory of Open Access Journals (Sweden)
Nicola eCarraro
2012-02-01
Full Text Available Intercellular transport of the plant hormone auxin is mediated by three families of membrane-bound protein carriers, with the PIN and ABCB families coding primarily for efflux proteins and the AUX/LAX family coding for influx proteins. In the last decade our understanding of gene and protein function for these transporters in Arabidopsis has expanded rapidly but very little is known about their role in woody plant development. Here we present a comprehensive account of all three families in the model woody species Populus, including chromosome distribution, protein structure, quantitative gene expression, and evolutionary relationships. The PIN and AUX/LAX gene families in Populus comprise 16 and 8 members respectively, and show evidence for the retention of paralogs following a relatively recent whole genome duplication. There is also evidence for differential expression across tissues within many gene pairs. The ABCB family is previously undescribed in Populus and includes 20 members, showing a much deeper evolutionary history including both tandem and whole genome duplication as well as probable loss. A striking number of these transporters are expressed in developing Populus stems and we suggest that evolutionary and structural relationships with known auxin transporters in Arabidopsis can point toward candidate genes for further study in Populus. This is especially important for the ABCBs, which is a large family and includes members in Arabidopsis that are able to transport other substrates in addition to auxin. Protein modeling, sequence alignment and expression data all point to ABCB1.1 as a likely auxin transport protein in Populus. Given that basipetal auxin flow through the cambial zone shapes the development of woody stems, it is important that we identify the full complement of proteins involved in this process. This work should lay the foundation for studies targeting specific proteins for functional characterization and in situ
Biedler, James K; Tu, Zhijian
2010-07-08
The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start
Directory of Open Access Journals (Sweden)
Tu Zhijian
2010-07-01
Full Text Available Abstract Background The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Results Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1 in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Chapman, Mark A.; Tang, Shunxue; Draeger, Dörthe; Nambeesan, Savithri; Shaffer, Hunter; Barb, Jessica G.; Knapp, Steven J.; Burke, John M.
2012-01-01
The genetic basis of floral symmetry is a topic of great interest because of its effect on pollinator behavior and, consequently, plant diversification. The Asteraceae, which is the largest family of flowering plants, is an ideal system in which to study this trait, as many species within the family exhibit a compound inflorescence containing both bilaterally symmetric (i.e., zygomorphic) and radially symmetric (i.e., actinomorphic) florets. In sunflower and related species, the inflorescence is composed of a single whorl of ray florets surrounding multiple whorls of disc florets. We show that in double-flowered (dbl) sunflower mutants (in which disc florets develop bilateral symmetry), such as those captured by Vincent van Gogh in his famous nineteenth-century sunflower paintings, an insertion into the promoter region of a CYCLOIDEA (CYC)-like gene (HaCYC2c) that is normally expressed specifically in WT rays is instead expressed throughout the inflorescence, presumably resulting in the observed loss of actinomorphy. This same gene is mutated in two independent tubular-rayed (tub) mutants, though these mutations involve apparently recent transposon insertions, resulting in little or no expression and radialization of the normally zygomorphic ray florets. Interestingly, a phylogenetic analysis of CYC-like genes from across the family suggests that different paralogs of this fascinating gene family have been independently recruited to specify zygomorphy in different species within the Asteraceae. PMID:22479210
Human GW182 Paralogs Are the Central Organizers for RNA-Mediated Control of Transcription.
Hicks, Jessica A; Li, Liande; Matsui, Masayuki; Chu, Yongjun; Volkov, Oleg; Johnson, Krystal C; Corey, David R
2017-08-15
In the cytoplasm, small RNAs can control mammalian translation by regulating the stability of mRNA. In the nucleus, small RNAs can also control transcription and splicing. The mechanisms for RNA-mediated nuclear regulation are not understood and remain controversial, hindering the effective application of nuclear RNAi and investigation of its natural regulatory roles. Here, we reveal that the human GW182 paralogs TNRC6A/B/C are central organizing factors critical to RNA-mediated transcriptional activation. Mass spectrometry of purified nuclear lysates followed by experimental validation demonstrates that TNRC6A interacts with proteins involved in protein degradation, RNAi, the CCR4-NOT complex, the mediator complex, and histone-modifying complexes. Functional analysis implicates TNRC6A, NAT10, MED14, and WDR5 in RNA-mediated transcriptional activation. These findings describe protein complexes capable of bridging RNA-mediated sequence-specific recognition of noncoding RNA transcripts with the regulation of gene transcription. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Benner Steven A
2005-03-01
Full Text Available Abstract Background Blocks of duplicated genomic DNA sequence longer than 1000 base pairs are known as low copy repeats (LCRs. Identified by their sequence similarity, LCRs are abundant in the human genome, and are interesting because they may represent recent adaptive events, or potential future adaptive opportunities within the human lineage. Sequence analysis tools are needed, however, to decide whether these interpretations are likely, whether a particular set of LCRs represents nearly neutral drift creating junk DNA, or whether the appearance of LCRs reflects assembly error. Here we investigate an LCR family containing the sulfotransferase (SULT 1A genes involved in drug metabolism, cancer, hormone regulation, and neurotransmitter biology as a first step for defining the problems that those tools must manage. Results Sequence analysis here identified a fourth sulfotransferase gene, which may be transcriptionally active, located on human chromosome 16. Four regions of genomic sequence containing the four human SULT1A paralogs defined a new LCR family. The stem hominoid SULT1A progenitor locus was identified by comparative genomics involving complete human and rodent genomes, and a draft chimpanzee genome. SULT1A expansion in hominoid genomes was followed by positive selection acting on specific protein sites. This episode of adaptive evolution appears to be responsible for the dopamine sulfonation function of some SULT enzymes. Each of the conclusions that this bioinformatic analysis generated using data that has uncertain reliability (such as that from the chimpanzee genome sequencing project has been confirmed experimentally or by a "finished" chromosome 16 assembly, both of which were published after the submission of this manuscript. Conclusion SULT1A genes expanded from one to four copies in hominoids during intra-chromosomal LCR duplications, including (apparently one after the divergence of chimpanzees and humans. Thus, LCRs may
Two Rounds of Whole Genome Duplication in the AncestralVertebrate
Energy Technology Data Exchange (ETDEWEB)
Dehal, Paramvir; Boore, Jeffrey L.
2005-04-12
The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.
Molecular Evolution and Functional Diversification of Replication Protein A1 in Plants
Aklilu, Behailu B.; Culligan, Kevin M.
2016-01-01
Replication protein A (RPA) is a heterotrimeric, single-stranded DNA binding complex required for eukaryotic DNA replication, repair, and recombination. RPA is composed of three subunits, RPA1, RPA2, and RPA3. In contrast to single RPA subunit genes generally found in animals and yeast, plants encode multiple paralogs of RPA subunits, suggesting subfunctionalization. Genetic analysis demonstrates that five Arabidopsis thaliana RPA1 paralogs (RPA1A to RPA1E) have unique and overlapping functions in DNA replication, repair, and meiosis. We hypothesize here that RPA1 subfunctionalities will be reflected in major structural and sequence differences among the paralogs. To address this, we analyzed amino acid and nucleotide sequences of RPA1 paralogs from 25 complete genomes representing a wide spectrum of plants and unicellular green algae. We find here that the plant RPA1 gene family is divided into three general groups termed RPA1A, RPA1B, and RPA1C, which likely arose from two progenitor groups in unicellular green algae. In the family Brassicaceae the RPA1B and RPA1C groups have further expanded to include two unique sub-functional paralogs RPA1D and RPA1E, respectively. In addition, RPA1 groups have unique domains, motifs, cis-elements, gene expression profiles, and pattern of conservation that are consistent with proposed functions in monocot and dicot species, including a novel C-terminal zinc-finger domain found only in plant RPA1C-like sequences. These results allow for improved prediction of RPA1 subunit functions in newly sequenced plant genomes, and potentially provide a unique molecular tool to improve classification of Brassicaceae species. PMID:26858742
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
A paralogous decoy protects Phytophthora sojae apoplastic effector PsXEG1 from a host inhibitor.
Ma, Zhenchuan; Zhu, Lin; Song, Tianqiao; Wang, Yang; Zhang, Qi; Xia, Yeqiang; Qiu, Min; Lin, Yachun; Li, Haiyang; Kong, Liang; Fang, Yufeng; Ye, Wenwu; Wang, Yan; Dong, Suomeng; Zheng, Xiaobo; Tyler, Brett M; Wang, Yuanchao
2017-02-17
The extracellular space (apoplast) of plant tissue represents a critical battleground between plants and attacking microbes. Here we show that a pathogen-secreted apoplastic xyloglucan-specific endoglucanase, PsXEG1, is a focus of this struggle in the Phytophthora sojae -soybean interaction. We show that soybean produces an apoplastic glucanase inhibitor protein, GmGIP1, that binds to PsXEG1 to block its contribution to virulence. P. sojae , however, secretes a paralogous PsXEG1-like protein, PsXLP1, that has lost enzyme activity but binds to GmGIP1 more tightly than does PsXEG1, thus freeing PsXEG1 to support P. sojae infection. The gene pair encoding PsXEG1 and PsXLP1 is conserved in many Phytophthora species, and the P. parasitica orthologs PpXEG1 and PpXLP1 have similar functions. Thus, this apoplastic decoy strategy may be widely used in Phytophthora pathosystems. Copyright © 2017, American Association for the Advancement of Science.
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
Evolution of trappin genes in mammals
Directory of Open Access Journals (Sweden)
Furutani Yutaka
2010-01-01
Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
The evolution of Dscam genes across the arthropods.
Armitage, Sophie A O; Freiburg, Rebecca Y; Kurtz, Joachim; Bravo, Ignacio G
2012-04-13
One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv), which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuronal wiring where the extreme variability at the somatic level is required for axonal guidance, and it plays a role in immunity where the variability has been hypothesised to relate to recognition of different antigens. Dscam-hv has been found across the Pancrustacea. Additionally, three paralogous non-hypervariable Dscam-like genes have also been described for D. melanogaster. Here we took a bioinformatics approach, building profile Hidden Markov Models to search across species for putative orthologs to the Dscam genes and for hypervariable alternatively spliced exons, and inferring the phylogenetic relationships among them. Our aims were to examine whether Dscam orthologs exist outside the Bilateria, whether the origin of Dscam-hv could lie outside the Pancrustacea, when the Dscam-like orthologs arose, how many alternatively spliced exons of each exon cluster were present in the most common recent ancestor, and how these clusters evolved. Our results suggest that the origin of Dscam genes may lie after the split between the Cnidaria and the Bilateria and supports the hypothesis that Dscam-hv originated in the common ancestor of the Pancrustacea. Our phylogeny of Dscam gene family members shows six well-supported clades: five containing Dscam-like genes and one containing all the Dscam-hv genes, a seventh clade contains arachnid putative Dscam genes. Furthermore, the exon clusters appear to have experienced different evolutionary histories. Dscam genes have undergone independent duplication events in the insects and
The evolution of Dscam genes across the arthropods
Directory of Open Access Journals (Sweden)
Armitage Sophie AO
2012-04-01
Full Text Available Abstract Background One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv, which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuronal wiring where the extreme variability at the somatic level is required for axonal guidance, and it plays a role in immunity where the variability has been hypothesised to relate to recognition of different antigens. Dscam-hv has been found across the Pancrustacea. Additionally, three paralogous non-hypervariable Dscam-like genes have also been described for D. melanogaster. Here we took a bioinformatics approach, building profile Hidden Markov Models to search across species for putative orthologs to the Dscam genes and for hypervariable alternatively spliced exons, and inferring the phylogenetic relationships among them. Our aims were to examine whether Dscam orthologs exist outside the Bilateria, whether the origin of Dscam-hv could lie outside the Pancrustacea, when the Dscam-like orthologs arose, how many alternatively spliced exons of each exon cluster were present in the most common recent ancestor, and how these clusters evolved. Results Our results suggest that the origin of Dscam genes may lie after the split between the Cnidaria and the Bilateria and supports the hypothesis that Dscam-hv originated in the common ancestor of the Pancrustacea. Our phylogeny of Dscam gene family members shows six well-supported clades: five containing Dscam-like genes and one containing all the Dscam-hv genes, a seventh clade contains arachnid putative Dscam genes. Furthermore, the exon clusters appear to have experienced different evolutionary histories. Conclusions Dscam genes have
Kim, Seon-Hee; Bae, Young-An
2017-09-01
Tyrosinase provides an essential activity during egg production in diverse platyhelminths by mediating sclerotization of eggshells. In this study, we investigated the genomic and evolutionary features of tyrosinases in parasitic platyhelminths whose genomic information is available. A pair of paralogous tyrosinases was detected in most trematodes, whereas they were lost in cyclophyllidean cestodes. A pseudophyllidean cestode displaying egg biology similar to that of trematodes possessed an orthologous gene. Interestingly, one of the paralogous tyrosinases appeared to have been multiplied into three copies in Clonorchis sinensis and Opisthorchis viverrini. In addition, a fifth tyrosinase gene that was minimally transcribed through all developmental stages was further detected in these opisthorchiid genomes. Phylogenetic analyses demonstrated that the tyrosinase gene has undergone duplication at least three times in platyhelminths. The additional opisthorchiid gene arose from the first duplication. A paralogous copy generated from these gene duplications, except for the last one, seemed to be lost in the major neodermatans lineages. In C. sinensis, tyrosinase gene expressions were initiated following sexual maturation and the levels were significantly enhanced by the presence of O2 and bile. Taken together, our data suggest that tyrosinase has evolved lineage-specifically across platyhelminths related to its copy number and induction mechanism.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Energy Technology Data Exchange (ETDEWEB)
Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL
2009-01-01
Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Genes and proteins of Escherichia coli K-12.
Riley, M
1998-01-01
GenProtEC is a database of Escherichia coli genes and their gene products, classified by type of function and physiological role and with citations to the literature for each. Also present are data on sequence similarities among E.coli proteins, representing groups of paralogous genes, with PAM values, percent identity of amino acids, length of alignment and percent aligned. GenProtEC can be accessed at the URL http://www.mbl.edu/html/ecoli.html
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
An Expanding Role For Purine Uptake Permease (PUP -like Transporters In Plant Secondary Metabolism.
Directory of Open Access Journals (Sweden)
John G. Jelesko
2012-05-01
Full Text Available For the past decade, our understanding of the plant purine uptake permease (PUP transporter family of was primarily oriented on purine nucleobase substrates and their tissue-specific expression patterns in Arabidopsis. However, a tobacco PUP-like homolog demonstrating nicotine uptake permease (NUP activity was recently shown to affect both nicotine metabolism and root cell growth. These new findings expand the physiological role for PUP-like transporters to include plant secondary metabolism. Molecular evolution analyses of PUP-like transporters indicate they are distinct group within an ancient super family of drug and metabolite transporters (DMTs. The PUP-like family originated during terrestrial plant evolution sometime between the bryophytes and the lycophytes. A phylogenetic analysis indicates that the PUP-like transporters were likely were derived from a pre-existing nucleotide sugar transporter family within the DMT super family. Within the lycophyte Selaginella, there are three paralogous groups of PUP-like transporters. One of the three PUP-like paralogous groups showed an extensive pattern of gene duplication and diversification within the angiosperm lineage, whereas the other two more ancestral PUP-like paralogous groups did not. Biochemical characterization of four closely-related PUP-like paralogs together with model-based phylogenetic analyses indicate both subfunctionalization and neofunctionalization during the molecular evolution of angiosperm PUP-like transporters. These findings suggest that members of the PUP-like family of DMT transporters are likely involved in diverse primary and secondary plant metabolic pathways.
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.
Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J
2017-05-01
The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.
Directory of Open Access Journals (Sweden)
Xiao-Jian Sun
Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Structure and evolution of the plant cation diffusion facilitator family of ion transporters
Directory of Open Access Journals (Sweden)
Zanis Michael J
2011-03-01
Full Text Available Abstract Background Members of the cation diffusion facilitator (CDF family are integral membrane divalent cation transporters that transport metal ions out of the cytoplasm either into the extracellular space or into internal compartments such as the vacuole. The spectrum of cations known to be transported by proteins of the CDF family include Zn, Fe, Co, Cd, and Mn. Members of this family have been identified in prokaryotes, eukaryotes, and archaea, and in sequenced plant genomes. CDF families range in size from nine members in Selaginella moellendorffii to 19 members in Populus trichocarpa. Phylogenetic analysis suggests that the CDF family has expanded within plants, but a definitive plant CDF family phylogeny has not been constructed. Results Representative CDF members were annotated from diverse genomes across the Viridiplantae and Rhodophyta lineages and used to identify phylogenetic relationships within the CDF family. Bayesian phylogenetic analysis of CDF amino acid sequence data supports organizing land plant CDF family sequences into 7 groups. The origin of the 7 groups predates the emergence of land plants. Among these, 5 of the 7 groups are likely to have originated at the base of the tree of life, and 2 of 7 groups appear to be derived from a duplication event prior to or coincident with land plant evolution. Within land plants, local expansion continues within select groups, while several groups are strictly maintained as one gene copy per genome. Conclusions Defining the CDF gene family phylogeny contributes to our understanding of this family in several ways. First, when embarking upon functional studies of the members, defining primary groups improves the predictive power of functional assignment of orthologous/paralogous genes and aids in hypothesis generation. Second, defining groups will allow a group-specific sequence motif to be generated that will help define future CDF family sequences and aid in functional motif
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Jain, Sourabh; Panda, Arup; Colson, Philippe; Raoult, Didier; Pontarotti, Pierre
2017-04-07
With the inclusion of new members, understanding about evolutionary mechanisms and processes by which members of the proposed order, Megavirales, have evolved has become a key area of interest. The central role of gene acquisition has been shown in previous studies. However, the major drawback in gene acquisition studies is the focus on few MV families or putative families with large variation in their genetic structure. Thus, here we have tried to develop a methodology by which we can detect horizontal gene transfers (HGTs), taking into consideration orthologous groups of distantly related Megavirale families. Here, we report an automated workflow MimiLook, prepared as a Perl command line program, that deduces orthologous groups (OGs) from ORFomes of Megavirales and constructs phylogenetic trees by performing alignment generation, alignment editing and protein-protein BLAST (BLASTP) searching across the National Center for Biotechnology Information (NCBI) non-redundant (nr) protein sequence database. Finally, this tool detects statistically validated events of gene acquisitions with the help of the T-REX algorithm by comparing individual gene tree with NCBI species tree. In between the steps, the workflow decides about handling paralogs, filtering outputs, identifying Megavirale specific OGs, detection of HGTs, along with retrieval of information about those OGs that are monophyletic with organisms from cellular domains of life. By implementing MimiLook, we noticed that nine percent of Megavirale gene families (i.e., OGs) have been acquired by HGT, 80% OGs were Megaviralespecific and eight percent were found to be sharing common ancestry with members of cellular domains (Eukaryote, Bacteria, Archaea, Phages or other viruses) and three percent were ambivalent. The results are briefly discussed to emphasize methodology. Also, MimiLook is relevant for detecting evolutionary scenarios in other targeted phyla with user defined modifications. It can be accessed at
Phylogenetic analysis of ferlin genes reveals ancient eukaryotic origins
Directory of Open Access Journals (Sweden)
Lek Monkol
2010-07-01
Full Text Available Abstract Background The ferlin gene family possesses a rare and identifying feature consisting of multiple tandem C2 domains and a C-terminal transmembrane domain. Much currently remains unknown about the fundamental function of this gene family, however, mutations in its two most well-characterised members, dysferlin and otoferlin, have been implicated in human disease. The availability of genome sequences from a wide range of species makes it possible to explore the evolution of the ferlin family, providing contextual insight into characteristic features that define the ferlin gene family in its present form in humans. Results Ferlin genes were detected from all species of representative phyla, with two ferlin subgroups partitioned within the ferlin phylogenetic tree based on the presence or absence of a DysF domain. Invertebrates generally possessed two ferlin genes (one with DysF and one without, with six ferlin genes in most vertebrates (three DysF, three non-DysF. Expansion of the ferlin gene family is evident between the divergence of lamprey (jawless vertebrates and shark (cartilaginous fish. Common to almost all ferlins is an N-terminal C2-FerI-C2 sandwich, a FerB motif, and two C-terminal C2 domains (C2E and C2F adjacent to the transmembrane domain. Preservation of these structural elements throughout eukaryotic evolution suggests a fundamental role of these motifs for ferlin function. In contrast, DysF, C2DE, and FerA are optional, giving rise to subtle differences in domain topologies of ferlin genes. Despite conservation of multiple C2 domains in all ferlins, the C-terminal C2 domains (C2E and C2F displayed higher sequence conservation and greater conservation of putative calcium binding residues across paralogs and orthologs. Interestingly, the two most studied non-mammalian ferlins (Fer-1 and Misfire in model organisms C. elegans and D. melanogaster, present as outgroups in the phylogenetic analysis, with results suggesting
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.
2007-12-20
Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.
Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.
2011-01-01
All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296
Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P
2011-04-15
All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.
Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome
2013-01-01
Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in
Liu, Jianxia; Wang, Runmei; Liu, Wenying; Zhang, Hongli; Guo, Yaodong; Wen, Riyu
2018-01-23
Heat-shock proteins (HSPs) are ubiquitous proteins with important roles in response to biotic and abiotic stress. The 70-kDa heat-shock genes ( Hsp70s ) encode a group of conserved chaperone proteins that play central roles in cellular networks of molecular chaperones and folding catalysts across all the studied organisms including bacteria, plants and animals. Several Hsp70s involved in drought tolerance have been well characterized in various plants, whereas no research on Chenopodium quinoa HSPs has been completed. Here, we analyzed the genome of C. quinoa and identified sixteen Hsp70 members in quinoa genome. Phylogenetic analysis revealed the independent origination of those Hsp70 members, with eight paralogous pairs comprising the Hsp70 family in quinoa. While the gene structure and motif analysis showed high conservation of those paralogous pairs, the synteny analysis of those paralogous pairs provided evidence for expansion coming from the polyploidy event. With several subcellular localization signals detected in CqHSP70 protein paralogous pairs, some of the paralogous proteins lost the localization information, indicating the diversity of both subcellular localizations and potential functionalities of those HSP70s. Further gene expression analyses revealed by quantitative polymerase chain reaction (qPCR) analysis illustrated the significant variations of Cqhsp70s in response to drought stress. In conclusion, the sixteen Cqhsp70 s undergo lineage-specific expansions and might play important and varied roles in response to drought stress.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
The biocontrol agent, Trichoderma virens, has the ability to protect plants from pathogens by eliciting plant defense responses, involvement in mycoparasitism, or secreting antagonistic secondary metabolites. SM1, an elicitor of induced systemic resistance (ISR), was found to have three paralogs wi...
Govindaraj, Lekha; Gupta, Tania; Esvaran, Vijaya Gowri; Awasthi, Arvind Kumar; Ponnuvel, Kangayam M
2016-04-01
Sugar transporters play an essential role in controlling carbohydrate transport and are responsible for mediating the movement of sugars into cells. These genes exist as large multigene families within the insect genome. In insects, sugar transporters not only have a role in sugar transport, but may also act as receptors for virus entry. Genome-wide annotation of silkworm Bombyx mori (B. mori) revealed 100 putative sugar transporter (BmST) genes exists as a large multigene family and were classified into 11 sub families, through phylogenetic analysis. Chromosomes 27, 26 and 20 were found to possess the highest number of BmST paralogous genes, harboring 22, 7 and 6 genes, respectively. These genes occurred in clusters exhibiting the phenomenon of tandem gene duplication. The ovary, silk gland, hemocytes, midgut and malphigian tubules were the different tissues/cells enriched with BmST gene expression. The BmST gene BGIBMGA001498 had maximum EST transcripts of 134 and expressed exclusively in the malphigian tubule. The expression of EST transcripts of the BmST clustered genes on chromosome 27 was distributed in various tissues like testis, ovary, silk gland, malphigian tubule, maxillary galea, prothoracic gland, epidermis, fat body and midgut. Three sugar transporter genes (BmST) were constitutively expressed in the susceptible race and were down regulated upon BmNPV infection at 12h post infection (hpi). The expression pattern of these three genes was validated through real-time PCR in the midgut tissues at different time intervals from 0 to 30hpi. In the susceptible B. mori race, expression of sugar transporter genes was constitutively expressed making the host succumb to viral infection. Copyright © 2015 Elsevier B.V. All rights reserved.
Biederman, Michelle K; Nelson, Megan M; Asalone, Kathryn C; Pedersen, Alyssa L; Saldanha, Colin J; Bracht, John R
2018-05-21
Developmentally programmed genome rearrangements are rare in vertebrates, but have been reported in scattered lineages including the bandicoot, hagfish, lamprey, and zebra finch (Taeniopygia guttata) [1]. In the finch, a well-studied animal model for neuroendocrinology and vocal learning [2], one such programmed genome rearrangement involves a germline-restricted chromosome, or GRC, which is found in germlines of both sexes but eliminated from mature sperm [3, 4]. Transmitted only through the oocyte, it displays uniparental female-driven inheritance, and early in embryonic development is apparently eliminated from all somatic tissue in both sexes [3, 4]. The GRC comprises the longest finch chromosome at over 120 million base pairs [3], and previously the only known GRC-derived sequence was repetitive and non-coding [5]. Because the zebra finch genome project was sourced from male muscle (somatic) tissue [6], the remaining genomic sequence and protein-coding content of the GRC remain unknown. Here we report the first protein-coding gene from the GRC: a member of the α-soluble N-ethylmaleimide sensitive fusion protein (NSF) attachment protein (α-SNAP) family hitherto missing from zebra finch gene annotations. In addition to the GRC-encoded α-SNAP, we find an additional paralogous α-SNAP residing in the somatic genome (a somatolog)-making the zebra finch the first example in which α-SNAP is not a single-copy gene. We show divergent, sex-biased expression for the paralogs and also that positive selection is detectable across the bird α-SNAP lineage, including the GRC-encoded α-SNAP. This study presents the identification and evolutionary characterization of the first protein-coding GRC gene in any organism. Copyright © 2018 Elsevier Ltd. All rights reserved.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Directory of Open Access Journals (Sweden)
Yan Koon-Kiu
2007-11-01
Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Gramene 2018: unifying comparative genomics and pathway resources for plant research
Tello-Ruiz, Marcela K; Naithani, Sushma; Stein, Joshua C; Gupta, Parul; Campbell, Michael; Olson, Andrew; Wei, Sharon; Preece, Justin; Geniza, Matthew J; Jiao, Yinping; Lee, Young Koung; Wang, Bo; Mulvaney, Joseph; Chougule, Kapeel; Elser, Justin
2017-01-01
Abstract Gramene (http://www.gramene.org) is a knowledgebase for comparative functional analysis in major crops and model plant species. The current release, #54, includes over 1.7 million genes from 44 reference genomes, most of which were organized into 62,367 gene families through orthologous and paralogous gene classification, whole-genome alignments, and synteny. Additional gene annotations include ontology-based protein structure and function; genetic, epigenetic, and phenotypic diversi...
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
Ai, Chenbing; Liang, Yuting; Miao, Bo; Chen, Miao; Zeng, Weimin; Qiu, Guanzhou
2018-07-01
Iron-oxidizing Acidithiobacillus spp. are applied worldwide in biomining industry to extract metals from sulfide minerals. They derive energy for survival through Fe 2+ oxidation and generate Fe 3+ for the dissolution of sulfide minerals. However, molecular mechanisms of their iron oxidation still remain elusive. A novel two-cytochrome-encoding gene cluster (named tce gene cluster) encoding a high-molecular-weight cytochrome c (AFE_1428) and a c 4 -type cytochrome c 552 (AFE_1429) in A. ferrooxidans ATCC 23270 was first identified in this study. Bioinformatic analysis together with transcriptional study showed that AFE_1428 and AFE_1429 were the corresponding paralog of Cyc2 (AFE_3153) and Cyc1 (AFE_3152) which were encoded by the extensively studied rus operon and had been proven involving in ferrous iron oxidation. Both AFE_1428 and AFE_1429 contained signal peptide and the classic heme-binding motif(s) as their corresponding paralog. The modeled structure of AFE_1429 showed high resemblance to Cyc1. AFE_1428 and AFE_1429 were preferentially transcribed as their corresponding paralogs in the presence of ferrous iron as sole energy source as compared with sulfur. The tce gene cluster is highly conserved in the genomes of four phylogenetic-related A. ferrooxidans strains that were originally isolated from different sites separated with huge geographical distance, which further implies the importance of this gene cluster. Collectively, AFE_1428 and AFE_1429 involve in Fe 2+ oxidation like their corresponding paralog by integrating with the metalloproteins encoded by rus operon. This study provides novel insights into the Fe 2+ oxidation mechanism in Fe 2+ -oxidizing A. ferrooxidans ssp.
Evolution, diversification and expression of KNOX proteins in plants
Directory of Open Access Journals (Sweden)
Jie eGao
2015-10-01
Full Text Available The KNOX (KNOTTED1-like homeobox transcription factors play a pivotal role in leaf and meristem development. The majority of these proteins are characterized by the KNOX1, KNOX2, ELK and homeobox domains whereas the proteins of the KNATM family contain only the KNOX domains. We carried out an extensive inventory of these proteins and here report on a total of 394 KNOX proteins from 48 species. The land plant proteins fall into two classes (I and II as previously shown where the class I family seems to be most closely related to the green algae homologs. The KNATM proteins are restricted to Eudicots and some species have multiple paralogs of this protein. Certain plants are characterized by a significant increase in the number of KNOX paralogs; one example is Glycine max. Through the analysis of public gene expression data we show that the class II proteins of this plant have a relatively broad expression specificity as compared to class I proteins, consistent with previous studies of other plants. In G. max, class I protein are mainly distributed in axis tissues and KNATM paralogs are overall poorly expressed; highest expression is in the early plumular axis. Overall, analysis of gene expression in G. max demonstrates clearly that the expansion in gene number is associated with functional diversification.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Directory of Open Access Journals (Sweden)
Mitchell Douglas A
2010-05-01
Full Text Available Abstract Background A new family of natural products has been described in which cysteine, serine and threonine from ribosomally-produced peptides are converted to thiazoles, oxazoles and methyloxazoles, respectively. These metabolites and their biosynthetic gene clusters are now referred to as thiazole/oxazole-modified microcins (TOMM. As exemplified by microcin B17 and streptolysin S, TOMM precursors contain an N-terminal leader sequence and C-terminal core peptide. The leader sequence contains binding sites for the posttranslational modifying enzymes which subsequently act upon the core peptide. TOMM peptides are small and highly variable, frequently missed by gene-finders and occasionally situated far from the thiazole/oxazole forming genes. Thus, locating a substrate for a particular TOMM pathway can be a challenging endeavor. Results Examination of candidate TOMM precursors has revealed a subclass with an uncharacteristically long leader sequence closely related to the enzyme nitrile hydratase. Members of this nitrile hydratase leader peptide (NHLP family lack the metal-binding residues required for catalysis. Instead, NHLP sequences display the classic Gly-Gly cleavage motif and have C-terminal regions rich in heterocyclizable residues. The NHLP family exhibits a correlated species distribution and local clustering with an ABC transport system. This study also provides evidence that a separate family, annotated as Nif11 nitrogen-fixing proteins, can serve as natural product precursors (N11P, but not always of the TOMM variety. Indeed, a number of cyanobacterial genomes show extensive N11P paralogous expansion, such as Nostoc, Prochlorococcus and Cyanothece, which replace the TOMM cluster with lanthionine biosynthetic machinery. Conclusions This study has united numerous TOMM gene clusters with their cognate substrates. These results suggest that two large protein families, the nitrile hydratases and Nif11, have been retailored for
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
Grone, Brian P; Maruska, Karen P
2015-05-01
To investigate the origins of the vertebrate stress-response system, we searched sequenced vertebrate genomes for genes resembling corticotropin-releasing hormone (CRH). We found that vertebrate genomes possess, in addition to CRH, another gene that resembles CRH in sequence and syntenic environment. This paralogous gene was previously identified only in the elephant shark (a holocephalan), but we find it also in marsupials, monotremes, lizards, turtles, birds, and fishes. We examined the relationship of this second vertebrate CRH gene, which we name CRH2, to CRH1 (previously known as CRH) and urocortin1/urotensin1 (UCN1/UTS1) in primitive fishes, teleosts, and tetrapods. The paralogs CRH1 and CRH2 likely evolved via duplication of CRH during a whole-genome duplication early in the vertebrate lineage. CRH2 was subsequently lost in both teleost fishes and eutherian mammals but retained in other lineages. To determine where CRH2 is expressed relative to CRH1 and UTS1, we used in situ hybridization on brain tissue from spotted gar (Lepisosteus oculatus), a neopterygian fish closely related to teleosts. In situ hybridization revealed widespread distribution of both crh1 and uts1 in the brain. Expression of crh2 was restricted to the putative secondary gustatory/secondary visceral nucleus, which also expressed calcitonin-related polypeptide alpha (calca), a marker of parabrachial nucleus in mammals. Thus, the evolutionary history of CRH2 includes restricted expression in the brain, sequence changes, and gene loss, likely reflecting release of selective constraints following whole-genome duplication. The discovery of CRH2 opens many new possibilities for understanding the diverse functions of the CRH family of peptides across vertebrates. © 2015 Wiley Periodicals, Inc.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
Expression of POTE protein in human testis detected by novel monoclonal antibodies
International Nuclear Information System (INIS)
Ise, Tomoko; Das, Sudipto; Nagata, Satoshi; Maeda, Hiroshi; Lee, Yoomi; Onda, Masanori; Anver, Miriam R.; Bera, Tapan K.; Pastan, Ira
2008-01-01
The POTE gene family is composed of 13 highly homologous paralogs preferentially expressed in prostate, ovary, testis, and placenta. We produced 10 monoclonal antibodies (MAbs) against three representative POTE paralogs: POTE-21, POTE-2γC, and POTE-22. One reacted with all three paralogs, six MAbs reacted with POTE-2γC and POTE-22, and three MAbs were specific to POTE-21. Epitopes of all 10 MAbs were located in the cysteine-rich repeats (CRRs) motifs located at the N-terminus of each POTE paralog. Testing the reactivity of each MAb with 12 different CRRs revealed slight differences among the antigenic determinants, which accounts for differences in cross-reactivity. Using MAbs HP8 and PG5 we were able to detect a POTE-actin fusion protein in human testis by immunoprecipitation followed by Western blotting. By immunohistochemistry we demonstrated that the POTE protein is expressed in primary spermatocytes, implying a role in spermatogenesis
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.
Pophaly, Saurabh D; Tellier, Aurélien
2015-12-01
The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.
Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe
2015-11-01
A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Directory of Open Access Journals (Sweden)
My Thanh Le
Full Text Available Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4 in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae.
Le, My Thanh; van Veldhuizen, Mart; Porcelli, Ida; Bongaerts, Roy J.; Gaskin, Duncan J. H.; Pearson, Bruce M.; van Vliet, Arnoud H. M.
2015-01-01
Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs) have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4) in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR) of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae. PMID:26512728
Directory of Open Access Journals (Sweden)
Keyhani Nemat O
2004-06-01
Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
2.4 Å resolution crystal structure of human TRAP1NM, the Hsp90 paralog in the mitochondrial matrix.
Sung, Nuri; Lee, Jungsoon; Kim, Ji Hyun; Chang, Changsoo; Tsai, Francis T F; Lee, Sukyeong
2016-08-01
TRAP1 is an organelle-specific Hsp90 paralog that is essential for neoplastic growth. As a member of the Hsp90 family, TRAP1 is presumed to be a general chaperone facilitating the late-stage folding of Hsp90 client proteins in the mitochondrial matrix. Interestingly, TRAP1 cannot replace cytosolic Hsp90 in protein folding, and none of the known Hsp90 co-chaperones are found in mitochondria. Thus, the three-dimensional structure of TRAP1 must feature regulatory elements that are essential to the ATPase activity and chaperone function of TRAP1. Here, the crystal structure of a human TRAP1NM dimer is presented, featuring an intact N-domain and M-domain structure, bound to adenosine 5'-β,γ-imidotriphosphate (ADPNP). The crystal structure together with epitope-mapping results shows that the TRAP1 M-domain loop 1 contacts the neighboring subunit and forms a previously unobserved third dimer interface that mediates the specific interaction with mitochondrial Hsp70.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).
Brady, Seán G; Litman, Jessica R; Danforth, Bryan N
2011-09-01
The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Stuermer, Claudia A. O.; Plattner, Helmut
2013-01-01
The SPFH protein superfamily is assumed to occur universally in eukaryotes, but information from protozoa is scarce. In the Paramecium genome, we found only Stomatins, 20 paralogs grouped in 8 families, STO1 to STO8. According to cDNA analysis, all are expressed, and molecular modeling shows the typical SPFH domain structure for all subgroups. For further analysis we used family-specific sequences for fluorescence and immunogold labeling, gene silencing, and functional tests. With all family members tested, we found a patchy localization at/near the cell surface and on vesicles. The Sto1p and Sto4p families are also associated with the contractile vacuole complex. Sto4p also makes puncta on some food vacuoles and is abundant on vesicles recycling from the release site of spent food vacuoles to the site of nascent food vacuole formation. Silencing of the STO1 family reduces mechanosensitivity (ciliary reversal upon touching an obstacle), thus suggesting relevance for positioning of mechanosensitive channels in the plasmalemma. Silencing of STO4 members increases pulsation frequency of the contractile vacuole complex and reduces phagocytotic activity of Paramecium cells. In summary, Sto1p and Sto4p members seem to be involved in positioning specific superficial and intracellular microdomain-based membrane components whose functions may depend on mechanosensation (extracellular stimuli and internal osmotic pressure). PMID:23376944
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
Matus, José Tomás; Aquea, Felipe; Espinoza, Carmen; Vega, Andrea; Cavallini, Erika; Dal Santo, Silvia; Cañón, Paola; Rodríguez-Hoces de la Guardia, Amparo; Serrano, Jennifer; Tornielli, Giovanni Battista; Arce-Johnson, Patricio
2014-01-01
The RESPONSIVE TO DEHYDRATION 22 (RD22) gene is a molecular link between abscisic acid (ABA) signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses in grapevine.
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
The zebrafish genome: a review and msx gene case study.
Postlethwait, J H
2006-01-01
Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Diversity of 23S rRNA genes within individual prokaryotic genomes.
Directory of Open Access Journals (Sweden)
Anna Pei
Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
Librado, Pablo; Rozas, Julio
2013-01-01
Animal olfactory systems have a critical role for the survival and reproduction of individuals. In insects, the odorant-binding proteins (OBPs) are encoded by a moderately sized gene family, and mediate the first steps of the olfactory processing. Most OBPs are organized in clusters of a few paralogs, which are conserved over time. Currently, the biological mechanism explaining the close physical proximity among OBPs is not yet established. Here, we conducted a comprehensive study aiming to gain insights into the mechanisms underlying the OBP genomic organization. We found that the OBP clusters are embedded within large conserved arrangements. These organizations also include other non-OBP genes, which often encode proteins integral to plasma membrane. Moreover, the conservation degree of such large clusters is related to the following: 1) the promoter architecture of the confined genes, 2) a characteristic transcriptional environment, and 3) the chromatin conformation of the chromosomal region. Our results suggest that chromatin domains may restrict the location of OBP genes to regions having the appropriate transcriptional environment, leading to the OBP cluster structure. However, the appropriate transcriptional environment for OBP and the other neighbor genes is not dominated by reduced levels of expression noise. Indeed, the stochastic fluctuations in the OBP transcript abundance may have a critical role in the combinatorial nature of the olfactory coding process.
Comparative sequence analysis of nitrogen fixation-related genes in six legumes
Directory of Open Access Journals (Sweden)
Dong Hyun eKim
2013-08-01
Full Text Available Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e. Medicago truncatula (Mt, Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc, Phaseolus vulgaris (Pv and Glycine max (Gm. Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks and nonsynonymous substitutions per nonsynonymous site (Ka between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the farthest distance between Mt and Pv in 6 legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reported some interesting observations e.g. no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
LRR-RLK family from two Citrus species: genome-wide identification and evolutionary aspects.
Magalhães, Diogo M; Scholte, Larissa L S; Silva, Nicholas V; Oliveira, Guilherme C; Zipfel, Cyril; Takita, Marco A; De Souza, Alessandra A
2016-08-12
Leucine-rich repeat receptor-like kinases (LRR-RLKs) represent the largest subfamily of plant RLKs. The functions of most LRR-RLKs have remained undiscovered, and a few that have been experimentally characterized have been shown to have important roles in growth and development as well as in defense responses. Although RLK subfamilies have been previously studied in many plants, no comprehensive study has been performed on this gene family in Citrus species, which have high economic importance and are frequent targets for emerging pathogens. In this study, we performed in silico analysis to identify and classify LRR-RLK homologues in the predicted proteomes of Citrus clementina (clementine) and Citrus sinensis (sweet orange). In addition, we used large-scale phylogenetic approaches to elucidate the evolutionary relationships of the LRR-RLKs and further narrowed the analysis to the LRR-XII group, which contains several previously described cell surface immune receptors. We built integrative protein signature databases for Citrus clementina and Citrus sinensis using all predicted protein sequences obtained from whole genomes. A total of 300 and 297 proteins were identified as LRR-RLKs in C. clementina and C. sinensis, respectively. Maximum-likelihood phylogenetic trees were estimated using Arabidopsis LRR-RLK as a template and they allowed us to classify Citrus LRR-RLKs into 16 groups. The LRR-XII group showed a remarkable expansion, containing approximately 150 paralogs encoded in each Citrus genome. Phylogenetic analysis also demonstrated the existence of two distinct LRR-XII clades, each one constituted mainly by RD and non-RD kinases. We identified 68 orthologous pairs from the C. clementina and C. sinensis LRR-XII genes. In addition, among the paralogs, we identified a subset of 78 and 62 clustered genes probably derived from tandem duplication events in the genomes of C. clementina and C. sinensis, respectively. This work provided the first comprehensive
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Pomel, Sébastien; Diogon, Marie; Bouchard, Philippe; Pradel, Lydie; Ravet, Viviane; Coffe, Gérard; Viguès, Bernard
2006-02-01
Previous attempts to identify the membrane skeleton of Paramecium cells have revealed a protein pattern that is both complex and specific. The most prominent structural elements, epiplasmic scales, are centered around ciliary units and are closely apposed to the cytoplasmic side of the inner alveolar membrane. We sought to characterize epiplasmic scale proteins (epiplasmins) at the molecular level. PCR approaches enabled the cloning and sequencing of two closely related genes by amplifications of sequences from a macronuclear genomic library. Using these two genes (EPI-1 and EPI-2), we have contributed to the annotation of the Paramecium tetraurelia macronuclear genome and identified 39 additional (paralogous) sequences. Two orthologous sequences were found in the Tetrahymena thermophila genome. Structural analysis of the 43 sequences indicates that the hallmark of this new multigenic family is a 79 aa domain flanked by two Q-, P- and V-rich stretches of sequence that are much more variable in amino-acid composition. Such features clearly distinguish members of the multigenic family from epiplasmic proteins previously sequenced in other ciliates. The expression of Green Fluorescent Protein (GFP)-tagged epiplasmin showed significant labeling of epiplasmic scales as well as oral structures. We expect that the GFP construct described herein will prove to be a useful tool for comparative subcellular localization of different putative epiplasmins in Paramecium.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Maruyama, Daisuke; Sugiyama, Tomoyuki; Endo, Toshiya; Nishikawa, Shuh-Ichi
2014-04-01
Immunoglobulin-binding protein (BiP) is a molecular chaperone of the heat shock protein 70 (Hsp70) family. BiP is localized in the endoplasmic reticulum (ER) and plays key roles in protein translocation, protein folding and quality control in the ER. The genomes of flowering plants contain multiple BiP genes. Arabidopsis thaliana has three BiP genes. BIP1 and BIP2 are ubiquitously expressed. BIP3 encodes a less well conserved BiP paralog, and it is expressed only under ER stress conditions in the majority of organs. Here, we report that all BiP genes are expressed and functional in pollen and pollen tubes. Although the bip1 bip2 double mutation does not affect pollen viability, the bip1 bip2 bip3 triple mutation is lethal in pollen. This result indicates that lethality of the bip1 bip2 double mutation is rescued by BiP3 expression. A decrease in the copy number of the ubiquitously expressed BiP genes correlates well with a decrease in pollen tube growth, which leads to reduced fitness of mutant pollen during fertilization. Because an increased protein secretion activity is expected to increase the protein folding demand in the ER, the multiple BiP genes probably cooperate with each other to ensure ER homeostasis in cells with active secretion such as rapidly growing pollen tubes.
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
Directory of Open Access Journals (Sweden)
Lei Zhong
2017-11-01
Full Text Available In contrast to other olfactory receptor families that exhibit frequent lineage-specific expansions, the vomeronasal type 1 receptor (V1R family exhibits a canonical six-member repertoire in teleosts. V1r1 and V1r2 are present in no more than one copy in all examined teleosts, including salmons, which are ancient polyploids, implying strict evolutionary constraints. However, recent polyploids have not been examined. Here, we identified a young allotetraploid lineage of weatherfishes and investigated their V1r1-V1r2 cluster. We found a novel pattern that the parental V1r1-V1r2 clusters had recombined in the tetraploid genome and that the recombinant was nearly fixed in the tetraploid population. Subsequent analyses suggested strong selective pressure, for both a new combination of paralogs and homogeneity among gene duplicates, acting on the V1r1-V1r2 pair.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
Directory of Open Access Journals (Sweden)
2005-07-01
Full Text Available Heterochromatin comprises a significant component of many eukaryotic genomes. In comparison to euchromatin, heterochromatin is gene poor, transposon rich, and late replicating. It serves many important biological roles, from gene silencing to accurate chromosome segregation, yet little is known about the evolutionary constraints that shape heterochromatin. A complementary approach to the traditional one of directly studying heterochromatic DNA sequence is to study the evolution of proteins that bind and define heterochromatin. One of the best markers for heterochromatin is the heterochromatin protein 1 (HP1, which is an essential, nonhistone chromosomal protein. Here we investigate the molecular evolution of five HP1 paralogs present in Drosophila melanogaster. Three of these paralogs have ubiquitous expression patterns in adult Drosophila tissues, whereas HP1D/rhino and HP1E are expressed predominantly in ovaries and testes respectively. The HP1 paralogs also have distinct localization preferences in Drosophila cells. Thus, Rhino localizes to the heterochromatic compartment in Drosophila tissue culture cells, but in a pattern distinct from HP1A and lysine-9 dimethylated H3. Using molecular evolution and population genetic analyses, we find that rhino has been subject to positive selection in all three domains of the protein: the N-terminal chromo domain, the C-terminal chromo-shadow domain, and the hinge region that connects these two modules. Maximum likelihood analysis of rhino sequences from 20 species of Drosophila reveals that a small number of residues of the chromo and shadow domains have been subject to repeated positive selection. The rapid and positive selection of rhino is highly unusual for a gene encoding a chromosomal protein and suggests that rhino is involved in a genetic conflict that affects the germline, belying the notion that heterochromatin is simply a passive recipient of "junk DNA" in eukaryotic genomes.
Directory of Open Access Journals (Sweden)
Danielle Vermaak
2005-07-01
Full Text Available Heterochromatin comprises a significant component of many eukaryotic genomes. In comparison to euchromatin, heterochromatin is gene poor, transposon rich, and late replicating. It serves many important biological roles, from gene silencing to accurate chromosome segregation, yet little is known about the evolutionary constraints that shape heterochromatin. A complementary approach to the traditional one of directly studying heterochromatic DNA sequence is to study the evolution of proteins that bind and define heterochromatin. One of the best markers for heterochromatin is the heterochromatin protein 1 (HP1, which is an essential, nonhistone chromosomal protein. Here we investigate the molecular evolution of five HP1 paralogs present in Drosophila melanogaster. Three of these paralogs have ubiquitous expression patterns in adult Drosophila tissues, whereas HP1D/rhino and HP1E are expressed predominantly in ovaries and testes respectively. The HP1 paralogs also have distinct localization preferences in Drosophila cells. Thus, Rhino localizes to the heterochromatic compartment in Drosophila tissue culture cells, but in a pattern distinct from HP1A and lysine-9 dimethylated H3. Using molecular evolution and population genetic analyses, we find that rhino has been subject to positive selection in all three domains of the protein: the N-terminal chromo domain, the C-terminal chromo-shadow domain, and the hinge region that connects these two modules. Maximum likelihood analysis of rhino sequences from 20 species of Drosophila reveals that a small number of residues of the chromo and shadow domains have been subject to repeated positive selection. The rapid and positive selection of rhino is highly unusual for a gene encoding a chromosomal protein and suggests that rhino is involved in a genetic conflict that affects the germline, belying the notion that heterochromatin is simply a passive recipient of "junk DNA" in eukaryotic genomes.
Directory of Open Access Journals (Sweden)
Gabriel Forn-Cuní
Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Evolution of the vertebrate Pax4/6 class of genes with focus on its novel member, the Pax10 gene.
Feiner, Nathalie; Meyer, Axel; Kuraku, Shigehiro
2014-06-19
The members of the paired box (Pax) family regulate key developmental pathways in many metazoans as tissue-specific transcription factors. Vertebrate genomes typically possess nine Pax genes (Pax1-9), which are derived from four proto-Pax genes in the vertebrate ancestor that were later expanded through the so-called two-round (2R) whole-genome duplication. A recent study proposed that pax6a genes of a subset of teleost fishes (namely, acanthopterygians) are remnants of a paralog generated in the 2R genome duplication, to be renamed pax6.3, and reported one more group of vertebrate Pax genes (Pax6.2), most closely related to the Pax4/6 class. We propose to designate this new member Pax10 instead and reconstruct the evolutionary history of the Pax4/6/10 class with solid phylogenetic evidence. Our synteny analysis showed that Pax4, -6, and -10 originated in the 2R genome duplications early in vertebrate evolution. The phylogenetic analyses of relationships between teleost pax6a and other Pax4, -6, and -10 genes, however, do not support the proposed hypothesis of an ancient origin of the acanthopterygian pax6a genes in the 2R genome duplication. Instead, we confirmed the traditional scenario that the acanthopterygian pax6a is derived from the more recent teleost-specific genome duplication. Notably, Pax6 is present in all vertebrates surveyed to date, whereas Pax4 and -10 were lost multiple times in independent vertebrate lineages, likely because of their restricted expression patterns: Among Pax6-positive domains, Pax10 has retained expression in the adult retina alone, which we documented through in situ hybridization and quantitative reverse transcription polymerase chain reaction experiments on zebrafish, Xenopus, and anole lizard. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Directory of Open Access Journals (Sweden)
Bergthorsson Ulfar
2011-09-01
Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
2.4 Å resolution crystal structure of human TRAP1 NM , the Hsp90 paralog in the mitochondrial matrix
Energy Technology Data Exchange (ETDEWEB)
Sung, Nuri; Lee, Jungsoon; Kim, Ji-Hyun; Chang, Changsoo; Tsai, Francis T. F.; Lee, Sukyeong
2016-07-13
TRAP1 is an organelle-specific Hsp90 paralog that is essential for neoplastic growth. As a member of the Hsp90 family, TRAP1 is presumed to be a general chaperone facilitating the late-stage folding of Hsp90 client proteins in the mitochondrial matrix. Interestingly, TRAP1 cannot replace cytosolic Hsp90 in protein folding, and none of the known Hsp90 co-chaperones are found in mitochondria. Thus, the three-dimensional structure of TRAP1 must feature regulatory elements that are essential to the ATPase activity and chaperone function of TRAP1. Here, the crystal structure of a human TRAP1NMdimer is presented, featuring an intact N-domain and M-domain structure, bound to adenosine 5'-β,γ-imidotriphosphate (ADPNP). The crystal structure together with epitope-mapping results shows that the TRAP1 M-domain loop 1 contacts the neighboring subunit and forms a previously unobserved third dimer interface that mediates the specific interaction with mitochondrial Hsp70.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro
2016-06-01
Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
The tRNA synthetase paralog PoxA modifies elongation factor-P with (R)-ß-lysine
DEFF Research Database (Denmark)
Roy, Hervé; Zou, S Betty; Bullwinkle, Tammy J
2011-01-01
The lysyl-tRNA synthetase paralog PoxA modifies elongation factor P (EF-P) with a-lysine at low efficiency. Cell-free extracts containing non-a-lysine substrates of PoxA modified EF-P with a change in mass consistent with addition of ß-lysine, a substrate also predicted by genomic analyses. EF......-P was efficiently functionally modified with (R)-ß-lysine but not (S)-ß-lysine or genetically encoded a-amino acids, indicating that PoxA has evolved an activity orthogonal to that of the canonical aminoacyl-tRNA synthetases....
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Directory of Open Access Journals (Sweden)
José Tomás Matus
Full Text Available The RESPONSIVE TO DEHYDRATION 22 (RD22 gene is a molecular link between abscisic acid (ABA signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses
Directory of Open Access Journals (Sweden)
Dharma R Thapa
Full Text Available Individuals infected by HIV are at an increased risk for developing non-Hodgkin's lymphomas (AIDS-NHL. In the highly active antiretroviral therapy (HAART era, there has been a significant decline in the incidence of AIDS-associated primary central nervous system lymphoma (PCNSL. However, only a modest decrease in incidence has been reported for other AIDS-NHL subtypes. Thus, AIDS-NHLs remain a significant cause of morbidity and mortality in HIV infected individuals. Recently, much attention has been directed toward the role of miRNAs in cancer, including NHL. Several miRNAs, including those encoded by the miR-17-92 polycistron, have been shown to play significant roles in B cell tumorigenesis. However, the role of miRNAs in NHL in the setting of HIV infection has not been defined.We used quantitative realtime PCR to assess the expression of miRNAs from three different paralog clusters, miR-17-92, miR-106a-363, and miR-106b-25 in 24 cases of AIDS-NHLs representing four tumor types, Burkitt's lymphoma (BL, n = 6, diffuse large B-cell lymphoma (DLBCL, n = 8, primary central nervous system lymphoma (PCNSL, n = 5, and primary effusion lymphoma (PEL, n = 5. We also used microarray analysis to identify a differentiation specific miRNA signature of naïve, germinal center, and memory B cell subsets from tonsils (n = 4. miRNAs from the miR-17-92 paralog clusters were upregulated by B cells, specifically during the GC differentiation stage. We also found overexpression of these miRNA clusters in all four AIDS-NHL subtypes. Finally, we also show that select miRNAs from these clusters (miR-17, miR-106a, and miR-106b inhibited p21 in AIDS-BL and DLBCL cases, thus providing a mechanistic role for these miRNAs in AIDS-NHL pathogenesis.Dysregulation of miR-17-92 paralog clusters is a common feature of AIDS-associated NHLs.
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Guimaraes, Ana M S; Toth, Balazs; Santos, Andrea P; do Nascimento, Naíla C; Kritchevsky, Janice E; Messick, Joanne B
2012-11-01
We report the complete genome sequence of "Candidatus Mycoplasma haemolamae," an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation.
Guimaraes, Ana M. S.; Toth, Balazs; Santos, Andrea P.; do Nascimento, Naíla C.; Kritchevsky, Janice E.; Messick, Joanne B.
2012-01-01
We report the complete genome sequence of “Candidatus Mycoplasma haemolamae,” an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Catalase/peroxidases (KatGs) are a superfamily of reactive oxygen species (ROS)-degrading enzymes believed to be horizontally acquired by ancient Ascomycota from bacteria. Subsequent gene duplication resulted in two KatG paralogs in ascomycetes: the widely distributed intracellular KatG1 group, and ...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na
2017-07-15
Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.
Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.
1993-01-01
The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2010-10-08
The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.
Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A
2016-12-01
Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Directory of Open Access Journals (Sweden)
Ogunjumo Oluwasanmi
2004-06-01
Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
González, James; López, Geovani; Argueta, Stefany; Escalera-Fanjul, Ximena; El Hafidi, Mohammed; Campero-Basaldua, Carlos; Strauss, Joseph; Riego-Ruiz, Lina; González, Alicia
2017-11-01
Saccharomyces cerevisiae harbors BAT1 and BAT2 paralogous genes that encode branched chain aminotransferases and have opposed expression profiles and physiological roles . Accordingly, in primary nitrogen sources such as glutamine, BAT1 expression is induced, supporting Bat1-dependent valine-isoleucine-leucine (VIL) biosynthesis, while BAT2 expression is repressed. Conversely, in the presence of VIL as the sole nitrogen source, BAT1 expression is hindered while that of BAT2 is activated, resulting in Bat2-dependent VIL catabolism. The presented results confirm that BAT1 expression is determined by transcriptional activation through the action of the Leu3-α-isopropylmalate (α-IPM) active isoform, and uncovers the existence of a novel α-IPM biosynthetic pathway operating in a put3 Δ mutant grown on VIL, through Bat2-Leu2-Leu1 consecutive action. The classic α-IPM biosynthetic route operates in glutamine through the action of the leucine-sensitive α-IPM synthases. The presented results also show that BAT2 repression in glutamine can be alleviated in a ure2 Δ mutant or through Gcn4-dependent transcriptional activation. Thus, when S. cerevisiae is grown on glutamine, VIL biosynthesis is predominant and is preferentially achieved through BAT1 ; while on VIL as the sole nitrogen source, catabolism prevails and is mainly afforded by BAT2 . Copyright © 2017 by the Genetics Society of America.
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require
Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi
2007-03-01
To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
The Role of the S40 Gene Family in Leaf Senescence
Directory of Open Access Journals (Sweden)
Muhammad Jehanzeb
2017-10-01
Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands
Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.
2006-01-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
Highly syntenic regions in the genomes of soybean, Medicago truncatula, and Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Roe Bruce A
2005-08-01
Full Text Available Abstract Background Recent genome sequencing enables mega-base scale comparisons between related genomes. Comparisons between animals, plants, fungi, and bacteria demonstrate extensive synteny tempered by rearrangements. Within the legume plant family, glimpses of synteny have also been observed. Characterizing syntenic relationships in legumes is important in transferring knowledge from model legumes to crops that are important sources of protein, fixed nitrogen, and health-promoting compounds. Results We have uncovered two large soybean regions exhibiting synteny with M. truncatula and with a network of segmentally duplicated regions in Arabidopsis. In all, syntenic regions comprise over 500 predicted genes spanning 3 Mb. Up to 75% of soybean genes are colinear with M. truncatula, including one region in which 33 of 35 soybean predicted genes with database support are colinear to M. truncatula. In some regions, 60% of soybean genes share colinearity with a network of A. thaliana duplications. One region is especially interesting because this 500 kbp segment of soybean is syntenic to two paralogous regions in M. truncatula on different chromosomes. Phylogenetic analysis of individual genes within these regions demonstrates that one is orthologous to the soybean region, with which it also shows substantially denser synteny and significantly lower levels of synonymous nucleotide substitutions. The other M. truncatula region is inferred to be paralogous, presumably resulting from a duplication event preceding speciation. Conclusion The presence of well-defined M. truncatula segments showing orthologous and paralogous relationships with soybean allows us to explore the evolution of contiguous genomic regions in the context of ancient genome duplication and speciation events.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Leiomodins: larger members of the tropomodulin (Tmod) gene family
Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.
2001-01-01
The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Unusual Gene Order and Organization of the Sea Urchin HoxCluster
Energy Technology Data Exchange (ETDEWEB)
Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen,Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, KevinJ.; Hood, Leroy
2005-05-10
The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is : 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Myo-Jing Kim
2014-12-01
Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.
Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria
Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.
2003-01-01
The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.
COGNITIVE ENDOPHENOTYPES OF MODERN AND EXTINCT HOMININS ASSOCIATED WITH NTNG GENE PARALOGS
Itohara, Shigeyoshi; Hashimoto, Ryota; Polygalov, Denis; Mchugh, Thomas; Zhang, Qi; Prosselkov, Pavel; Kazutaka, Ohi; Takeda, Masatoshi
2016-01-01
A pair of vertebrate-specific and brain-expressed pre-synaptic genes, NTNG1 and NTNG2, contributes to the Intellectual Quotient (IQ) test scores in a complementary manner. Single nucleotide polymorphisms (SNPs) of NTNG1 are associated with attenuated verbal comprehension (VC) or processing speed (PS) while NTNG2 SNPs affect working memory (WM) and perceptual organization (PO), forming cognitive endophenotypes in healthy and schizophrenia (SCZ)-affected human subjects. Regions of interest (ROI...
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Directory of Open Access Journals (Sweden)
Sandra Gutiérrez
2012-01-01
Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.
Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B
2006-09-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.
Wolf Yuri I; Novichkov Pavel S; Sorokin Alexander V; Makarova Kira S; Koonin Eugene V
2007-01-01
Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs). Rapid accumulation of genome sequences creates opportunities for refining COGs ...
Directory of Open Access Journals (Sweden)
Renz Adina J
2011-01-01
Full Text Available Abstract Background Cichlid fishes have undergone rapid, expansive evolutionary radiations that are manifested in the diversification of their trophic morphologies, tooth patterning and coloration. Understanding the molecular mechanisms that underlie the cichlids' unique patterns of evolution requires a thorough examination of genes that pattern the neural crest, from which these diverse phenotypes are derived. Among those genes, the homeobox-containing Dlx gene family is of particular interest since it is involved in the patterning of the brain, jaws and teeth. Results In this study, we characterized the dlx genes of an African cichlid fish, Astatotilapia burtoni, to provide a baseline to later allow cross-species comparison within Cichlidae. We identified seven dlx paralogs (dlx1a, -2a, -4a, -3b, -4b, -5a and -6a, whose orthologies were validated with molecular phylogenetic trees. The intergenic regions of three dlx gene clusters (dlx1a-2a, dlx3b-4b, and dlx5a-6a were amplified with long PCR. Intensive cross-species comparison revealed a number of conserved non-coding elements (CNEs that are shared with other percomorph fishes. This analysis highlighted additional lineage-specific gains/losses of CNEs in different teleost fish lineages and a novel CNE that had previously not been identified. Our gene expression analyses revealed overlapping but distinct expression of dlx orthologs in the developing brain and pharyngeal arches. Notably, four of the seven A. burtoni dlx genes, dlx2a, dlx3b, dlx4a and dlx5a, were expressed in the developing pharyngeal teeth. Conclusion This comparative study of the dlx genes of A. burtoni has deepened our knowledge of the diversity of the Dlx gene family, in terms of gene repertoire, expression patterns and non-coding elements. We have identified possible cichlid lineage-specific changes, including losses of a subset of dlx expression domains in the pharyngeal teeth, which will be the targets of future functional
Gene-expression patterns in peripheral blood classify familial breast cancer susceptibility.
Piccolo, Stephen R; Andrulis, Irene L; Cohen, Adam L; Conner, Thomas; Moos, Philip J; Spira, Avrum E; Buys, Saundra S; Johnson, W Evan; Bild, Andrea H
2015-11-04
Women with a family history of breast cancer face considerable uncertainty about whether to pursue standard screening, intensive screening, or prophylactic surgery. Accurate and individualized risk-estimation approaches may help these women make more informed decisions. Although highly penetrant genetic variants have been associated with familial breast cancer (FBC) risk, many individuals do not carry these variants, and many carriers never develop breast cancer. Common risk variants have a relatively modest effect on risk and show limited potential for predicting FBC development. As an alternative, we hypothesized that additional genomic data types, such as gene-expression levels, which can reflect genetic and epigenetic variation, could contribute to classifying a person's risk status. Specifically, we aimed to identify common patterns in gene-expression levels across individuals who develop FBC. We profiled peripheral blood mononuclear cells from women with a family history of breast cancer (with or without a germline BRCA1/2 variant) and from controls. We used the support vector machines algorithm to differentiate between patients who developed FBC and those who did not. Our study used two independent datasets, a training set of 124 women from Utah (USA) and an external validation (test) set from Ontario (Canada) of 73 women (197 total). We controlled for expression variation associated with clinical, demographic, and treatment variables as well as lymphocyte markers. Our multigene biomarker provided accurate, individual-level estimates of FBC occurrence for the Utah cohort (AUC = 0.76 [0.67-84]) . Even at their lower confidence bounds, these accuracy estimates meet or exceed estimates from alternative approaches. Our Ontario cohort resulted in similarly high levels of accuracy (AUC = 0.73 [0.59-0.86]), thus providing external validation of our findings. Individuals deemed to have "high" risk by our model would have an estimated 2.4 times greater odds of
Dong, Chun-Juan; Shang, Qing-Mao
2013-07-01
Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.
Directory of Open Access Journals (Sweden)
Jason D. Gillman
2013-03-01
Full Text Available Seed phytate is a repository of P and minerals in soybean [ (L. Merr.] seeds that limits P and mineral bioavailability for monogastric animals (e.g., humans, swine [], and poultry [especially chicken, ] due to insufficient digestive tract phytase activity. We previously identified epistatic recessive mutations affecting two paralogous adenosine triphosphate-binding cassette phytic acid transporter genes (one a nonsense mutation in and the other a missense mutation in as the molecular genetic basis in the ethyl methanesulfonate (EMS-induced mutant low phytate soybean line M153. An additional mutant low phytate line, M766, contained one single nucleotide polymorphism within the ninth intron of the locus as well as a nonsense mutation in . The objectives of this research were to clarify the genetics underlying the low phytate phenotype in line M766 and to determine P partitioning in new combinations of mutant alleles from M766 and M153. Inheritance of nonsense alleles affecting both ( genes (one from M153 and one from M766 led to the production of viable seeds that contained transgressive reductions in total seed phytate and significantly higher levels of inorganic phosphate than has been reported for nontransgenic soybean material and will allow efficient molecular selection of soybeans with even greater reductions of phytate for improved quality soybean meal.
Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.
Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi
2008-07-01
Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.
Directory of Open Access Journals (Sweden)
Zhi Zou
Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.
Toth, Balazs; Santos, Andrea P.; do Nascimento, Naíla C.; Kritchevsky, Janice E.
2012-01-01
We report the complete genome sequence of “Candidatus Mycoplasma haemolamae,” an endemic red-cell pathogen of camelids. The single, circular chromosome has 756,845 bp, a 39.3% G+C content, and 925 coding sequences (CDSs). A great proportion (49.1%) of these CDSs are organized into paralogous gene families, which can now be further explored with regard to antigenic variation. PMID:23105057
International Nuclear Information System (INIS)
Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming
2012-01-01
Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.
International Nuclear Information System (INIS)
Veelen, Lieneke R. van; Essers, Jeroen; Rakt, Mandy W.M.M. van de; Odijk, Hanny; Pastink, Albert; Zdzienicka, MaIgorzata Z.; Paulusma, Coen C.; Kanaar, Roland
2005-01-01
Homologous recombination is of major importance for the prevention of genomic instability during chromosome duplication and repair of DNA damage, especially double-strand breaks. Biochemical experiments have revealed that during the process of homologous recombination the RAD52 group proteins, including Rad51, Rad52 and Rad54, are involved in an essential step: formation of a joint molecule between the broken DNA and the intact repair template. Accessory proteins for this reaction include the Rad51 paralogs and BRCA2. The significance of homologous recombination for the cell is underscored by the evolutionary conservation of the Rad51, Rad52 and Rad54 proteins from yeast to humans. Upon treatment of cells with ionizing radiation, the RAD52 group proteins accumulate at the sites of DNA damage into so-called foci. For the yeast Saccharomyces cerevisiae, foci formation of Rad51 and Rad54 is abrogated in the absence of Rad52, while Rad51 foci formation does occur in the absence of the Rad51 paralog Rad55. By contrast, we show here that in mammalian cells, Rad52 is not required for foci formation of Rad51 and Rad54. Furthermore, radiation-induced foci formation of Rad51 and Rad54 is impaired in all Rad51 paralog and BRCA2 mutant cell lines tested, while Rad52 foci formation is not influenced by a mutation in any of these recombination proteins. Despite their evolutionary conservation and biochemical similarities, S. cerevisiae and mammalian Rad52 appear to differentially contribute to the DNA-damage response