WorldWideScience

Sample records for paralogous gene families

  1. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  2. Characterization of paralogous protein families in rice

    Directory of Open Access Journals (Sweden)

    Zhu Wei

    2008-02-01

    Full Text Available Abstract Background High gene numbers in plant genomes reflect polyploidy and major gene duplication events. Oryza sativa, cultivated rice, is a diploid monocotyledonous species with a ~390 Mb genome that has undergone segmental duplication of a substantial portion of its genome. This, coupled with other genetic events such as tandem duplications, has resulted in a substantial number of its genes, and resulting proteins, occurring in paralogous families. Results Using a computational pipeline that utilizes Pfam and novel protein domains, we characterized paralogous families in rice and compared these with paralogous families in the model dicotyledonous diploid species, Arabidopsis thaliana. Arabidopsis, which has undergone genome duplication as well, has a substantially smaller genome (~120 Mb and gene complement compared to rice. Overall, 53% and 68% of the non-transposable element-related rice and Arabidopsis proteins could be classified into paralogous protein families, respectively. Singleton and paralogous family genes differed substantially in their likelihood of encoding a protein of known or putative function; 26% and 66% of singleton genes compared to 73% and 96% of the paralogous family genes encode a known or putative protein in rice and Arabidopsis, respectively. Furthermore, a major skew in the distribution of specific gene function was observed; a total of 17 Gene Ontology categories in both rice and Arabidopsis were statistically significant in their differential distribution between paralogous family and singleton proteins. In contrast to mammalian organisms, we found that duplicated genes in rice and Arabidopsis tend to have more alternative splice forms. Using data from Massively Parallel Signature Sequencing, we show that a significant portion of the duplicated genes in rice show divergent expression although a correlation between sequence divergence and correlation of expression could be seen in very young genes. Conclusion

  3. Functional evolution of a multigene family: orthologous and paralogous pheromone receptor genes in the turnip moth, Agrotis segetum.

    Directory of Open Access Journals (Sweden)

    Dan-Dan Zhang

    Full Text Available Lepidopteran pheromone receptors (PRs, for which orthologies are evident among closely related species, provide an intriguing example of gene family evolution in terms of how new functions may arise. However, only a limited number of PRs have been functionally characterized so far and thus evolutionary scenarios suffer from elements of speculation. In this study we investigated the turnip moth Agrotis segetum, in which female moths produce a mixture of chemically related pheromone components that elicit specific responses from receptor cells on male antennae. We cloned nine A. segetum PR genes and the Orco gene by degenerate primer based RT-PCR. The nine PR genes, named as AsegOR1 and AsegOR3-10, fall into four distinct orthologous clusters of known lepidopteran PRs, of which one contains six paralogues. The paralogues are under relaxed selective pressure, contrasting with the purifying selection on other clusters. We identified the receptors AsegOR9, AsegOR4 and AsegOR5, specific for the respective homologous pheromone components (Z-5-decenyl, (Z-7-dodecenyl and (Z-9-tetradecenyl acetates, by two-electrode voltage clamp recording from Xenopus laevis oocytes co-expressing Orco and each PR candidate. These receptors occur in three different orthologous clusters. We also found that the six paralogues with high sequence similarity vary dramatically in ligand selectivity and sensitivity. Different from AsegOR9, AsegOR6 showed a relatively large response to the behavioural antagonist (Z-5-decenol, and a small response to (Z-5-decenyl acetate. AsegOR1 was broadly tuned, but most responsive to (Z-5-decenyl acetate, (Z-7-dodecenyl acetate and the behavioural antagonist (Z-8-dodecenyl acetate. AsegOR8 and AsegOR7, which differ from AsegOR6 and AsegOR1 by 7 and 10 aa respectively, showed much lower sensitivities. AsegOR10 showed only small responses to all the tested compounds. These results suggest that new receptors arise through gene duplication, and

  4. Gene conversion homogenizes the CMT1A paralogous repeats

    Directory of Open Access Journals (Sweden)

    Hurles Matthew E

    2001-12-01

    Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.

  5. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  6. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  7. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Science.gov (United States)

    Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun

    2015-01-01

    Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  8. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...

  9. Investigating the effect of paralogs on microarray gene-set analysis

    LENUS (Irish Health Repository)

    Faure, Andre J

    2011-01-24

    Abstract Background In order to interpret the results obtained from a microarray experiment, researchers often shift focus from analysis of individual differentially expressed genes to analyses of sets of genes. These gene-set analysis (GSA) methods use previously accumulated biological knowledge to group genes into sets and then aim to rank these gene sets in a way that reflects their relative importance in the experimental situation in question. We suspect that the presence of paralogs affects the ability of GSA methods to accurately identify the most important sets of genes for subsequent research. Results We show that paralogs, which typically have high sequence identity and similar molecular functions, also exhibit high correlation in their expression patterns. We investigate this correlation as a potential confounding factor common to current GSA methods using Indygene http:\\/\\/www.cbio.uct.ac.za\\/indygene, a web tool that reduces a supplied list of genes so that it includes no pairwise paralogy relationships above a specified sequence similarity threshold. We use the tool to reanalyse previously published microarray datasets and determine the potential utility of accounting for the presence of paralogs. Conclusions The Indygene tool efficiently removes paralogy relationships from a given dataset and we found that such a reduction, performed prior to GSA, has the ability to generate significantly different results that often represent novel and plausible biological hypotheses. This was demonstrated for three different GSA approaches when applied to the reanalysis of previously published microarray datasets and suggests that the redundancy and non-independence of paralogs is an important consideration when dealing with GSA methodologies.

  10. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  11. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Science.gov (United States)

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Chromosome structures: reduction of certain problems with unequal gene content and gene paralogs to integer linear programming.

    Science.gov (United States)

    Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin

    2017-12-06

    Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these

  13. Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

    Science.gov (United States)

    Preston, Jill C.; Kellogg, Elizabeth A.

    2006-01-01

    Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

  14. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  15. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  16. Zebrafish brd2a and brd2b are paralogous members of the bromodomain-ET (BET family of transcriptional coregulators that show structural and expression divergence

    Directory of Open Access Journals (Sweden)

    Bee Katharine J

    2008-04-01

    Full Text Available Abstract Background Brd2 belongs to the bromodomain-extraterminal domain (BET family of transcriptional co-regulators, and functions as a pivotal histone-directed recruitment scaffold in chromatin modification complexes affecting signal-dependent transcription. Brd2 facilitates expression of genes promoting proliferation and is implicated in apoptosis and in egg maturation and meiotic competence in mammals; it is also a susceptibility gene for juvenile myoclonic epilepsy (JME in humans. The brd2 ortholog in Drosophila is a maternal effect, embryonic lethal gene that regulates several homeotic loci, including Ultrabithorax. Despite its importance, there are few systematic studies of Brd2 developmental expression in any organism. To help elucidate both conserved and novel gene functions, we cloned and characterized expression of brd2 cDNAs in zebrafish, a vertebrate system useful for genetic analysis of development and disease, and for study of the evolution of gene families and functional diversity in chordates. Results We identify cDNAs representing two paralogous brd2 loci in zebrafish, brd2a on chromosome 19 and brd2b on chromosome 16. By sequence similarity, syntenic and phylogenetic analyses, we present evidence for structural divergence of brd2 after gene duplication in fishes. brd2 paralogs show potential for modular domain combinations, and exhibit distinct RNA expression patterns throughout development. RNA in situ hybridizations in oocytes and embryos implicate brd2a and brd2b as maternal effect genes involved in egg polarity and egg to embryo transition, and as zygotic genes important for development of the vertebrate nervous system and for morphogenesis and differentiation of the digestive tract. Patterns of brd2 developmental expression in zebrafish are consistent with its proposed role in Homeobox gene regulation. Conclusion Expression profiles of zebrafish brd2 paralogs support a role in vertebrate developmental patterning and

  17. Orthology and paralogy constraints: satisfiability and consistency

    OpenAIRE

    Lafond, Manuel; El-Mabrouk, Nadia

    2014-01-01

    Background A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family   G . But is a given set   C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for   G ? While previous studies have focused on full sets of constraints, here we consider the general case where   C does not necessarily involve a ...

  18. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  19. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  20. Orthology and paralogy constraints: satisfiability and consistency.

    Science.gov (United States)

    Lafond, Manuel; El-Mabrouk, Nadia

    2014-01-01

    A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family  G. But is a given set  C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for  G? While previous studies have focused on full sets of constraints, here we consider the general case where  C does not necessarily involve a constraint for each pair of genes. The problem is subdivided in two parts: (1) Is  C satisfiable, i.e. can we find an event-labeled gene tree G inducing  C? (2) Is there such a G which is consistent, i.e., such that all displayed triplet phylogenies are included in a species tree? Previous results on the Graph sandwich problem can be used to answer to (1), and we provide polynomial-time algorithms for satisfiability and consistency with a given species tree. We also describe a new polynomial-time algorithm for the case of consistency with an unknown species tree and full knowledge of pairwise orthology/paralogy relationships, as well as a branch-and-bound algorithm in the case when unknown relations are present. We show that our algorithms can be used in combination with ProteinOrtho, a sequence similarity-based orthology detection tool, to extract a set of robust orthology/paralogy relationships.

  1. Transcriptional start site turnover in the evolution of bacterial paralogous genes - the pelE-pelD virulence genes in Dickeya.

    Science.gov (United States)

    Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie

    2016-11-01

    After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.

  2. Clusters of ancestrally related genes that show paralogy in whole or in part are a major feature of the genomes of humans and other species.

    Directory of Open Access Journals (Sweden)

    Michael B Walker

    Full Text Available Arrangements of genes along chromosomes are a product of evolutionary processes, and we can expect that preferable arrangements will prevail over the span of evolutionary time, often being reflected in the non-random clustering of structurally and/or functionally related genes. Such non-random arrangements can arise by two distinct evolutionary processes: duplications of DNA sequences that give rise to clusters of genes sharing both sequence similarity and common sequence features and the migration together of genes related by function, but not by common descent. To provide a background for distinguishing between the two, which is important for future efforts to unravel the evolutionary processes involved, we here provide a description of the extent to which ancestrally related genes are found in proximity.Towards this purpose, we combined information from five genomic datasets, InterPro, SCOP, PANTHER, Ensembl protein families, and Ensembl gene paralogs. The results are provided in publicly available datasets (http://cgd.jax.org/datasets/clustering/paraclustering.shtml describing the extent to which ancestrally related genes are in proximity beyond what is expected by chance (i.e. form paraclusters in the human and nine other vertebrate genomes, as well as the D. melanogaster, C. elegans, A. thaliana, and S. cerevisiae genomes. With the exception of Saccharomyces, paraclusters are a common feature of the genomes we examined. In the human genome they are estimated to include at least 22% of all protein coding genes. Paraclusters are far more prevalent among some gene families than others, are highly species or clade specific and can evolve rapidly, sometimes in response to environmental cues. Altogether, they account for a large portion of the functional clustering previously reported in several genomes.

  3. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Science.gov (United States)

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  4. Functional studies of heading date-related gene TaPRR73, a paralog of Ppd1 in common wheat

    Directory of Open Access Journals (Sweden)

    Wenping eZhang

    2016-06-01

    Full Text Available Photoperiod response-related genes play a crucial role in duration of the plant growth. In this study, we focused on TaPRR73, a paralog of Green Revolution gene Ppd1 (TaPRR37. We found that overexpression of the truncated TaPRR73 form lacking part of the N-terminal PR domain in transgenic rice promoted heading under long day conditions. Association analysis in common wheat verified that TaPRR73 was an important agronomic photoperiod response gene that significantly affected heading date and plant height; expression analysis proved that specific alleles of TaPRR73-A1 had highly expressed levels in earlier heading lines; the distribution of haplotypes indicated that one of these alleles had been selected in breeding programs. Our results demonstrated that TaPRR73 contributed to regulation of heading date in wheat and could be useful in wheat breeding and in broadening adaptation of the crop to new regions.

  5. On the Use of Gene Ontology Annotations to Assess Functional Similarity among Orthologs and Paralogs: A Short Report.

    Directory of Open Access Journals (Sweden)

    Paul D Thomas

    Full Text Available A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011 has proposed a metric for the "functional similarity" between two genes that uses only the Gene Ontology (GO annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the "ortholog conjecture" (or, more properly, the "ortholog functional conservation hypothesis". First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1 that GO annotations are often incomplete, potentially in a biased manner, and subject to an "open world assumption" (absence of an annotation does not imply absence of a function, and 2 that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the

  6. Gene conversion and DNA sequence polymorphism in the sex-determination gene fog-2 and its paralog ftr-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali

    2010-07-01

    Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.

  7. A crucial role of paralogous β-defensin genes in the Chinese alligator innate immune system revealed by the first determination of a Crocodilia defensin cluster.

    Science.gov (United States)

    Tang, Ke-Yi; Wang, Xin; Wan, Qiu-Hong; Fang, Sheng-Guo

    2018-04-01

    The β-defensin, one of the antimicrobial peptides (AMPs), is a significant component of the innate immune with a broad range of antimicrobial activities. Differing from the widely-studied mammals and birds, limited information about β-defensins has been reported in reptiles, especially in crocodilians. As a same ancient species as dinosaurs and the most endangered species of 23 crocodilians, the survival of Chinese alligator (Alligator sinensis) means a powerful immune system and possible involvement of AMPs in its immune resistance. In this study, we identified 20 novel Alligator sinensisβ-defensin genes (AsBDs) from a 390 kb region using bioinformatic and experimental approaches, and successfully distinguished six orthologous AsBDs to birds and nine paralogous AsBDs undergoing gene duplication events. The amino acid alignment shows that the AsBD paralogs, like α-defensins, encode a significantly longer pro-piece comparing with the orthologs. The calculation of non-synonymous (d N ) and synonymous (d S ) substitutions in the mature peptide reveals that the AsBD paralogs experience a significantly higher selective pressure (d N /d S ) than the orthologs, but a similar evolutionary force to α-defensins. The gene expression result indicates that the AsBD paralogs have a significantly higher expression level than the orthologos in gastrointestinal tract where the host is vulnerable to enteric pathogenic bacteria, as observed in α-defensins. These three pieces of evidence demonstrate that the AsBD paralogs do play an important role in maintaining long-term survival of this endangered reptile. Thus, this survey of AsBDs on the genomic structure, evolutionary characteristics, and expression pattern provides a genetic and immunological foundation for further investigating their antimicrobial function and alternative antibiotics potentiality. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    Science.gov (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  9. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  10. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  11. COGNITIVE ENDOPHENOTYPES OF MODERN AND EXTINCT HOMININS ASSOCIATED WITH NTNG GENE PARALOGS

    OpenAIRE

    Itohara, Shigeyoshi; Hashimoto, Ryota; Polygalov, Denis; Mchugh, Thomas; Zhang, Qi; Prosselkov, Pavel; Kazutaka, Ohi; Takeda, Masatoshi

    2016-01-01

    A pair of vertebrate-specific and brain-expressed pre-synaptic genes, NTNG1 and NTNG2, contributes to the Intellectual Quotient (IQ) test scores in a complementary manner. Single nucleotide polymorphisms (SNPs) of NTNG1 are associated with attenuated verbal comprehension (VC) or processing speed (PS) while NTNG2 SNPs affect working memory (WM) and perceptual organization (PO), forming cognitive endophenotypes in healthy and schizophrenia (SCZ)-affected human subjects. Regions of interest (ROI...

  12. The Pic19 NBS-LRR gene family members are closely linked to Scmv1, but not involved in maize resistance to sugarcane mosaic virus

    DEFF Research Database (Denmark)

    Jiang, Lu; Ingvardsen, Christina Rønn; Lübberstedt, Thomas

    2008-01-01

    the isolation and characterization of the Pic19R gene family members from the inbred line FAP1360A, which shows complete resistance to SCMV. Two primer pairs were designed based on the conserved regions among the known Pic19 paralogs and used for rapid amplification of cDNA ends of FAP1360A. Six full-length c...... of the Pic19R family indicated that the Pic19R-1 paralog is identical to the known Rxo1 gene conferring resistance to rice bacterial streak disease and none of the other Pic19R paralogs seems to be involved in resistance to SCMV...

  13. Genetic diversity and natural selection of Plasmodium knowlesi merozoite surface protein 1 paralog gene in Malaysia.

    Science.gov (United States)

    Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek

    2018-03-14

    Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural

  14. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015

  15. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Directory of Open Access Journals (Sweden)

    Palmer Jeffrey D

    2006-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and

  16. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Science.gov (United States)

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  17. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  18. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  19. The impact of paralogy on phylogenomic studies - a case study on annelid relationships.

    Directory of Open Access Journals (Sweden)

    Torsten H Struck

    Full Text Available Phylogenomic studies based on hundreds of genes derived from expressed sequence tags libraries are increasingly used to reveal the phylogeny of taxa. A prerequisite for these studies is the assignment of genes into clusters of orthologous sequences. Sophisticated methods of orthology prediction are used in such analyses, but it is rarely assessed whether paralogous sequences have been erroneously grouped together as orthologous sequences after the prediction, and whether this had an impact on the phylogenetic reconstruction using a super-matrix approach. Herein, I tested the impact of paralogous sequences on the reconstruction of annelid relationships based on phylogenomic datasets. Using single-partition analyses, screening for bootstrap support, blast searches and pruning of sequences in the supermatrix, wrongly assigned paralogous sequences were found in eight partitions and the placement of five taxa (the annelids Owenia, Scoloplos, Sthenelais and Eurythoe and the nemertean Cerebratulus including the robust bootstrap support could be attributed to the presence of paralogous sequences in two partitions. Excluding these sequences resulted in a different, weaker supported placement for these taxa. Moreover, the analyses revealed that paralogous sequences impacted the reconstruction when only a single taxon represented a previously supported higher taxon such as a polychaete family. One possibility of a priori detection of wrongly assigned paralogous sequences could combine 1 a screening of single-partition analyses based on criteria such as nodal support or internal branch length with 2 blast searches of suspicious cases as presented herein. Also possible are a posteriori approaches in which support for specific clades is investigated by comparing alternative hypotheses based on differences in per-site likelihoods. Increasing the sizes of EST libraries will also decrease the likelihood of wrongly assigned paralogous sequences, and in the case

  20. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Directory of Open Access Journals (Sweden)

    Roberta eAcri-Nunes-Miranda

    2014-03-01

    Full Text Available The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The ‘orchid code’ model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG- and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. Athens. The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like are exclusively expressed in gynostemium and ovary, however no

  1. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Science.gov (United States)

    Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana

    2014-01-01

    The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for

  2. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  3. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  4. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  5. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  6. Selection Signatures in the First Exon of Paralogous Receptor Kinase Genes from the Sym2 Region of the Pisum sativum L. Genome

    Directory of Open Access Journals (Sweden)

    Anton S. Sulima

    2017-11-01

    Full Text Available During the initial step of the symbiosis between legumes (Fabaceae and nitrogen-fixing bacteria (rhizobia, the bacterial signal molecule known as the Nod factor (nodulation factor is recognized by plant LysM motif-containing receptor-like kinases (LysM-RLKs. The fifth chromosome of barrel medic (Medicago truncatula Gaertn. contains a cluster of paralogous LysM-RLK genes, one of which is known to participate in symbiosis. In the syntenic region of the pea (Pisum sativum L. genome, three genes have been identified: PsK1 and PsSym37, two symbiosis-related LysM-RLK genes with known sequences, and the unsequenced PsSym2 gene which presumably encodes a LysM-RLK and is associated with increased selectivity to certain Nod factors. In this work, we identified a new gene encoding a LysM-RLK, designated as PsLykX, within the Sym2 genomic region. We sequenced the first exons (corresponding to the protein receptor domain of PsSym37, PsK1, and PsLykX from a large set of pea genotypes of diverse origin. The nucleotide diversity of these fragments was estimated and groups of haplotypes for each gene were revealed. Footprints of selection pressure were detected via comparative analyses of SNP distribution across the first exons of these genes and their homologs MtLYK2, MtLYK3, and MtLYK4 from M. truncatula retrieved from the Medicago Hapmap project. Despite the remarkable similarity among all the studied genes, they exhibited contrasting selection signatures, possibly pointing to diversification of their functions. Signatures of balancing selection were found in LysM1-encoding parts of PsSym37 and PsK1, suggesting that the diversity of these parts may be important for pea LysM-RLKs. The first exons of PsSym37 and PsK1 displayed signatures of purifying selection, as well as MtLYK2 of M. truncatula. Evidence of positive selection affecting primarily LysM domains was found in all three investigated M. truncatula genes, as well as in the pea gene PsLykX. The data

  7. Paralogous gene analysis reveals a highly enantioselective 1,2-O-isopropylideneglycerol caprylate esterase of Bacillus subtilis

    NARCIS (Netherlands)

    Droge, MJ; Bos, R; Quax, WJ

    Carboxylesterase NP of Bacillus subtilis Thai 1-8, characterized in 1992 as a very enantioselective (S)-naproxen esterase, was found to show no enantiopreference towards (S)-1,2-O-isopropylideneglycerol (IPG) esters. The ybfK gene was identified by the B. subtilis genome project as an unknown gene

  8. Similar but not the same: insights into the evolutionary history of paralogous sex-determining genes of the dwarf honey bee Apis florea.

    Science.gov (United States)

    Biewer, M; Lechner, S; Hasselmann, M

    2016-01-01

    Studying the fate of duplicated genes provides informative insight into the evolutionary plasticity of biological pathways to which they belong. In the paralogous sex-determining genes complementary sex determiner (csd) and feminizer (fem) of honey bee species (genus Apis), only heterozygous csd initiates female development. Here, the full-length coding sequences of the genes csd and fem of the phylogenetically basal dwarf honey bee Apis florea are characterized. Compared with other Apis species, remarkable evolutionary changes in the formation and localization of a protein-interacting (coiled-coil) motif and in the amino acids coding for the csd characteristic hypervariable region (HVR) are observed. Furthermore, functionally different csd alleles were isolated as genomic fragments from a random population sample. In the predicted potential specifying domain (PSD), a high ratio of πN/πS=1.6 indicated positive selection, whereas signs of balancing selection, commonly found in other Apis species, are missing. Low nucleotide diversity on synonymous and genome-wide, non-coding sites as well as site frequency analyses indicated a strong impact of genetic drift in A. florea, likely linked to its biology. Along the evolutionary trajectory of ~30 million years of csd evolution, episodic diversifying selection seems to have acted differently among distinct Apis branches. Consistently low amino-acid differences within the PSD among pairs of functional heterozygous csd alleles indicate that the HVR is the most important region for determining allele specificity. We propose that in the early history of the lineage-specific fem duplication giving rise to csd in Apis, A. florea csd stands as a remarkable example for the plasticity of initial sex-determining signals.

  9. Hox paralog group 2 genes control the migration of mouse pontine neurons through slit-robo signaling.

    Directory of Open Access Journals (Sweden)

    Marc J Geisen

    2008-06-01

    Full Text Available The pontine neurons (PN represent a major source of mossy fiber projections to the cerebellum. During mouse hindbrain development, PN migrate tangentially and sequentially along both the anteroposterior (AP and dorsoventral (DV axes. Unlike DV migration, which is controlled by the Netrin-1/Dcc attractive pathway, little is known about the molecular mechanisms guiding PN migration along the AP axis. Here, we show that Hoxa2 and Hoxb2 are required both intrinsically and extrinsically to maintain normal AP migration of subsets of PN, by preventing their premature ventral attraction towards the midline. Moreover, the migration defects observed in Hoxa2 and Hoxb2 mutant mice were phenocopied in compound Robo1;Robo2, Slit1;Slit2, and Robo2;Slit2 knockout animals, indicating that these guidance molecules act downstream of Hox genes to control PN migration. Indeed, using chromatin immunoprecipitation assays, we further demonstrated that Robo2 is a direct target of Hoxa2 in vivo and that maintenance of high Robo and Slit expression levels was impaired in Hoxa2 mutant mice. Lastly, the analysis of Phox2b-deficient mice indicated that the facial motor nucleus is a major Slit signaling source required to prevent premature ventral migration of PN. These findings provide novel insights into the molecular control of neuronal migration from transcription factor to regulation of guidance receptor and ligand expression. Specifically, they address the question of how exposure to multiple guidance cues along the AP and DV axes is regulated at the transcriptional level and in turn translated into stereotyped migratory responses during tangential migration of neurons in the developing mammalian brain.

  10. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh in vertebrates.

    Directory of Open Access Journals (Sweden)

    Joana Pereira

    Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  11. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh) in vertebrates.

    Science.gov (United States)

    Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  12. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  13. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  14. Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.

    Science.gov (United States)

    Goodstadt, Leo; Ponting, Chris P

    2006-09-29

    Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46%) of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a fast and robust

  15. Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.

    Directory of Open Access Journals (Sweden)

    Leo Goodstadt

    2006-09-01

    Full Text Available Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46% of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  17. Sphingolipid base modifying enzymes in sunflower (Helianthus annuus): cloning and characterization of a C4-hydroxylase gene and a new paralogous Δ8-desaturase gene.

    Science.gov (United States)

    Moreno-Pérez, Antonio J; Martínez-Force, Enrique; Garcés, Rafael; Salas, Joaquín J

    2011-05-15

    Sphingolipids are components of plant cell membranes that participate in the regulation of important physiological processes. Unlike their animal counterparts, plant sphingolipids are characterized by high levels of base C4-hydroxylation. Moreover, desaturation at the Δ8 position predominates over the Δ4 desaturation typically found in animal sphingolipids. These modifications are due to the action of C4-hydroxylases and Δ8-long chain base desaturases, and they are important for complex sphingolipids finally becoming functional. The long chain bases of sunflower sphingolipids have high levels of hydroxylated and unsaturated moieties. Here, a C4-long chain base hydroxylase was functionally characterized in sunflower plant, an enzyme that could complement the sur2Δ mutation when heterologously expressed in this yeast mutant deficient in hydroxylation. This hydroxylase was ubiquitously expressed in sunflower, with the highest levels found in the developing cotyledons. In addition, we identified a new Δ8-long base chain desaturase gene that displays strong homology to a previously reported desaturase gene. This desaturase was also expressed in yeast and was able to change the long chain base composition of the transformed host. We studied the expression of this desaturase and compared it with that of the other isoform described in sunflower. The desaturase form studied in this paper displayed higher expression levels in developing seeds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  18. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  19. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  20. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO and orthologous genes related by speciation events (PAOs, SMOs/APAOs. Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies.

  1. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  2. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  3. Petal-specific subfunctionalization of an APETALA3 paralog in the Ranunculales and its implications for petal evolution.

    Science.gov (United States)

    Sharma, Bharti; Guo, Chunce; Kong, Hongzhi; Kramer, Elena M

    2011-08-01

    • The petals of the lower eudicot family Ranunculaceae are thought to have been derived many times independently from stamens. However, investigation of the genetic basis of their identity has suggested an alternative hypothesis: that they share a commonly inherited petal identity program. This theory is based on the fact that an ancient paralogous lineage of APETALA3 (AP3) in the Ranunculaceae appears to have a conserved, petal-specific expression pattern. • Here, we have used a combination of approaches, including RNAi, comparative gene expression and molecular evolutionary studies, to understand the function of this petal-specific AP3 lineage. • Functional analysis of the Aquilegia locus AqAP3-3 has demonstrated that the paralog is required for petal identity with little contribution to the identity of the other floral organs. Expanded expression studies and analyses of molecular evolutionary patterns provide further evidence that orthologs of AqAP3-3 are primarily expressed in petals and are under higher purifying selection across the family than the other AP3 paralogs. • Taken together, these findings suggest that the AqAP3-3 lineage underwent progressive subfunctionalization within the order Ranunculales, ultimately yielding a specific role in petal identity that has probably been conserved, in stark contrast with the multiple independent origins predicted by botanical theories. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  4. Isolation, structural analysis, and expression characteristics of the maize nuclear factor Y gene families

    International Nuclear Information System (INIS)

    Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi

    2016-01-01

    NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.

  5. An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Directory of Open Access Journals (Sweden)

    Davis Thomas M

    2010-03-01

    Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

  6. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  7. Expression and phylogenetic analyses reveal paralogous lineages of putatively classical and non-classical MHC-I genes in three sparrow species (Passer).

    Science.gov (United States)

    Drews, Anna; Strandh, Maria; Råberg, Lars; Westerdahl, Helena

    2017-06-26

    The Major Histocompatibility Complex (MHC) plays a central role in immunity and has been given considerable attention by evolutionary ecologists due to its associations with fitness-related traits. Songbirds have unusually high numbers of MHC class I (MHC-I) genes, but it is not known whether all are expressed and equally important for immune function. Classical MHC-I genes are highly expressed, polymorphic and present peptides to T-cells whereas non-classical MHC-I genes have lower expression, are more monomorphic and do not present peptides to T-cells. To get a better understanding of the highly duplicated MHC genes in songbirds, we studied gene expression in a phylogenetic framework in three species of sparrows (house sparrow, tree sparrow and Spanish sparrow), using high-throughput sequencing. We hypothesize that sparrows could have classical and non-classical genes, as previously indicated though never tested using gene expression. The phylogenetic analyses reveal two distinct types of MHC-I alleles among the three sparrow species, one with high and one with low level of polymorphism, thus resembling classical and non-classical genes, respectively. All individuals had both types of alleles, but there was copy number variation both within and among the sparrow species. However, the number of highly polymorphic alleles that were expressed did not vary between species, suggesting that the structural genomic variation is counterbalanced by conserved gene expression. Overall, 50% of the MHC-I alleles were expressed in sparrows. Expression of the highly polymorphic alleles was very variable, whereas the alleles with low polymorphism had uniformly low expression. Interestingly, within an individual only one or two alleles from the polymorphic genes were highly expressed, indicating that only a single copy of these is highly expressed. Taken together, the phylogenetic reconstruction and the analyses of expression suggest that sparrows have both classical and non

  8. Paralogs hnRNP L and hnRNP LL exhibit overlapping but distinct RNA binding constraints.

    Directory of Open Access Journals (Sweden)

    Sarah A Smith

    Full Text Available HnRNP (heterogeneous nuclear ribonucleoprotein proteins are a large family of RNA-binding proteins that regulate numerous aspects of RNA processing. Interestingly, several paralogous pairs of hnRNPs exist that exhibit similar RNA-binding specificity to one another, yet have non-redundant functional targets in vivo. In this study we systematically investigate the possibility that the paralogs hnRNP L and hnRNP LL have distinct RNA binding determinants that may underlie their lack of functional redundancy. Using a combination of RNAcompete and native gel analysis we find that while both hnRNP L and hnRNP LL preferentially bind sequences that contain repeated CA dinucleotides, these proteins differ in their requirement for the spacing of the CAs. Specifically, hnRNP LL has a more stringent requirement for a two nucleotide space between CA repeats than does hnRNP L, resulting in hnRNP L binding more promiscuously than does hnRNP LL. Importantly, this differential requirement for the spacing of CA dinucleotides explains the previously observed differences in the sensitivity of hnRNP L and LL to mutations within the CD45 gene. We suggest that overlapping but divergent RNA-binding preferences, as we show here for hnRNP L and hnRNP LL, may be commonplace among other hnRNP paralogs.

  9. The lipoxygenase gene family: a genomic fossil of shared polyploidy between Glycine max and Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Choi Beom-Soon

    2008-12-01

    Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between

  10. miR-92a family and their target genes in tumorigenesis and metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)

    2014-04-15

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.

  11. miR-92a family and their target genes in tumorigenesis and metastasis

    International Nuclear Information System (INIS)

    Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang

    2014-01-01

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis

  12. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  13. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  14. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  15. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  16. Reverse genetic characterization of two paralogous acetoacetyl CoA thiolase genes in Arabidopsis reveals their importance in plant growth and development

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Huanan; Song, Zhihong; Nikolau, Basil J.

    2012-03-31

    Acetoacetyl CoA thiolase (AACT, EC 2.3.1.9) catalyzes the condensation of two acetyl CoA molecules to form acetoacetyl CoA. Two AACT‐encoding genes, At5g47720 (AACT1) and At5g48230 (AACT2), were functionally identified in the Arabidopsis genome by direct enzymological assays and functional expression in yeast. Promoter::GUS fusion experiments indicated that AACT1 is primarily expressed in the vascular system and AACT2 is highly expressed in root tips, young leaves, top stems and anthers. Characterization of T‐DNA insertion mutant alleles at each AACT locus established that AACT2 function is required for embryogenesis and for normal male gamete transmission. In contrast, plants lacking AACT1 function are completely viable and show no apparent growth phenotypes, indicating that AACT1 is functionally redundant with respect to AACT2 function. RNAi lines that express reduced levels of AACT2 show pleiotropic phenotypes, including reduced apical dominance, elongated life span and flowering duration, sterility, dwarfing, reduced seed yield and shorter root length. Microscopic analysis reveals that the reduced stature is caused by a reduction in cell size and fewer cells, and male sterility is caused by loss of the pollen coat and premature degeneration of the tapetal cells. Biochemical analyses established that the roots of AACT2 RNAi plants show quantitative and qualitative alterations in phytosterol profiles. These phenotypes and biochemical alterations are reversed when AACT2 RNAi plants are grown in the presence of mevalonate, which is consistent with the role of AACT2 in generating the bulk of the acetoacetyl CoA precursor required for the cytosol‐localized, mevalonate‐derived isoprenoid biosynthetic pathway.

  17. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  18. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families.

    Science.gov (United States)

    Voloshanenko, Oksana; Gmach, Philipp; Winter, Jan; Kranz, Dominique; Boutros, Michael

    2017-11-01

    Signaling pathway modules are often encoded by several closely related paralogous genes that can have redundant roles and are therefore difficult to analyze by loss-of-function analysis. A typical example is the Wnt signaling pathway, which in mammals is mediated by 19 Wnt ligands that can bind to 10 Frizzled (FZD) receptors. Although significant progress in understanding Wnt-FZD receptor interactions has been made in recent years, tools to generate systematic interaction maps have been largely lacking. Here we generated cell lines with multiplex mutant alleles of FZD1 , FZD2 , and FZD7 and demonstrate that these cells are unresponsive to canonical Wnt ligands. Subsequently, we performed genetic rescue experiments with combinations of FZDs and canonical Wnts to create a functional ligand-receptor interaction map. These experiments showed that whereas several Wnt ligands, such as Wnt3a, induce signaling through a broad spectrum of FZD receptors, others, such as Wnt8a, act through a restricted set of FZD genes. Together, our results map functional interactions of FZDs and 10 Wnt ligands and demonstrate how multiplex targeting by clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 can be used to systematically elucidate the functions of multigene families.-Voloshanenko, O., Gmach, P., Winter, J., Kranz, D., Boutros, M. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families. © The Author(s).

  19. Genomic assessment of the evolution of the prion protein gene family in vertebrates.

    Science.gov (United States)

    Harrison, Paul M; Khachane, Amit; Kumar, Manish

    2010-05-01

    Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long

  20. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  1. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    Science.gov (United States)

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  2. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  3. Genome-Wide Identification and Functional Analysis of the Calcineurin B-like Protein and Calcineurin B-like Protein-Interacting Protein Kinase Gene Families in Turnip (Brassica rapa var. rapa

    Directory of Open Access Journals (Sweden)

    Xin Yin

    2017-07-01

    Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.

  4. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  5. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  6. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  7. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  8. Genomic Anatomy of a Premier Major Histocompatibility Complex Paralogous Region on Chromosome 1q21–q22

    Science.gov (United States)

    Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi

    2001-01-01

    Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under

  9. Identifying pathogenicity of human variants via paralog-based yeast complementation.

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2017-05-01

    Full Text Available To better understand the health implications of personal genomes, we now face a largely unmet challenge to identify functional variants within disease-associated genes. Functional variants can be identified by trans-species complementation, e.g., by failure to rescue a yeast strain bearing a mutation in an orthologous human gene. Although orthologous complementation assays are powerful predictors of pathogenic variation, they are available for only a few percent of human disease genes. Here we systematically examine the question of whether complementation assays based on paralogy relationships can expand the number of human disease genes with functional variant detection assays. We tested over 1,000 paralogous human-yeast gene pairs for complementation, yielding 34 complementation relationships, of which 33 (97% were novel. We found that paralog-based assays identified disease variants with success on par with that of orthology-based assays. Combining all homology-based assay results, we found that complementation can often identify pathogenic variants outside the homologous sequence region, presumably because of global effects on protein folding or stability. Within our search space, paralogy-based complementation more than doubled the number of human disease genes with a yeast-based complementation assay for disease variation.

  10. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  12. Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.

    Directory of Open Access Journals (Sweden)

    Hui Song

    Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.

  13. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  14. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  15. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  16. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  17. Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family.

    Science.gov (United States)

    Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L

    2015-06-05

    The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD

  18. Novel male-biased expression in paralogs of the aphid slimfast nutrient amino acid transporter expansion

    Directory of Open Access Journals (Sweden)

    Nathanson Lubov

    2011-09-01

    Full Text Available Abstract Background A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are intriguing because the newly sequenced pea aphid genome harbors an extraordinary number of lineage-specific gene duplications relative to other insect genomes. Though many of their duplicated genes may be involved in their complex life cycle, duplications in nutrient amino acid transporters appear to be associated rather with their essential amino acid poor diet and the intracellular symbiosis aphids rely on to compensate for dietary deficits. Past work has shown that some duplicated amino acid transporters are highly expressed in the specialized cells housing the symbionts, including a paralog of an aphid-specific expansion homologous to the Drosophila gene slimfast. Previous data provide evidence that these bacteriocyte-expressed transporters mediate amino acid exchange between aphids and their symbionts. Results We report that some nutrient amino acid transporters show male-biased expression. Male-biased expression characterizes three paralogs in the aphid-specific slimfast expansion, and the male-biased expression is conserved across two aphid species for at least two paralogs. One of the male-biased paralogs has additionally experienced an accelerated rate of non-synonymous substitutions. Conclusions This is the first study to document male-biased slimfast expression. Our data suggest that the male-biased aphid slimfast paralogs diverged from their ancestral function to fill a functional role in males. Furthermore, our results provide evidence that members of the slimfast expansion are maintained in the aphid genome not only for the previously hypothesized role in mediating amino acid exchange between the symbiotic partners, but also for sex-specific roles.

  19. Differential paralog divergence modulates genome evolution across yeast species.

    Directory of Open Access Journals (Sweden)

    Monica R Sanchez

    2017-02-01

    Full Text Available Evolutionary outcomes depend not only on the selective forces acting upon a species, but also on the genetic background. However, large timescales and uncertain historical selection pressures can make it difficult to discern such important background differences between species. Experimental evolution is one tool to compare evolutionary potential of known genotypes in a controlled environment. Here we utilized a highly reproducible evolutionary adaptation in Saccharomyces cerevisiae to investigate whether experimental evolution of other yeast species would select for similar adaptive mutations. We evolved populations of S. cerevisiae, S. paradoxus, S. mikatae, S. uvarum, and interspecific hybrids between S. uvarum and S. cerevisiae for ~200-500 generations in sulfate-limited continuous culture. Wild-type S. cerevisiae cultures invariably amplify the high affinity sulfate transporter gene, SUL1. However, while amplification of the SUL1 locus was detected in S. paradoxus and S. mikatae populations, S. uvarum cultures instead selected for amplification of the paralog, SUL2. We measured the relative fitness of strains bearing deletions and amplifications of both SUL genes from different species, confirming that, converse to S. cerevisiae, S. uvarum SUL2 contributes more to fitness in sulfate limitation than S. uvarum SUL1. By measuring the fitness and gene expression of chimeric promoter-ORF constructs, we were able to delineate the cause of this differential fitness effect primarily to the promoter of S. uvarum SUL1. Our data show evidence of differential sub-functionalization among the sulfate transporters across Saccharomyces species through recent changes in noncoding sequence. Furthermore, these results show a clear example of how such background differences due to paralog divergence can drive changes in genome evolution.

  20. Decoding the Divergent Subcellular Location of Two Highly Similar Paralogous LEA Proteins

    Directory of Open Access Journals (Sweden)

    Marie-Hélène Avelange-Macherel

    2018-05-01

    Full Text Available Many mitochondrial proteins are synthesized as precursors in the cytosol with an N-terminal mitochondrial targeting sequence (MTS which is cleaved off upon import. Although much is known about import mechanisms and MTS structural features, the variability of MTS still hampers robust sub-cellular software predictions. Here, we took advantage of two paralogous late embryogenesis abundant proteins (LEA from Arabidopsis with different subcellular locations to investigate structural determinants of mitochondrial import and gain insight into the evolution of the LEA genes. LEA38 and LEA2 are short proteins of the LEA_3 family, which are very similar along their whole sequence, but LEA38 is targeted to mitochondria while LEA2 is cytosolic. Differences in the N-terminal protein sequences were used to generate a series of mutated LEA2 which were expressed as GFP-fusion proteins in leaf protoplasts. By combining three types of mutation (substitution, charge inversion, and segment replacement, we were able to redirect the mutated LEA2 to mitochondria. Analysis of the effect of the mutations and determination of the LEA38 MTS cleavage site highlighted important structural features within and beyond the MTS. Overall, these results provide an explanation for the likely loss of mitochondrial location after duplication of the ancestral gene.

  1. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  2. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  3. Computational Identification of the Paralogs and Orthologs of Human Cytochrome P450 Superfamily and the Implication in Drug Discovery

    Directory of Open Access Journals (Sweden)

    Shu-Ting Pan

    2016-06-01

    Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.

  4. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  5. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  6. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  7. Contrasting patterns in the evolution of the Rab GTPase family in Archaeplastida

    Directory of Open Access Journals (Sweden)

    Romana Petrželková

    2014-12-01

    Full Text Available Rab GTPases are a vast group of proteins serving a role of master regulators in membrane trafficking in eukaryotes. Previous studies delineated some 23 Rab and Rab-like paralogs ancestral for eukaryotes and mapped their current phylogenetic distribution, but the analyses relied on a limited sampling of the eukaryotic diversity. Taking advantage of the recent growth of genome and transcriptome resources for phylogenetically diverse plants and algae, we reanalyzed the evolution of the Rab family in eukaryotes with the primary plastid, collectively constituting the presumably monophyletic supergroup Archaeplastida. Our most important novel findings are as follows: (i the ancestral set of Rabs in Archaeplastida included not only the paralogs Rab1, Rab2, Rab5, Rab6, Rab7, Rab8, Rab11, Rab18, Rab23, Rab24, Rab28, IFT27, and RTW (=Rabl2, as suggested previously, but also Rab14 and Rab34, because Rab14 exists in glaucophytes and Rab34 is present in glaucophytes and some green algae; (ii except in embryophytes, Rab gene duplications have been rare in Archaeplastida. Most notable is the independent emergence of divergent, possibly functionally novel, in-paralogs of Rab1 and Rab11 in several archaeplastidial lineages; (iii recurrent gene losses have been a significant factor shaping Rab gene complements in archaeplastidial species; for example, the Rab21 paralog was lost at least six times independently within Archaeplastida, once in the lineage leading to the “core” eudicots; (iv while the glaucophyte Cyanophora paradoxa has retained the highest number of ancestral Rab paralogs among all archaeplastidial species studied so far, rhodophytes underwent an extreme reduction of the Rab gene set along their stem lineage, resulting in only six paralogs (Rab1, Rab2, Rab6, Rab7, Rab11, and Rab18 present in modern red algae. Especially notable is the absence of Rab5, a virtually universal paralog essential for the endocytic pathway, suggesting that endocytosis

  8. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  9. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben

    2008-01-01

    to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...

  10. Expansion and contraction of the DUP240 multigene family in Saccharomyces cerevisiae populations.

    OpenAIRE

    Leh-Louis, Véronique; Wirth, Bénédicte; Potier, Serge; Souciet, Jean-Luc; Despons, Laurence

    2004-01-01

    The influence of duplicated sequences on chromosomal stability is poorly understood. To characterize chromosomal rearrangements involving duplicated sequences, we compared the organization of tandem repeats of the DUP240 gene family in 15 Saccharomyces cerevisiae strains of various origins. The DUP240 gene family consists of 10 members of unknown function in the reference strain S288C. Five DUP240 paralogs on chromosome I and two on chromosome VII are arranged as tandem repeats that are highl...

  11. Paralog-divergent Features May Help Reduce Off-target Effects of Drugs: Hints from Glucagon Subfamily Analysis

    Directory of Open Access Journals (Sweden)

    Zhining Sa

    2017-08-01

    Full Text Available Side effects from targeted drugs remain a serious concern. One reason is the nonselective binding of a drug to unintended proteins such as its paralogs, which are highly homologous in sequences and have similar structures and drug-binding pockets. To identify targetable differences between paralogs, we analyzed two types (type-I and type-II of functional divergence between two paralogs in the known target protein receptor family G-protein coupled receptors (GPCRs at the amino acid level. Paralogous protein receptors in glucagon-like subfamily, glucagon receptor (GCGR and glucagon-like peptide-1 receptor (GLP-1R, exhibit divergence in ligands and are clinically validated drug targets for type 2 diabetes. Our data showed that type-II amino acids were significantly enriched in the binding sites of antagonist MK-0893 to GCGR, which had a radical shift in physicochemical properties between GCGR and GLP-1R. We also examined the role of type-I amino acids between GCGR and GLP-1R. The divergent features between GCGR and GLP-1R paralogs may be helpful in their discrimination, thus enabling the identification of binding sites to reduce undesirable side effects and increase the target specificity of drugs.

  12. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  13. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  14. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    Directory of Open Access Journals (Sweden)

    Qian Yan

    Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

  15. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  16. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  17. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  18. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  19. Genome-Wide Identification and Comparative Analysis of the 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase (HMGR Gene Family in Gossypium

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2018-01-01

    Full Text Available Terpenes are the largest and most diverse class of secondary metabolites in plants and play a very important role in plant adaptation to environment. 3-Hydroxy-3-methylglutaryl coenzyme A reductase (HMGR is a rate-limiting enzyme in the process of terpene biosynthesis in the cytosol. Previous study found the HMGR genes underwent gene expansion in Gossypium raimondii, but the characteristics and evolution of the HMGR gene family in Gossypium genus are unclear. In this study, genome-wide identification and comparative study of HMGR gene family were carried out in three Gossypium species with genome sequences, i.e., G. raimondii, Gossypium arboreum, and Gossypium hirsutum. In total, nine, nine and 18 HMGR genes were identified in G. raimondii, G. arboreum, and G. hirsutum, respectively. The results indicated that the HMGR genes underwent gene expansion and a unique gene cluster containing four HMGR genes was found in all the three Gossypium species. The phylogenetic analysis suggested that the expansion of HMGR genes had occurred in their common ancestor. There was a pseudogene that had a 10-bp deletion resulting in a frameshift mutation and could not be translated into functional proteins in G. arboreum and the A-subgenome of G. hirsutum. The expression profiles of the two pseudogenes showed that they had tissue-specific expression. Additionally, the expression pattern of the pseudogene in the A-subgenome of G. hirsutum was similar to its paralogous gene in the D-subgenome of G. hirsutum. Our results provide useful information for understanding cytosolic terpene biosynthesis in Gossypium species.

  20. A phylogenomic gene cluster resource: The phylogeneticallyinferred groups (PhlGs) database

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir S.; Boore, Jeffrey L.

    2005-08-25

    We present here the PhIGs database, a phylogenomic resource for sequenced genomes. Although many methods exist for clustering gene families, very few attempt to create truly orthologous clusters sharing descent from a single ancestral gene across a range of evolutionary depths. Although these non-phylogenetic gene family clusters have been used broadly for gene annotation, errors are known to be introduced by the artifactual association of slowly evolving paralogs and lack of annotation for those more rapidly evolving. A full phylogenetic framework is necessary for accurate inference of function and for many studies that address pattern and mechanism of the evolution of the genome. The automated generation of evolutionary gene clusters, creation of gene trees, determination of orthology and paralogy relationships, and the correlation of this information with gene annotations, expression information, and genomic context is an important resource to the scientific community.

  1. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  2. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  3. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  4. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  5. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  6. Roles of ATR1 paralogs YMR279c and YOR378w in boron stress tolerance

    International Nuclear Information System (INIS)

    Bozdag, Gonensin Ozan; Uluisik, Irem; Gulculer, Gulce Sila; Karakaya, Huseyin C.; Koc, Ahmet

    2011-01-01

    Highlights: → ATR1 paralog YMR279c plays role in boron detoxification. → YMR279c overexpression lowers cytoplasmic boron levels. → ATR1 paralog YOR378w has no roles in boron stress response. -- Abstract: Boron is a necessary nutrient for plants and animals, however excess of it causes toxicity. Previously, Atr1 and Arabidopsis Bor1 homolog were identified as the boron efflux pump in yeast, which lower the cytosolic boron concentration and help cells to survive in the presence of toxic amount of boron. In this study, we analyzed ATR1 paralogs, YMR279c and YOR378w, to understand whether they participate in boron stress tolerance in yeast. Even though these genes share homology with ATR1, neither their deletion rendered cells boron sensitive nor their expression was significantly upregulated by boron treatment. However, expression of YMR279, but not YOR378w, from the constitutive GAPDH promoter on a high copy plasmid provided remarkable boron resistance by decreasing intracellular boron levels. Thus our results suggest the presence of a third boron exporter, YMR279c, which functions similar to ATR1 and provides boron resistance in yeast.

  7. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    Science.gov (United States)

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  8. Evolution of the paralogous hap and iga genes in Haemophilus influenzae: evidence for a conserved hap pseudogene associated with microcolony formation in the recently diverged Haemophilus aegyptius and H. influenzae biogroup aegyptius

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Lomholt, Hans Bredsted

    2002-01-01

    genetic polymorphism and pronounced mosaic-like patterns in both genes, but no evidence of intrastrain recombination between the two genes. A conserved hap pseudogene was present in all strains of H. aegyptius and H. influenzae biogroup aegyptius, each of which constituted distinct subpopulations...... on conjunctival cells, previously termed microcolony formation. The fact that individual hap pseudogenes differed from the ancestral sequence by zero to two positions within a 1.5 kb stretch suggests that the silencing event happened approximately 2000-11,000 years ago. Divergence of H. aegyptius and H...

  9. Hsf and Hsp gene families in Populus: genome-wide identification, organization and correlated expression during development and in stress responses.

    Science.gov (United States)

    Zhang, Jin; Liu, Bobin; Li, Jianbo; Zhang, Li; Wang, Yan; Zheng, Huanquan; Lu, Mengzhu; Chen, Jun

    2015-03-14

    Heat shock proteins (Hsps) are molecular chaperones that are involved in many normal cellular processes and stress responses, and heat shock factors (Hsfs) are the transcriptional activators of Hsps. Hsfs and Hsps are widely coordinated in various biological processes. Although the roles of Hsfs and Hsps in stress responses have been well characterized in Arabidopsis, their roles in perennial woody species undergoing various environmental stresses remain unclear. Here, a comprehensive identification and analysis of Hsf and Hsp families in poplars is presented. In Populus trichocarpa, we identified 42 paralogous pairs, 66.7% resulting from a whole genome duplication. The gene structure and motif composition are relatively conserved in each subfamily. Microarray and quantitative real-time RT-PCR analyses showed that most of the Populus Hsf and Hsp genes are differentially expressed upon exposure to various stresses. A coexpression network between Populus Hsf and Hsp genes was generated based on their expression. Coordinated relationships were validated by transient overexpression and subsequent qPCR analyses. The comprehensive analysis indicates that different sets of PtHsps are downstream of particular PtHsfs and provides a basis for functional studies aimed at revealing the roles of these families in poplar development and stress responses.

  10. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  11. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  12. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  13. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  14. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  15. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  16. Expression Pattern of Two Paralogs Encoding Cinnamyl Alcohol Dehydrogenases in Arabidopsis. Isolation and Characterization of the Corresponding Mutants1

    Science.gov (United States)

    Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

    2003-01-01

    Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cβ. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units. PMID:12805615

  17. Expression pattern of two paralogs encoding cinnamyl alcohol dehydrogenases in Arabidopsis. Isolation and characterization of the corresponding mutants.

    Science.gov (United States)

    Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

    2003-06-01

    Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cbeta. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units.

  18. Cytochrome P450 1D1: A novel CYP1A-related gene that is not transcriptionally activated by PCB126 or TCDD

    DEFF Research Database (Denmark)

    Goldstone, J.V.; Jönsson, M.E.; Behrendt, Lars

    2009-01-01

    Enzymes in the cytochrome P450 1 family oxidize many common environmental toxicants. We identified a new CYP1, termed CYP1D1, in zebrafish. Phylogenetically, CYP1D1 is paralogous to CYP1A and the two share 45% amino acid identity and similar gene structure. In adult zebrafish, CYP1D1 is most high...

  19. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  20. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  1. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  2. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  3. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  4. Don't throw the baby out with the bathwater: identifying and mapping paralogs in salmonids.

    Science.gov (United States)

    Dufresne, France

    2016-01-01

    Many eukaryotic genomes contain a large fraction of gene duplicates (or paralogs) as a result of ancient or recent whole-genome duplications (Ohno 1970; Jaillon et al. 2004; Kellis et al. 2004). Identifying paralogs with NGS data is a pervasive problem in both ancient polyploids and neopolyploids. Likewise, paralogs are often treated as a nuisance that has to be detected and removed (Everett et al. 2012). In this issue of Molecular Ecology Resources, Waples et al. (2015) show that exclusion might not be necessary and how we may miss out on important genomic information in doing so. They present a novel statistical approach to detect paralogs based on the segregation of RAD loci in haploid offspring and test their method by constructing linkage maps with and without these duplicated loci in chum salmon, Oncorhynchus keta (Fig.1). Their linkage map including the resolved paralogs shows that these are mostly located in the distal regions of several linkage groups. Particularly intriguing is their finding that these homoeologous regions appear impoverished in transposable elements (TE). Given the role that TE play in genome remodelling, it is noteworthy that these elements are of low abundance in regions showing residual tetrasomic inheritance. This raises the question whether re-diploidization is constrained in these regions and whether they might have a role to play in salmonid speciation. This study provides an original approach to identifying duplicated loci in species with a pedigree, as well as providing a dense linkage map for chum salmon, and interesting insights into the retention of gene duplicates in an ancient polyploid. © 2015 John Wiley & Sons Ltd.

  5. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  6. Function of Rad51 paralogs in eukaryotic homologous recombinational repair

    International Nuclear Information System (INIS)

    Liu, N.; Skowronek, K.

    2003-01-01

    Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR

  7. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  8. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  9. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  10. Microbial Evolution: Xenology (Apparently) Trumps Paralogy.

    Science.gov (United States)

    Eme, Laura; Doolittle, W Ford

    2016-11-21

    Within-genome gene duplication is generally considered the source of extra copies when higher dosage is required and a starting point for evolution of new function. A new study suggests that horizontal gene transfer can appear to play both roles. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Phylogenomic approaches to common problems encountered in the analysis of low copy repeats: The sulfotransferase 1A gene family example

    Directory of Open Access Journals (Sweden)

    Benner Steven A

    2005-03-01

    Full Text Available Abstract Background Blocks of duplicated genomic DNA sequence longer than 1000 base pairs are known as low copy repeats (LCRs. Identified by their sequence similarity, LCRs are abundant in the human genome, and are interesting because they may represent recent adaptive events, or potential future adaptive opportunities within the human lineage. Sequence analysis tools are needed, however, to decide whether these interpretations are likely, whether a particular set of LCRs represents nearly neutral drift creating junk DNA, or whether the appearance of LCRs reflects assembly error. Here we investigate an LCR family containing the sulfotransferase (SULT 1A genes involved in drug metabolism, cancer, hormone regulation, and neurotransmitter biology as a first step for defining the problems that those tools must manage. Results Sequence analysis here identified a fourth sulfotransferase gene, which may be transcriptionally active, located on human chromosome 16. Four regions of genomic sequence containing the four human SULT1A paralogs defined a new LCR family. The stem hominoid SULT1A progenitor locus was identified by comparative genomics involving complete human and rodent genomes, and a draft chimpanzee genome. SULT1A expansion in hominoid genomes was followed by positive selection acting on specific protein sites. This episode of adaptive evolution appears to be responsible for the dopamine sulfonation function of some SULT enzymes. Each of the conclusions that this bioinformatic analysis generated using data that has uncertain reliability (such as that from the chimpanzee genome sequencing project has been confirmed experimentally or by a "finished" chromosome 16 assembly, both of which were published after the submission of this manuscript. Conclusion SULT1A genes expanded from one to four copies in hominoids during intra-chromosomal LCR duplications, including (apparently one after the divergence of chimpanzees and humans. Thus, LCRs may

  12. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  13. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  14. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  15. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  16. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  17. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  18. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  19. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  20. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  1. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  2. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  3. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  4. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  5. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  6. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  7. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  8. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  9. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  10. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  11. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  12. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  13. Relief of autoinhibition by conformational switch explains enzyme activation by a catalytically dead paralog

    Energy Technology Data Exchange (ETDEWEB)

    Volkov, Oleg A.; Kinch, Lisa; Ariagno, Carson; Deng, Xiaoyi; Zhong, Shihua; Grishin, Nick; Tomchick, Diana R.; Chen, Zhe; Phillips, Margaret A.

    2016-12-15

    Catalytically inactive enzyme paralogs occur in many genomes. Some regulate their active counterparts but the structural principles of this regulation remain largely unknown. We report X-ray structures ofTrypanosoma brucei S-adenosylmethionine decarboxylase alone and in functional complex with its catalytically dead paralogous partner, prozyme. We show monomericTbAdoMetDC is inactive because of autoinhibition by its N-terminal sequence. Heterodimerization with prozyme displaces this sequence from the active site through a complex mechanism involving acis-to-transproline isomerization, reorganization of a β-sheet, and insertion of the N-terminal α-helix into the heterodimer interface, leading to enzyme activation. We propose that the evolution of this intricate regulatory mechanism was facilitated by the acquisition of the dimerization domain, a single step that can in principle account for the divergence of regulatory schemes in the AdoMetDC enzyme family. These studies elucidate an allosteric mechanism in an enzyme and a plausible scheme by which such complex cooperativity evolved.

  14. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  15. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  16. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    Science.gov (United States)

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  17. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  18. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  19. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  20. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  2. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover using a large insert BAC library

    Directory of Open Access Journals (Sweden)

    Thomas Ann

    2009-07-01

    Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate

  3. Analysis of the reptile CD1 genes: evolutionary implications.

    Science.gov (United States)

    Yang, Zhi; Wang, Chunyan; Wang, Tao; Bai, Jianhui; Zhao, Yu; Liu, Xuhan; Ma, Qingwei; Wu, Xiaobing; Guo, Ying; Zhao, Yaofeng; Ren, Liming

    2015-06-01

    CD1, as the third family of antigen-presenting molecules, is previously only found in mammals and chickens, which suggests that the chicken and mammalian CD1 shared a common ancestral gene emerging at least 310 million years ago. Here, we describe CD1 genes in the green anole lizard and Crocodylia, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles. Although the reptilian CD1 protein structures are predicted to be similar to human CD1d and chicken CD1.1, CD1 isotypes are not found to be orthologous between mammals, birds, and reptiles according to phylogenetic analyses, suggesting an independent diversification of CD1 isotypes during the speciation of mammals, birds, and reptiles. In the green anole lizard, although the single CD1 locus and MHC I gene are located on the same chromosome, there is an approximately 10-Mb-long sequence in between, and interestingly, several genes flanking the CD1 locus belong to the MHC paralogous region on human chromosome 19. The CD1 genes in Crocodylia are located in two loci, respectively linked to the MHC region and MHC paralogous region (corresponding to the MHC paralogous region on chromosome 19). These results provide new insights for studying the origin and evolution of CD1.

  4. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Jason S Lehmann

    Full Text Available Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  5. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Science.gov (United States)

    Lehmann, Jason S; Fouts, Derrick E; Haft, Daniel H; Cannella, Anthony P; Ricaldi, Jessica N; Brinkac, Lauren; Harkins, Derek; Durkin, Scott; Sanka, Ravi; Sutton, Granger; Moreno, Angelo; Vinetz, Joseph M; Matthias, Michael A

    2013-01-01

    Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  6. SPOCS: Software for Predicting and Visualizing Orthology/Paralogy Relationships Among Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Darren S.; Phillips, Aaron R.; Callister, Stephen J.; Conlan, Sean; McCue, Lee Ann

    2013-10-15

    At the rate that prokaryotic genomes can now be generated, comparative genomics studies require a flexible method for quickly and accurately predicting orthologs among the rapidly changing set of genomes available. SPOCS implements a graph-based ortholog prediction method to generate a simple tab-delimited table of orthologs and in addition, html files that provide a visualization of the predicted ortholog/paralog relationships to which gene/protein expression metadata may be overlaid. AVAILABILITY AND IMPLEMENTATION: A SPOCS web application is freely available at http://cbb.pnnl.gov/portal/tools/spocs.html. Source code for Linux systems is also freely available under an open source license at http://cbb.pnnl.gov/portal/software/spocs.html; the Boost C++ libraries and BLAST are required.

  7. Roquin Paralogs Differentially Regulate Functional NKT Cell Subsets.

    Science.gov (United States)

    Drees, Christoph; Vahl, J Christoph; Bortoluzzi, Sabrina; Heger, Klaus D; Fischer, Julius C; Wunderlich, F Thomas; Peschel, Christian; Schmidt-Supprian, Marc

    2017-04-01

    NKT cells represent a small subset of glycolipid-recognizing T cells that are heavily implicated in human allergic, autoimmune, and malignant diseases. In the thymus, precursor cells recognize self-glycolipids by virtue of their semi-invariant TCR, which triggers NKT cell lineage commitment and maturation. During their development, NKT cells are polarized into the NKT1, NKT2, and NKT17 subsets, defined through their cytokine-secretion patterns and the expression of key transcription factors. However, we have largely ignored how the differentiation into the NKT cell subsets is regulated. In this article, we describe the mRNA-binding Roquin-1 and -2 proteins as central regulators of murine NKT cell fate decisions. In the thymus, T cell-specific ablation of the Roquin paralogs leads to a dramatic expansion of NKT17 cells, whereas peripheral mature NKT cells are essentially absent. Roquin-1/2-deficient NKT17 cells show exaggerated lineage-specific expression of nearly all NKT17-defining proteins tested. We show through mixed bone marrow chimera experiments that NKT17 polarization is mediated through cell-intrinsic mechanisms early during NKT cell development. In contrast, the loss of peripheral NKT cells is due to cell-extrinsic factors. Surprisingly, Roquin paralog-deficient NKT cells are, in striking contrast to conventional T cells, compromised in their ability to secrete cytokines. Altogether, we show that Roquin paralogs regulate the development and function of NKT cell subsets in the thymus and periphery. Copyright © 2017 by The American Association of Immunologists, Inc.

  8. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  9. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  10. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  11. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  12. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  13. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Evolutionary Expansion of WRKY Gene Family in Banana and Its Expression Profile during the Infection of Root Lesion Nematode, Pratylenchus coffeae

    Science.gov (United States)

    Suthanthiram, Backiyarani; Subbaraya, Uma; Marimuthu Somasundram, Saraswathi; Muthu, Mayilvaganan

    2016-01-01

    The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1) MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2) MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3) MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4) cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or repressors in a

  15. Evolutionary Expansion of WRKY Gene Family in Banana and Its Expression Profile during the Infection of Root Lesion Nematode, Pratylenchus coffeae.

    Directory of Open Access Journals (Sweden)

    Raja Kaliyappan

    Full Text Available The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1 MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2 MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3 MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4 cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or

  16. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  17. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  18. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  19. Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

    Directory of Open Access Journals (Sweden)

    Roger Andrew J

    2003-06-01

    Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

  20. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  1. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  2. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  3. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  4. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  5. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  6. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  7. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  8. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  9. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  10. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  11. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  12. Dynamic Changes in Yeast Phosphatase Families Allow for Specialization in Phosphate and Thiamine Starvation.

    Science.gov (United States)

    Nahas, John V; Iosue, Christine L; Shaik, Noor F; Selhorst, Kathleen; He, Bin Z; Wykoff, Dennis D

    2018-05-10

    Convergent evolution is often due to selective pressures generating a similar phenotype. We observe relatively recent duplications in a spectrum of Saccharomycetaceae yeast species resulting in multiple phosphatases that are regulated by different nutrient conditions - thiamine and phosphate starvation. This specialization is both transcriptional and at the level of phosphatase substrate specificity. In Candida glabrata , loss of the ancestral phosphatase family was compensated by the co-option of a different histidine phosphatase family with three paralogs. Using RNA-seq and functional assays, we identify one of these paralogs, CgPMU3 , as a thiamine phosphatase. We further determine that the 81% identical paralog CgPMU2 does not encode thiamine phosphatase activity; however, both are capable of cleaving the phosphatase substrate, 1-napthyl-phosphate. We functionally demonstrate that members of this family evolved novel enzymatic functions for phosphate and thiamine starvation, and are regulated transcriptionally by either nutrient condition, and observe similar trends in other yeast species. This independent, parallel evolution involving two different families of histidine phosphatases suggests that there were likely similar selective pressures on multiple yeast species to recycle thiamine and phosphate. In this work, we focused on duplication and specialization, but there is also repeated loss of phosphatases, indicating that the expansion and contraction of the phosphatase family is dynamic in many Ascomycetes. The dynamic evolution of the phosphatase gene families is perhaps just one example of how gene duplication, co-option, and transcriptional and functional specialization together allow species to adapt to their environment with existing genetic resources. Copyright © 2018, G3: Genes, Genomes, Genetics.

  13. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  14. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  15. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  16. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  17. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  18. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  19. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  20. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  1. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  2. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  3. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  4. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  5. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  6. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  7. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  8. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  9. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  10. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  11. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  12. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  13. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  14. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  15. Parallel evolution of tetrodotoxin resistance in three voltage-gated sodium channel genes in the garter snake Thamnophis sirtalis.

    Science.gov (United States)

    McGlothlin, Joel W; Chuckalovcak, John P; Janes, Daniel E; Edwards, Scott V; Feldman, Chris R; Brodie, Edmund D; Pfrender, Michael E; Brodie, Edmund D

    2014-11-01

    Members of a gene family expressed in a single species often experience common selection pressures. Consequently, the molecular basis of complex adaptations may be expected to involve parallel evolutionary changes in multiple paralogs. Here, we use bacterial artificial chromosome library scans to investigate the evolution of the voltage-gated sodium channel (Nav) family in the garter snake Thamnophis sirtalis, a predator of highly toxic Taricha newts. Newts possess tetrodotoxin (TTX), which blocks Nav's, arresting action potentials in nerves and muscle. Some Thamnophis populations have evolved resistance to extremely high levels of TTX. Previous work has identified amino acid sites in the skeletal muscle sodium channel Nav1.4 that confer resistance to TTX and vary across populations. We identify parallel evolution of TTX resistance in two additional Nav paralogs, Nav1.6 and 1.7, which are known to be expressed in the peripheral nervous system and should thus be exposed to ingested TTX. Each paralog contains at least one TTX-resistant substitution identical to a substitution previously identified in Nav1.4. These sites are fixed across populations, suggesting that the resistant peripheral nerves antedate resistant muscle. In contrast, three sodium channels expressed solely in the central nervous system (Nav1.1-1.3) showed no evidence of TTX resistance, consistent with protection from toxins by the blood-brain barrier. We also report the exon-intron structure of six Nav paralogs, the first such analysis for snake genes. Our results demonstrate that the molecular basis of adaptation may be both repeatable across members of a gene family and predictable based on functional considerations. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  17. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  18. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  19. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  20. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  1. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  2. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  3. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  4. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  5. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  6. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  7. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  8. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  9. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  10. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  11. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  12. Human GW182 Paralogs Are the Central Organizers for RNA-Mediated Control of Transcription.

    Science.gov (United States)

    Hicks, Jessica A; Li, Liande; Matsui, Masayuki; Chu, Yongjun; Volkov, Oleg; Johnson, Krystal C; Corey, David R

    2017-08-15

    In the cytoplasm, small RNAs can control mammalian translation by regulating the stability of mRNA. In the nucleus, small RNAs can also control transcription and splicing. The mechanisms for RNA-mediated nuclear regulation are not understood and remain controversial, hindering the effective application of nuclear RNAi and investigation of its natural regulatory roles. Here, we reveal that the human GW182 paralogs TNRC6A/B/C are central organizing factors critical to RNA-mediated transcriptional activation. Mass spectrometry of purified nuclear lysates followed by experimental validation demonstrates that TNRC6A interacts with proteins involved in protein degradation, RNAi, the CCR4-NOT complex, the mediator complex, and histone-modifying complexes. Functional analysis implicates TNRC6A, NAT10, MED14, and WDR5 in RNA-mediated transcriptional activation. These findings describe protein complexes capable of bridging RNA-mediated sequence-specific recognition of noncoding RNA transcripts with the regulation of gene transcription. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. A paralogous decoy protects Phytophthora sojae apoplastic effector PsXEG1 from a host inhibitor.

    Science.gov (United States)

    Ma, Zhenchuan; Zhu, Lin; Song, Tianqiao; Wang, Yang; Zhang, Qi; Xia, Yeqiang; Qiu, Min; Lin, Yachun; Li, Haiyang; Kong, Liang; Fang, Yufeng; Ye, Wenwu; Wang, Yan; Dong, Suomeng; Zheng, Xiaobo; Tyler, Brett M; Wang, Yuanchao

    2017-02-17

    The extracellular space (apoplast) of plant tissue represents a critical battleground between plants and attacking microbes. Here we show that a pathogen-secreted apoplastic xyloglucan-specific endoglucanase, PsXEG1, is a focus of this struggle in the Phytophthora sojae -soybean interaction. We show that soybean produces an apoplastic glucanase inhibitor protein, GmGIP1, that binds to PsXEG1 to block its contribution to virulence. P. sojae , however, secretes a paralogous PsXEG1-like protein, PsXLP1, that has lost enzyme activity but binds to GmGIP1 more tightly than does PsXEG1, thus freeing PsXEG1 to support P. sojae infection. The gene pair encoding PsXEG1 and PsXLP1 is conserved in many Phytophthora species, and the P. parasitica orthologs PpXEG1 and PpXLP1 have similar functions. Thus, this apoplastic decoy strategy may be widely used in Phytophthora pathosystems. Copyright © 2017, American Association for the Advancement of Science.

  14. Diversification of Transcriptional Regulation Determines Subfunctionalization of Paralogous Branched Chain Aminotransferases in the Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    González, James; López, Geovani; Argueta, Stefany; Escalera-Fanjul, Ximena; El Hafidi, Mohammed; Campero-Basaldua, Carlos; Strauss, Joseph; Riego-Ruiz, Lina; González, Alicia

    2017-11-01

    Saccharomyces cerevisiae harbors BAT1 and BAT2 paralogous genes that encode branched chain aminotransferases and have opposed expression profiles and physiological roles . Accordingly, in primary nitrogen sources such as glutamine, BAT1 expression is induced, supporting Bat1-dependent valine-isoleucine-leucine (VIL) biosynthesis, while BAT2 expression is repressed. Conversely, in the presence of VIL as the sole nitrogen source, BAT1 expression is hindered while that of BAT2 is activated, resulting in Bat2-dependent VIL catabolism. The presented results confirm that BAT1 expression is determined by transcriptional activation through the action of the Leu3-α-isopropylmalate (α-IPM) active isoform, and uncovers the existence of a novel α-IPM biosynthetic pathway operating in a put3 Δ mutant grown on VIL, through Bat2-Leu2-Leu1 consecutive action. The classic α-IPM biosynthetic route operates in glutamine through the action of the leucine-sensitive α-IPM synthases. The presented results also show that BAT2 repression in glutamine can be alleviated in a ure2 Δ mutant or through Gcn4-dependent transcriptional activation. Thus, when S. cerevisiae is grown on glutamine, VIL biosynthesis is predominant and is preferentially achieved through BAT1 ; while on VIL as the sole nitrogen source, catabolism prevails and is mainly afforded by BAT2 . Copyright © 2017 by the Genetics Society of America.

  15. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  16. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  17. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  18. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  19. Molecular and functional characterization of seven Na+/K+-ATPase β subunit paralogs in Senegalese sole (Solea senegalensis Kaup, 1858).

    Science.gov (United States)

    Armesto, Paula; Infante, Carlos; Cousin, Xavier; Ponce, Marian; Manchado, Manuel

    2015-04-01

    In the present work, seven genes encoding Na(+),K(+)-ATPase (NKA) β-subunits in the teleost Solea senegalensis are described for the first time. Sequence analysis of the predicted polypeptides revealed a high degree of conservation with those of other vertebrate species and maintenance of important motifs involved in structure and function. Phylogenetic analysis clustered the seven genes into four main clades: β1 (atp1b1a and atp1b1b), β2 (atp1b2a and atp1b2b), β3 (atp1b3a and atp1b3b) and β4 (atp1b4). In juveniles, all paralogous transcripts were detected in the nine tissues examined albeit with different expression patterns. The most ubiquitous expressed gene was atp1b1a whereas atp1b1b was mainly detected in osmoregulatory organs (gill, kidney and intestine), and atp1b2a, atp1b2b, atp1b3a, atp1b3b and atp1b4 in brain. An expression analysis in three brain regions and pituitary revealed that β1-type transcripts were more abundant in pituitary than the other β paralogs with slight differences between brain regions. Quantification of mRNA abundance in gills after a salinity challenge showed an activation of atp1b1a and atp1b1b at high salinity water (60 ppt) and atp1b3a and atp1b3b in response to low salinity (5 ppt). Transcriptional analysis during larval development showed specific expression patterns for each paralog. Moreover, no differences in the expression profiles between larvae cultivated at 10 and 35 ppt were observed except for atp1b4 with higher mRNA levels at 10 than 35 ppt at 18 days post hatch. Whole-mount in situ hybridization analysis revealed that atp1b1b was mainly localized in gut, pronephric tubule, gill, otic vesicle, and chordacentrum of newly hatched larvae. All these data suggest distinct roles of NKA β subunits in tissues, during development and osmoregulation with β1 subunits involved in the adaptation to hyperosmotic conditions and β3 subunits to hypoosmotic environments. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. ZP Domain Proteins in the Abalone Egg Coat Include a Paralog of VERL under Positive Selection That Binds Lysin and 18-kDa Sperm Proteins

    Science.gov (United States)

    Aagaard, Jan E.; Vacquier, Victor D.; MacCoss, Michael J.; Swanson, Willie J.

    2010-01-01

    Identifying fertilization molecules is key to our understanding of reproductive biology, yet only a few examples of interacting sperm and egg proteins are known. One of the best characterized comes from the invertebrate archeogastropod abalone (Haliotis spp.), where sperm lysin mediates passage through the protective egg vitelline envelope (VE) by binding to the VE protein vitelline envelope receptor for lysin (VERL). Rapid adaptive divergence of abalone lysin and VERL are an example of positive selection on interacting fertilization proteins contributing to reproductive isolation. Previously, we characterized a subset of the abalone VE proteins that share a structural feature, the zona pellucida (ZP) domain, which is common to VERL and the egg envelopes of vertebrates. Here, we use additional expressed sequence tag sequencing and shotgun proteomics to characterize this family of proteins in the abalone egg VE. We expand 3-fold the number of known ZP domain proteins present within the VE (now 30 in total) and identify a paralog of VERL (vitelline envelope zona pellucida domain protein [VEZP] 14) that contains a putative lysin-binding motif. We find that, like VERL, the divergence of VEZP14 among abalone species is driven by positive selection on the lysin-binding motif alone and that these paralogous egg VE proteins bind a similar set of sperm proteins including a rapidly evolving 18-kDa paralog of lysin, which may mediate sperm–egg fusion. This work identifies an egg coat paralog of VERL under positive selection and the candidate sperm proteins with which it may interact during abalone fertilization. PMID:19767347

  1. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  2. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  3. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  4. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  5. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  6. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  7. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  8. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  9. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  10. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  11. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  12. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  13. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  14. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  15. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  16. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  17. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  19. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  1. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  2. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  3. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  4. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  5. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  6. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  8. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  9. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  10. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  11. Control of Copper Resistance and Inorganic Sulfur Metabolism by Paralogous Regulators in Staphylococcus aureus*

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.

    2011-01-01

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296

  12. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus.

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P

    2011-04-15

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.

  13. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  14. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  15. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  16. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  17. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  19. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  20. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  1. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  2. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  3. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  4. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  5. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  6. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  7. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  8. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  9. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  10. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  11. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  12. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  13. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  14. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  15. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  16. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  17. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  18. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  19. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  20. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  1. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  2. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  3. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  4. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  5. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  6. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  7. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  8. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  9. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  10. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  12. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  13. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  14. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  15. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  16. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  17. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  18. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  19. Regulation of gill claudin paralogs by salinity, cortisol and prolactin in Mozambique tilapia (Oreochromis mossambicus).

    Science.gov (United States)

    Tipsmark, Christian K; Breves, Jason P; Rabeneck, D Brett; Trubitt, Rebecca T; Lerner, Darren T; Grau, E Gordon

    2016-09-01

    In euryhaline teleosts, reorganization of gill tight junctions during salinity acclimation involves dynamic expression of specific claudin (Cldn) paralogs. We identified four transcripts encoding Cldn tight junction proteins in the tilapia gill transcriptome: cldn10c, cldn10e, cldn28a and cldn30. A tissue distribution experiment found cldn10c and cldn10e expression levels in the gill to be 100-fold higher than any other tissues examined. cldn28a and cldn30 levels in the gill were 10-fold greater than levels in other tissues. Expression of these genes in Mozambique tilapia was examined during acclimation to fresh water (FW), seawater (SW), and in response to hormone treatments. Transfer of tilapia from FW to SW elevated cldn10c and cldn10e, while cldn28a and cldn30 were stimulated following transfer from SW to FW. In hypophysectomized tilapia transferred to FW, pituitary extirpation induced reduced expression of cldn10c, cldn10e and cldn28a; these effects were mitigated equally by either prolactin or cortisol replacement. In vitro experiments with gill filaments showed that cortisol stimulated expression of all four cldns examined, suggesting a direct action of cortisol in situ. Our data indicate that elevated cldn10c and cldn10e expression is important during acclimation of tilapia to SW possibly by conferring ion specific paracellular permeability. On the other hand, expression of cldn28a and cldn30 appears to contribute to reorganization of branchial epithelium during FW acclimation. Hormone treatment experiments showed that particular FW- and SW-induced cldns are controlled by cortisol and prolactin. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  1. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  2. Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula)

    Czech Academy of Sciences Publication Activity Database

    Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr

    2017-01-01

    Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016

  3. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  4. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  5. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  6. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  7. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  8. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  9. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  10. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Directory of Open Access Journals (Sweden)

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  11. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  12. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  14. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  15. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  16. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  17. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  18. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  19. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  20. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  1. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  2. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  3. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  4. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  5. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  6. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  7. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  8. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  9. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    Science.gov (United States)

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  11. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  12. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  13. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  14. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  15. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  16. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  17. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  19. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  1. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  2. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

    Science.gov (United States)

    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

    2008-07-01

    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

  3. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  4. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  5. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  6. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  7. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  8. A paralog of the proteinaceous elicitor sm1 affects colonization of maize roots by Trichoderma virens

    Science.gov (United States)

    The biocontrol agent, Trichoderma virens, has the ability to protect plants from pathogens by eliciting plant defense responses, involvement in mycoparasitism, or secreting antagonistic secondary metabolites. SM1, an elicitor of induced systemic resistance (ISR), was found to have three paralogs wi...

  9. A Theory of Utility Conditionals: Paralogical Reasoning from Decision-Theoretic Leakage

    Science.gov (United States)

    Bonnefon, Jean-Francois

    2009-01-01

    Many "if p, then q" conditionals have decision-theoretic features, such as antecedents or consequents that relate to the utility functions of various agents. These decision-theoretic features leak into reasoning processes, resulting in various paralogical conclusions. The theory of utility conditionals offers a unified account of the various forms…

  10. Evolution and Expression Patterns of CYC/TB1 Genes in Anacyclus: Phylogenetic Insights for Floral Symmetry Genes in Asteraceae

    Science.gov (United States)

    Bello, María A.; Cubas, Pilar; Álvarez, Inés; Sanjuanbenito, Guillermo; Fuertes-Aguilar, Javier

    2017-01-01

    Homologs of the CYC/TB1 gene family have been independently recruited many times across the eudicots to control aspects of floral symmetry The family Asteraceae exhibits the largest known diversification in this gene paralog family accompanied by a parallel morphological floral richness in its specialized head-like inflorescence. In Asteraceae, whether or not CYC/TB1 gene floral symmetry function is preserved along organismic and gene lineages is unknown. In this study, we used phylogenetic, structural and expression analyses focused on the highly derived genus Anacyclus (tribe Anthemidae) to address this question. Phylogenetic reconstruction recovered eight main gene lineages present in Asteraceae: two from CYC1, four from CYC2 and two from CYC3-like genes. The species phylogeny was recovered in most of the gene lineages, allowing the delimitation of orthologous sets of CYC/TB1 genes in Asteraceae. Quantitative real-time PCR analysis indicated that in Anacyclus three of the four isolated CYC2 genes are more highly expressed in ray flowers. The expression of the four AcCYC2 genes overlaps in several organs including the ligule of ray flowers, as well as in anthers and ovules throughout development. PMID:28487706

  11. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  12. The YsrS Paralog DygS Has the Capacity To Activate Expression of the Yersinia enterocolitica Ysa Type III Secretion System.

    Science.gov (United States)

    Walker, Kimberly A; Griggs, Lauren A; Obrist, Markus; Bode, Addys; Summers, R Patrick; Miller, Virginia L

    2016-06-15

    The Yersinia enterocolitica Ysa type III secretion system (T3SS) is associated with intracellular survival, and, like other characterized T3SSs, it is tightly controlled. Expression of the ysa genes is only detected following growth at low temperatures (26°C) and in high concentrations of sodium chloride (290 mM) in the medium. The YsrSTR phosphorelay (PR) system is required for ysa expression and likely responds to NaCl. During our investigations into the Ysr PR system, we discovered that genes YE3578 and YE3579 are remarkably similar to ysrR and ysrS, respectively, and are probably a consequence of a gene duplication event. The amino acid differences between YE3578 and ysrR are primarily clustered into two short regions. The differences between YE3579 and ysrS are nearly all located in the periplasmic sensing domain; the cytoplasmic domains are 98% identical. We investigated whether these paralogs were capable of activating ysa gene expression. We found that the sensor paralog, named DygS, is capable of compensating for loss of ysrS, but the response regulator paralog, DygR, cannot complement a ysrR gene deletion. In addition, YsrR, but not DygR, interacts with the histidine phosphorelay protein YsrT. Thus, DygS likely activates ysa gene expression in response to a signal other than NaCl and provides an example of a phosphorelay system in which two sensor kinases feed into the same regulatory pathway. All organisms need mechanisms to promote survival in changing environments. Prokaryotic phosphorelay systems are minimally comprised of a histidine kinase (HK) that senses an extracellular stimulus and a response regulator (RR) but can contain three or more proteins. Through gene duplication, a unique hybrid HK was created. We show that, while the hybrid appears to retain all of the phosphorelay functions, it responds to a different signal than the original. Both HKs transmit the signal to the same RR, which activates a promoter that transcribes a set of genes

  13. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  14. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

    Science.gov (United States)

    Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

    2017-09-27

    Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

  15. Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

    Directory of Open Access Journals (Sweden)

    Power Deborah M

    2010-12-01

    Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which

  16. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  17. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  18. Structural and binding properties of two paralogous fatty acid binding proteins of Taenia solium metacestode.

    Directory of Open Access Journals (Sweden)

    Seon-Hee Kim

    Full Text Available BACKGROUND: Fatty acid (FA binding proteins (FABPs of helminths are implicated in acquisition and utilization of host-derived hydrophobic substances, as well as in signaling and cellular interactions. We previously demonstrated that secretory hydrophobic ligand binding proteins (HLBPs of Taenia solium metacestode (TsM, a causative agent of neurocysticercosis (NC, shuttle FAs in the surrounding host tissues and inwardly transport the FAs across the parasite syncytial membrane. However, the protein molecules responsible for the intracellular trafficking and assimilation of FAs have remained elusive. METHODOLOGY/PRINCIPAL FINDINGS: We isolated two novel TsMFABP genes (TsMFABP1 and TsMFABP2, which encoded 133- and 136-amino acid polypeptides with predicted molecular masses of 14.3 and 14.8 kDa, respectively. They shared 45% sequence identity with each other and 15-95% with other related-members. Homology modeling demonstrated a characteristic β-barrel composed of 10 anti-parallel β-strands and two α-helices. TsMFABP2 harbored two additional loops between β-strands two and three, and β-strands six and seven, respectively. TsMFABP1 was secreted into cyst fluid and surrounding environments, whereas TsMFABP2 was intracellularly confined. Partially purified native proteins migrated to 15 kDa with different isoelectric points of 9.2 (TsMFABP1 and 8.4 (TsMFABP2. Both native and recombinant proteins bound to 11-([5-dimethylaminonaphthalene-1-sulfonyl]aminoundecannoic acid, dansyl-DL-α-amino-caprylic acid, cis-parinaric acid and retinol, which were competitively inhibited by oleic acid. TsMFABP1 exhibited high affinity toward FA analogs. TsMFABPs showed weak binding activity to retinol, but TsMFABP2 showed relatively high affinity. Isolation of two distinct genes from an individual genome strongly suggested their paralogous nature. Abundant expression of TsMFABP1 and TsMFABP2 in the canal region of worm matched well with the histological distributions

  19. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

    Science.gov (United States)

    Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

    2016-09-01

    The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

  20. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  1. Models of gene gain and gene loss for probabilistic reconstruction of gene content in the last universal common ancestor of life.

    Science.gov (United States)

    Kannan, Lavanya; Li, Hua; Rubinstein, Boris; Mushegian, Arcady

    2013-12-19

    The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral ("high ancestrality"). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes.

  2. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  4. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  5. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  6. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  7. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family.

    Science.gov (United States)

    Guo, Chunlei; Guo, Rongrong; Xu, Xiaozhao; Gao, Min; Li, Xiaoqin; Song, Junyang; Zheng, Yi; Wang, Xiping

    2014-04-01

    WRKY proteins comprise a large family of transcription factors that play important roles in plant defence regulatory networks, including responses to various biotic and abiotic stresses. To date, no large-scale study of WRKY genes has been undertaken in grape (Vitis vinifera L.). In this study, a total of 59 putative grape WRKY genes (VvWRKY) were identified and renamed on the basis of their respective chromosome distribution. A multiple sequence alignment analysis using all predicted grape WRKY genes coding sequences, together with those from Arabidopsis thaliana and tomato (Solanum lycopersicum), indicated that the 59 VvWRKY genes can be classified into three main groups (I-III). An evaluation of the duplication events suggested that several WRKY genes arose before the divergence of the grape and Arabidopsis lineages. Moreover, expression profiles derived from semiquantitative PCR and real-time quantitative PCR analyses showed distinct expression patterns in various tissues and in response to different treatments. Four VvWRKY genes showed a significantly higher expression in roots or leaves, 55 responded to varying degrees to at least one abiotic stress treatment, and the expression of 38 were altered following powdery mildew (Erysiphe necator) infection. Most VvWRKY genes were downregulated in response to abscisic acid or salicylic acid treatments, while the expression of a subset was upregulated by methyl jasmonate or ethylene treatments.

  8. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  9. Conservation of σ28-Dependent Non-Coding RNA Paralogs and Predicted σ54-Dependent Targets in Thermophilic Campylobacter Species.

    Directory of Open Access Journals (Sweden)

    My Thanh Le

    Full Text Available Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4 in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae.

  10. Conservation of σ28-Dependent Non-Coding RNA Paralogs and Predicted σ54-Dependent Targets in Thermophilic Campylobacter Species

    Science.gov (United States)

    Le, My Thanh; van Veldhuizen, Mart; Porcelli, Ida; Bongaerts, Roy J.; Gaskin, Duncan J. H.; Pearson, Bruce M.; van Vliet, Arnoud H. M.

    2015-01-01

    Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs) have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4) in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR) of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae. PMID:26512728

  11. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  12. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  13. Familial adult spinal muscular atrophy associated with the VAPB gene: report of 42 cases in Brazil

    Directory of Open Access Journals (Sweden)

    Victor Kosac

    2013-10-01

    Full Text Available Familial spinal muscular atrophy (FSMA associated with the vesicle-associated membrane protein-associated protein B (VAPB gene is a rare autosomal dominant disease with late onset and slow progression. We studied 10 of 42 patients from 5 families by taking clinical histories and performing physical exams, electrophysiological studies, and genetic tests. All patients presented late onset disease with slow progression characterized by fasciculations, proximal weakness, amyotrophy, and hypoactive deep tendon reflex, except two who exhibited brisk reflex. Two patients showed tongue fasciculations and respiratory insufficiency. Electrophysiological studies revealed patterns of lower motor neuron disease, and genetic testing identified a P56S mutation of the VAPB gene. Although it is a rare motor neuron disease, FSMA with this mutation might be much more prevalent in Brazil than expected, and many cases may be undiagnosed. Genetic exams should be performed whenever it is suspected in Brazil.

  14. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  15. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  16. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  17. Genome-wide identification and expression analysis of MAPK and MAPKK gene family in Malus domestica.

    Science.gov (United States)

    Zhang, Shizhong; Xu, Ruirui; Luo, Xiaocui; Jiang, Zesheng; Shu, Huairui

    2013-12-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, which are composed of three classes of hierarchically organized protein kinases, namely MAPKKKs, MAPKKs, and MAPKs. Although genome-wide analysis of this family has been carried out in some species, little is known about MAPK and MAPKK genes in apple (Malus domestica). In this study, a total of 26 putative apple MAPK genes (MdMPKs) and 9 putative apple MAPKK genes (MdMKKs) have been identified and located within the apple genome. Phylogenetic analysis revealed that MdMAPKs and MdMAPKKs could be divided into 4 subfamilies (groups A, B, C and D), respectively. The predicted MdMAPKs and MdMAPKKs were distributed across 13 out of 17 chromosomes with different densities. In addition, analysis of exon-intron junctions and of intron phase inside the predicted coding region of each candidate gene has revealed high levels of conservation within and between phylogenetic groups. According to the microarray and expressed sequence tag (EST) analysis, the different expression patterns indicate that they may play different roles during fruit development and rootstock-scion interaction process. Moreover, MAPK and MAPKK genes were performed expression profile analyses in different tissues (root, stem, leaf, flower and fruit), and all of the selected genes were expressed in at least one of the tissues tested, indicating that the MAPKs and MAPKKs are involved in various aspects of physiological and developmental processes of apple. To our knowledge, this is the first report of a genome-wide analysis of the apple MAPK and MAPKK gene family. This study provides valuable information for understanding the classification and putative functions of the MAPK signal in apple. © 2013.

  18. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Liu, Peng; Stajich, Jason E

    2015-04-01

    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease

    OpenAIRE

    Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian; Xia, Kun

    2010-01-01

    Purpose Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, ...

  20. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  1. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  2. Elusive Origins of the Extra Genes in Aspergillus oryzae

    Science.gov (United States)

    Khaldi, Nora; Wolfe, Kenneth H.

    2008-01-01

    The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939

  3. Elusive origins of the extra genes in Aspergillus oryzae.

    Directory of Open Access Journals (Sweden)

    Nora Khaldi

    Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.

  4. Analysis of inversions in the factor VIII gene in Spanish hemophilia A patients and families

    Energy Technology Data Exchange (ETDEWEB)

    Domenech, M.; Tizzano, E.; Baiget, M. [Hospital de Sant Pau, Barcelona (Spain); Altisent, C. [Hospital Vall d`Hebron, Barcelona (Spain)

    1994-09-01

    Intron 22 is the largest intron of the factor VIII gene and contains a CpG island from which two additional transcripts originate. One of these transcripts corresponds to the F8A gene which have telomeric extragenic copies in the X chromosome. An inversion involving homologous recombination between the intragenic and the distal or proximal copies of the F8A gene has been recently described as a common cause of severe hemophilia A (HA). We analyzed intron 22 rearrangements in 195 HA patients (123 familial and 72 sporadic cases). According to factor VIII levels, our sample was classified as severe in 114 cases, moderate in 29 cases and mild in 52 cases. An intron 22 (F8A) probe was hybridized to Southern blots of BcII digested DNA obtained from peripheral blood. A clear pattern of altered bands identifies distal or proximal inversions. We detected an abnormal pattern identifying an inversion in 49 (25%) of the analyzed cases. 43% of severe HA patients (49 cases) showed an inversion. As expected, no inversion was found in the moderate and mild group of patients. We found a high proportion (78%) of the distal rearrangement. From 49 identified inversions, 33 were found in familial cases (27%), while the remaining 15 were detected in sporadic patients (22%) in support that this mutational event occurs with a similar frequency in familial or sporadic cases. In addition, we detected a significant tendency of distal inversion to occur more frequently in familial cases than in sporadic cases. Inhibitor development to factor VIII was documented in approximately 1/3 of the patients with inversion. The identification of such a frequent molecular event in severe hemophilia A patients has been applied in our families to carrier and prenatal diagnosis, to determine the origin of the mutation in the sporadic cases and to detect the presence of germinal mosaicism.

  5. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  6. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  7. Expression of the KNOTTED HOMEOBOX Genes in the Cactaceae Cambial Zone Suggests Their Involvement in Wood Development.

    Science.gov (United States)

    Reyes-Rivera, Jorge; Rodríguez-Alonso, Gustavo; Petrone, Emilio; Vasco, Alejandra; Vergara-Silva, Francisco; Shishkova, Svetlana; Terrazas, Teresa

    2017-01-01

    The vascular cambium is a lateral meristem that produces secondary xylem (i.e., wood) and phloem. Different Cactaceae species develop different types of secondary xylem; however, little is known about the mechanisms underlying wood formation in the Cactaceae. The KNOTTED HOMEOBOX (KNOX) gene family encodes transcription factors that regulate plant development. The role of class I KNOX genes in the regulation of the shoot apical meristem, inflorescence architecture, and secondary growth is established in a few model species, while the functions of class II KNOX genes are less well understood, although the Arabidopsis thaliana class II KNOX protein KNAT7 is known to regulate secondary cell wall biosynthesis. To explore the involvement of the KNOX genes in the enormous variability of wood in Cactaceae, we identified orthologous genes expressed in species with fibrous ( Pereskia lychnidiflora and Pilosocereus alensis ), non-fibrous ( Ariocarpus retusus ), and dimorphic ( Ferocactus pilosus ) wood. Both class I and class II KNOX genes were expressed in the cactus cambial zone, including one or two class I paralogs of KNAT1 , as well as one or two class II paralogs of KNAT3 - KNAT4 - KNAT5 . While the KNOX gene SHOOTMERISTEMLESS ( STM) and its ortholog ARK1 are expressed during secondary growth in the Arabidopsis and Populus stem, respectively, we did not find STM orthologs in the Cactaceae cambial zone, which suggests possible differences in the vascular cambium genetic regulatory network in these species. Importantly, while two class II KNOX paralogs from the KNAT7 clade were expressed in the cambial zone of A. retusus and F. pilosus , we did not detect KNAT7 ortholog expression in the cambial zone of P. lychnidiflora . Differences in the transcriptional repressor activity of secondary cell wall biosynthesis by the KNAT7 orthologs could therefore explain the differences in wood development in the cactus species.