49 CFR 219.17 - Construction.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Construction. 219.17 Section 219.17 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE General § 219.17 Construction. Nothing in this part— (a) Restricts...

22 CFR 219.140 - Employment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 219.140 Section 219.140 Foreign... DEVELOPMENT § 219.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity conducted by the agency. The...

The influence of market orientation on innovation strategies

OpenAIRE

Newman, Alexander; Prajogo, Daniel; Atherton, Andrew

2016-01-01

Purpose This study examines the effects of market orientation on exploratory and exploitative innovation, and the moderating effects of family ownership on these relationships. Design/methodology/approach This study utilizes multi-group path analysis and confirmatory factor analysis in LISREL on data from 228 firms in the Australian service sector. Findings This study establishes that both customer and competitor innovation are positively related to exploitative and exploratory innovation. Ho...

36 CFR 219.2 - Principles.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Principles. 219.2 Section 219... Forest System Land and Resource Management Planning Purpose and Principles § 219.2 Principles. The planning regulations in this subpart are based on the following principles: (a) The first priority for...

15 CFR 280.219 - Settlement.

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Settlement. 280.219 Section 280.219... Enforcement § 280.219 Settlement. (a) Cases may be settled before service of a charging letter. In cases in which settlement is reached before service of a charging letter, a proposed charging letter will be...

First-in-human uPAR PET

DEFF Research Database (Denmark)

Persson, Morten; Skovgaard, Dorthe; Brandt-Larsen, Malene

2015-01-01

A first-in-human clinical trial with Positron Emission Tomography (PET) imaging of the urokinase-type plasminogen activator receptor (uPAR) in patients with breast, prostate and bladder cancer, is described. uPAR is expressed in many types of human cancers and the expression is predictive...... for targeted molecular imaging with PET. The safety, pharmacokinetic, biodistribution profile and radiation dosimetry after a single intravenous dose of (64)Cu-DOTA-AE105 were assessed by serial PET and computed tomography (CT) in 4 prostate, 3 breast and 3 bladder cancer patients. Safety assessment...... of invasion, metastasis and indicates poor prognosis. uPAR PET imaging therefore holds promise to be a new and innovative method for improved cancer diagnosis, staging and individual risk stratification. The uPAR specific peptide AE105 was conjugated to the macrocyclic chelator DOTA and labeled with (64)Cu...

Innovative problem solving by wild spotted hyenas

Science.gov (United States)

Benson-Amram, Sarah; Holekamp, Kay E.

2012-01-01

Innovative animals are those able to solve novel problems or invent novel solutions to existing problems. Despite the important ecological and evolutionary consequences of innovation, we still know very little about the traits that vary among individuals within a species to make them more or less innovative. Here we examine innovative problem solving by spotted hyenas (Crocuta crocuta) in their natural habitat, and demonstrate for the first time in a non-human animal that those individuals exhibiting a greater diversity of initial exploratory behaviours are more successful problem solvers. Additionally, as in earlier work, we found that neophobia was a critical inhibitor of problem-solving success. Interestingly, although juveniles and adults were equally successful in solving the problem, juveniles were significantly more diverse in their initial exploratory behaviours, more persistent and less neophobic than were adults. We found no significant effects of social rank or sex on success, the diversity of initial exploratory behaviours, behavioural persistence or neophobia. Our results suggest that the diversity of initial exploratory behaviours, akin to some measures of human creativity, is an important, but largely overlooked, determinant of problem-solving success in non-human animals. PMID:22874748

de la nature de l’innovation (The nature of innovation)

OpenAIRE

Rémy Volpi

2006-01-01

Marx par la lutte des classes, Schumpeter par l’innovation, concluent que le capitalisme par nature s’autodétruit. Mais, alors que pour Marx le capitalisme rend les riches plus riches tandis que leurs rangs s’étiolent, et les pauvres plus pauvres et plus nombreux, pour Schumpeter, le capitalisme démocratise la consommation. Et pour Galbraith, l’opulence est réelle, mais obtenue au prix de l’instrumentalisation du consommateur. D’autres auteurs imaginent que pour faire reprendre des couleurs à...

49 CFR 219.13 - Preemptive effect.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 219.13 Section 219.13 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE General § 219.13 Preemptive effect. (a) Under...

45 CFR 150.219 - Final determination.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Final determination. 150.219 Section 150.219... Are Failing To Substantially Enforce HIPAA Requirements § 150.219 Final determination. If, after... the State a written notice of its final determination. The notice includes the following: (a...

Crowdsourcing business model innovation

DEFF Research Database (Denmark)

Waldner, Florian; Poetz, Marion Kristin; Bogers, Marcel

2016-01-01

Successfully adapting existing business models or developing new ones significantly influences a firm’s ability to generate profits and develop competitive advantages. However, business model innovation is perceived as a complex, risky and uncertain process and its success strongly depends...... on whether or not the firm is capable of understanding and addressing their customers’ needs. We conduct a quantitative exploratory case study to investigate how crowdsourcing-based search approaches among user communities can contribute to developing business model innovation. Drawing on data from...... a crowdsourcing initiative designed to develop ideas for new business models in the podcast industry, we provide first exploratory insights into the value of crowdsourcing for innovating a firm’s way of creating, delivering and capturing value, and discuss characteristics of crowd-contributors that influence...

Competing With the Use of Business Model innovation - an Exploratory Case Study of the Journey of Born Global Firms

Directory of Open Access Journals (Sweden)

Marlene Johansson

2014-08-01

Full Text Available Purpose: The purpose of this article is to investigate how business models are used by born global firms to act upon new business opportunities and how they manage business model innovation over time to prosper and grow. Design/Methodology: The study is based on three exploratory case studies of born global firms in mobile communication, financial services and digital music distribution. Findings: Three interrelated capabilities to manage business model innovation are articulated in the context of born global firms; sensing capabilities, entrepreneurial capabilities and relational capabilities and four propositions are formulated. We find that business model innovations are used as a tool by maturing born global firms to navigate the value chains and achieve international growth. We further propose that born global need the capabilities to balance different business model designs simultaneously and to manage its business model innovation in a timely manner. Originality: This article contributes to both the business model literature and research of international entrepreneurship. By putting business model research into the dynamic context of rapidly internationalizing born global firms, we contribute to the field of business model research with findings of how business models are used in the internationalization processes. Certain capabilities are needed to manage business model innovation for born global firms to dynamically use business models as a tool in the international growth overtime.

Innovations in the restaurant industry: An exploratory study

Directory of Open Access Journals (Sweden)

Ivkov Milan

2016-01-01

Full Text Available This paper tends to identify managers' current innovation activities and attitudes, and also perceptions of what might become future trends and the prospective course in the restaurant industry. Additionally, this paper analyses linkage between sociodemographic profile of managers and a type of innovation they prefer/apply. Full service casual dining restaurant managers from three different countries were interviewed in order to examine their attitudes towards innovations, and to reveal their perceptions of future trends. ANOVA was used to reveal differences between managers' attitudes towards the area of innovation. The results of qualitative study highlight five areas of innovation that could help managers create value based service and increase competitiveness. It is found that age, education level and experience of the restaurant managers affect the innovation type they apply. Additionally, this paper is the first to examine the linkage between socio-demographic profile of restaurant managers and a type of innovation they apply. It offers useful guidelines for hospitality managers.

49 CFR 21.9 - Compliance information.

Science.gov (United States)

2010-10-01

... 49 Transportation 1 2010-10-01 2010-10-01 false Compliance information. 21.9 Section 21.9 Transportation Office of the Secretary of Transportation NONDISCRIMINATION IN FEDERALLY-ASSISTED PROGRAMS OF THE DEPARTMENT OF TRANSPORTATION-EFFECTUATION OF TITLE VI OF THE CIVIL RIGHTS ACT OF 1964 § 21.9 Compliance information. (a) Cooperation and...

48 CFR 653.219 - Small business programs.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Small business programs. 653.219 Section 653.219 Federal Acquisition Regulations System DEPARTMENT OF STATE CLAUSES AND FORMS FORMS Prescription of Forms 653.219 Small business programs. ...

Creative Climate: A Leadership Lever for Innovation

Science.gov (United States)

Isaksen, Scott G.; Akkermans, Hans J.

2011-01-01

The working atmosphere within an organization has an important influence on its level of innovative productivity. Organizational leaders influence innovative productivity as well as the climate for creativity and innovation. This exploratory study included 140 respondents from 103 different organizations, 31 industries, and 10 countries, all of…

CFD analysis of PAR performance as function of inlet design

International Nuclear Information System (INIS)

Park, Kweonha; Khor, Chong Lee

2016-01-01

Highlights: • The new concept of PAR (passive autocatalytic recombiner) was proposed and analyzed. • Guidance wall was added at the bottom of PAR to enhance the flow rate through the catalyst. • The new concept of PAR was proved to have a better hydrogen removal performance. - Abstract: Passive autocatalytic recombiner (PAR) is very useful hydrogen mitigation measurement. It is widely implemented in the current and advanced light water reactors (ALWRs). The design of the PARs should be optimized for the specific use under severe accident scenarios. Several techniques and innovations have been fused into the PAR, as an effort to increase its efficiency of hydrogen mitigation. This study proposes different concepts of PAR, which applied some changes to the honeycomb catalyst PAR made by the Korea Nuclear Technology (KNT) Inc. Two slices of plate are added to the bottom of PAR model, which intended to act as a reflection wall and promote the gas flow into PAR. Hydrogen volume fraction was given 4 vol. % which tested by KNT to investigate the performance of PAR in different direction gas flow conditions to see maximum hydrogen recombination rate. The new concept of PAR was proved to have a better hydrogen removal performance compared to the original honeycomb catalyst PAR.

CFD analysis of PAR performance as function of inlet design

Energy Technology Data Exchange (ETDEWEB)

Park, Kweonha, E-mail: khpark@kmou.ac.kr [Division of Mechanical and Energy systems Engineering, Korea Maritime University, Dongsam-dong, Yeongdo-gu, Busan 606-791 (Korea, Republic of); Khor, Chong Lee, E-mail: itachi_829@hotmail.com [Department of Mechanical Engineering, Korea Maritime University (Korea, Republic of)

2016-01-15

Highlights: • The new concept of PAR (passive autocatalytic recombiner) was proposed and analyzed. • Guidance wall was added at the bottom of PAR to enhance the flow rate through the catalyst. • The new concept of PAR was proved to have a better hydrogen removal performance. - Abstract: Passive autocatalytic recombiner (PAR) is very useful hydrogen mitigation measurement. It is widely implemented in the current and advanced light water reactors (ALWRs). The design of the PARs should be optimized for the specific use under severe accident scenarios. Several techniques and innovations have been fused into the PAR, as an effort to increase its efficiency of hydrogen mitigation. This study proposes different concepts of PAR, which applied some changes to the honeycomb catalyst PAR made by the Korea Nuclear Technology (KNT) Inc. Two slices of plate are added to the bottom of PAR model, which intended to act as a reflection wall and promote the gas flow into PAR. Hydrogen volume fraction was given 4 vol. % which tested by KNT to investigate the performance of PAR in different direction gas flow conditions to see maximum hydrogen recombination rate. The new concept of PAR was proved to have a better hydrogen removal performance compared to the original honeycomb catalyst PAR.

20 CFR 219.1 - Introduction.

Science.gov (United States)

2010-04-01

... Annuity), 234 (Lump-Sum Payments), and 222 (Family Relationships), certain requirements must be met before... used as evidence. Part 222 defines and explains family relationships for which evidence requirements... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 219.1 Section 219.1 Employees...

22 CFR 219.160 - Communications.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Communications. 219.160 Section 219.160 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN... communication with applicants, participants, personnel of other Federal entities, and members of the public. (1...

48 CFR 1353.219 - Small business programs.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Small business programs. 1353.219 Section 1353.219 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES AND FORMS FORMS Prescription of Forms 1353.219 Small business programs. Use Form CD-570, Small Business Set...

20 CFR 219.2 - Definitions.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Definitions. 219.2 Section 219.2 Employees... some other person. Benefit means any employee annuity, spouse annuity, survivor annuity, or lump-sum... proves to the satisfaction of the Board that an individual meets a requirement for eligibility for...

Paradoxes and Innovation in Family Firms

DEFF Research Database (Denmark)

Ingram, Amy E.; Lewis, Marianne W.; Barton, Sid

2016-01-01

thinkers are more likely to manage these tensions and fuel innovative behavior. Leveraging family business and organizational paradox literatures, this multi-stage exploratory study develops measures of paradoxical tensions and paradoxical thinking in family firms, and tests these propositions. Findings...... indicate that paradoxical tensions may stymie innovative behavior, but that leaders' paradoxical thinking is positively related to innovative behavior....

Innovation clusters and determinants of innovativeness in manufacturing industries

NARCIS (Netherlands)

Sevinç, M.; Ulusoy, G.

2016-01-01

Innovation is an important source of competitiveness and is studied extensively by both the academicians and the practitioners particularly in the last decades. This study is based on the results of an exploratory study conducted in the Northern Marmara region of Turkey covering 184 manufacturing

49 CFR 1542.219 - Supplementing law enforcement personnel.

Science.gov (United States)

2010-10-01

... 49 Transportation 9 2010-10-01 2010-10-01 false Supplementing law enforcement personnel. 1542.219 Section 1542.219 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.219 Supplementing law...

Open innovation in SMEs : trends, motives and management challenges

NARCIS (Netherlands)

Vrande, van de V.J.A.; Jong, de J.P.J.; Vanhaverbeke, W.P.M.; Rochemont, de M.H.

2009-01-01

Open innovation has so far been studied mainly in high-tech, multinational enterprises. This exploratory paper investigates if open innovation practices are also applied by small- and medium-sized enterprises (SMEs). Drawing on a database collected from 605 innovative SMEs in the Netherlands, we

36 CFR 219.17 - Interaction with private landowners.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Interaction with private landowners. 219.17 Section 219.17 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF... Sustainability § 219.17 Interaction with private landowners. The responsible official must seek to collaborate...

Evaluation of Nitrogen Uptake and Growth Performance of Advanced Mutant Lines MR219-4 and MR219-9 Grown Under Aerobic Conditions

International Nuclear Information System (INIS)

Shyful Azizi Abdul Rahman; Abdul Rahim Harun; Rusli Ibrahim; Khairuddin Abdul Rahim

2014-01-01

Developing a good crop production management package; drought resistance variety, effective water and nutrient management in rice production practices is crucial for global climate change adaptation. A research project under IAEA RAS5065 (Supporting Climate-Proofing Rice Production Systems (CRiPS) Based on Nuclear Applications) was conducted from 2012 to 2013, in collaboration with MARDI. Two advanced mutant lines, MR219-4 and MR219-9 were used in this research project to evaluate growth, yield potential and fertilizer uptake under different water input condition (flooded and aerobic). The advanced mutant line MR219-9 showed comparable growth, yield and nitrogen uptake under both flooded and aerobic conditions. The yield and yield components are not significantly different from the parent variety (MR219) but total N uptake was lower than MR219 regardless of water regime. The field trial showed that MR219-9 has a better total N content which is comparable to the aerobic rice variety (MRIA 1) and this indicates that this advance mutant line MR219-9 is a potential aerobic rice variety. (author)

Managing Innovation Paradox in the Sustainable Innovation Ecosystem: A Case Study of Ambidextrous Capability in a Focal Firm

Directory of Open Access Journals (Sweden)

Delin Zeng

2017-11-01

Full Text Available To achieve sustainable development, focal firms should balance two paradoxical kinds of innovation activities: exploitative and exploratory ones. Published works found that ambidexterity is an effective way to resolve paradoxical tensions, but few in-depth studies have been conducted to explore the innovation paradox of focal firms in the innovation ecosystem from an ambidextrous capability perspective. This paper takes China Spacesat Co., Ltd. as the case to study focal firms’ management of innovation paradoxes in the sustainable innovation ecosystem and finds that: (1 Sustainable innovation is an ecosystem in which focal firms’ internal functional departments, including the product department, technical center, and Makers’ groups, cooperate with external organizations, including component suppliers, scientific research institutes, and government departments, closely and complementarily; (2 In the exploitative and exploratory innovations of complex products, focal firms in the sustainable innovation ecosystem mainly confront three paradoxes: profit drive vs. breakthroughs in the strategic intent of sustainable innovation of the profit-driven model, tight vs. loose coupling of sustainable innovation, and sustainable innovation driven by discipline vs. that by passion; (3 Focal firms in the innovation ecosystem resolve these three innovation paradoxes with structural, contextual, and coordinated ambidextrous capabilities, and build innovation paradox management mechanisms with three steps in sequence, namely by establishing dual sustainable strategic innovation units, strengthening sustainable organizational ties between the internal and external, while co-creating and sharing innovation values, and, finally, promoting the formation and development of their sustainable innovation ecosystem. This paper complements and enriches the innovation ecosystem and ambidextrous capability theory, providing significant practical guidance to the

37 CFR 1.219 - Early publication.

Science.gov (United States)

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Early publication. 1.219... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Publication of Applications § 1.219 Early publication. Applications that will be published under § 1.211 may be published...

THE CONTRIBUTION OF INNOVATION SYSTEMS AND ORGANIZATIONAL CULTURE FOR INNOVATION GENERATION

Directory of Open Access Journals (Sweden)

Elaine da Silva

2018-04-01

Full Text Available Introduction: Emphasizes the role of innovation in the Information and Knowledge Society as a favorable element of developing regional, national and global levels. Objective: The aim is reflect about the coming of innovation in the context of production systems and their respective role for the development of society. Methodology: The research sets up a qualitative approach to literature and exploratory nature. Results: As from selected literature review, presents conceptual aspects of innovation in the context of production systems and analyzes its contribution to the national innovation system and the role of organizational culture focused on innovation. Conclusions: Think about innovation from the systemic approach, based on the interaction of the different relevant agents to influence and contribute to the generation of innovation is fundamental in the current conjuncture, characterized by the agility of the transformations in social, economic, political and technological contexts.

20 CFR 219.23 - Evidence to prove death.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence to prove death. 219.23 Section 219... EVIDENCE REQUIRED FOR PAYMENT Evidence of Age and Death § 219.23 Evidence to prove death. (a) Preferred evidence of death. The best evidence of a person's death is— (1) A certified copy of or extract from the...

36 CFR 219.19 - Ecological, social, and economic sustainability.

Science.gov (United States)

2010-07-01

... economic sustainability. 219.19 Section 219.19 Parks, Forests, and Public Property FOREST SERVICE..., Social, and Economic Sustainability § 219.19 Ecological, social, and economic sustainability. Sustainability, composed of interdependent ecological, social, and economic elements, embodies the Multiple-Use...

48 CFR 52.219-22 - Small Disadvantaged Business Status.

Science.gov (United States)

2010-10-01

.... Status as a small business and status as a small disadvantaged business for general statistical purposes... Business Status. 52.219-22 Section 52.219-22 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.219-22 Small Disadvantaged Business Status. As prescribed in 19.308(b), insert the following...

Constellations-driven innovation

DEFF Research Database (Denmark)

Hansbøl, Mikala

2011-01-01

The paper presents a science and technology studies and actor-network-theory inspired approach to understanding the development and ongoing re-didactication and re-design of a Danish developed presentation tool called the Theme Board (Tematavlen.dk). It is argued that this approach provides a par...... a particularly useful point of departure for engaging in researching innovation and didactic design of digital teaching and learning instruments such as the Theme Board that are programmed and serviced 'in the sky'. I call this approach: constellation-driven innovations....

Playful Collaboration (or Not): Using a Game to Grasp the Social Dynamics of Open Innovation in Innovation and Business Education

Science.gov (United States)

Bogers, Marcel; Sproedt, Henrik

2012-01-01

This article explores how playing games can be used to teach intangible social interaction across boundaries, in particular within open collaborative innovation. We present an exploratory case study of how students learned from playing a board game in a graduate course of the international and interdisciplinary Innovation and Business master's…

30 CFR 219.102 - Method of payment.

Science.gov (United States)

2010-07-01

... writing to the Minerals Management Service, Minerals Revenue Management, P.O. Box 5760, Denver, Colorado... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Method of payment. 219.102 Section 219.102 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT...

Evaluating effectiveness of project start-ups: an exploratory study

NARCIS (Netherlands)

Halman, Johannes I.M.; Burger, G.T.N.

In this paper an exploratory study is reported about the effectiveness of project start-up (PSU) practices within a world-scale operating, high technology innovating and manufacturing company. The emphasis is on the focal position of both project owner and project manager. To uncover potential

Exploratory of society

Science.gov (United States)

Cederman, L.-E.; Conte, R.; Helbing, D.; Nowak, A.; Schweitzer, F.; Vespignani, A.

2012-11-01

A huge flow of quantitative social, demographic and behavioral data is becoming available that traces the activities and interactions of individuals, social patterns, transportation infrastructures and travel fluxes. This has caused, together with innovative computational techniques and methods for modeling social actions in hybrid (natural and artificial) societies, a qualitative change in the ways we model socio-technical systems. For the first time, society can be studied in a comprehensive fashion that addresses social and behavioral complexity. In other words we are in the position to envision the development of large data and computational cyber infrastructure defining an exploratory of society that provides quantitative anticipatory, explanatory and scenario analysis capabilities ranging from emerging infectious disease to conflict and crime surges. The goal of the exploratory of society is to provide the basic infrastructure embedding the framework of tools and knowledge needed for the design of forecast/anticipatory/crisis management approaches to socio technical systems, supporting future decision making procedures by accelerating the scientific cycle that goes from data generation to predictions.

Zinc finger protein 219-like (ZNF219L) and Sox9a regulate synuclein-γ2 (sncgb) expression in the developing notochord of zebrafish.

Science.gov (United States)

Lien, Huang-Wei; Yang, Chung-Hsiang; Cheng, Chia-Hsiung; Liao, Yung-Feng; Han, Yu-San; Huang, Chang-Jen

2013-12-13

Zebrafish synuclein-γ2 (sncgb) has been reported to be expressed specifically in the notochord. However, the mechanism by which the sncgb gene promoter is regulated has not been described. In this paper, we demonstrate that Zinc finger protein 219-like (ZNF219L) and sox9a are involved in the regulation of sncgb gene expression. Furthermore, we observed that over-expression of both ZNF219L and Sox9a resulted in increased sncgb expression. In addition, ZNF219L is physically associated with Sox9a, and simultaneous morpholino knockdown of znf219L and sox9a caused a synergistic decrease of sncgb expression in the notochord. Taken together, our results reveal that coordination of ZNF219L with Sox9a is involved in the regulation of notochord-specific expression of sncgb. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

40 CFR 86.219-94 - CVS calibration.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false CVS calibration. 86.219-94 Section 86.219-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty...

49 CFR 173.219 - Life-saving appliances.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Life-saving appliances. 173.219 Section 173.219... Life-saving appliances. (a) A life-saving appliance, self-inflating or non-self-inflating, containing small quantities of hazardous materials that are required as part of the life-saving appliance must...

7 CFR 58.219 - High pressure pumps and lines.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false High pressure pumps and lines. 58.219 Section 58.219....219 High pressure pumps and lines. High pressure lines may be cleaned-in-place and shall be of such construction that dead ends, valves and the high pressure pumps can be disassembled for hand cleaning. The high...

Women Entrepreneurship and Innovations in India: An Exploratory Study

Directory of Open Access Journals (Sweden)

Hemantkumar P. Bulsara

2014-06-01

Full Text Available Increased female entrepreneurial activity heralds a progress for women’s rights and optimization of their economic and social living index. Women entrepreneurship is synonymous with women empowerment. Parallel to the male counterparts, female entrepreneurs are catalytic in job creation, innovation and more than tangible contribution to the GNP of the country. An economy thrives when women get a level playing field as men. Innovation works as a catalyst or an instrument for Entrepreneurship. Indian Women, despite all the social hurdles stand tall from the rest of the crowd and are applauded for their achievements in their respective field. The transformation of social fabric of the Indian society, in terms of increased educational status of women and varied aspirations for better living, necessitated a change in the life style of Indian women. This paper endeavors to explore studies related to Women Entrepreneurship and Innovation in India. Few examples from Gujarat, India have been taken to understand the study in a better way. Keywords: Women Entrepreneurship; Innovation; Entrepreneurship; India; Economy; Gujarat.

36 CFR 219.12 - Collaboration and cooperatively developed landscape goals.

Science.gov (United States)

2010-07-01

... cooperatively developed landscape goals. 219.12 Section 219.12 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE PLANNING National Forest System Land and Resource Management Planning Collaborative Planning for Sustainability § 219.12 Collaboration and cooperatively developed landscape goals. (a...

48 CFR 1352.219-71 - Notification to delay performance (Deviation).

Science.gov (United States)

2010-10-01

... performance (Deviation). 1352.219-71 Section 1352.219-71 Federal Acquisition Regulations System DEPARTMENT OF....219-71 Notification to delay performance (Deviation). As prescribed in 48 CFR 1319.811-3(b), insert the following clause: Notification To Delay Performance (Deviation) (APR 2010) The contractor shall...

Innovation pedagogy in the MARIHE program : A case study on faculty perceptions

NARCIS (Netherlands)

Godonoga, Ana; Güney, Isil; Kopelyan, Sofya; Yasmin, Nowreen; Holz, Oliver; Aleksandrovich, Maria; Zoglowek, Herbert

2016-01-01

The paper promotes awareness of innovation pedagogy in European higher education by presenting the results of a mixed methods exploratory case study on faculty perceptions of innovation pedagogy standards in a Joint Master Degree program in Research and Innovation in Higher Education (MaRIHE) and on

Facilitating innovation : an action-oriented approach and participatory methodology to improve innovative social practice in agriculture

OpenAIRE

Engel, P.G.H.

1995-01-01

This study focuses upon the social organization of innovation. It makes use of insights from knowledge and information systems research, development sociology, management science and applied philosophy and seeks answers to the following questions: What do social actors, individuals and/or organizations, actually do to innovate their practices? How do they organize themselves? Can this be managed or facilitated, and if so, how? The research is exploratory rather than concl...

Knowledge Management and Innovation: The Role of Virtual Social Networks in Innovative Consumer Behavior

Directory of Open Access Journals (Sweden)

Andre Grutzmann

2013-04-01

Full Text Available Online social networks made up of actors with different degrees of innovativeness may allow knowledge management to collect new ideas and measure their acceptance. This research investigates consumer innovativeness and relationships with the uses and participation in social networks. This research has a quantitative exploratory scope, and among the main findings, we can mention that the dimensions of the adopted scale were corroborated by using factor analysis. The findings cannot be generalized, but there are evidences that relationship between social networking and innovative consumer behavior exists. Although there are limitations, correlations were found between the social dimension of innovativeness and information search in the networks and also the use of social networking information for the decision to purchase new products.

Small Business Innovation Research : Program Solicitation (Closing Date : May 1, 1989)

Science.gov (United States)

1989-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research - Program Solicitation (Closing Date : May 2, 1988)

Science.gov (United States)

1988-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research - Program Solicitation (Closing Date : May 16, 1983)

Science.gov (United States)

1983-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research : Program Solicitation (Closing Date : May 3, 1993)

Science.gov (United States)

1993-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research - Program Solicitation (Closing Date : May 1, 1991)

Science.gov (United States)

1991-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research : Program Solicitation (Closing Date : May 2, 1995)

Science.gov (United States)

1995-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

Small Business Innovation Research : Program Solicitation (Closing Date : May 1, 1990)

Science.gov (United States)

1990-01-01

This solicitation for research proposals is issued by the Department of Transportation (DOT) pursuant to the Small Business Innovation Development Act of 1982, P.L. 97-219, as amended by P.L. 99-443. The law seeks to encourage the initiative of the p...

12 CFR 219.1 - Authority, purpose and scope.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Authority, purpose and scope. 219.1 Section 219.1 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM REIMBURSEMENT FOR PROVIDING FINANCIAL RECORDS; RECORDKEEPING REQUIREMENTS FOR CERTAIN FINANCIAL RECORDS...

Service oriented product innovation for improved environmental performance. An an exploratory case study of the air conditioning and cooling sector

Energy Technology Data Exchange (ETDEWEB)

Cook, M.; Maggs, H.; Neame, C.; Lemon, M. [The School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire (United Kingdom)

2006-09-15

The need to improve the environmental performance of production and consumption practices within advanced industrialised nations is widely accepted. Finding ways to satisfy demand using far fewer resources is central to research in this field. For many, the trajectories of service orientated products are thought to provide an opportunity to address this need and anticipate futures in which economic growth is de-coupled from resource use. This paper presents the findings of exploratory research in the air-conditioning and cooling sector, which sought to understand how these benefits might be realised. It suggests that these benefits will not arise as a result of economic restructuring but rather that a deeper understanding of the process of service innovation, which underpins trajectories of service orientated products, is required to develop effective policy.

The marketing function in exploratory product innovation : contrasting different project types

NARCIS (Netherlands)

Smits, A.A.J.; Dankbaar, B.; Vissers, G.

2011-01-01

This paper focuses on the marketing function in product innovation projects in established b-t-b firms. The marketing function in an innovation project is a term to denote both the project members that connect the project to customers or, more broadly, the market, and their activities in innovation

Evaluation and characterization of advanced rice mutant line of rice (Oryza sativa), MR219-4 and MR219-9 under drought condition

International Nuclear Information System (INIS)

Abdul Rahim Harun; Zarith Shafika Kamarudin; Abdullah, M.Z.; Anna, L.P.K.; Sobri Hussain; Rusli Ibrahim; Khairuddin abdul Rahim

2012-01-01

Two advance rice mutant lines, MR219-4 and MR219-9 derived from mutagenesis of Oryza sativa cv. MR219 with gamma radiation at 300 Gy were evaluated in simulated drought condition in the greenhouse at Malaysian Nuclear Agency. The mutants were evaluated simultaneously with ARN1, a drought resistant variety and MR211 a susceptible cultivar as a check. Randomized complete block design with three replicates was used in the experiment. The evaluation and selection were done based on leaf rolling and leaf drying as well as other agronomic traits, such as, number of tillers per plant, plant height, flag leaf area, grain weight per plant, grain yield per plant, 100-grain weight, harvest index, panicle length and plant biomass. The mutants MR219-4 showed moderate tolerance and MR219-9 showed tolerance to drought respectively as compare to the check variety (ARN1, MR211) and control MR219. Leaf rolling, leaf drying, days to flowering and days to maturity are valuable secondary traits that may provide additional information for selection because of associating with the plant survival under water stress. Further research on expression of drought-tolerant lines under different drought conditions is essential in order to identify particular traits that are associated with drought tolerance and high yield potential. Similarly the importance of secondary traits, relative to other putative traits for drought tolerance, needs to be tested in various environments. (author)

Innovation Networks: the Contribution of Partnerships to Innovative Performance of Firms in the Brazilian Electrical-Electronics Industry

Directory of Open Access Journals (Sweden)

Silvye Ane Massaini

2015-01-01

Full Text Available Innovation networks have been identified in the literature as a way to complement firms’ innovative capabilities through collaboration with other partners. To provide empirical evidence for this assertion, this paper investigates the contribution of partners established in innovation networks for innovative performance of firms in the Brazilian electricalelectronics industry. For this purpose, we carried out an exploratory and descriptive survey among 185 companies. The data were analyzed using structural equation modeling (SEM. As the main findings, we observed that the establishment of collaborative relationships with customers, competitors and universities/research institutions can contribute to organizational and process innovation. However, despite obtaining some significant results concerning the contribution of different partners in the network, electrical-electronics industry companies also attach great importance to internal activities to develop their innovations.

Business Model Innovation in Airlines

Directory of Open Access Journals (Sweden)

Bruno Alencar Pereira

2017-03-01

Full Text Available The business models innovation in airlines can contribute to the creation of value, competitive advantage and profitability with new possibilities of action. The proposed paper aimed to identify the business models adopted by airlines and identify how the innovation occurs at these organizations. The methodology adopted is characterized as empirical, exploratory and descriptive research by multiple case study with three major Brazilian airlines. The results demonstrate that the search for paradigm breaks, related to the dichotomic traditional models of low-cost and full-service, toward hybrid business models occur linearly, as examples highlighted by companies, in which internal changes in business models are considered major organizational innovations.

Radiological risk of actinon (219Rn)

International Nuclear Information System (INIS)

Crawford, D.J.

1981-12-01

The research reported was designed to provide information on the following subjects: (1) development of the functional relations between exposure to the 219 Rn decay chain and pertinent health effects; (2) specification of the circumstances under which a significant concentration of the decay chain may occur; (3) recommendation of an exposure standard which will provide protection of the public from significant elevation of health effects; and (4) an assessment of the impact of 219 Rn on determinations of the concentration of the 222 Rn decay chain and/or its precursors

An economic and financial exploratory

Science.gov (United States)

Cincotti, S.; Sornette, D.; Treleaven, P.; Battiston, S.; Caldarelli, G.; Hommes, C.; Kirman, A.

2012-11-01

This paper describes the vision of a European Exploratory for economics and finance using an interdisciplinary consortium of economists, natural scientists, computer scientists and engineers, who will combine their expertise to address the enormous challenges of the 21st century. This Academic Public facility is intended for economic modelling, investigating all aspects of risk and stability, improving financial technology, and evaluating proposed regulatory and taxation changes. The European Exploratory for economics and finance will be constituted as a network of infrastructure, observatories, data repositories, services and facilities and will foster the creation of a new cross-disciplinary research community of social scientists, complexity scientists and computing (ICT) scientists to collaborate in investigating major issues in economics and finance. It is also considered a cradle for training and collaboration with the private sector to spur spin-offs and job creations in Europe in the finance and economic sectors. The Exploratory will allow Social Scientists and Regulators as well as Policy Makers and the private sector to conduct realistic investigations with real economic, financial and social data. The Exploratory will (i) continuously monitor and evaluate the status of the economies of countries in their various components, (ii) use, extend and develop a large variety of methods including data mining, process mining, computational and artificial intelligence and every other computer and complex science techniques coupled with economic theory and econometric, and (iii) provide the framework and infrastructure to perform what-if analysis, scenario evaluations and computational, laboratory, field and web experiments to inform decision makers and help develop innovative policy, market and regulation designs.

14 CFR 21.9 - Replacement and modification articles.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Replacement and modification articles. 21.9... CERTIFICATION PROCEDURES FOR PRODUCTS AND PARTS General § 21.9 Replacement and modification articles. (a) If a person knows, or should know, that a replacement or modification article is reasonably likely to be...

20 CFR 219.43 - Evidence of child's dependency.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence of child's dependency. 219.43... EVIDENCE REQUIRED FOR PAYMENT Evidence of Relationship § 219.43 Evidence of child's dependency. (a) When the dependency requirement must be met. Usually the dependency requirement must be met at one of the...

Crowdsourcing Business Model Innovation

DEFF Research Database (Denmark)

Waldner, Florian; Poetz, Marion

Successfully adapting existing business models or developing new ones significantly influences a firm?s ability to generate profits and develop competitive advantages. However, business model innovation is perceived as a complex, risky and uncertain process and its success strongly depends...... on whether or not firms are capable of understanding and addressing their customers? needs. This study explores how crowdsourcing-based search approaches can contribute to the process of business model innovation. Drawing on data from a crowdsourcing initiative designed to develop ideas for new business...... models in the podcast industry, we provide first exploratory insights into the value of crowdsourcing for innovating a firm?s business model, and discuss which characteristics of crowd-contributors increase the quantity and quality of the outcome....

20 CFR 219.24 - Evidence of presumed death.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence of presumed death. 219.24 Section... EVIDENCE REQUIRED FOR PAYMENT Evidence of Age and Death § 219.24 Evidence of presumed death. When a person cannot be proven dead but evidence of death is needed, the Board may presume he or she died at a certain...

MicroRNA-219 modulates NMDA receptor-mediated neurobehavioral dysfunction

DEFF Research Database (Denmark)

Kocerha, Jannet; Faghihi, Mohammad Ali; Lopez-Toledano, Miguel A

2009-01-01

significantly modulated behavioral responses associated with disrupted NMDA receptor transmission. Furthermore, pretreatment with the antipsychotic drugs haloperidol and clozapine prevented dizocilpine-induced effects on miR-219. Taken together, these data support an integral role for miR-219 in the expression...

Building an Integrative Model for Managing Exploratory Innovation

DEFF Research Database (Denmark)

Zarmeen, Parisha; Turri, Vanessa Gina; Sanchez, Ron

2014-01-01

central problems” organizations face when trying to manage innovation processes (Van de Ven, 1986). We develop an enhanced version of O’Connor’s (2008) Discovery, Incubation and Acceleration (DIA) model by integrating elements of Sanchez’ (2012) theory of architectural isomorphism as well as Markides...

Project management plan for Project W-178, 219-S secondary containment

International Nuclear Information System (INIS)

Buckles, D.I.

1995-01-01

This Project Management Plan (PMP) establishes the organizational responsibilities, control systems, and procedures for managing the execution of project activities for Project W-178, the 219-S Secondary Containment Upgrade. The scope of this project will provide the 219-S Facility with secondary containment for all tanks and piping systems. Tank 103 will be replaced with a new tank which will be designated as Tank 104. Corrosion protection shall be installed as required. The cells shall be cleaned and the surface repaired as required. The 219-S Waste Handling Facility (219-S Facility), located in the 200 West Area, was constructed in 1951 to support the 222-S Laboratory Facility. The 219-S Facility has three tanks, TK-101, TK-102, and TK-103, which receive and neutralize low level radioactive wastes from the 222-S Laboratory. For purposes of the laboratory, the different low level waste streams have been designated as high activity and intermediate activity. The 219-S Facility accumulates and treats the liquid waste prior to transferring it to SY Tank Farm in the 200-W Area. Transfers are normally made by pipeline from the 219-S Facility to the 241-SY Tank Farm. Presently transfers are being made by tanker truck to the 200-E Area Tank Farms due to the diversion box catch tank which has been removed from service

COMBINATION THERAPIES OR STANDALONE INTERVENTIONS? INNOVATION OPTIONS FOR PHARMACEUTICAL FIRMS FIGHTING CANCER

OpenAIRE

GUNJAN BHARDWAJ; ANSHIT AGRAWAL; RUPESH TYAGI

2015-01-01

Innovation is key to the pharma model, from an initial discovery to the final development of a marketable drug. Here, we explore the innovation options in the fiercely contested therapeutic area of Oncology. We studied clinical development of drugs targeting PD-1 and PD-L1 pathway. In this interesting contest, companies seem to be focusing on standalone interventions (exploratory innovation) and combination therapy (exploitative innovation) in clinical development. Merck Sharp and Dohme, havi...

48 CFR 552.219-72 - Preparation, Submission, and Negotiation of Subcontracting Plans.

Science.gov (United States)

2010-10-01

..., and Negotiation of Subcontracting Plans. 552.219-72 Section 552.219-72 Federal Acquisition Regulations... Text of Provisions and Clauses 552.219-72 Preparation, Submission, and Negotiation of Subcontracting... Negotiation of Subcontracting Plans (JUN 2005) (a) An offeror, other than a small business concern, submitting...

49 CFR 219.207 - Fatality.

Science.gov (United States)

2010-10-01

... TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE Post-Accident Toxicological Testing § 219.207 Fatality. (a) In the..., United States Code (but not the agent of the Secretary for purposes of the Federal Tort Claims Act...

Business Model Innovation Portfolio Strategy for Growth Under Product-Market Configurations

OpenAIRE

Bert Verhoeven; Lester W. Johnson

2017-01-01

Purpose: The research links three concepts: product market growth strategy, the magnitude of innovation and Business Model Innovation, merging them together into a dynamic Business Model Innovation strategy framework. Design/Methodology/Approach: The paper is conceptual and exploratory in nature and builds on existing literature and the author’s experience with developing business models. Findings: The BMI strategy framework can help managers establish a BMI portfolio strategy followi...

48 CFR 1852.219-73 - Small business subcontracting plan.

Science.gov (United States)

2010-10-01

... Provisions and Clauses 1852.219-73 Small business subcontracting plan. As prescribed in 1819.708-70(a), insert the following provision: Small Business Subcontracting Plan (MAY 1999) (a) This provision is not... contain FAR clause 52.219-9, “Small Business Subcontracting Plan.” The apparent low bidder must submit the...

36 CFR 219.15 - Interaction with American Indian tribes and Alaska Natives.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Interaction with American Indian tribes and Alaska Natives. 219.15 Section 219.15 Parks, Forests, and Public Property FOREST... Collaborative Planning for Sustainability § 219.15 Interaction with American Indian tribes and Alaska Natives...

Radiological risk of actinon (/sup 219/Rn)

Energy Technology Data Exchange (ETDEWEB)

Crawford, D.J.

1981-12-01

The research reported was designed to provide information on the following subjects: (1) development of the functional relations between exposure to the /sup 219/Rn decay chain and pertinent health effects; (2) specification of the circumstances under which a significant concentration of the decay chain may occur; (3) recommendation of an exposure standard which will provide protection of the public from significant elevation of health effects; and (4) an assessment of the impact of /sup 219/Rn on determinations of the concentration of the /sup 222/Rn decay chain and/or its precursors.

The dilemma of service productivity and service innovation : An empirical exploration in financial services

NARCIS (Netherlands)

Aspara, Jaakko; Klein, Jan; Luo, Xueming; Tikkanen, Henrikki

2017-01-01

We conduct a systematic exploratory investigation of the effects of firms’ existing service productivity on the success of their new service innovations. Although previous research extensively addresses service productivity and service innovation, respectively, this is the first empirical study that

First-in-human uPAR PET: Imaging of Cancer Aggressiveness

Science.gov (United States)

Persson, Morten; Skovgaard, Dorthe; Brandt-Larsen, Malene; Christensen, Camilla; Madsen, Jacob; Nielsen, Carsten H.; Thurison, Tine; Klausen, Thomas Levin; Holm, Søren; Loft, Annika; Berthelsen, Anne Kiil; Ploug, Michael; Pappot, Helle; Brasso, Klaus; Kroman, Niels; Højgaard, Liselotte; Kjaer, Andreas

2015-01-01

A first-in-human clinical trial with Positron Emission Tomography (PET) imaging of the urokinase-type plasminogen activator receptor (uPAR) in patients with breast, prostate and bladder cancer, is described. uPAR is expressed in many types of human cancers and the expression is predictive of invasion, metastasis and indicates poor prognosis. uPAR PET imaging therefore holds promise to be a new and innovative method for improved cancer diagnosis, staging and individual risk stratification. The uPAR specific peptide AE105 was conjugated to the macrocyclic chelator DOTA and labeled with 64Cu for targeted molecular imaging with PET. The safety, pharmacokinetic, biodistribution profile and radiation dosimetry after a single intravenous dose of 64Cu-DOTA-AE105 were assessed by serial PET and computed tomography (CT) in 4 prostate, 3 breast and 3 bladder cancer patients. Safety assessment with laboratory blood screening tests was performed before and after PET ligand injection. In a subgroup of the patients, the in vivo stability of our targeted PET ligand was determined in collected blood and urine. No adverse or clinically detectable side effects in any of the 10 patients were found. The ligand exhibited good in vivo stability and fast clearance from plasma and tissue compartments by renal excretion. In addition, high uptake in both primary tumor lesions and lymph node metastases was seen and paralleled high uPAR expression in excised tumor tissue. Overall, this first-in-human study therefore provides promising evidence for safe use of 64Cu-DOTA-AE105 for uPAR PET imaging in cancer patients. PMID:26516369

INNOVATION ET R-D DANS LES SERVICES : DES MODALITÉS ORIGINALES, QUI PEUVENT ENRICHIR LES CONCEPTIONS INDUSTRIELLES

OpenAIRE

Gadrey , Jean; Gallouj , Faïz; Lhuillery , Stéphane; Weinstein , Olivier

1994-01-01

International audience; Bien que les services soient largement majoritaires dans les grands agrégats économiques, ils ne représentent qu'une faible proportion des dépenses ou des effectifs de R-D des entreprises tels qu'ils sont évalués par les organismes nationaux et internationaux. Par ailleurs, les théories économiques de l'innovation tendent à négliger les services ou à considérer que l'innovation y est pour l'essentiel réduite à l'adoption d'innovations produites dans l'industrie. Dans c...

INNOVATIVE CLUSTER OR COMPETITIVENESS POLE?

Directory of Open Access Journals (Sweden)

Liliana Scutaru

2015-02-01

Full Text Available The paper analyzes the situation of clusters in Romania and their areas of activity and innovation in entrepreneurship Romanian state. It is made also a territorial distribution of clusters on the eight regions. The findings lead to the conclusion that there are some clusters that have the vocation to become poles of competitiveness in areas such as renewable energy, automotive, electronics, health, biotechnology, mechatronics or ICT (Information and Communication Technology which represent the resources for future of the Romanian economy. Regarding the degree of innovation of Romanian Small and Medium Enterprises (SMEs, the level is relatively modest, 30.8% of all enterprises being innovative. If we were to answer the question the title suggests, we would say "yes" to both since the innovative cluster as well as the competitiveness pole promotes par excellence, innovation through study, research and stimulation of creativity. And this is more than enough to support economic growth of Romania and maintain the competitiveness worldwide.

43 CFR 2.19 - When will bureaus waive fees?

Science.gov (United States)

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false When will bureaus waive fees? 2.19 Section... OF INFORMATION ACT Requests for Records under the FOIA § 2.19 When will bureaus waive fees? (a) Fees... section and appendix D to this part. The burden is on you to justify entitlement to a fee waiver. Requests...

36 CFR 219.1 - Purpose.

Science.gov (United States)

2010-07-01

... System Land and Resource Management Planning Purpose and Principles § 219.1 Purpose. (a) Land and... management of these lands. (3) Sustainability, composed of interdependent ecological, social, and economic elements, embodies the principles of multiple-use and sustained-yield without impairment to the...

STRATEGY FORMULATION PROCESS AND INNOVATION PERFORMANCE NEXUS

Directory of Open Access Journals (Sweden)

Chijioke Nwachukwu

2018-03-01

Full Text Available The purpose of this study is to examine the link between strategy formulation process and innovation performance indicators in microfinance banks in Nigeria (MFBs. 100 employees of leading microfinance banks were randomly selected for this study. 80 questionnaires were returned but only 76 were found usable for the analysis. Regression analysis technique was used in examining the nature of the relationships of the variables and for hypotheses testing. The authors used exploratory factor analysis and Cronbach's alpha to test for the validity and reliability of the questionnaires. The results show that strategy formulation process has a positive effect on process innovation performance, product innovation performance and marketing innovation performance. Thus, all the three hypotheses tested were supported. The authors, therefore, concludes that a systematic strategy formulation process is necessary for firms to achieve and sustain process innovation performance, product innovation performance and marketing innovation performance. This study proposed suggestion for further studies.

IMAGE AND PRESS IN THE AMAZON: the configuration of the photograph in the newspaper Estado do Pará

Directory of Open Access Journals (Sweden)

Netilia Silva dos Anjos Seixas

2016-12-01

Full Text Available Este estudo busca contribuir para o entendimento da trajetória da fotografia nos jornais paraenses, a partir de um dos principais impressos do Estado, o Estado do Pará (1911-1980. Trata-se de um estudo exploratório, com base em pesquisa bibliográfica, documental e análise dos dados empíricos, usando os métodos iconográfico e iconológico, de Erwin Panofsky e Boris Kossoy. Foram observadas as fotografias publicadas em 1912, quando uma das primeiras fotografias jornalísticas foi encontrada no impresso, 1920, 1960 e 1980, nos meses de janeiro, abril, julho e outubro, correspondendo a cerca de 30 por cento do total de edições de cada ano selecionado. O jornal Estado do Pará iniciou sua edição com apresentação gráfica inovadora, destacando-se, mais tarde, com a publicação de imagens fotográficas e participando do estabelecimento da imprensa na Amazônia.   PALAVRAS-CHAVE: Fotografia de imprensa; Jornal Estado do Pará; Amazônia.     ABSTRACT This study seeks to contribute to the understanding of the trajectory of photography in the newspapers of Pará, from one of the main printed forms of the country, the State of Pará (1911-1980. It is an exploratory study, based on bibliographical research, documentary and empirical data analysis, using the iconographic and iconological methods of Erwin Panofsky and Boris Kossoy. Photographs published in 1912 were observed, when one of the first journalistic photographs was found on the press, 1920, 1960 and 1980, in the months of January, April, July and October, corresponding to about 30 percent of the total editions of each year selected. The newspaper Estado do Pará began its edition with an innovative graphic presentation, highlighting, later, with the publication of photographic images and participating in the establishment of the press in the Amazon.   KEYWORDS: Press photography; Newspaper Estado do Pará; Amazon.     RESUMEN Este estudio pretende contribuir a la comprensi

48 CFR 2452.219-70 - Small business subcontracting plan compliance.

Science.gov (United States)

2010-10-01

... of Provisions and Clauses 2452.219-70 Small business subcontracting plan compliance. As prescribed in 2419.708(d), insert the following provision: Small Business Subcontracting Plan Compliance (FEB 2006... the clause at FAR 52.219-9, Small Business Subcontracting Plan. (c) The government will consider...

25 CFR 166.219 - How do I acquire a permit through negotiation?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false How do I acquire a permit through negotiation? 166.219 Section 166.219 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER GRAZING PERMITS Permit Requirements Obtaining A Permit § 166.219 How do I acquire a permit through negotiation? (a) Permits may be negotiated and granted by th...

The spatial dimensions of innovation

DEFF Research Database (Denmark)

Lorentzen, Anne

2005-01-01

This article takes a critical look at assumptions and ideas fundamental to theories of ‘regional innovation systems’ and ‘learning regions’. First the original theories and their roots are presented briefly. Then a number of key concepts and assumptions will be discussed. After that two trends...... of development of the original theories will be discussed. One trend is the diversification of the notion of proximity. The other is the inclusion of the global or extralocal linkages in the models. The concluding part suggests a change in perspective in the study of innovation towards a focus on the actors...... of this process and their societal embeddedness on different scales. More exploratory methods of research would be useful for the creation of relevant scientific knowledge on social processes of innovation....

48 CFR 219.800 - General.

Science.gov (United States)

2010-10-01

... (Acquisition, Technology, and Logistics) its authority under paragraph 8(a)(1)(A) of the Small Business Act (15... DEFENSE SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Contracting With the Small Business Administration (The 8(a) Program) 219.800 General. (a) By Partnership Agreement (PA) between the Small Business...

A novel zinc finger protein 219-like (ZNF219L) is involved in the regulation of collagen type 2 alpha 1a (col2a1a) gene expression in zebrafish notochord.

Science.gov (United States)

Lien, Huang-Wei; Yang, Chung-Hsiang; Cheng, Chia-Hsiung; Hung, Chin-Chun; Liao, Wei-Hao; Hwang, Pung-Pung; Han, Yu-San; Huang, Chang-Jen

2013-01-01

The notochord is required for body plan patterning in vertebrates, and defects in notochord development during embryogenesis can lead to diseases affecting the adult. It is therefore important to elucidate the gene regulatory mechanism underlying notochord formation. In this study, we cloned the zebrafish zinc finger 219-like (ZNF219L) based on mammalian ZNF219, which contains nine C2H2-type zinc finger domains. Through whole-mount in situ hybridization, we found that znf219L mRNA is mainly expressed in the zebrafish midbrain-hindbrain boundary, hindbrain, and notochord during development. The znf219L morpholino knockdown caused partial abnormal notochord phenotype and reduced expression of endogenous col2a1a in the notochord specifically. In addition, ZNF219L could recognize binding sites with GGGGG motifs and trigger augmented activity of the col2a1a promoter in a luciferase assay. Furthermore, in vitro binding experiments revealed that ZNF219L recognizes the GGGGG motifs in the promoter region of the zebrafish col2a1a gene through its sixth and ninth zinc finger domains. Taken together, our results reveal that ZNF219L is involved in regulating the expression of col2a1a in zebrafish notochord specifically.

How can strategic philanthropy contribute to innovation for companies

OpenAIRE

Matteucci, Alessandro

2014-01-01

This investigation proposes to explore the existing link between a strategic conception of philanthropy and innovation. Indeed, the nature of the research question relies on an unexplored field in the CSR and Innovation management academic literature. It starts with the interest to know which the benefits are for a firm encouraged to invest strategically in philanthropy. In this regard, the analysis contributes in fitting this gap by following different objectives in an exploratory perspectiv...

49 CFR 219.701 - Standards for drug and alcohol testing.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Standards for drug and alcohol testing. 219.701... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE Drug and Alcohol Testing Procedures § 219.701 Standards for drug and alcohol testing. (a) Drug testing required or authorized by subparts B...

20 CFR 219.30 - When evidence of marriage is required.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false When evidence of marriage is required. 219.30... EVIDENCE REQUIRED FOR PAYMENT Evidence of Relationship § 219.30 When evidence of marriage is required. (a) When an application is filed for benefits. Documentary evidence of marriage is required when an...

Prognostic value of plasma soluble urokinase plasminogen activator receptor (suPAR) in Danish patients with recurrent epithelial ovarian cancer (REOC)

DEFF Research Database (Denmark)

Begum, Farah Diba; Høgdall, Estrid V S; Riisbo, Rikke

2006-01-01

ovarian cancer (REOC). For determination of suPAR, pre-chemotherapeutic blood samples from the patients with REOC were processed into plasma (EDTA) within one working day from venipuncture. The plasma suPAR level is not correlated with performance status (p=0.41), FIGO stage (p=0.09), treatment...... of REOC patients. Multivariate analysis showed that only TFI of 12 months (p=0.001) and performance score status of 2 (p=0.02) were independent prognostic factors. Our study indicates that pre-chemotherapeutic measurement of plasma suPAR level in REOC patients may not be useful to identify a subgroup...... of patients with poor prognosis....

20 CFR 219.33 - Evidence of a deemed valid marriage.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence of a deemed valid marriage. 219.33... EVIDENCE REQUIRED FOR PAYMENT Evidence of Relationship § 219.33 Evidence of a deemed valid marriage. (a) Preferred evidence. Preferred evidence of a deemed valid marriage is— (1) Evidence of a ceremonial marriage...

20 CFR 219.32 - Evidence of a common-law marriage.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence of a common-law marriage. 219.32... EVIDENCE REQUIRED FOR PAYMENT Evidence of Relationship § 219.32 Evidence of a common-law marriage. (a) Preferred evidence. Evidence of a common-law marriage must give the reasons why the informant believes that...

Enhancing the innovative capacity of small firms through triple helix interactions : challenges and opportunities

NARCIS (Netherlands)

Ranga, Liana Marina; Miedema, Joost; Jorna, Rene

2008-01-01

This paper presents the results of a recent exploratory study aiming to enhance the innovative capacity of small firms in the Northern Netherlands, a region lagging behind the rest of the country in terms of economic growth and innovative capacity. The triple helix perspective is adopted to examine

Directed and persistent movement arises from mechanochemistry of the ParA/ParB system.

Science.gov (United States)

Hu, Longhua; Vecchiarelli, Anthony G; Mizuuchi, Kiyoshi; Neuman, Keir C; Liu, Jian

2015-12-22

The segregation of DNA before cell division is essential for faithful genetic inheritance. In many bacteria, segregation of low-copy number plasmids involves an active partition system composed of a nonspecific DNA-binding ATPase, ParA, and its stimulator protein ParB. The ParA/ParB system drives directed and persistent movement of DNA cargo both in vivo and in vitro. Filament-based models akin to actin/microtubule-driven motility were proposed for plasmid segregation mediated by ParA. Recent experiments challenge this view and suggest that ParA/ParB system motility is driven by a diffusion ratchet mechanism in which ParB-coated plasmid both creates and follows a ParA gradient on the nucleoid surface. However, the detailed mechanism of ParA/ParB-mediated directed and persistent movement remains unknown. Here, we develop a theoretical model describing ParA/ParB-mediated motility. We show that the ParA/ParB system can work as a Brownian ratchet, which effectively couples the ATPase-dependent cycling of ParA-nucleoid affinity to the motion of the ParB-bound cargo. Paradoxically, this resulting processive motion relies on quenching diffusive plasmid motion through a large number of transient ParA/ParB-mediated tethers to the nucleoid surface. Our work thus sheds light on an emergent phenomenon in which nonmotor proteins work collectively via mechanochemical coupling to propel cargos-an ingenious solution shaped by evolution to cope with the lack of processive motor proteins in bacteria.

The Influencing Factors of Enterprise Sustainable Innovation: An Empirical Study

Directory of Open Access Journals (Sweden)

Si-Hua Chen

2016-04-01

Full Text Available Sustainable innovation is the inexhaustible source of development of enterprises. Within fierce market competition, only by depending on continuous innovation can an enterprise exist and develop. By conducting an exploratory factor analysis and a confirmatory factor analysis, this paper proposes a theoretical model, dividing enterprise sustainable innovation ability into three aspects: knowledge innovation capability, production innovation capability, and market innovation capability, and analyzes the influencing factors respectively. Finally, applying this theoretical model to a practical case, with system dynamics method, the simulation results show that they are consistent with real enterprise facts. Therefore, the framework of determinants of sustainable innovation built in this paper has already been verified theoretically and practically. It not only lays a theoretical foundation for further research, but also provides a clear ground for firms to improve their sustainable innovation.

Fonds d'innovation pour le développement (FID) aux fins de la ...

International Development Research Centre (IDRC) Digital Library (Canada)

innovation en santé dans le but d'améliorer les conditions de vie des pauvres dans le monde entier. Le Fonds d'innovation pour le développement (FID) appuiera des scientifiques et des établissements voués à la recherche en santé par le ...

A perspective on open innovation in small- and medium-sized enterprises in South Africa, and design requirements for an open innovation approach

Directory of Open Access Journals (Sweden)

Krause, Willie

2015-05-01

Full Text Available This paper provides key results from an exploratory research study aimed at understanding the current landscape in small- and medium-sized enterprises (SMEs in South Africa with regard to their appetite for, and use of, open innovation. The survey, which was conducted within a contained group of SMEs that belong to business network groups on LinkedIn, explored the current use and perception of open innovation. It was found that collaboration is the approach most preferred by the SMEs surveyed, with customers and suppliers as their preferred innovation partners. Based on the findings of the survey, this paper proposes 25 design requirements, grouped into five functional categories, for an open innovation approach. The design requirements have been developed as a primer to a more complete open innovation approach for SMEs.

36 CFR 219.36 - Definitions.

Science.gov (United States)

2010-07-01

... Forest System Land and Resource Management Planning Definitions § 219.36 Definitions. Definitions of the... vision for a specific area of land or type of land within the plan area. Statements of desired conditions... species of plants or animals which are not indigenous to an area but valued for their contribution to...

Experimental Design Strategy As Part of an Innovative Construction Industry

NARCIS (Netherlands)

Rogier Laterveer

2013-01-01

This exploratory and conceptual article sets out to research what arguments and possibilities for experimentation in construction exists and if experimentation can contribute towards more innovative construction as a whole. Traditional, -western- construction is very conservative and regional, often

49 CFR 219.5 - Definitions.

Science.gov (United States)

2010-10-01

... TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE General § 219.5 Definitions. As used in this part— Accident or... alcohol) that has known mind- or function-altering effects on a human subject, specifically including any... ownership or control of the railroad and not operated or staffed by a salaried officer or employee of the...

La co-conception en partenariat de systèmes agricoles innovants

Directory of Open Access Journals (Sweden)

Vall Eric

2016-01-01

Full Text Available La co-conception de systèmes agricoles innovants est une piste prometteuse pour répondre au défi de l’innovation, notamment pour les exploitations agricoles familiales africaines confrontées à de multiples changements. Mais il faut penser à la place et aux rôles tenus par de multiples acteurs (agriculteurs, conseillers, chercheurs pour produire les changements souhaités par toutes les parties, et donc réfléchir à la question du partenariat dans le processus. Cet article présente la démarche de conception en partenariat de systèmes agricoles innovants (CPSAI élaborée entre 2005 et 2015 dans l’ouest du Burkina Faso, notamment sur la gestion de la fumure organique des cultures. La CPSAI s’appuie sur un dispositif partenarial formalisé et sur une démarche progressive en trois phases itératives : (1 exploration et formalisation du partenariat, (2 conceptions et test des options de changement, (3 bilan et désengagement. Les résultats obtenus montrent que l’innovation est plus efficace et durable quand elle est le produit d’un travail partenarial.

Management Activity Linkages to Innovation Deconstruction: An Exploratory Study of the Furniture Industry in Croatia

Directory of Open Access Journals (Sweden)

Andreja Pirc Barčić

2016-03-01

Full Text Available Corporate leaders often view innovation as a key contributor to superior profits, market sharing, and competitive positioning. However, confusion regarding the definition of innovation, how to create it, and how to implement it remains. In countries that are recent European Union members, little research has been done on innovation and how innovation is related to corporate management activities. In this study, the linkages were examined in the Croatian furniture industry. The first part of the study was to deconstruct innovation into three components: product innovation, production process innovation, and human resource innovation. The second part of the study evaluates the relationships between these innovation components and four company management activities/factors (research and development investments, company flexibility, export activity, and the Internet usage were examined. Scale testing resulted in valid deconstruction measures of innovation. Hypothesized correlations between innovation components and company management factors were supported, although the results were not fully consistent with those of previous studies.

48 CFR 252.219-7004 - Small business subcontracting plan (test program).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...

40 CFR 80.219 - Designation and downstream requirements for GPA gasoline.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Designation and downstream requirements for GPA gasoline. 80.219 Section 80.219 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... sold or dispensed for use in motor vehicles at a retail outlet or wholesale purchaser-consumer facility...

20 CFR 219.42 - When evidence of child's dependency is required.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false When evidence of child's dependency is required. 219.42 Section 219.42 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE... child's dependency is required. Evidence of a child's dependency on the employee is required when— (a...

48 CFR 1552.219-71 - Procedures for Participation in the EPA Mentor-Protege Program.

Science.gov (United States)

2010-10-01

... Participation in the EPA Mentor-Protege Program. 1552.219-71 Section 1552.219-71 Federal Acquisition Regulations... Texts of Provisions and Clauses 1552.219-71 Procedures for Participation in the EPA Mentor-Protege... EPA Mentor-Protege Program (OCT 2000) (a) This provision sets forth the procedures for participation...

Exploring Innovation: A Qualitative Study of Academic Libraries

Science.gov (United States)

Beninghove, Linda Scanlon

2016-01-01

As academic libraries evolve to affirm their place as key partners in research, teaching, and learning in university communities, the process of innovation is one of great importance in the intentional design of library services, resources, and staffing. This dissertation was a qualitative, exploratory research study in which the conceptual…

Services financiers et déploiement d'innovations agricoles au Sahel ...

International Development Research Centre (IDRC) Digital Library (Canada)

Services financiers et déploiement d'innovations agricoles au Sahel. Au cours des vingt dernières années, plusieurs innovations visant à améliorer les rendements des cultures vivrières ont été développées dans les centres de recherche agronomique d'Afrique de l'Ouest et par les chercheurs de la communauté ...

12 CFR 219.6 - Payment procedures.

Science.gov (United States)

2010-01-01

... obtain payment of costs incurred prior to the time the financial institution receives this notice. [Reg... PROVIDING FINANCIAL RECORDS; RECORDKEEPING REQUIREMENTS FOR CERTAIN FINANCIAL RECORDS (REGULATION S) Reimbursement to Financial Institutions for Providing Financial Records § 219.6 Payment procedures. (a) Notice...

36 CFR 219.20 - Ecological sustainability.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Ecological sustainability... Sustainability § 219.20 Ecological sustainability. To achieve ecological sustainability, the responsible official... diversity and species diversity are components of ecological sustainability. The planning process must...

27 CFR 28.219 - Return of wine withdrawn for export with benefit of drawback.

Science.gov (United States)

2010-04-01

... Exportation of Wine With Benefit of Drawback § 28.219 Return of wine withdrawn for export with benefit of... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Return of wine withdrawn for export with benefit of drawback. 28.219 Section 28.219 Alcohol, Tobacco Products and Firearms...

L’innovation sociale et l’entrepreneur schumpétérien : deux lectures théoriques

Directory of Open Access Journals (Sweden)

Dennis Harrisson

2012-05-01

Full Text Available Le rôle de l’entrepreneur est fondamental dans la théorie de l’innovation conçue par Schumpeter. Toutefois, le concept d’entrepreneur est toujours un sujet de controverse. D’une part, il ne semble pas guidé par un intérêt égoïste tel que le proposent les tenants de la théorie du choix rationnel; d’autre part, il n’est pas non plus contraint entièrement par les barrières institutionnelles selon les préceptes de la théorie institutionnaliste. L’entrepreneur est capable de lever les obstacles afin d’innover. Dans cet article, nous traitons de la place de l’entrepreneur dans la conception de l’innovation sociale. Les connaissances développées sur le processus d’innovation sont complétées par des avancées dans la théorie du choix rationnel et dans la théorie institutionnaliste. Ainsi, le rôle de l’entrepreneur est mieux compris comme étant l’objet d’une tension entre l’intérêt individuel et le bien commun.The entrepreneur's role is fundamental in the theory of innovation devised by Schumpeter. However, the concept of entrepreneur is still controversial. On the one hand, it does not seem guided by an egoistic interest as proposed by the advocates of rational choice theory, and secondly, it is not entirely constrained across institutional boundaries according to the principles of institutionalist theory. The entrepreneur is able to remove barriers to innovation. In this paper, we discuss the role of the entrepreneur in the development of social innovation. The knowledge acquired in the innovation process are complemented by advances in the rational choice theory of and the institutionalist theory. Thus, the role of the entrepreneur is better understood as being subject to a tension between individual interest and common good.

FooPar

DEFF Research Database (Denmark)

Hargreaves, F. P.; Merkle, D.

2013-01-01

We present FooPar, an extension for highly efficient Parallel Computing in the multi-paradigm programming language Scala. Scala offers concise and clean syntax and integrates functional programming features. Our framework FooPar combines these features with parallel computing techniques. Foo......, results based on a empirical analysis on two supercomputers are given. We achieve close-to-optimal performance wrt. theoretical peak performance. Based on this result we conclude that FooPar allows programmers to fully access Scalas design features without suffering from performance drops when compared...

Livestock Vaccine Innovation Fund: Strengthening of Research ...

International Development Research Centre (IDRC) Digital Library (Canada)

This project creates the authorization for capacity building support to develop and manage the Livestock Vaccine Innovation Fund (LVIF). The fund aims to support the ... Des chercheurs appuyés par le CRDI parlent de leurs expériences au Comité sur les ONG lors du forum de la Commission de la condition de la femme.

Par@Graph - a parallel toolbox for the construction and analysis of large complex climate networks

NARCIS (Netherlands)

Tantet, A.J.J.

2015-01-01

In this paper, we present Par@Graph, a software toolbox to reconstruct and analyze complex climate networks having a large number of nodes (up to at least 106) and edges (up to at least 1012). The key innovation is an efficient set of parallel software tools designed to leverage the inherited hybrid

Exploring the Enablers of Organizational and Marketing Innovations in SMEs

Directory of Open Access Journals (Sweden)

Oluseyi Moses Ajayi

2015-02-01

Full Text Available Previous research studies on innovation tend to focus on process and product innovations. Recent theoretical opinions reveal that Organizational and Marketing Innovations (OMIs could be the necessary prerequisites to optimally utilize and deploy such process and product innovations. It is important to note that there is a dearth of information on the enablers of OMIs capabilities among small and medium-sized enterprises (SMEs. Despite their closeness to their customers, many SMEs are finding it difficult to achieve successful and effective innovations; these are innovations that have a positive impact on the business growth and returns. This study presents findings from exploratory qualitative research conducted in South-Western Nigeria. Drawing upon information-rich evidence from 13 in-depth interviews with the owners and the managers of SMEs, this study identifies some enablers that can promote SMEs’ OMIs capabilities, effective innovations, and organizational survival.

48 CFR 219.702 - Statutory requirements.

Science.gov (United States)

2010-10-01

..., DEPARTMENT OF DEFENSE SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS The Small Business Subcontracting Program 219.702 Statutory requirements. (1) Section 834 of Public Law 101-189, as amended (15 U.S.C. 637... on a corporate, division, or plant-wide basis will reduce administrative burdens while enhancing...

Cardiovascular risk prediction in the general population with use of suPAR, CRP, and Framingham Risk Score

DEFF Research Database (Denmark)

Lyngbæk, Stig; Marott, Jacob L; Sehestedt, Thomas

2013-01-01

for men (p=0.034) and borderline significant for women (p=0.054), while the integrated discrimination improvement was highly significant (P≤0.001) for both genders. CONCLUSIONS: suPAR provides prognostic information of CVD risk beyond FRS and improves risk prediction substantially when combined with CRP...... events were recorded. After adjusting for FRS, women with suPAR levels in the highest tertile had a 1.74-fold (95% confidence interval [CI]: 1.08-2.81, p=0.027) and men a 2.09-fold (95% CI: 1.37-3.18, p20%) risk categories, respectively. This was reflected in a significant improvement of C statistics...

Morphological differentiation of Streptomyces viridochromogenes E-219 on solid culture

International Nuclear Information System (INIS)

Liang Xinle; Zhu Jing; Jin Yingyan

2012-01-01

The Streptomyces viridochromogenes E-219 was derived from Streptomyces viridochromogenes CGMCC4.1119 treated with 60 Co γ-rays irradiation and protoplast fusion. With the help of fluorescent probes, fluorescence microscope and electron microscopy, the morphology and development of E-219 on solid surface culture were investigated in this study. The effect of agarslant culture time on the production of Avilamycin was also studied to provide theoretical basis for industrial fermentation of selecting the appropriate seed to culture on the agarslant culture medium. The results implied that the development of colonies of Streptomyces viridochromogenes accompanied the intermittent hyhae apoptosis, and the production of spores was from the active mycelium. The colonial morphology of strain E-219 was significantly different from the original strain CGMCC4h1119. There were variegated hyphae formation in the stage of spore germination and initial hyphae development (10 h) with the live and dead segments alternated in a highly regular fashion within the same hypha. After the early single colony formation, the third phase was followed by profuse growth of the live segments derived from the variegated hypha, then the second apoptosis of the mycelia (48 h) was occurred with another quick growth, and sporulation was occurred at 96 h. Strain CGMCC4.1119 had spiral sporotrichial and round conidiophores with spike, whereas strain E-219 had linear sporotrichial, smooth and dylindrical conidiophore. The results of shake flask experiments indicated that the spores of E-219 had that highest activity when cultured on agarslant culture medium and incubated for 106 h with the production of avilamycin up to 1200 mg/L. (authors)

Phosphorylation of Mycobacterium tuberculosis ParB participates in regulating the ParABS chromosome segregation system.

Science.gov (United States)

Baronian, Grégory; Ginda, Katarzyna; Berry, Laurence; Cohen-Gonsaud, Martin; Zakrzewska-Czerwińska, Jolanta; Jakimowicz, Dagmara; Molle, Virginie

2015-01-01

Here, we present for the first time that Mycobacterium tuberculosis ParB is phosphorylated by several mycobacterial Ser/Thr protein kinases in vitro. ParB and ParA are the key components of bacterial chromosome segregation apparatus. ParB is a cytosolic conserved protein that binds specifically to centromere-like DNA parS sequences and interacts with ParA, a weak ATPase required for its proper localization. Mass spectrometry identified the presence of ten phosphate groups, thus indicating that ParB is phosphorylated on eight threonines, Thr32, Thr41, Thr53, Thr110, Thr195, and Thr254, Thr300, Thr303 as well as on two serines, Ser5 and Ser239. The phosphorylation sites were further substituted either by alanine to prevent phosphorylation or aspartate to mimic constitutive phosphorylation. Electrophoretic mobility shift assays revealed a drastic inhibition of DNA-binding by ParB phosphomimetic mutant compared to wild type. In addition, bacterial two-hybrid experiments showed a loss of ParA-ParB interaction with the phosphomimetic mutant, indicating that phosphorylation is regulating the recruitment of the partitioning complex. Moreover, fluorescence microscopy experiments performed in the surrogate Mycobacterium smegmatis ΔparB strain revealed that in contrast to wild type Mtb ParB, which formed subpolar foci similar to M. smegmatis ParB, phoshomimetic Mtb ParB was delocalized. Thus, our findings highlight a novel regulatory role of the different isoforms of ParB representing a molecular switch in localization and functioning of partitioning protein in Mycobacterium tuberculosis.

Phosphorylation of Mycobacterium tuberculosis ParB participates in regulating the ParABS chromosome segregation system.

Directory of Open Access Journals (Sweden)

Grégory Baronian

Full Text Available Here, we present for the first time that Mycobacterium tuberculosis ParB is phosphorylated by several mycobacterial Ser/Thr protein kinases in vitro. ParB and ParA are the key components of bacterial chromosome segregation apparatus. ParB is a cytosolic conserved protein that binds specifically to centromere-like DNA parS sequences and interacts with ParA, a weak ATPase required for its proper localization. Mass spectrometry identified the presence of ten phosphate groups, thus indicating that ParB is phosphorylated on eight threonines, Thr32, Thr41, Thr53, Thr110, Thr195, and Thr254, Thr300, Thr303 as well as on two serines, Ser5 and Ser239. The phosphorylation sites were further substituted either by alanine to prevent phosphorylation or aspartate to mimic constitutive phosphorylation. Electrophoretic mobility shift assays revealed a drastic inhibition of DNA-binding by ParB phosphomimetic mutant compared to wild type. In addition, bacterial two-hybrid experiments showed a loss of ParA-ParB interaction with the phosphomimetic mutant, indicating that phosphorylation is regulating the recruitment of the partitioning complex. Moreover, fluorescence microscopy experiments performed in the surrogate Mycobacterium smegmatis ΔparB strain revealed that in contrast to wild type Mtb ParB, which formed subpolar foci similar to M. smegmatis ParB, phoshomimetic Mtb ParB was delocalized. Thus, our findings highlight a novel regulatory role of the different isoforms of ParB representing a molecular switch in localization and functioning of partitioning protein in Mycobacterium tuberculosis.

48 CFR 752.219-8 - Utilization of small business concerns and small disadvantaged business concerns.

Science.gov (United States)

2010-10-01

... business concerns and small disadvantaged business concerns. 752.219-8 Section 752.219-8 Federal... AND CONTRACT CLAUSES Texts of Provisions and Clauses 752.219-8 Utilization of small business concerns and small disadvantaged business concerns. The Foreign Assistance Act calls for USAID to give small...

Knowledge sharing and innovation in relationships interorganizational type of information technology outsourcing

OpenAIRE

Roberta Rodrigues Faoro; Mírian Oliveira; Marcelo Faoro de Abreu

2017-01-01

Introduction: this paper presents an analysis of the sharing of knowledge and innovation in the inter-relationships of the type outsourcing of Information Technology. Objective: analyze the existence of relationship between knowledge sharing and innovation in the inter-relationships of the type of outsourcing information technology (IT). Methodology: research is exploratory, qualitative and using as a strategy the multiple case study, which analyzed 12 companies in IT outsourci...

48 CFR 219.7104 - Developmental assistance costs eligible for reimbursement or credit.

Science.gov (United States)

2010-10-01

... costs eligible for reimbursement or credit. 219.7104 Section 219.7104 Federal Acquisition Regulations... reimbursement or credit. (a) Developmental assistance provided under an approved mentor-protege agreement is... eligible for reimbursement are set forth in appendix I. (b) Before incurring any costs under the Program...

Governance, marketing and innovations in Beninese pineapple supply chains : a survey of smallholder farmers in South Benin

NARCIS (Netherlands)

Arinloye, D.D.A.A.

2013-01-01

The main goal of the study was to identify an innovative approach that could overcome market quality and price information asymmetry issues in pineapple supply chain in Benin. Two case studies were conducted in Benin and Ghana, with an in-depth survey of 219 farmers in Benin. The study mapped

48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...

Key Mechanisms for Employee-Driven Innovation in Governmental Client Organisations

DEFF Research Database (Denmark)

Sørensen, Henrik; Faber, Lene; Wandahl, Søren

2018-01-01

the mechanisms of organisational trust, innovation safety, organisational practices, cultural settings and the recognition and rewards structure to motivate employees. The decision-making procedures should be transparent especially to the idea-owner and the employees involved, and the implementation and putting......In order to ensure that knowledge and ideas are transformed into innovative contributions, a systematic approach is important. The aim of this research was to identify the specific mechanisms that are key to implementing an innovation process model when conducting Employee-driven Innovation...... in a governmental client organisation. The methodological approach was an exploratory case study of a governmental client organisation within the Danish construction industry. The units of analysis were groups of employees and managers within the case organisation. The primary mechanisms identified were...

Universities and Councils Network on Innovation for Inclusive ...

International Development Research Centre (IDRC) Digital Library (Canada)

The recently completed IDRC-supported project, 104904 Science and Technology Innovation for the Base of the Pyramid (Southeast Asia), supported research on ... Des chercheurs appuyés par le CRDI parlent de leurs expériences au Comité sur les ONG lors du forum de la Commission de la condition de la femme.

The perceptions and nature of service delivery innovation among government employees: An exploratory study

Directory of Open Access Journals (Sweden)

Nico Martins

2015-11-01

Full Text Available Innovation has become prominent within the leadership literature as an underlying and important aspect of service delivery. This study set out to determine the perceptions and nature of service delivery innovation among employees of a South African government department, using a sample of 289 participants. Statistical analysis was conducted to analyse the data which indicate that innovation is an important aspect of service delivery. This study suggests that to enhance service delivery employees should be encouraged to be innovative. The implications of the findings are discussed and recommendations for future research are made.

ParA and ParB coordinate chromosome segregation with cell elongation and division during Streptomyces sporulation

Science.gov (United States)

Donczew, Magdalena; Mackiewicz, Paweł; Wróbel, Agnieszka; Flärdh, Klas; Zakrzewska-Czerwińska, Jolanta

2016-01-01

In unicellular bacteria, the ParA and ParB proteins segregate chromosomes and coordinate this process with cell division and chromosome replication. During sporulation of mycelial Streptomyces, ParA and ParB uniformly distribute multiple chromosomes along the filamentous sporogenic hyphal compartment, which then differentiates into a chain of unigenomic spores. However, chromosome segregation must be coordinated with cell elongation and multiple divisions. Here, we addressed the question of whether ParA and ParB are involved in the synchronization of cell-cycle processes during sporulation in Streptomyces. To answer this question, we used time-lapse microscopy, which allows the monitoring of growth and division of single sporogenic hyphae. We showed that sporogenic hyphae stop extending at the time of ParA accumulation and Z-ring formation. We demonstrated that both ParA and ParB affect the rate of hyphal extension. Additionally, we showed that ParA promotes the formation of massive nucleoprotein complexes by ParB. We also showed that FtsZ ring assembly is affected by the ParB protein and/or unsegregated DNA. Our results indicate the existence of a checkpoint between the extension and septation of sporogenic hyphae that involves the ParA and ParB proteins. PMID:27248800

36 CFR 219.18 - Role of advisory committees.

Science.gov (United States)

2010-07-01

... PLANNING National Forest System Land and Resource Management Planning Collaborative Planning for... variety of public purposes, particularly those groups organized to develop landscape goals (§ 219.12(b...

48 CFR 1052.219-73 - Department of the Treasury Mentor-Protégé Program.

Science.gov (United States)

2010-10-01

... Mentor-Protégé Program. 1052.219-73 Section 1052.219-73 Federal Acquisition Regulations System... and Clauses 1052.219-73 Department of the Treasury Mentor-Protégé Program. As described in DTAR 1019.202-70, insert the following provision: Department of the Treasury Mentor-Protégé Program (JAN 2000...

Par Pond water balance

International Nuclear Information System (INIS)

Hiergesell, R.A.; Dixon, K.L.

1996-06-01

A water budget for the Par Pond hydrologic system was established in order to estimate the rate of groundwater influx to Par Pond. This estimate will be used in modeling exercises to predict Par Pond reservoir elevation and spillway discharge in the scenario where Savannah River water is no longer pumped and discharged into Par Pond. The principal of conservation of mass was used to develop the water budget, where water inflow was set equal to water outflow. Components of the water budget were identified, and the flux associated with each was determined. The water budget was considered balanced when inflow and outflow summed to zero. The results of this study suggest that Par Pond gains water from the groundwater system in the upper reaches of the reservoir, but looses water to the groundwater system near the dam. The rate of flux of groundwater from the water table aquifer into Par Pond was determined to be 13 cfs. The rate of flux from Par Pond to the water table aquifer near the dam was determined to be 7 cfs

49 CFR 219.800 - Annual reports.

Science.gov (United States)

2010-10-01

..., DEPARTMENT OF TRANSPORTATION CONTROL OF ALCOHOL AND DRUG USE Annual Report § 219.800 Annual reports. (a) Each... also use the electronic version of the MIS form provided by the DOT. The Administrator may designate... submission to FRA. For information on where to submit MIS forms and for the electronic version of the form...

20 CFR 219.50 - When evidence of “living with” is required.

Science.gov (United States)

2010-04-01

... with” is required. Evidence of “living with” (see part 222 of this chapter on Family Relationships) is... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false When evidence of âliving withâ is required. 219.50 Section 219.50 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD...

12 CFR 219.5 - Conditions for payment.

Science.gov (United States)

2010-01-01

... financial records prior to the time the financial institution is notified of such event. (c) Itemized bill... FOR PROVIDING FINANCIAL RECORDS; RECORDKEEPING REQUIREMENTS FOR CERTAIN FINANCIAL RECORDS (REGULATION S) Reimbursement to Financial Institutions for Providing Financial Records § 219.5 Conditions for...

suPAR

DEFF Research Database (Denmark)

Hodges, Gethin W; Bang, Casper N; Wachtell, Kristian

2015-01-01

The fundamental role of inflammation in cardiovascular disease (CVD) has prompted interest in numerous biomarkers that detect subclinical levels of inflammation. Soluble urokinase plasminogen activator receptor (suPAR) is a novel biomarker that correlates significantly with cardiovascular events ...... comprehensive review of suPAR in CVD and explore its function and usefulness in predicting cardiovascular events....

Idea management in support of pharmaceutical front end innovation

DEFF Research Database (Denmark)

Aagaard, Annabeth

2012-01-01

The pharmaceutical industry faces continuing pressures from rising R&D costs and depreciating value of patents, as patent lives is eroded by testing procedures and pressures from public authorities to cut health care costs. These challenges have increased the focus on shortening development times......, which again put pressure on the efficiency of front end innovation (FEI). In the attempt to overcome these various challenges pharmaceutical companies are looking for new models to support FEI. This paper explores in what way idea management can be applied as a tool in facilitation of front end...... innovation in practice. First I show through a literature study, how idea management and front end innovation are related and may support each other. Hereafter I apply an exploratory case study of front end innovation in eight medium to large pharmaceutical companies in examination of how idea management...

C9.A/14 steelwork joints de poutres par plaque frontale : assemblages par gousset

CERN Document Server

2015-01-01

Les Tables de résistances ultimes des assemblages boulonnés par plaque frontale et par gousset, complétées par une description des modèles de calcul et des exemples d’application, ont pour but de faciliter la tâche de l'ingénieur et du constructeur. Cette première partie C9.A/14 contient les chapitres suivants: - Joints de poutres par plaque frontale en acier S235 et S355 - Assemblages par gousset en acier S235 et S355 Les Tables contiennent des données relatives à la géométrie ainsi que les valeurs de calcul correspondantes des résistances ultimes des assemblages ; elles remplacent le chapitre « Assemblages par plaques frontales et boulons HR » des anciennes Tables C9.1 de 1983 / 2002. Le calcul de ces assemblages par plaque frontale est basé sur les hypothèses du modèle de la méthode des composants décrite dans la norme SN EN 1993-1-8. Les vérifications sont effectuées selon la norme SIA 263:2013. Les assemblages par gousset remplacent les assemblages par double cornière, (telle...

L'INNOVATION DANS LES SERVICES : DES MODALITÉS ORIGINALES, QUI PEUVENT ENRICHIR LES CONCEPTIONS INDUSTRIELLES

OpenAIRE

Gadrey , Jean; Gallouj , Faïz; Weinstein , Olivier

1995-01-01

International audience; Bien qu'ils soient largement majoritaires dans les grands agrégats économiques, les théories économiques de l'innovation tendent à négliger les services ou à considérer que l'innovation y est pour l'essentiel réduite à l'adoption d'innovations produites dans l'industrie. Dans cette contribution, on conteste ces points de vue en examinant les trois questions suivantes -pourquoi l'innovation dans les services est-elle méconnue ou oubliée par ces théories? -quelles sont (...

Extraction and purification of {sup 227}Ac and development of solid {sup 219}Rn source

Energy Technology Data Exchange (ETDEWEB)

Tang, Quan; Qiu, Shoukang; Xiao, Detao; Zhou, Yaohui; An, Xiaogang [University of South China, Hengyang (China). Radon Key Laboratory of Hunan Province/School of Nuclear Science and Technology

2014-04-01

The method of {sup 227}Ac extraction and purification from high-grade uranium ore and the test results of solid {sup 219}Rn source made from {sup 227}Ac are reported in this paper. With five years of follow-up monitoring, radiochemical purity of {sup 227}Ac and the emanation power of solid {sup 219}Rn source has been checked by emanation method and γ-spectrometry, the results showed that {sup 228}Th, {sup 231}Pa and {sup 226}Ra have been effectively removed and the emanation power of {sup 219}Rn source is about 80%. The long-term test results also showed that the {sup 219}Rn emanation rate remains stable in a wide air humidity range (40% ∝ 90%). Though the {sup 219}Rn source has not been accurately calibrated yet, it has been applied in the research for delay coincidence measurement of {sup 223}Ra. (orig.)

Innovation, Micro-Business and UK Government Support La politique de soutien à l’entreprise du gouvernement britannique: les micro-entreprises face au défi de l’innovation

Directory of Open Access Journals (Sweden)

Bernard Offerle

2009-10-01

Full Text Available « Innover » est devenu la solution à tous les problèmes économiques, même si le concept en lui-même reste assez difficile à cerner. On accorde, par ailleurs, un rôle essentiel aux PME dans cette course à la compétitivité. La Grande-Bretagne est dans la situation paradoxale de faire à la fois preuve de plus d’esprit d’entreprise, mais de moins d’innovation que ses principaux partenaires européens. Les Britanniques ne manquent certes pas de bonnes idées, mais ils éprouvent certaines difficultés à les transformer en produits innovants, certainement parce qu’ils ne bénéficient pas assez d’encouragements. Le gouvernement a donc élaboré un système assez sophistiqué de soutien aux petites entreprises qui tente d’apporter des réponses pratiques aux questions que peuvent se poser les entrepreneurs au quotidien. Il n’est cependant pas sûr que cette stratégie apporte les résultats escomptés : les entrepreneurs, notamment ceux d’origine étrangère ou issus de l’immigration, ont soif d’indépendance et préfèrent prendre leurs distances par rapport aux autorités. En revanche, ce dont les petits entrepreneurs ont un besoin plus urgent pour pouvoir innover sont des banquiers compréhensifs et prêts à prendre des risques. Ils souhaiteraient également ne pas être submergés par des tâches administratives qui leur prennent beaucoup trop de temps. Le gouvernement ne semble pas encore avoir su apporter de solutions très innovantes à ces deux problèmes pourtant prioritaires.

9 CFR 93.219 - Declaration for poultry.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Declaration for poultry. 93.219... AGRICULTURE EXPORTATION AND IMPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS IMPORTATION OF CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS...

Preretinal partial pressure of oxygen gradients before and after experimental pars plana vitrectomy.

Science.gov (United States)

Petropoulos, Ioannis K; Pournaras, Jean-Antoine C; Stangos, Alexandros N; Pournaras, Constantin J

2013-01-01

To evaluate preretinal partial pressure of oxygen (PO2) gradients before and after experimental pars plana vitrectomy. Arteriolar, venous, and intervascular preretinal PO2 gradients were recorded in 7 minipigs during slow withdrawal of oxygen-sensitive microelectrodes (10-μm tip diameter) from the vitreoretinal interface to 2 mm into the vitreous cavity. Recordings were repeated after pars plana vitrectomy and balanced salt solution (BSS) intraocular perfusion. Arteriolar, venous, and intervascular preretinal PO2 at the vitreoretinal interface were 62.3 ± 13.8, 22.5 ± 3.3, and 17.0 ± 7.5 mmHg, respectively, before vitrectomy; 97.7 ± 19.9, 40.0 ± 21.9, and 56.3 ± 28.4 mmHg, respectively, immediately after vitrectomy; and 59.0 ± 27.4, 25.2 ± 3.0, and 21.5 ± 4.5 mmHg, respectively, 2½ hours after interruption of BSS perfusion. PO2 2 mm from the vitreoretinal interface was 28.4 ± 3.6 mmHg before vitrectomy; 151.8 ± 4.5 mmHg immediately after vitrectomy; and 34.8 ± 4.1 mmHg 2½ hours after interruption of BSS perfusion. PO2 gradients were still present after vitrectomy, with the same patterns as before vitrectomy. Preretinal PO2 gradients are not eliminated after pars plana vitrectomy. During BSS perfusion, vitreous cavity PO2 is very high. Interruption of BSS perfusion evokes progressive equilibration of vitreous cavity PO2 with concomitant progressive return of preretinal PO2 gradients to their previtrectomy patterns. This indicates that preretinal diffusion of oxygen is not altered after vitrectomy. The beneficial effect of vitrectomy in ischemic retinal diseases or macular edema may be related to other mechanisms, such as increased oxygen convection currents or removal of growth factors and cytokines secreted in the vitreous.

Environmental management best practices: towards social innovation

OpenAIRE

Batle, Julio; Orfila-Sintes, Francina; Moon, C. J.

2018-01-01

This research investigates exploratory environmental initiatives in tourism companies in Mallorca over five years, with special consideration to those involving partnerships and synergies with other parties (including academic ones), in an exploration of Social Innovation (SI) approaches in the industry. The paper starts with an outline of the growing importance of sustainability within the hospitality industry and its inherent relation with SI. The study draws its empirical material from ten...

Establishing a CoPs-based innovation ecosystem to enhance competence - the case of CGN in China

DEFF Research Database (Denmark)

Chen, Jian; Lui, Xielin; Hu, Yimei

2016-01-01

This research investigated how an innovation system is created, and how technology, value and capability evolve at different stages of an innovation ecosystem. Based on an exploratory and process-oriented case study onof the innovation ecosystem strategy of a nuclear power giant- China General...... Nuclear Power Group (CGN, formerly known as China Guangdong Nuclear Power Group) for the period 1987-2014, this paper presents an integrative framework to explicate the micro-foundation of the formation mechanism of an innovation ecosystem for complex product system (CoPs) characterized by interdependency...

Evaluación del estado nutricional de un grupo de estudiantes universitarios mediante parámetros dietéticos y de composición corporal Nutritional status assessment in a group of university students by means of dietary parameters and body composition

OpenAIRE

C. Martínez Roldán; P. Veiga Herreros; A. López de Andrés; J. M.ª Cobo Sanz; A. Carbajal Azcona

2005-01-01

Objetivo: Valorar el estado nutricional de adultos jóvenes mediante parámetros dietéticos y de composición corporal. Metodología: La muestra está formada por 49 jóvenes (35 mujeres y 14 hombres) con una media de edad de 21,9 ± 2,9 años de la Universidad Alfonso X el Sabio de Madrid. La composición corporal se analizó usando parámetros antropométricos. Mediante cuestionarios validados se valoró la actividad física realizada durante 1 semana y la ingesta de energía y nutrientes. Ésta se estimó ...

Un « gouvernement des journalistes par le Pouvoir politique » par défaut ?

Directory of Open Access Journals (Sweden)

Matthieu Lardeau

2013-12-01

journalistes au profit d’un gouvernement indirect – ou par défaut – des journalistes par les autorités publiques.This paper aims to discuss the interactions between two concomitant phenomenathat tagged the 1950s to 1970s French press: on the one hand, the movement initiated in 1951 at Le Monde and pursued by dailies’ journalists to develop and implement journalists’ associations (“Société de journalistes” or “Société de rédacteurs” inside the newsroom to run – on their own or in association with newspaper management – newsrooms and newspapers (editorial content, and business policy to some extent; and, on the other hand, the responses to this growing movement by public authorities (both political and administrative who aimee to contain the demands for more independence and power by journalists. This exploratory study is based on the analysis of two kinds of literature too often neglected by academics despite their great richness: (1 professional literature mainly authored by journalists involved in management duties, and managers of printing presses (Perier Daville, Boegner, Pigasse, etc., a flourishing literature since 1944, and more particularly during the 1960s and 1970s; (2 the grey literature that encompasses public reports like those produced by the Prime Minister’s Office (Lindon (1970 and Serisé (1972 commissions, and the Conseil economique et social, etc. Our main results show that propositions and actions advanced by journalists and members of the news media: (1 remain largely unexploited by the profession and political authorities despite their innovation and effectiveness; (2 are regularly contained or blocked by political and public authorities who intend to maintain their ruling power over the press and journalism; (3 and that journalism-representative organizations and dominant journalists invariably uphold containment positions to limit journalists’ empowerment in management and newspaper governance. Consequently, most

STRATEGIC MANAGEMENT OF SUSTAINABILITY AND INNOVATION

Directory of Open Access Journals (Sweden)

Vanessa Cuzziol Pinsky

2013-09-01

Full Text Available The sustainable development, global competitiveness and rapid technological change increasingly challenge companies to innovate with a focus on sustainability. The objectives of this study were to identify the critical success factors in business management and identify the challenges to implement sustainable products. This is an exploratory, descriptive and qualitative research, using the case study method. Data were collected through semi-structured and in-depth interviews with executives from the marketing and innovation departments, complemented by secondary sources, including sustainability reports, websites and other company documents. The content analysis revealed the critical success factors to implement sustainable products, highlighting the involvement of senior leadership, setting goals and long term vision, the involvement of the value chain in the search for sustainable solutions and have a area of innovation with sustainability goals. The key challenges identified are related to the involvement of the supply chain, using the principles of the life cycle assessment, marketing communication and measurement of results and environmental benefits.

SOCIAL KNOWLEDGE MANAGEMENT, RESEARCH AND INNOVATION NETWORKS FOR INCLUSION

Directory of Open Access Journals (Sweden)

Sandra Ace vedo Zapata

2017-09-01

Full Text Available The objective is to describe the social management of knowledge through research and innovation networks to promote social inclusion. The reflection of the exploratory stage is presented within the doctoral thesis analyzing the challenges of the universities in the achievement of social inclusion with networks of research and innovation. A descriptive work was done, with documentary tracking, systematization and analysis. The findings show that it is necessary to articulate efforts in interdisciplinary and transdisciplinary networks with different actors: state, company, education, scientists, technologists and vulnerable, excluded populations, to build policies and strategies for social inclusion.

21 CFR 2.19 - Methods of analysis.

Science.gov (United States)

2010-04-01

... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL GENERAL ADMINISTRATIVE RULINGS AND DECISIONS General Provisions § 2.19 Methods of analysis. Where the method of analysis... issues of the “Journal of the Association of Official Analytical Chemists”), which are incorporated by...

Configurations and level structure of 219Rn

International Nuclear Information System (INIS)

Sheline, R.K.; Liang, C.F.; Paris, P.

1998-01-01

The level structure of 219 Rn has been studied using the alpha decay of 223 Ra and coincident gamma rays. While only modest changes are required in the level structure, and only above 342.8 keV, severe changes are required throughout the level scheme in the spin assigments. These changes allow the assignment of two sets of anomalous bands with K=5/2 ± and K=3/2 ± . The K=5/2 ± bands have configurations intermediate between the reflection asymmetric configuration and the g 9/2 shell model configuration, while the K=3/2 ± bands have configurations intermediate between the mixed reflection asymmetric configuration and the i 11/2 shell model configuration. Comparison of the systematics of 219 Rn with neighboring isotones, isobars, and isotopes shows clearly the collapse of the quadrupole-octupole-type configurations into the less degenerate shell model configurations. copyright 1998 The American Physical Society

Change in the game : business model innovation in the video game industry across time

OpenAIRE

Locke, Austin; Uhrínová, Bianka

2017-01-01

Technological innovation has changed business models across multiple industries – retail (Amazon), taxi (Uber), hotel (Airbnb). Through exploratory research, using secondary data, this thesis describes changes that have occurred in video gaming industry from its creation to the current, modern era that are connected to technological innovation. Based on the current research of business models, the authors created a “Value Creation-Revenue Stream Framework” that they use to anal...

Approaches to Innovation Process Assessment: Complex Results from an Exploratory Investigation

Directory of Open Access Journals (Sweden)

Ondrej Zizlavsky

2015-12-01

companies is noted. Therefore, this paper is supposed to motivate researchers to conduct more large-scale studies in the area of innovative performance measurement systems and their implementation in different business sectors and areas.

Delivering beneficial impacts in Assistive Technology: Improving government's approach to innovation.

Science.gov (United States)

Lane, Joseph P

2015-01-01

Society typically relies on the industrial sector to supply product and service innovations through the free market system. In some areas of free market failure deemed important to society - such as Assistive Technology - governments intervene by applying alternative innovation systems. This paper contends that governments consistently and inappropriately support an exploratory grant approach led by academia which generates knowledge in conceptual and prototype states, and instead should shift to a procurement contract approach led by industry which designs, tests and deploys commercial products and services.

Can Participatory Action Research Create Value for Business Model Innovation?

DEFF Research Database (Denmark)

Sparre, Mogens; Rasmussen, Ole Horn; Fast, Alf Michael

Innovation (BMI)?” – has been investigated from five different perspectives based upon The Business Model Cube and The Where to Look Model. Using both established and newly developed tools the paper presents how. Theory and data from two cases are presented and it is demonstrated how industry increase......Abstract: Participatory Action Research (PAR) has a longer academic history compared with the idea of business models (BMs). This paper indicates how industries gain by using the combined methodology. The research question "Can participatory action research create value for Business Model...... their monetary and/or non-monetary value creation doing BMI based upon PAR. The process is essential and using the methodology of PAR creates meaning. Behind the process, the RAR methodology and its link to BM and BMI may contribute to theory construction and creation of a common language in academia around...

48 CFR 53.219 - Small Business Programs.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Small Business Programs... (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.219 Small Business Programs. (a) The following form may be used in reporting small disadvantaged business contracting data: OF 312 (10/00), Small...

Parálisis cerebral :

OpenAIRE

Cabrero Izquierdo, María del Carmen

2012-01-01

Se aborda el tema de la parálisis cerebral definiendo qué es, clasificando los tipos de parálisis dependiendo de la afectación y las características principales. Se explican algunos de sus tratamientos, se dan sistemas alternativos y/o aumentativos de comunicación para un alumno con PC (parálisis cerebral).

Agents Network´s and Innovation in Traditional Small Business

Directory of Open Access Journals (Sweden)

Ricardo Augusto Bonotto Barboza

2016-12-01

Full Text Available The universe of micro and small enterprises (MSEs which is operating in traditional sectors of the economy have peculiar characteristics that is materialized in barriers to innovation, public policy of interventions are needed to minimize their difficulties. This study aimed to report the virtues , the limitations and difficulties of the implementation of two instruments as potential or as an actual innovations inducers in micro and small enterprises ( MSEs traditional base. The methodological strategy used included a qualitative research, exploratory, designed as simple cases study , with data collected through interviews and participant observation. It was found that the micro and small business traditional base, even those who are targets of public policies and programs have many difficulties to operationalize innovation. It was also noted that the junction of the two instruments potentiated innovative activities.

48 CFR 1819.7302 - NASA contract clauses.

Science.gov (United States)

2010-10-01

... to Public Law 97-219 (the Small Business Innovation Development Act of 1982). (b) Contracting... pursuant to Public Law 97-219 (the Small Business Innovation Development Act of 1982). (c) Contracting... Law 97-219 (the Small Business Innovation Development Act of 1982). (d) Contracting officers shall...

The Dilemma of Service Productivity and Service Innovation

Science.gov (United States)

Aspara, Jaakko; Klein, Jan F.; Luo, Xueming; Tikkanen, Henrikki

2017-01-01

We conduct a systematic exploratory investigation of the effects of firms’ existing service productivity on the success of their new service innovations. Although previous research extensively addresses service productivity and service innovation, this is the first empirical study that bridges the gap between these two research streams and examines the links between the two concepts. Based on a comprehensive data set of new service introductions in a financial services market over a 14-year period, we empirically explore the relationship between a firm’s existing service productivity and the firm’s success in introducing new services to the market. The results unveil a fundamental service productivity-service innovation dilemma: Being productive in existing services increases a firm’s willingness to innovate new services proactively but decreases the firm’s capabilities of bringing these services to the market successfully. We provide specific insights into the mechanism underlying the complex relationship between a firm’s productivity in existing services, its innovation proactivity, and its service innovation success. For managers, we not only unpack and elucidate this dilemma but also demonstrate that a focused customer scope and growth market conditions may enable firms to mitigate the dilemma and successfully pursue service productivity and service innovation simultaneously. PMID:29706764

Beyond venture capital : an exploratory study of the finance-innovation-policy nexus in cleantech

NARCIS (Netherlands)

Migendt, Michael; Polzin, Friedemann|info:eu-repo/dai/nl/413317404; Schock, Florian; Täube, Florian A.; von Flotow, Paschen

2017-01-01

In recent years, scholarly interest in financing for innovation has grown, particularly for mitigating cli-mate change. However, extant literature has neglected the interaction of actors along the equity financing value chain, and the indirect effects of innovation and financial policy on the supply

Global Innovation in Emerging Economies | CRDI - Centre de ...

International Development Research Centre (IDRC) Digital Library (Canada)

21 déc. 2010 ... Au cours des dernières décennies, on a assisté à une véritable transformation en ce qui concerne l'innovation de la part des entreprises, notamment au chapitre du ... Deux grandes nouvelles tendances se démarquent : l'implantation, par les sociétés multinationales, de la recherche-développement (R-D) ...

12 CFR 219.23 - Recordkeeping and reporting requirements.

Science.gov (United States)

2010-01-01

... Funds § 219.23 Recordkeeping and reporting requirements. (a) Domestic and international funds transfers... recordkeeping and reporting requirements for domestic and international funds transfers by insured depository... usefulness in criminal, tax, or regulatory investigations or proceedings. These regulations are codified at...

Novel role for proteinase-activated receptor 2 (PAR2) in membrane trafficking of proteinase-activated receptor 4 (PAR4).

Science.gov (United States)

Cunningham, Margaret R; McIntosh, Kathryn A; Pediani, John D; Robben, Joris; Cooke, Alexandra E; Nilsson, Mary; Gould, Gwyn W; Mundell, Stuart; Milligan, Graeme; Plevin, Robin

2012-05-11

Proteinase-activated receptors 4 (PAR(4)) is a class A G protein-coupled receptor (GPCR) recognized through the ability of serine proteases such as thrombin and trypsin to mediate receptor activation. Due to the irreversible nature of activation, a fresh supply of receptor is required to be mobilized to the cell surface for responsiveness to agonist to be sustained. Unlike other PAR subtypes, the mechanisms regulating receptor trafficking of PAR(4) remain unknown. Here, we report novel features of the intracellular trafficking of PAR(4) to the plasma membrane. PAR(4) was poorly expressed at the plasma membrane and largely retained in the endoplasmic reticulum (ER) in a complex with the COPI protein subunit β-COP1. Analysis of the PAR(4) protein sequence identified an arginine-based (RXR) ER retention sequence located within intracellular loop-2 (R(183)AR → A(183)AA), mutation of which allowed efficient membrane delivery of PAR(4). Interestingly, co-expression with PAR(2) facilitated plasma membrane delivery of PAR(4), an effect produced through disruption of β-COP1 binding and facilitation of interaction with the chaperone protein 14-3-3ζ. Intermolecular FRET studies confirmed heterodimerization between PAR(2) and PAR(4). PAR(2) also enhanced glycosylation of PAR(4) and activation of PAR(4) signaling. Our results identify a novel regulatory role for PAR(2) in the anterograde traffic of PAR(4). PAR(2) was shown to both facilitate and abrogate protein interactions with PAR(4), impacting upon receptor localization and cell signal transduction. This work is likely to impact markedly upon the understanding of the receptor pharmacology of PAR(4) in normal physiology and disease.

MicroRNA-219-5p Promotes Tumor Growth and Metastasis of Hepatocellular Carcinoma by Regulating Cadherin 1

Directory of Open Access Journals (Sweden)

Jing Yang

2018-01-01

Full Text Available MicroRNAs play significant roles in the development of cancer and may serve as promising therapeutic targets. In our previous work, miR-219-5p was identified as one of the important metastasis-related microRNAs in HCC. Here we demonstrated that miR-219-5p expression was elevated in HCC tissues and was associated with vascular invasion and dismal prognosis. In multivariate analysis, miR-219-5p was identified as an independent prognostic indicator for HCC patients. Functional mechanism analyses showed that miR-219-5p promoted HCC cell proliferation and invasion in in vitro, as well as in vivo, tumor growth and metastasis in nude mice models bearing human HCC tumors. In addition, cadherin 1 (CDH1 was revealed to be a downstream target of miR-219-5p in HCC cells. In conclusion, miR-219-5p promotes tumor growth and metastasis of HCC by regulating CDH1 and can serve as a prognostic marker for HCC patients.

Innovative potential of small and medium-sized enterprises in the Antofagasta-Chile region: an exploratory study

Directory of Open Access Journals (Sweden)

Gianni A. Romani Chocce

2006-10-01

Full Text Available The aim of this research is to analyze the innovative potential of Small and Medium Enterprises (SMEs in the Region of Antofagasta - Chile. The paper makes a detailed bibliographic revision on regional innovation processes and presents the results of a questionnaire applied to SMEs, considered as innovative according to the Organization for Economic Co-operation and Development (OCDE criteria. Although these results have to be carefully considered, due to the size of the sample it is possible to observe that there is an increasing awareness of the importance of innovation in the region while, at the same time, many obstacles to innovate are recognized.

25 CFR 2.19 - Action by Area Directors and Education Programs officials on appeal.

Science.gov (United States)

2010-04-01

... Programs officials on appeal. (a) Area Directors, Area Education Programs Administrators, Agency... 25 Indians 1 2010-04-01 2010-04-01 false Action by Area Directors and Education Programs officials on appeal. 2.19 Section 2.19 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR PROCEDURES...

CHARACTERIZATION OF THE K2-19 MULTIPLE-TRANSITING PLANETARY SYSTEM VIA HIGH-DISPERSION SPECTROSCOPY, AO IMAGING, AND TRANSIT TIMING VARIATIONS

Energy Technology Data Exchange (ETDEWEB)

Narita, Norio; Hori, Yasunori; Kusakabe, Nobuhiko; Takeda, Yoichi; Tamura, Motohide [Astrobiology Center, 2-21-1 Osawa, Mitaka, Tokyo, 181-8588 (Japan); Hirano, Teruyuki [Department of Earth and Planetary Sciences, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo 152-8551 (Japan); Fukui, Akihiko; Yanagisawa, Kenshi [Okayama Astrophysical Observatory, National Astronomical Observatory of Japan, Asakuchi, Okayama 719-0232 (Japan); Sanchis-Ojeda, Roberto [Department of Astronomy, University of California, Berkeley, CA 94720 (United States); Winn, Joshua N. [Department of Physics, and Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Ryu, Tsuguru; Onitsuka, Masahiro [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo, 181-8588 (Japan); Kudo, Tomoyuki [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI 96720 (United States); Delrez, Laetitia; Gillon, Michael; Jehin, Emmanuel [Institut d’Astrophysique et de Géophysique, Université de Liège, Allée du 6 Août 17, Bat. B5C, B-4000 Liège (Belgium); McCormac, James [Department of Physics, University of Warwick, Gibbet Hill Road, Coventry CV4 7AL (United Kingdom); Holman, Matthew [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Izumiura, Hideyuki, E-mail: norio.narita@nao.ac.jp [SOKENDAI (The Graduate University for Advanced Studies), 2-21-1 Osawa, Mitaka, Tokyo, 181-8588 (Japan)

2015-12-10

K2-19 (EPIC201505350) is an interesting planetary system in which two transiting planets with radii ∼7 R{sub ⊕} (inner planet b) and ∼4 R{sub ⊕} (outer planet c) have orbits that are nearly in a 3:2 mean-motion resonance. Here, we present results of ground-based follow-up observations for the K2-19 planetary system. We have performed high-dispersion spectroscopy and high-contrast adaptive-optics imaging of the host star with the HDS and HiCIAO on the Subaru 8.2 m telescope. We find that the host star is a relatively old (≥8 Gyr) late G-type star (T{sub eff} ∼ 5350 K, M{sub s} ∼ 0.9 M{sub ⊙}, and R{sub s} ∼ 0.9 R{sub ⊙}). We do not find any contaminating faint objects near the host star that could be responsible for (or dilute) the transit signals. We have also conducted transit follow-up photometry for the inner planet with KeplerCam on the FLWO 1.2 m telescope, TRAPPISTCAM on the TRAPPIST 0.6 m telescope, and MuSCAT on the OAO 1.88 m telescope. We confirm the presence of transit timing variations (TTVs), as previously reported by Armstrong and coworkers. We model the observed TTVs of the inner planet using the synodic chopping formulae given by Deck and Agol. We find two statistically indistinguishable solutions for which the period ratios (P{sub c}/P{sub b}) are located slightly above and below the exact 3:2 commensurability. Despite the degeneracy, we derive the orbital period of the inner planet P{sub b} ∼ 7.921 days and the mass of the outer planet M{sub c} ∼ 20 M{sub ⊕}. Additional transit photometry (especially for the outer planet) as well as precise radial-velocity measurements would be helpful to break the degeneracy and to determine the mass of the inner planet.

Evaluating Additionality of an Innovation Subsidy Program Targeted at SMEs: An Exploratory Study

Directory of Open Access Journals (Sweden)

Sonja Radas

2013-04-01

Full Text Available This paper explores the effectiveness of a recently introduced innovation subsidy program targeted at SMEs in Croatia. Three aspects of program additionality were evaluated: input, output and behavioral aspects. Both qualitative and survey research was employed, and four case studies with selected recipient companies were conducted. This study is a response to the policy-makers’ need for early program assessment. It attempts to show that even with early evaluation and small population of recipients it is possible to gain insight into program effectiveness. The analysis suggests that the effects of programs targeted at innovative SMEs might need to be evaluated differently than general subsidies. This is especially evident in the evaluation of input additionality. The analysis indicates that SMEs which started with a higher R&D capability tend to increase R&D intensity while participating in the program. The program raised R&D and innovation capability of the participating SMEs, but commercialization of project results remains a concern.

Investigating the effects of ICT on innovation and performance of European hospitals: an exploratory study.

Science.gov (United States)

Arvanitis, Spyros; Loukis, Euripidis N

2016-05-01

Hospitals are making big investments in various types of ICT, so it is important to investigate their effects on innovation and performance. This paper presents an empirical study in this direction, based on data for 743 hospitals from 18 European countries. We specified and estimated econometrically five equations: one for product innovation, one for process innovation and three equations for the three different dimensions of (ICT-enabled) hospital performance. All five equations included various ICT-related variables reflecting ICT infrastructure and a series of important ICT applications, some of them hospital-specific, and some others of general business use, and also ICT personnel (viewed as a kind of 'soft' ICT investment), while the performance equations also included the two innovation measures.

Using customer relationships to acquire technological innovation: a value-chain analysis of supplier contracts with scientific research institutions

CERN Multimedia

2003-01-01

"In this exploratory research, a value-chain analysis is used to investigate how industrial suppliers working with the European Research Laboratory for Particle Physics (CERN) gain benefits resulting from technological innovation".

Virtual Exploratories

DEFF Research Database (Denmark)

Jensen, Sisse Siggaard

2006-01-01

-systems, the paper introduces the designing strategy referred to as virtual exploratories. Some of the advanced virtual worlds may inspire the design of such provoking and challenging virtual exploratories, and especially the Massively Multi-User Online Role-Playing Games (MMORPGS). However, if we have to learn from...... the design and activity of the advanced virtual worlds and role-playing games, then the empirical research on the actors’ activity, while they are acting, is an important precondition to it. A step towards the conception of such a designing strategy for virtual exploratories is currently pursued....... [1] The research project: Actors and Avatars Communicating in Virtual Worlds – an Empirical Analysis of Actors’ Sense-making Strategies When Based on a Communication Theoretical Approach’ (2006-2007) is supported...

Records management: a basis for organizational learning and innovation

Directory of Open Access Journals (Sweden)

Francisco José Aragão Pedroza Cunha

Full Text Available The understanding of (transformations related to organizational learning processes and knowledge recording can promote innovation. The objective of this study was to review the conceptual contributions of several studies regarding Organizational Learning and Records Management and to highlight the importance of knowledge records as an advanced management technique for the development and attainment of innovation. To accomplish this goal, an exploratory and multidisciplinary literature review was conducted. The results indicated that the identification and application of management models to represent knowledge is a challenge for organizations aiming to promote conditions for the creation and use of knowledge in order to transform it into organizational innovation. Organizations can create spaces and environments for local, regional, national, and global exchange with the strategic goal of generating and sharing knowledge, provided they know how to utilize Records Management mechanisms.

Corneal topographic changes after 20-gauge pars plana vitrectomy associated with scleral buckling for the treatment of rhegmatogenous retinal detachment

Directory of Open Access Journals (Sweden)

Alexandre Achille Grandinetti

2013-04-01

Full Text Available PURPOSE: To evaluate the changes in corneal topography after 20-gauge pars plana vitrectomy associated with scleral buckling for the repair of rhegmatogenous retinal detachment. METHODS: Twenty-five eyes of 25 patients with rhegmatogenous retinal detachment were included in this study. 20-gauge pars plana vitrectomy associated with scleral buckling was performed in all patients. The corneal topography of each was measured before surgery and one week, one month, and three months after surgery by computer-assisted videokeratoscopy. RESULTS: A statistically significant central corneal steepening (average, 0,9 D , p<0,001 was noted one week after surgery. The total corneal astigmatism had a significant increase in the first postoperative month (p=0,007. All these topographic changes persisted for the first month but returned to preoperative values three months after the surgery. CONCLUSION: Pars plana vitrectomy with scleral buckling was found to induce transient changes in corneal topography.

The energy transition: new dialogues between cities and local stakeholders. Exploratory study

International Nuclear Information System (INIS)

Saxer, Olivia; Lacassagne, Sylvie; Guerin, Laura; Dupas, Stephane

2016-01-01

Energy Cities has carried out an exploratory study for cities and diverse project leaders desiring to start a sustainable energy transition in collaboration with all stakeholders in their territory. Local authorities have a key role to play in climate and energy policies and in the energy transition towards a low carbon, energy efficient and sustainable society. However, they cannot act alone. They often control only a small percentage of the emissions of local greenhouse gases directly, and this percentage rarely exceeds a quarter. It is therefore necessary to rely on the involvement of local stakeholders, which in turn will provide an opportunity for these stakeholders to be ambitious through innovative actions. How to stimulate stakeholders' involvement? In the past several years, a number of citizens', economic actors' or other local actors' initiatives have contributed to the energy transition of territories. These initiatives are based on empowerment. For instance, stakeholders can get access and the power to act on innovative tools and approaches, such as social economy, stakeholders' participation, crowd-funding, renewable energy citizen cooperatives and fab labs. Two primary questions to explore: As coordinators and pilots of local strategies for energy transition, how can local authorities foster, identify, support and replicate local energy transition initiatives? What dialogue should local authorities and leaders of local initiatives engage in? How can they drive new modes of governance, where stakeholders share responsibility to co-develop public policies, manage their city, and encourage the energy transition at the local level? We selected more than ten European energy transition initiatives, as diverse as they are innovative, anticipating new forms of governance and new ways to act and collaborate. The exploratory study does not only describe their process but it also analyses the synergies between the different stakeholders and the role the

The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC model.

Science.gov (United States)

Murai, Kiyohito; Sun, Guoqiang; Ye, Peng; Tian, E; Yang, Su; Cui, Qi; Sun, Guihua; Trinh, Daniel; Sun, Olivia; Hong, Teresa; Wen, Zhexing; Kalkum, Markus; Riggs, Arthur D; Song, Hongjun; Ming, Guo-li; Shi, Yanhong

2016-03-11

Dysregulated expression of miR-219, a brain-specific microRNA, has been observed in neurodevelopmental disorders, such as schizophrenia (SCZ). However, its role in normal mammalian neural stem cells (NSCs) and in SCZ pathogenesis remains unknown. We show here that the nuclear receptor TLX, an essential regulator of NSC proliferation and self-renewal, inhibits miR-219 processing. miR-219 suppresses mouse NSC proliferation downstream of TLX. Moreover, we demonstrate upregulation of miR-219 and downregulation of TLX expression in NSCs derived from SCZ patient iPSCs and DISC1-mutant isogenic iPSCs. SCZ NSCs exhibit reduced cell proliferation. Overexpression of TLX or inhibition of miR-219 action rescues the proliferative defect in SCZ NSCs. Therefore, this study uncovers an important role for TLX and miR-219 in both normal neurodevelopment and in SCZ patient iPSC-derived NSCs. Moreover, this study reveals an unexpected role for TLX in regulating microRNA processing, independent of its well-characterized role in transcriptional regulation.

An Exploratory Study of Consumer Adoption of Online Shipping: Mediating Effect of Online Purchase Intention

OpenAIRE

Songpol Kulviwat; Ramendra Thaku; Chiquan Guo

2006-01-01

An exploratory study was conducted to investigate consumer adoption of online purchase using a survey data set. Based upon the theory of innovation and self-efficacy theory, risk aversion, online proficiency, shopping convenience, and product choice variety were proposed to influence consumer intention to shop online, which, in turn, affects online purchases. Results of regression analyses revealed that all but shopping convenience were significant predictors of consumer intention to purchase...

Engaging pediatric intensive care unit (PICU) clinical staff to lead practice improvement: the PICU participatory action research project (PICU-PAR).

Science.gov (United States)

Collet, Jean-Paul; Skippen, Peter W; Mosavianpour, Mir Kaber; Pitfield, Alexander; Chakraborty, Bubli; Hunte, Garth; Lindstrom, Ronald; Kissoon, Niranjan; McKellin, William H

2014-01-08

Despite considerable efforts, engaging staff to lead quality improvement activities in practice settings is a persistent challenge. At British Columbia Children's Hospital (BCCH), the pediatric intensive care unit (PICU) undertook a new phase of quality improvement actions based on the Community of Practice (CoP) model with Participatory Action Research (PAR). This approach aims to mobilize the PICU 'community' as a whole with a focus on practice; namely, to create a 'community of practice' to support reflection, learning, and innovation in everyday work. An iterative two-stage PAR process using mixed methods has been developed among the PICU CoP to describe the environment (stage 1) and implement specific interventions (stage 2). Stage 1 is ethnographic description of the unit's care practice. Surveys, interviews, focus groups, and direct observations describe the clinical staff's experiences and perspectives around bedside care and quality endeavors in the PICU. Contrasts and comparisons across participants, time and activities help understanding the PICU culture and experience. Stage 2 is a succession of PAR spirals, using results from phase 1 to set up specific interventions aimed at building the staff's capability to conduct QI projects while acquiring appropriate technical skills and leadership capacity (primary outcome). Team communication, information, and interaction will be enhanced through a knowledge exchange (KE) and a wireless network of iPADs. Lack of leadership at the staff level in order to improve daily practice is a recognized challenge that faces many hospitals. We believe that the PAR approach within a highly motivated CoP is a sound method to create the social dynamic and cultural context within which clinical teams can grow, reflect, innovate and feel proud to better serve patients.

Par Pond vegetation status 1996

International Nuclear Information System (INIS)

Mackey, H.E. Jr.; Riley, R.S.

1996-12-01

The water level of Par Pond was lowered approximately 20 feet in mid-1991 in order to protect downstream residents from possible dam failure suggested by subsidence on the downstream slope of the dam and to repair the dam. This lowering exposed both emergent and nonemergent macrophyte beds to drying conditions resulting in extensive losses. A survey of the newly emergent, shoreline aquatic plant communities of Par Pond began in June 1995, three months after the refilling of Par Pond to approximately 200 feet above mean sea level. These surveys continued in July, September, and late October, 1995, and into the early spring and late summer of 1996. Communities similar to the pre-drawdown, Par Pond aquatic plant communities continue to become re-established. Emergent beds of maidencane, lotus, waterlily, watershield, and Pontederia are extensive and well developed. Measures of percent cover, width of beds, and estimates of area of coverage with satellite data indicate regrowth within two years of from 40 to 60% of levels prior to the draw down. Cattail occurrence continued to increase during the summer of 1996, especially in the former warm arm of Par Pond, but large beds common to Par Pond prior to the draw down still have not formed. Lotus has invaded and occupies many of the areas formerly dominated by cattail beds. To track the continued development of macrophytes in Par Pond, future surveys through the summer and early fall of 1997, along with the evaluation of satellite data to map the extent of the macrophyte beds of Par Pond, are planned

48 CFR 52.219-2 - Equal Low Bids.

Science.gov (United States)

2010-10-01

.... If the bidder is awarded a contract as a result of receiving priority consideration under this... AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 52.219-2 Equal...) amount to more than 50 percent of the contract price. (c) Failure to identify the labor surplus areas as...

Code Assessment of SPACE 2.19 using LSTF Steam Generator Tube Rupture Test

Energy Technology Data Exchange (ETDEWEB)

Kim, Minhee; Kim, Seyun [KHNP CRI, Daejeon (Korea, Republic of)

2016-10-15

The SPACE is a best estimated two-phase three-field thermal-hydraulic analysis code used to analyze the safety and performance of pressurized water reactors. As a result of the development, the 2.19 version of the code was released through the successive various verification and validation works. The present work is on the line of expanding the work by Kim et al. In this study, results produced by the SPACE 2.19 code were compared with the experimental data from JAERI's LSTF Test Run LSTF SB-SG-06 experiment simulating a Steam Generator Tube Rupture (SGTR) transient. In order to identify the predictability of SPACE 2.19, the LSTF steam generator tube rupture test was simulated. To evaluate the computed results, LSTF SB-SG-06 test data simulating the SGTR and the RELAP5/ MOD3.1 are used. The calculation results indicate that the SPACE 2.19 code predicted well the sequence of events and the major phenomena during the transient, such as the asymmetric loop behavior, reactor coolant system cooldown and heat transfer by natural circulation, the primary and secondary system depressurization by the pressurizer auxiliary spray and the steam dump using the intact loop steam generator relief valve.

48 CFR 852.219-72 - Evaluation factor for participation in the VA mentor-protégé program.

Science.gov (United States)

2010-10-01

... participation in the VA mentor-protégé program. 852.219-72 Section 852.219-72 Federal Acquisition Regulations... Texts of Provisions and Clauses 852.219-72 Evaluation factor for participation in the VA mentor-protégé... the VA Mentor-Protégé Program (DEC2009) This solicitation contains an evaluation factor or sub-factor...

33 CFR 135.219 - Notification of changes affecting certification.

Science.gov (United States)

2010-07-01

... SECURITY (CONTINUED) MARINE POLLUTION FINANCIAL RESPONSIBILITY AND COMPENSATION OFFSHORE OIL POLLUTION COMPENSATION FUND Financial Responsibility for Offshore Facilities § 135.219 Notification of changes affecting... Fund Administrator in writing when any changes occur which prevent the owner, operator, or guarantor...

25 CFR 39.219 - What happens if a residential program does not maintain residency levels required by this subpart?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false What happens if a residential program does not maintain residency levels required by this subpart? 39.219 Section 39.219 Indians BUREAU OF INDIAN AFFAIRS..., Student Counts, and Verifications Residential Programs § 39.219 What happens if a residential program does...

20 CFR 725.219 - Duration of entitlement; child.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Duration of entitlement; child. 725.219... of entitlement; child. (a) An individual is entitled to benefits as a child for each month beginning... month in which any one of the following events first occurs: (1) The child dies; (2) The child marries...

MicroRNA-219-2-3p functions as a tumor suppressor in gastric cancer and is regulated by DNA methylation.

Directory of Open Access Journals (Sweden)

Huizi Lei

Full Text Available BACKGROUND AIMS: Gastric cancer is the most frequent gastrointestinal tumor in adults and is the most lethal form of human cancer. Despite of the improvements in treatments, the underlying mechanism of gastric carcinogenesis is not well known. To define novel modulators that regulate susceptibility to tumorgenesis, we focused on miR-219-2-3p. METHODS: Quantitative RT-PCR was employed to investigate the level of miR-219-2-3p in gastric cancer (GC tissues (n = 113 and their matched adjacent normal tissues (n = 113. In vitro cell proliferation, apoptosis assays, cell migration, and invasion assays were performed to elucidate biological effects of miR-219-2-3p. Since silencing of miRNA by promoter CpG island methylation may be an important mechanism in tumorgenesis, GC cells were treated with 5-aza-2'-deoxycytidine and trichostatin A, and expression changes of miR-219-2-3p were subsequently examined by quantitative RT-PCR. Finally, the methylation status of CpG island upstream of miR-219-2-3p was analyzed by methylation-specific PCR in GC tissues (n = 22. RESULTS: miR-219-2-3p was down-regulated in GC and cell lines. In addition, the experiments documented the lower expression of miR-219-2-3p in GC specimens with higher grade and later stage tumors. Meanwhile, miR-219-2-3p exerted antiproliferative, proapoptotic, and antimetastatic roles and reduced levels of p-ERK1/2 in GC cells. Furthermore, 5-aza-2'-deoxycytidine and trichostatin A increased the expression (~2 fold of miR-219-2-3p in GC cells. By methylation-specific PCR, DNA methylation in the upstream region of miR-219-2-3p was detected in both adjacent normal tissues and cancer tissues. As expected, the methylation level was considerably higher in the miR-219-2-3p down-regulated group than up-regulated group. CONCLUSIONS: miR-219-2-3p is potentially involved in gastric cancer progression and metastasis by regulating ERK1/2-related signal pathways, which may provide a novel therapeutic strategy

Hypothalamic miR-219 regulates individual metabolic differences in response to diet-induced weight cycling

Directory of Open Access Journals (Sweden)

Mariana Schroeder

2018-03-01

Full Text Available Consumption of a low calorie diet is the most common approach to lose weight. While generally effective at first, it is frequently followed by a relapse where the pre-diet weight is regained, and often exceeded. This pattern of repeated weight loss/regain is referred to as weight cycling and the resulting metabolic response varies greatly between individuals. Objective: We attempted to address the issue of individual differences in the response to weight cycling in male mice. Methods: We first exposed adult wild type mice to repeated cycles of high/low fat food. Next, using a lentiviral approach, we knocked-down or over-expressed miR-219 in the ventromedial hypothalamus (VMH of an additional mouse cohort and performed a full metabolic assessment. Results: Exposure of wild type males to weight cycling resulted in the division of the cohort into subsets of resistant versus metabolic-syndrome-prone (MS animals, which differed in their metabolic profile and hypothalamic miR-219 levels. Lentiviral knock-down of miR-219 in the VMH led to exacerbation of metabolic syndrome. In contrast, over-expression of miR-219 resulted in moderation of the metabolic syndrome phenotype. Conclusions: Our results suggest a role for miR-219 in the mediation of the metabolic phenotype resulting from repeated weight cycling. Keywords: Weight cycling, Metabolic syndrome, miRNAs, Ventromedial hypothalamus, High fat diet, Diabetes

Navigating the Tensions of Innovative Assessment and Pedagogy in Higher Education

Directory of Open Access Journals (Sweden)

Jennifer Lock

2018-04-01

Full Text Available Innovative practice in a classroom adds challenges and tensions to programs and institutional structures in higher education. With the recent emphasis on curricula reform, there is a great focus on assessment and pedagogical practices to support student learning. To illustrate the tensions arising from these efforts, we present four pedagogical and assessment innovation approaches using both Shulman’s (2005 Signature Pedagogies and Tatar’s (2007 Design Tensions frameworks. The four approaches include problem-based learning, game-based learning, case-based learning, and technology-enhanced learning. A narrative for each approach examines and addresses tensions using Shulman’s (2005 surface, deep and implicit structures. We argue that there is an interconnected complexity and conflicting visions among the micro- (e.g., classroom or practicum, meso- (e.g., program, and macro- (e.g., institution levels. We acknowledge that dynamic tensions continually exist and needs to be thoughtfully navigated in support of innovative assessment and pedagogies in higher education. Dans l’enseignement supérieur, les pratiques innovatrices en salle de classe ajoutent des défis et des tensions aux programmes et aux structures institutionnelles. Suite à l’importance accrue récemment attachée à la réforme des programmes d’études, l’accent est mis sur l’évaluation et les pratiques pédagogiques pour soutenir l’apprentissage des étudiants. Afin d’illustrer les tensions qui découlent de ces efforts, nous présentons quatre approches de pédagogie et d’évaluation innovatrices qui font appel à la fois aux cadres de Shulman, Signature Pedagogies (2005, et à ceux de Tatar, Design Tensions (2007. Les quatre approches comprennent l’apprentissage par problèmes, l’apprentissage fondé sur le jeu, l’apprentissage basé sur des cas et l’apprentissage amélioré par les technologies. Chaque approche est examinée et traite des tensions

48 CFR 52.219-19 - Small Business Concern Representation for the Small Business Competitiveness Demonstration Program.

Science.gov (United States)

2010-10-01

... Representation for the Small Business Competitiveness Demonstration Program. 52.219-19 Section 52.219-19 Federal... Representation for the Small Business Competitiveness Demonstration Program. As prescribed in 19.1008(a), insert the following provision: Small Business Concern Representation for the Small Business Competitiveness...

Developing a Scale for Innovation Management at Schools: A Study of Validity and Reliability

Science.gov (United States)

Bulbul, Tuncer

2012-01-01

The purpose of this study is to develop a valid and reliable assessment tool for use in determining the competency beliefs of school administrators about innovation management. The scale applied to a study group of 216 school administrators, after work Centered on assessing intelligibility and specialized opinion. Exploratory and confirmatory…

Innovations et métallurgies en Méditerranée occidentale (XIIIe–XVe siècles

Directory of Open Access Journals (Sweden)

Verna, Catherine

2011-12-01

Full Text Available After a definition of technical innovation in the Middle Ages and it’s relationship to industry, this paper explores it’s characteristics in the fi eld of iron and silver (silver-bearing lead and copper metallurgy from the 13th to the 15th centuries in the western Mediterranean area. The exploration opens with a synthesis of the circulation of iron and steel products, with special care taken over the definition of their respective qualities, in particular the distinction between iron and steel; the exploration continues with an introduction to specific technical territories related to industrial “districts”, which allows the author to present the study of the circulation of technical knowledge. The paper concludes with a study of notables (Catalan in particular as rural entrepreneurs who invested in the technical innovation of their time.[fr] Après avoir défi ni l’innovation technique au Moyen Âge et ses rapports à l’industrie, cet article en étudie les caractéristiques dans les domaines de la métallurgie du fer et de l’argent (plomb et cuivre argentifères du XIIIe au XVe siècle, en Méditerranée occidentale. Cet examen s’ouvre par un tableau de la circulation des produits sidérurgiques, attentif à la définition de leurs qualités respectives, en particulier à la distinction fer-acier; il se poursuit par la présentation des territoires techniques spécifiques associés à des districts industriels, ce qui permet à l’auteur d’aborder l’étude des circulations des savoirs techniques. L’article se conclut par une étude des notables (en particulier catalans, entrepreneurs ruraux, qui ont investi dans l’innovation technique.

36 CFR 219.4 - Identification and consideration of issues.

Science.gov (United States)

2010-07-01

... capabilities and available resources, including current and likely Forest Service budgets; (iv) The scientific... restore ecological conditions that are similar to the biological and physical range of expected variability (§ 219.20(b)(1)); and (vii) Opportunities to contribute to knowledge about and preservation of...

Engaging Pediatric Intensive Care Unit (PICU) clinical staff to lead practice improvement: the PICU Participatory Action Research Project (PICU-PAR)

Science.gov (United States)

2014-01-01

Background Despite considerable efforts, engaging staff to lead quality improvement activities in practice settings is a persistent challenge. At British Columbia Children’s Hospital (BCCH), the pediatric intensive care unit (PICU) undertook a new phase of quality improvement actions based on the Community of Practice (CoP) model with Participatory Action Research (PAR). This approach aims to mobilize the PICU ‘community’ as a whole with a focus on practice; namely, to create a ‘community of practice’ to support reflection, learning, and innovation in everyday work. Methodology An iterative two-stage PAR process using mixed methods has been developed among the PICU CoP to describe the environment (stage 1) and implement specific interventions (stage 2). Stage 1 is ethnographic description of the unit’s care practice. Surveys, interviews, focus groups, and direct observations describe the clinical staff’s experiences and perspectives around bedside care and quality endeavors in the PICU. Contrasts and comparisons across participants, time and activities help understanding the PICU culture and experience. Stage 2 is a succession of PAR spirals, using results from phase 1 to set up specific interventions aimed at building the staff’s capability to conduct QI projects while acquiring appropriate technical skills and leadership capacity (primary outcome). Team communication, information, and interaction will be enhanced through a knowledge exchange (KE) and a wireless network of iPADs. Relevance Lack of leadership at the staff level in order to improve daily practice is a recognized challenge that faces many hospitals. We believe that the PAR approach within a highly motivated CoP is a sound method to create the social dynamic and cultural context within which clinical teams can grow, reflect, innovate and feel proud to better serve patients. PMID:24401288

CONSUMERS' PERCEPTION ON INNOVATION IN THE TOURISM VALUE CHAIN

Directory of Open Access Journals (Sweden)

Ravar Anamaria Sidonia

2013-07-01

Full Text Available In the current economic environment, innovation is considered critical by the majority of tourism companies that are increasingly willing to spend more to become more innovative. This tendency is visible in all segments of the tourism value chain: accommodation services, transportation, intermediaries – travel agencies and tour-operators – as well at entertainment and leisure facilities. The final aim of innovation in tourism enterprises is to increase customer satisfaction and thus secure the enterprises' competitive advantage on a continuously changing market. Thus, consumers' perception on innovation is relevant not only to academics and researchers, but especially to organisations in the business environment, which use customer feedback in order to develop innovative products which are better suited to the individual needs of tourists. The purpose of this article is to determine how consumers of tourist services perceive innovation in the various segments of the tourism value chain. The results will indicate the perceived intensity with which innovation is implemented in the tourism industry as well as the sectors in which innovation could bring additional benefits to tourists. To this aim, it was conducted a literature review on the main types of innovations in hospitality, airline transportation and travel intermediaries, as well as a pilot questionnaire-based study on 120 regular consumers of tourist services. Results indicate a discrepancy between the importance tourists give to innovation and the actual perceived level of innovation in the tourism value chain. Furthermore, the research shows the importance of innovation in different segments of the tourism value chain in the purchase decision of a tourism product. Unfortunately, results indicate that Romanian tourism operators' perceived innovativeness is lower in comparison with foreign tourism operators. The study is exploratory, representing a starting point into a more

Characterization of Brazilian Industrial Companies’ Processes and Challenges as to Innovation Management

Directory of Open Access Journals (Sweden)

Marcelo Seido Nagano

2014-09-01

Full Text Available The goal of this study is to investigate the use of product innovation management practices and the challenges faced by organizations when increasing their innovative performance. To this end, we analyzed the relationships between internal organizational elements, as well as the influence of contextual factors (size, field and source of capital in the characterization of innovation management systems and of barriers to innovation faced by each company. We chose this topic due to the fact that management processes that leverage innovative performance are not yet fully understood, and because of the lack of empirical studies that analyze the reality of the practices proposed in the organizational world, especially in Brazil. As a conceptual basis, we presented modern approaches to innovation, which recognize that this should not be seen as an isolated event but as a process. Exploratory qualitative research was carried out by means of a multiple case study. In it, we studied the innovation management systems of four companies which present relevant product development activities in Brazil. As well as a detailed study of the elements of innovation management, this article includes contributions referring to the characterization of organizational challenges faced by organizations when managing their innovation process.

Differentiating innovation priorities among stakeholder in hospital care.

Science.gov (United States)

Lambooij, Mattijs S; Hummel, Marjan J

2013-08-16

Decisions to adopt a particular innovation may vary between stakeholders because individual stakeholders may disagree on the costs and benefits involved. This may translate to disagreement between stakeholders on priorities in the implementation process, possibly explaining the slow diffusion of innovations in health care. In this study, we explore the differences in stakeholder preferences for innovations, and quantify the difference in stakeholder priorities regarding costs and benefits. The decision support technique called the analytic hierarchy process was used to quantify the preferences of stakeholders for nine information technology (IT) innovations in hospital care. The selection of the innovations was based on a literature review and expert judgments. Decision criteria related to the costs and benefits of the innovations were defined. These criteria were improvement in efficiency, health gains, satisfaction with care process, and investments required. Stakeholders judged the importance of the decision criteria and subsequently prioritized the selected IT innovations according to their expectations of how well the innovations would perform for these decision criteria. The stakeholder groups (patients, nurses, physicians, managers, health care insurers, and policy makers) had different preference structures for the innovations selected. For instance, self-tests were one of the innovations most preferred by health care insurers and managers, owing to their expected positive impacts on efficiency and health gains. However, physicians, nurses and patients strongly doubted the health gains of self-tests, and accordingly ranked self-tests as the least-preferred innovation. The various stakeholder groups had different expectations of the value of the nine IT innovations. The differences are likely due to perceived stakeholder benefits of each innovation, and less to the costs to individual stakeholder groups. This study provides a first exploratory quantitative

20 CFR 219.35 - Evidence that a marriage has ended.

Science.gov (United States)

2010-04-01

... divorce or annulment; or (2) Evidence of the death (See § 219.23) of a party to the marriage. (b) Other..., the claimant must explain the reason therefor and submit other convincing evidence that the marriage...

Developing and testing the patient-centred innovation questionnaire for hospital nurses.

Science.gov (United States)

Huang, Ching-Yuan; Weng, Rhay-Hung; Wu, Tsung-Chin; Lin, Tzu-En; Hsu, Ching-Tai; Hung, Chiu-Hsia; Tsai, Yu-Chen

2018-03-01

Develop the patient-centred innovation questionnaire for hospital nurses and establish its validity and reliability. Patient-centred care has been adopted by health care managers in their efforts to improve health care quality. It is regarded as a core concept for developing innovation. A cross-sectional study was employed to collect data from hospital nurses in Taiwan. This study was divided into two stages: pilot study and main study. In the main study, 596 valid responses were collected. This study adopted reliability analysis, exploratory factor analysis, confirmatory factor analysis and selected nurse innovation scale as a criterion to test criterion-related validity. Five-dimension patient-centred innovation questionnaire was proposed: access and practicability, co-ordination and communication, sharing power and responsibility, care continuity, family and person focus. Each dimension demonstrated a reliability of 0.89-0.98. All dimensions had acceptable convergent and discriminate validity. The patient-centred innovation questionnaire and nurse innovation scale exhibited a significantly positive correlation. Patient-centred innovation questionnaire not only had a good theoretical basis but also had sufficient reliability and construct validity, and criterion-related validity. Patient-centred innovation questionnaire could give a measure for evaluating the implementation of patient-centred care and could be used as a management tool during the process of nurse innovation. © 2017 John Wiley & Sons Ltd.

Conceptual design report, 219-S secondary containment upgrade, Project W-178

International Nuclear Information System (INIS)

Beyer, J.J.

1993-05-01

The 219-S Facility is located in the 200-West Area on the Hanford Site and was constructed in 1951. The facility receives and treats liquid, low-level mixed waste from the 222-S Laboratory prior to transfer of that waste to the SY Tank Farm. The 219-S Facility consists of Cell A containing Tanks 101 and 102 and Cell B containing Tank 103 and a spare space. Project W-178 will modify the 219-S Facility to bring it into compliance with the tank system standards in WAC 173-303-640. The secondary containment upgrade will consist of a stainless steel cell liner in both Cell A and the spare space in Cell B. Additionally, Cell B will be modified by taking Tank 103 out of service and installing a new tank: Tank 104. The construction work will be accomplished in phases to minimize service interruption to the 222-S Laboratory. The proposed design and construction method is the most cost effective of four alternatives evaluated during a value engineering session. Project W-178 is a fiscal year 1995 Line Item. Total estimated construction costs of the project are $2,600,000; other project costs are $710,000. The total project cost is $3,300,000

Protease-activated receptor (PAR)-2 is required for PAR-1 signalling in pulmonary fibrosis

NARCIS (Netherlands)

Lin, Cong; von der Thüsen, Jan; Daalhuisen, Joost; ten Brink, Marieke; Crestani, Bruno; van der Poll, Tom; Borensztajn, Keren; Spek, C. Arnold

2015-01-01

Idiopathic pulmonary fibrosis is the most devastating diffuse fibrosing lung disease of unknown aetiology. Compelling evidence suggests that both protease-activated receptor (PAR)-1 and PAR-2 participate in the development of pulmonary fibrosis. Previous studies have shown that bleomycin-induced

Liens entre le savoir et l'innovation dans les services de gestion des ...

International Development Research Centre (IDRC) Digital Library (Canada)

Ce projet de recherche-action portera sur l'innovation dans la prestation de services par les administrations locales au Sri Lanka. Il ciblera principalement les administrateurs locaux chargés de la prestation des services de gestion des déchets solides. Les chercheurs établiront dans quelle mesure les interactions entre les ...

26 CFR 1.219-2 - Definition of active participant.

Science.gov (United States)

2010-04-01

... individuals whose compensation exceeds a certain amount accrue benefits under the plan. An individual whose... participant. However, any benefit that may vary with future compensation of an individual provides additional... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Definition of active participant. 1.219-2...

48 CFR 952.219-70 - DOE Mentor-Protege program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false DOE Mentor-Protege program... FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 952.219-70 DOE Mentor.... DOE Mentor-Protege Program (MAY 2000) The Department of Energy has established a Mentor-Protege...

48 CFR 52.219-9 - Small business subcontracting plan.

Science.gov (United States)

2010-10-01

... Clauses 52.219-9 Small business subcontracting plan. As prescribed in 19.708(b), insert the following clause: Small Business Subcontracting Plan (OCT 2010) (a) This clause does not apply to small business... business, and women-owned small business concerns. If the offeror is submitting an individual contract plan...

Is Participatory Action Research an innovative pedagogical alternative for training teachers as researchers? The training plan and evaluation for normal schools.

Science.gov (United States)

Paredes-Chi, Arely Anahy; Castillo-Burguete, María Teresa

2018-06-01

Normal schools in Mexico train teachers for basic level education. Classified as Higher Education Institutions, part of their mandate is to conduct scientific research to improve educational quality. Currently, normal school students can meet graduation requirements by either writing a thesis or reporting on professional practice using Participatory Action Research (PAR). Teachers at normal schools have only limited experience in conducting and supervising PAR projects. With the aim of analyzing the situation and addressing this paradox, we used PAR to develop a plan to train normal school teachers in application of PAR methodology. We present the training proposal and evaluate its results in a pilot phase. These suggest that PAR represents an innovative option for training teachers to conduct research and therefore fulfill part of their responsibilities at normal schools in Mexico. Changes in institutional culture and structure would be required for successful implementation of PAR in this context. Copyright © 2018 Elsevier Ltd. All rights reserved.

Results from an exploratory study to identify the factors that contribute to success for UK medical device small- and medium-sized enterprises.

Science.gov (United States)

Hourd, P C; Williams, D J

2008-07-01

This paper reports the results from an exploratory study that sets out to identify and compare the strategic approaches and patterns of business practice employed by 14 UK small- and medium-sized enterprises to achieve success in the medical device sector of the health-care industry. An interview-based survey was used to construct individual case studies of the medical device technology (MDT) companies. A cross-case analysis was performed to search for patterns and themes that cut across these individual cases. Exploratory results revealed the heterogeneity of MDT companies and the distinctive features of the MDT innovation process that emphasize the importance of a strategic approach for achieving milestones in the product development and exploitation process and for creating value for the company and its stakeholders. Recognizing the heterogeneity of MDT companies, these exploratory findings call for further investigation to understand better the influence of components of the MDT innovation process on the commercialization life cycle and value trajectory. This is required to assist start-up or spin-out MDT companies in the UK and worldwide to navigate the critical transitions that determine access to financial and consumer markets and enhance the potential to build a successful business. This will be important not only for bioscience-based companies but also for engineering-based companies aiming to convert their activities into medical devices and the health- and social-care market.

Stimulation de la capacité d'innovation des micro, petites et ...

International Development Research Centre (IDRC) Digital Library (Canada)

Stimulation de la capacité d'innovation des micro, petites et moyennes entreprises d'Asie par le truchement d'intermédiaires ... En plus d'études de cas comparatives menées en Chine et en Thaïlande, des bourses de recherche menant à la maîtrise ou au doctorat seront octroyées à de jeunes professeurs ainsi qu'à des ...

Creating the environment for innovation and entrepreneurship

Directory of Open Access Journals (Sweden)

Paul M. Lane

2016-10-01

Full Text Available Innovation generation and diffusion have been widely acknowledged as hinging upon the complex set of institutional, social and psychological processes. The objective of the paper is to examine the need and possibilities of creating the environment for innovation and entrepreneurship in the university setting. In particular, this paper focuses on interrelationships and roles of specific groups of university members: the administration, faculty and students. The study is exploratory in character, based on observations and literature review. It starts with defining modern-day university as home of innovation emphasizing the need for interdisciplinary and interinstitutional approaches. The paper discusses the need of faculty to learn to reach across the institution and beyond to work with others, working across silos of academia and meeting with others from very different disciplines. Second it examines ways the university administration support can encourage innovation among its faculty, staff and students. Third, it draws on existing research to identify key dimensions of change. The study proposes pathways that may activate the mechanisms of climate and infrastructure for innovation. The proposed dimensions and analyzed areas of change can potentially form the foundations of a framework for universities seeking to diagnose their existing condition and use such findings to enhance the generation and diffusion of innovation. The university quest to break down the barriers and reach across the disciplines to generate innovation takes commitment which needs to be coupled with administrative change such as the reward structures lined up with the vision and changes regarding the teaching and learning practices as well as the physical environment for the classes, the class rooms and meeting spaces of students and faculty.

48 CFR 1852.219-79 - Mentor requirements and evaluation.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Mentor requirements and... and Clauses 1852.219-79 Mentor requirements and evaluation. As prescribed in 1819.7215, insert the following clause: Mentor Requirements and Evaluation (MAY 2009) (a) The purpose of the NASA Mentor-Protégé...

Knowledge sharing and innovation in relationships interorganizational type of information technology outsourcing

Directory of Open Access Journals (Sweden)

Roberta Rodrigues Faoro

2017-04-01

Full Text Available Introduction: this paper presents an analysis of the sharing of knowledge and innovation in the inter-relationships of the type outsourcing of Information Technology. Objective: analyze the existence of relationship between knowledge sharing and innovation in the inter-relationships of the type of outsourcing information technology (IT. Methodology: research is exploratory, qualitative and using as a strategy the multiple case study, which analyzed 12 companies in IT outsourcing environments, 4 suppliers of IT and IT 8 client companies. Data were collected through semi structured interviews, documentary and direct observation. Results: it can be noted that the sharing of knowledge showed contribute to the existence of innovation in IT outsourcing environment. The suppliers prioritize the codification of shared knowledge, while customers prefer the sharing of knowledge through informal conversations. It was identified that the motives for outsourcing IT may be related to the sharing of knowledge and innovation. Conclusions: this research contributes to the advancement of knowledge about the knowledge and innovation sharing phenomena in outsourcing of IT environments.

41 CFR 302-3.219 - Is there a limit on how many times I may receive reimbursement for tour renewal travel?

Science.gov (United States)

2010-07-01

... many times I may receive reimbursement for tour renewal travel? 302-3.219 Section 302-3.219 Public Contracts and Property Management Federal Travel Regulation System RELOCATION ALLOWANCES RELOCATION....219 Is there a limit on how many times I may receive reimbursement for tour renewal travel? (a) If you...

38 CFR 21.219 - Supplies consisting of clothing, magazines and periodicals, and items which may be personally...

Science.gov (United States)

2010-07-01

... clothing, magazines and periodicals, and items which may be personally used by the veteran. 21.219 Section....219 Supplies consisting of clothing, magazines and periodicals, and items which may be personally used... will be supplied. (b) Furnishing magazines and periodicals. Appropriate past issues of magazines...

48 CFR 52.219-1 - Small Business Program Representations.

Science.gov (United States)

2010-10-01

... section 8(a), 8(d), 9, or 15 of the Small Business Act or any other provision of Federal law that... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Small Business Program....219-1 Small Business Program Representations. As prescribed in 19.308(a)(1), insert the following...

48 CFR 552.219-76 - Mentor Requirements and Evaluation.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Mentor Requirements and....219-76 Mentor Requirements and Evaluation. As prescribed in 519.7017(b), insert the following clause: Mentor Requirements and Evaluation (SEP 2009) (a) The purpose of the GSA Mentor-Protégé Program is for a...

48 CFR 752.219-71 - Mentor requirements and evaluation.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Mentor requirements and....219-71 Mentor requirements and evaluation. As prescribed in AIDAR 719.273-11(b), insert the following clause: Mentor Requirements and Evaluation (July 13, 2007) (a) Mentor and Protégé firms shall submit an...

5 CFR 591.219 - How does OPM compute shelter price indexes?

Science.gov (United States)

2010-01-01

... REGULATIONS ALLOWANCES AND DIFFERENTIALS Cost-of-Living Allowance and Post Differential-Nonforeign Areas Cost-Of-Living Allowances § 591.219 How does OPM compute shelter price indexes? (a) In addition to rental...

Code Assessment of SPACE 2.19 using LSTF 10% Main Steam-Line-Break Test

Energy Technology Data Exchange (ETDEWEB)

Kim, Minhee; Kim, Seyun [KHNP CRI, Daejeon (Korea, Republic of)

2016-10-15

The Safety and Performance Analysis Code for Nuclear Power Plants (SPACE) has been developed in recent years by the Korea Hydro and Nuclear Power Co. through collaborative works with other Korean nuclear industries and research institutes. As a result of the development, the 2.19 version of the code was released through the successive various verification and validation works. In this study, results produced by the SPACE 2.19 code were compared with the experimental data from JAERI's LSTF Test Run SBSL- 01 for a 10% main steam line break transient in a pressurized water reactor. The LSTF 10% main steam line break test were simulated using the SPACE 2.19 for code V and V work. The overall comparisons between the SPACE 2.19 code prediction and the LSTF Test Run SB-SL-01 experimental data are reasonably satisfactory. The comparisons were conducted in terms of the variations of mass flow rate, void fraction, pressure, collapsed liquid level, temperature, and system flow rate for the transient. In addition, the input model was modified for simulation accuracy of PZR pressure based on the calculated results. The correction of PORV setpoint affects to simulate the PORV open and close phenomena similarly with experiments. From the modification, the computed results show a reasonable agreement with experimental data in overall transient time.

36 CFR 219.11 - Monitoring and evaluation for adaptive management.

Science.gov (United States)

2010-07-01

... OF AGRICULTURE PLANNING National Forest System Land and Resource Management Planning The Framework for Planning § 219.11 Monitoring and evaluation for adaptive management. (a) Plan monitoring strategy... national, regional, and local supply and demand for products, services, and values. Special consideration...

Medi-Effect Study of NPD Organizational Environment between Transformational Leadership and Green Products Innovation in Green Entrepreneurs%绿色新创企业NPD组织环境对变革型领导与绿色产品创新的中介关系研究

Institute of Scientific and Technical Information of China (English)

李先江

2018-01-01

When new enterprises carry out green business strategy,in order to explore medi-effect study of NPD organiza-tional environment between transformational leadership and green products innovation this study divide NPD organizational environment into compatibility & importance and resource synergy,build catenation model of transformational leader-ship———organizational environment of new product development———green product innovation,219 firms from four cities of China were studied as empirical samples.The results show that transformational leadership can indirectly controlled by two types of innovation through controlling NPD organization environment.when organizations need to develop explorato-ry green product innovation,transformational leadership can promote the R&D of exploratory green product innovation by strengthening and highlighting the compatibility and importance of NPD organization environments;when organizations need to develop exploitative green product innovation,transformational leadership can promote the R&D of exploitative green product innovation by strengthening and highlighting resource synergy of NPD organization environments.%为了探索实施绿色创业战略时变革型领导在利用式绿色产品创新和探索式绿色产品创新中的作用,将新产品开发(NPD)组织环境作为变革型领导与绿色产品创新间的中介变量,将 NPD 组织环境划分为兼容性与重要性和资源综效,构建了变革型领导 -新产品开发组织环境 -绿色产品创新的连锁关系模型,并以国内4个城市218家企业为样本进行实证分析.研究发现:变革型领导可以通过对新产品开发组织环境的掌控间接控制利用式绿色产品创新和探索式绿色产品创新两类�

Cultivating Innovative Entrepreneurs for the Twenty-First Century: A Study of U.S. and German Students

Science.gov (United States)

Mayhew, Matthew J.; Simonoff, Jeffrey S.; Baumol, William J.; Selznick, Benjamin S.; Vassallo, Stephen J.

2016-01-01

The purpose of this exploratory study was to examine the cultivation of innovative entrepreneurial intentions among students in three distinctive educational settings: a U.S. undergraduate four-year environment, a U.S. M.B.A. two-year environment, and a German five-year business and technology environment. Results suggested that innovative…

The strategic trade-offs for beneficial open innovation : the case of ''open source'' consortia in mobile OS development

NARCIS (Netherlands)

Querbes, A.

2011-01-01

The trivialization of smartphones has given rise to an architectural reconfiguration of the mobile operating system innovation process. We have also seen the recent emergence of three ?open source? consortia: the Symbian and LiMo Foundations, and the Open Handset Alliance. In this exploratory paper,

Synthesis, radiochemistry and biological evaluation of a new somatostatin analogue (SDZ 219-387) labelled with technetium-99m

International Nuclear Information System (INIS)

Maina, T.; Stolz, B.; Albert, R.; Bruns, C.; Koch, P.; Maecke, H.

1994-01-01

A new derivative of octreotide SDZ 219-387 [PnAO-(D)Phe 1 -octreotide] was synthesized, which binds specifically and with high affinity to somatostatin receptors in vitro (pK i =9.79±0.16). This new somatostatin analogue chelates technetium-99m under mild labelling conditions in good yields. The resulting [ 99m Tc]SDZ 219-387 was stable up to 6 h after labelling and could be isolated in a pure radiochemical and chemical form by high-perfomance liquid chromatographic purification. The intravenous administration of purified [ 99m Tc]SDZ 219-387 revealed that the radioligand was rapidly cleared from circulation, and tumour uptake of 0.38% ID/g was observed at 1.5 h post injection. [ 99m Tc]SDZ 219-387 specifically interacted with somatostatin binding sites on the tumour. However, the radioligand is highly lipophilic and excreted mainly through the hepatobiliary system. As a consequence, [ 99m Tc]SDZ 219-387 exhibits increased background activity and therefore is not appropriate for the in vivo visualization of somatostatin receptor-positive tumours and/or their metastases in the abdomen. (orig.)

Foresight and the third mission of universities: the case for innovation system foresight

DEFF Research Database (Denmark)

Piirainen, Kalle A.; Dahl Andersen, Allan; Andersen, Per Dannemand

2016-01-01

and innovation dimensions through the development of joint understanding of the agendas and future needs of stakeholders. In addition, foresight enables education to be designed to address identified needs. Research limitations/implications – The findings are both conceptual and exploratory in nature...... analyse the third mission and relevant literature on innovation systems and foresight to explain how and why foresight contributes to the third mission. Findings – The authors propose that foresight contributes to the third mission of universities,particularly to the research and development.......Thus, the argument needs further examination through a broader study on foresight in the university–industry context and/or longitudinal research on the outcomes and impact of foresight in this context. Practical implications – The findings highlight the importance of understanding the systemic nature of innovation...

Marker-assisted introgression of broad-spectrum blast resistance genes into the cultivated MR219 rice variety.

Science.gov (United States)

Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

2017-07-01

The rice cultivar MR219 is famous for its better yield and long and fine grain quality; however, it is susceptible to blast disease. The main objective of this study was to introgress blast resistance genes into MR219 through marker-assisted selection (MAS). The rice cultivar MR219 was used as the recurrent parent, and Pongsu Seribu 1 was used as the donor. Marker-assisted foreground selection was performed using RM6836 and RM8225 to identify plants possessing blast resistance genes. Seventy microsatellite markers were used to estimate recurrent parent genome (RPG) recovery. Our analysis led to the development of 13 improved blast resistant lines with Piz, Pi2 and Pi9 broad-spectrum blast resistance genes and an MR219 genetic background. The RPG recovery of the selected improved lines was up to 97.70% with an average value of 95.98%. Selected improved lines showed a resistance response against the most virulent blast pathogen pathotype, P7.2. The selected improved lines did not express any negative effect on agronomic traits in comparison with MR219. The research findings of this study will be a conducive approach for the application of different molecular techniques that may result in accelerating the development of new disease-resistant rice varieties, which in turn will match rising demand and food security worldwide. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

User roles and contributions during the new product development process in collaborative innovation communities.

Science.gov (United States)

Guo, Wei; Zheng, Qing; An, Weijin; Peng, Wei

2017-09-01

Collaborative innovation (co-innovation) community emerges as a new product design platform where companies involve users in the new product development (NPD) process. Large numbers of users participate and contribute to the process voluntarily. This exploratory study investigates the heterogeneous roles of users based on a global co-innovation project in online community. Content analysis, social network analysis and cluster method are employed to measure user behaviors, distinguish user roles, and analyze user contributions. The study identifies six user roles that emerge during the NPD process in co-innovation community: project leader, active designer, generalist, communicator, passive designer, and observer. The six user roles differ in their contribution forms and quality. This paper contributes to research on co-innovation in online communities, including design team structure, user roles and their contribution to design task and solution, as well as user value along the process. In addition, the study provides practices guidance on implementing project, attracting users, and designing platform for co-innovation community practitioners. Copyright © 2017 Elsevier Ltd. All rights reserved.

Marketing of Patents for Innovation: A Study in Brazilian Multicase Universities

Directory of Open Access Journals (Sweden)

Felipe de Almeida Malvezzi

2014-11-01

Full Text Available Ways to make patents Brazilian universities in innovation has been discussed both by academia and by the funding agencies in order to generate, in addition to knowledge, social and economic benefits to the university and to society in general. In this sense, this research aimed to understand the strategies and marketing practices developed by Brazilian universities for the promotion and commercialization of patent records, aiming at innovation. The assumption for this research is that the use of marketing strategies is a necessary and fundamental for the successful transfer of patents when it sees technological innovation. The research is exploratory qualitative approach based on references, interviews and multi case study. After gathering and analyzing data involving UNICAMP, USP and UFMG in promoting and marketing your patents, it was observed that the main marketing practices identified were: inventory and classification of patents, agents of innovation, integrated marketing communication, technological showcase, executive summary of patents, event promotion and institutional visits. We also conclude, in the context of marketing innovation management at the university, the biggest challenge is to work radical and incremental innovation differently and simultaneously, since both are necessary for scientific and technological development in the short and long term. 

Exploring the dimensionality of the Originality subscale of the Kirton Adaption-Innovation Inventory.

Science.gov (United States)

Im, Subin; Hu, Michael Y; Toh, Rex S

2003-12-01

The Kirton Adaption-Innovation Inventory, which is a widely used measure of innovative (as opposed to adaptive) cognitive individual style, is believed to have three dimensions: Sufficiency of Originality, Efficiency, and Rule/Group Conformity. Several studies have raised concerns regarding its construct validity, specifically with respect to the Sufficiency of Originality subscale. Within this subscale, exploratory factor analysis identified two distinct subdimensions, Idea Generation and Preference for Change. In this study, we used a sample of 356 household participants (with an average age of 56 yr., average income of 39,700 dollars, and average of 15 yr. of education) from the Arkansas Household Research Panel. We then employed Bollen and Grandjean's approach based on confirmatory factor analysis to assess whether there are actually two distinct subdimensions instead of one. Our study shows that within the Sufficiency of Originality subscale, there are indeed two distinct subdimensions, Idea Generation and Preference for Change. Further analyses indicate that dropping double-loaded items identified through exploratory factor analysis significantly improves the fit statistics. Also, allowing correlated errors for the measurement items that belong to the same subdimension can also significantly improve the overall fit of the model based on chi-square statistics.

36 CFR 223.219 - Sustainable harvest of special forest products.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Sustainable harvest of....219 Sustainable harvest of special forest products. (a) Sustainable harvest levels. Prior to offering... product's sustainable harvest level. A special forest product's sustainable harvest level is the total...

Par Pond vegetation status Summer 1995 -- Summary

International Nuclear Information System (INIS)

Mackey, H.E. Jr.; Riley, R.S.

1996-01-01

The water level of Par Pond was lowered approximately 20 feet in mid-1991 in order to protect downstream residents from possible dam failure suggested by subsidence on the downstream slope of the dam and to repair the dam. This lowering exposed both emergent and nonemergent macrophyte beds to drying conditions resulting in extensive losses. A survey of the newly emergent, shoreline aquatic plant communities of Par Pond began in June 1995, three months after the refilling of Par Pond to approximately 200 feet above mean sea level. These surveys continued in July, September, and late October, 1995. Communities similar to the pre-drawdown, Par Pond aquatic plant communities are becoming re-established. Emergent beds of maidencane, lotus, waterlily, and watershield are extensive and well developed. Cattail occurrence continued to increase during the summer, but large beds common to Par Pond prior to the drawdown have not formed. Estimates from SPOT HRV, remote sensing satellite data indicated that as much as 120 hectares of emergent wetlands vegetation may have been present along the Par Pond shoreline by early October, 1995. To track the continued development of macrophytes in Par Pond, future surveys throughout 1996 and 1997, along with the continued evaluation of satellite data to map the areal extent of the macrophyte beds of Par Pond, are planned

The corrosion Characteristics and Behaviors of the Ti-2.19Al-2.35Zr alloy

International Nuclear Information System (INIS)

Kim, Tae Hoon; Kang, Chang Sun; Baek, Jong Hyuk; Kim, Hyun Gil; Choi, Byoung Kwon; Jeong, Yong Hwan

2007-01-01

Ti-2.19Al-2.35Zr alloy is being considered as a steam generator tube material for the advanced pressurized water reactor (PWR) which is being developed by KAERI for the purpose of seawater desalination as well as a small scale electricity production. The main operational environment of SMART differs somewhat from that of a commercial PWR. That is, a heat-exchange tube is always exposed to a high temperature/pressure condition and an ammonia water chemistry is designed as a pH controlling agent without an addition of boric acid. The excellent mechanical and corrosion resistance properties are required for the steam generator tube material in SMART. Thus Ti-2.19Al-2.35Zr alloy was studied to investigate of the corrosion characteristics and behaviors of the Ti- 2.19Al-2.35Zr alloy in a simulated-SMART loop

The Potential for Innovation in the Swedish Food Sector

OpenAIRE

Beckeman, Märit

2011-01-01

The food sector in Sweden, comprised of retailers, food manufacturers and packaging suppliers, has been investigated, guided by two research questions: What does “innovation” mean to the different actors (i.e. is there a gap in opinions)? How is innovation performed and what are the key issues? But before this research of the present, the past was studied (the author’s licentiate) to identify and describe the factors and reasons behind the growing food sector in Sweden after World War II, par...

Innovation en matière de biocarburants sous le signe de l'inclusion ...

International Development Research Centre (IDRC) Digital Library (Canada)

Ce projet favorisera une innovation en matière de biocarburants qui prend en compte tous les acteurs pertinents, dont les femmes vivant en milieu rural. Les chercheurs ... Des chercheurs appuyés par le CRDI parlent de leurs expériences au Comité sur les ONG lors du forum de la Commission de la condition de la femme.

Influence of APOE and RNF219 on Behavioral and Cognitive Features of Female Patients Affected by Mild Cognitive Impairment or Alzheimer’s Disease

Directory of Open Access Journals (Sweden)

Alessandra Mosca

2018-04-01

Full Text Available The risk for Alzheimer’s disease (AD is associated with the presence of the 4 allele of Apolipoprotein E (APOE gene and, recently, with a novel genetic variant of the RNF219 gene. This study aimed at evaluating interactions between APOE-4 and RNF219/G variants in the modulation of behavioral and cognitive features of two cohorts of patients suffering from mild cognitive impairment (MCI or AD. We enrolled a total of 173 female MCI or AD patients (83 MCI; 90 AD. Subjects were screened with a comprehensive set of neuropsychological evaluations and genotyped for the APOE and RNF219 polymorphic variants. Analysis of covariance was performed to assess the main and interaction effects of APOE and RNF219 genotypes on the cognitive and behavioral scores. The analysis revealed that the simultaneous presence of APOE-4 and RNF219/G variants results in significant effects on specific neuropsychiatric scores in MCI and AD patients. In MCI patients, RNF219 and APOE variants worked together to impact the levels of anxiety negatively. Similarly, in AD patients, the RNF219 variants were found to be associated with increased anxiety levels. Our data indicate a novel synergistic activity APOE and RNF219 in the modulation of behavioral traits of female MCI and AD patients.

Correlación entre algunos parámetros climáticos y la hora del día en Heredia, Costa Rica.

Directory of Open Access Journals (Sweden)

Jaime Wright

2016-03-01

Full Text Available Se midieron las radiaciones solar global, infrarroja y ultravioleta, la presión atmosférica, la temperatura del aire, la humedad relativa y la velocidad del viento en Heredia, Costa Rica (latitud 10° 02’ N, longitud 84° 09’ W, altitud 1050 m durante el período de enero 1996 a diciembre 1997, y se correlacionaron con el tiempo local. Este trabajo contribuirá al desarrollo de un modelo para derivar parámetros climáticos a partir de la hora del día. Correlaciones entre parámetros climáticos y el mes del año han sido desarrolladas en investigaciones anteriores. Análisis de regresión entre valores horarios medios mensuales de los parámetros climáticos y el tiempo local mostraron una relación cúbica como mejor método de ajuste. Las observaciones experimentales presentadas en este estudio son consistentes con los esperados procesos físicos conocidos.

Organizational Values and Innovative Organizational Knowledge Creation

Directory of Open Access Journals (Sweden)

Lilian Aparecida Pasquini Miguel

2009-01-01

Full Text Available Innovation is a source of competitive advantage and is based on the continuous creation of organizational knowledge, which is supported by the individual learning. The individual learning of traditional / comportamentalist and constructivist nature can be understood, by extension, as organizational learning. The knowledge can be innovative if, along with the enabling conditions that characterize it - intention, fluctuation or chaos, autonomy, redundancy and variety of requirements – the process of learning is based on a constructivist nature, the only one capable to generate new learning solutions. The organizational values are beliefs that guide the organizations behavior and constitute motivational goals. This work had as aim to identify the relationship between organizational values and the creation of knowledge. The descriptive exploratory research used the quantitative method. The organizational values appeared in this study mainly associated to the knowledge creation aspects in the internal sphere of the organizations. The orientation towards the external environment appeared less related to the organizational values.

ParABS system in chromosome partitioning in the bacterium Myxococcus xanthus.

Directory of Open Access Journals (Sweden)

Antonio A Iniesta

Full Text Available Chromosome segregation is an essential cellular function in eukaryotic and prokaryotic cells. The ParABS system is a fundamental player for a mitosis-like process in chromosome partitioning in many bacterial species. This work shows that the social bacterium Myxococcus xanthus also uses the ParABS system for chromosome segregation. Its large prokaryotic genome of 9.1 Mb contains 22 parS sequences near the origin of replication, and it is shown here that M. xanthus ParB binds preferentially to a consensus parS sequence in vitro. ParB and ParA are essential for cell viability in M. xanthus as in Caulobacter crescentus, but unlike in many other bacteria. Absence of ParB results in anucleate cells, chromosome segregation defects and loss of viability. Analysis of ParA subcellular localization shows that it clusters at the poles in all cells, and in some, in the DNA-free cell division plane between two chromosomal DNA masses. This ParA localization pattern depends on ParB but not on FtsZ. ParB inhibits the nonspecific interaction of ParA with DNA, and ParA colocalizes with chromosomal DNA only when ParB is depleted. The subcellular localization of ParB suggests a single ParB-parS complex localized at the edge of the nucleoid, next to a polar ParA cluster, with a second ParB-parS complex migrating after the replication of parS takes place to the opposite nucleoid edge, next to the other polar ParA cluster.

Par-baked Bread Technology: Formulation and Process Studies to Improve Quality.

Science.gov (United States)

Almeida, Eveline Lopes; Steel, Caroline Joy; Chang, Yoon Kil

2016-01-01

Extending the shelf-life of bakery products has been an important requirement resulting from the mechanization of this industry and the need to increase the distance for the distribution of final products, caused by the increase in production and consumer demand. Technologies based on the interruption of the breadmaking process represent an alternative to overcome product staling and microbiological deterioration. The production of par-baked breads is one of these technologies. It consists of baking the bread in two stages, and due to the possibility of retarding the second stage, it can be said that the bread can always be offered fresh to the consumer. The technology inserts logistics as part of the production process and creates the "hot point" concept, these being the locations where the bread is finalized, such as in the consumers' homes or sales locations. In this work, a review of the papers published on this subject was carried out, and aspects related to both the formulation and the process were considered. This technology still faces a few challenges, such as solving bread quality problems that appear due to process modifications, and these will also be considered. The market for these breads has grown rapidly and the bakery industry searches innovations related to par-baked bread technology.

The Dilemma of Service Productivity and Service Innovation: An Empirical Exploration in Financial Services.

Science.gov (United States)

Aspara, Jaakko; Klein, Jan F; Luo, Xueming; Tikkanen, Henrikki

2018-05-01

We conduct a systematic exploratory investigation of the effects of firms' existing service productivity on the success of their new service innovations. Although previous research extensively addresses service productivity and service innovation, this is the first empirical study that bridges the gap between these two research streams and examines the links between the two concepts. Based on a comprehensive data set of new service introductions in a financial services market over a 14-year period, we empirically explore the relationship between a firm's existing service productivity and the firm's success in introducing new services to the market. The results unveil a fundamental service productivity-service innovation dilemma: Being productive in existing services increases a firm's willingness to innovate new services proactively but decreases the firm's capabilities of bringing these services to the market successfully. We provide specific insights into the mechanism underlying the complex relationship between a firm's productivity in existing services, its innovation proactivity, and its service innovation success. For managers, we not only unpack and elucidate this dilemma but also demonstrate that a focused customer scope and growth market conditions may enable firms to mitigate the dilemma and successfully pursue service productivity and service innovation simultaneously.

Estimating isotopic ratios, spatial distribution and inventory of radionuclides at Nuclear Sites 201, 219 and 221

International Nuclear Information System (INIS)

Gilbert, R.O.; Simpson, J.C.; Engel, D.W.; Kinnison, R.R.

1984-03-01

For NS201 the estimated average 239 240 Pu to 241 Am ratios for vegetation and soil are 7.3 and 11.5, respectively, where the 241 Am data were obtained using wet chemistry. The geometric mean 90 Sr to 137 Cs ratios for vegetation and soil at NS201 are estimated to be 1.1 and 1.9. These results suggest that the true (population) median 239 240 Pu to 241 Am and 90 Sr to 137 Cs ratios are smaller for vegetation than for soil at NS201. For NS219 and NS221 the estimated average 239 240 Pu to 241 Am ratios for surface soil at NS219 and NS221 are 2.8 and 0.78, respectively. There is an obvious statistical difference in the average 239 240 Pu to 241 Am ratios at these sites. The geometric mean 239 240 Pu to 241 Am ratios for vegetation samples at NS219 and NS221 are estimated to be 3.2 and 0.82, respectively. The data suggest there may be a difference in the 239 240 Pu to 241 Am ratios for soil and vegetation at NS219, but not at NS221. The geometric mean 90 Sr to 137 Cs ratio for surface soil at NS219 and NS221 combined is 0.93. The geometric mean 90 Sr to 137 Cs ratio for vegetation for the two sites (pooled data) is estimated to be 1.8. 43 references, 42 figures, 7 tables

PHP143 Exploratory Test of Stakeholder Theory in the Implementation Process of It-Innovations in Hospital Care

NARCIS (Netherlands)

Lambooij, M.S.; Hummel, J. Marjan

2012-01-01

Objectives The main hypothesis in this study is that stakeholders have different preferences concerning IT innovations in hospitals, and these preferences are caused by perceived cost/benefit ratios. This will translate in disagreement between stakeholders on which innovations to implement first,

222-S radioactive liquid waste line replacement and 219-S secondary containment upgrade, Hanford Site, Richland, Washington

International Nuclear Information System (INIS)

1995-01-01

The U.S. Department of Energy (DOE) is proposing to: (1) replace the 222-S Laboratory (222-S) radioactive liquid waste drain lines to the 219-S Waste Handling Facility (219-S); (2) upgrade 219-S by replacing or upgrading the waste storage tanks and providing secondary containment and seismic restraints to the concrete cells which house the tanks; and (3) replace the transfer lines from 219-S to the 241-SY Tank Farm. This environmental assessment (EA) has been prepared in compliance with the National Environmental Policy Act (NEPA) of 1969, as amended, the Council on Environmental Quality Regulations for Implementing the Procedural Provisions of NEPA (40 Code of Federal Regulations [CFR] 1500-1508), and the DOE Implementing Procedures for NEPA (10 CFR 1021). 222-S is used to perform analytical services on radioactive samples in support of the Tank Waste Remediation System and Hanford Site environmental restoration programs. Activities conducted at 222-S include decontamination of analytical processing and support equipment and disposal of nonarchived radioactive samples. These activities generate low-level liquid mixed waste. The liquid mixed waste is drained through pipelines in the 222-S service tunnels and underground concrete encasements, to two of three tanks in 219-S, where it is accumulated. 219-S is a treatment, storage, and/or disposal (TSD) unit, and is therefore required to meet Washington Administrative Code (WAC) 173-303, Dangerous Waste Regulations, and the associated requirements for secondary containment and leak detection. The service tunnels are periodically inspected by workers and decontaminated as necessary to maintain as low as reasonably achievable (ALARA) radiation levels. Although no contamination is reaching the environment from the service tunnels, the risk of worker exposure is present and could increase. 222-S is expected to remain in use for at least the next 30 years to serve the Hanford Site environmental cleanup mission

Analysis of ParB-centromere interactions by multiplex SPR imaging reveals specific patterns for binding ParB in six centromeres of Burkholderiales chromosomes and plasmids.

Science.gov (United States)

Pillet, Flavien; Passot, Fanny Marie; Pasta, Franck; Anton Leberre, Véronique; Bouet, Jean-Yves

2017-01-01

Bacterial centromeres-also called parS, are cis-acting DNA sequences which, together with the proteins ParA and ParB, are involved in the segregation of chromosomes and plasmids. The specific binding of ParB to parS nucleates the assembly of a large ParB/DNA complex from which ParA-the motor protein, segregates the sister replicons. Closely related families of partition systems, called Bsr, were identified on the chromosomes and large plasmids of the multi-chromosomal bacterium Burkholderia cenocepacia and other species from the order Burkholeriales. The centromeres of the Bsr partition families are 16 bp palindromes, displaying similar base compositions, notably a central CG dinucleotide. Despite centromeres bind the cognate ParB with a narrow specificity, weak ParB-parS non cognate interactions were nevertheless detected between few Bsr partition systems of replicons not belonging to the same genome. These observations suggested that Bsr partition systems could have a common ancestry but that evolution mostly erased the possibilities of cross-reactions between them, in particular to prevent replicon incompatibility. To detect novel similarities between Bsr partition systems, we have analyzed the binding of six Bsr parS sequences and a wide collection of modified derivatives, to their cognate ParB. The study was carried out by Surface Plasmon Resonance imaging (SPRi) mulitplex analysis enabling a systematic survey of each nucleotide position within the centromere. We found that in each parS some positions could be changed while maintaining binding to ParB. Each centromere displays its own pattern of changes, but some positions are shared more or less widely. In addition from these changes we could speculate evolutionary links between these centromeres.

La pelade par plaques

Science.gov (United States)

Spano, Frank; Donovan, Jeff C.

2015-01-01

Résumé Objectif Présenter aux médecins de famille des renseignements de base pour faire comprendre l’épidémiologie, la pathogenèse, l’histologie et l’approche clinique au diagnostic de la pelade par plaques. Sources des données Une recension a été effectuée dans PubMed pour trouver des articles pertinents concernant la pathogenèse, le diagnostic et le pronostic de la pelade par plaques. Message principal La pelade par plaques est une forme de perte pileuse auto-immune dont la prévalence durant une vie est d’environ 2 %. Des antécédents personnels ou familiaux de troubles auto-immuns concomitants, comme le vitiligo ou une maladie de la thyroïde, peuvent être observés dans un petit sous-groupe de patients. Le diagnostic peut souvent être posé de manière clinique en se fondant sur la perte de cheveux non cicatricielle et circulaire caractéristique, accompagnée de cheveux en « point d’exclamation » en périphérie chez ceux dont le problème en est aux premiers stades. Le diagnostic des cas plus complexes ou des présentations inhabituelles peut être facilité par une biopsie et un examen histologique. Le pronostic varie largement et de mauvais résultats sont associés à une apparition à un âge précoce, une perte importante, la variante ophiasis, des changements aux ongles, des antécédents familiaux ou des troubles auto-immuns concomitants. Conclusion La pelade par plaques est une forme auto-immune de perte de cheveux périodiquement observée en soins primaires. Les médecins de famille sont bien placés pour identifier la pelade par plaques, déterminer la gravité de la maladie et poser le diagnostic différentiel approprié. De plus, ils sont en mesure de renseigner leurs patients à propos de l’évolution clinique de la maladie ainsi que du pronostic général selon le sous-type de patients.

Open innovation: A preliminary model from the Knowledge-based Theory

Directory of Open Access Journals (Sweden)

Rocío González-Sánchez

2011-04-01

Full Text Available Purpose: The open innovation paradigm is an alternative and/or complementary way to knowledge management processes in its various stages, questioning the basic assumptions where some of the technological innovation strategies and processes are based on. The new logic of innovation process exploits knowledge dissemination through new innovation communities, on the one hand, and, considers of strategic value the external access to intangible resources. Thus, this approach supposes an alternative view to the traditional close innovation, focused on the exclusive exploitation of value innovations. This paper aims to contribute to building an integrated model of key factors to success in open innovation processes. It is analyzed for the role that certain key knowledge management decisions have on the results of open innovation projects, to facilitate the change process and provide new capacity or skills to do so. Design/methodology/approach: Through the review of theoretical and empirical literature, we show the main variables related to the functioning of open innovation systems, and establish various propositions about the meaning and intensity of such relationships.Findings: The management of open innovation project improves through three external factors: technical leadership based on experience, the intensive use of ICT, which allows a multilateral communication, and the existence of intermediate agents or facilitators with a strong neutral attitude. The results also depend on internal factors: the link function, the search routines, the establishment of incentive systems to encourage proactivity and organizational culture.Originality/value: In the absence of full proposals to guide effective decision making on both the management of relationships between organizations, as well as factors inherent to each of them, this paper proposes an exploratory model that integrates the key success factors in open innovation processes.

Keratometric alterations following the 25-gauge transconjunctival sutureless pars plana vitrectomy versus the conventional pars plana vitrectomy.

Science.gov (United States)

Citirik, Mehmet; Batman, Cosar; Bicer, Tolga; Zilelioglu, Orhan

2009-09-01

To assess the alterations in keratometric astigmatism following the 25-gauge transconjunctival sutureless pars plana vitrectomy versus the conventional pars plana vitrectomy. Sixteen consecutive patients were enrolled into the study. Conventional vitrectomy was applied to eight of the cases and 25-gauge transconjunctival sutureless vitrectomy was performed in eight patients. Keratometry was performed before and after the surgery. In the 25-gauge transconjunctival sutureless pars plana vitrectomy group, statistically significant changes were not observed in the corneal curvature in any post-operative follow-up measurement (p > 0.05); whereas in the conventional pars plana vitrectomy group, statistically significant changes were observed in the first postoperative day (p = 0.01) and first postoperative month (p = 0.03). We noted that these changes returned to baseline in three months (p = 0.26). Both 25-gauge transconjunctival sutureless and conventional pars plana vitrectomy are effective surgical modalities for selected diseases of the posterior segment. Surgical procedures are critical for the visual rehabilitation of the patients. The post-operative corneal astigmatism of the vitrectomised eyes can be accurately determined at least two months post-operatively.

Centromere pairing by a plasmid-encoded type I ParB protein

DEFF Research Database (Denmark)

Ringgaard, Simon; Löwe, Jan; Gerdes, Kenn

2007-01-01

The par2 locus of Escherichia coli plasmid pB171 encodes two trans-acting proteins, ParA and ParB, and two cis-acting sites, parC1 and parC2, to which ParB binds cooperatively. ParA is related to MinD and oscillates in helical structures and thereby positions ParB/parC-carrying plasmids regularly......, hence identifying the N terminus of ParB as a requirement for ParB-mediated centromere pairing. These observations suggest that centromere pairing is an important intermediate step in plasmid partitioning mediated by the common type I loci....

Cross-cultural influence on diffusion and adoption of innovation: An exploratory case study to investigate the social-cultural barriers

OpenAIRE

Deligiannaki, A; Ali, M

2011-01-01

The development of science and technology increasing rapidly; in many cases advantageous innovations find obstacles for their establishment and in some others they simply fail. The authors of this paper demonstrate that the reason this may happen, is not depended only form the innovation itself; but the socio cultural aspects plays a fundamental role for the diffusion and the adoption of innovation. A number of studies have dealt with the diffusion and the adoption of innovation but limited r...

18 CFR 367.2190 - Account 219, Accumulated other comprehensive income.

Science.gov (United States)

2010-04-01

... COMPANY ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT UNIFORM SYSTEM OF ACCOUNTS FOR CENTRALIZED SERVICE COMPANIES SUBJECT TO THE PROVISIONS OF THE PUBLIC UTILITY HOLDING COMPANY ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT Balance Sheet Chart of Accounts Proprietary Capital § 367.2190 Account 219...

Analysis of ParB-centromere interactions by multiplex SPR imaging reveals specific patterns for binding ParB in six centromeres of Burkholderiales chromosomes and plasmids.

Directory of Open Access Journals (Sweden)

Flavien Pillet

Full Text Available Bacterial centromeres-also called parS, are cis-acting DNA sequences which, together with the proteins ParA and ParB, are involved in the segregation of chromosomes and plasmids. The specific binding of ParB to parS nucleates the assembly of a large ParB/DNA complex from which ParA-the motor protein, segregates the sister replicons. Closely related families of partition systems, called Bsr, were identified on the chromosomes and large plasmids of the multi-chromosomal bacterium Burkholderia cenocepacia and other species from the order Burkholeriales. The centromeres of the Bsr partition families are 16 bp palindromes, displaying similar base compositions, notably a central CG dinucleotide. Despite centromeres bind the cognate ParB with a narrow specificity, weak ParB-parS non cognate interactions were nevertheless detected between few Bsr partition systems of replicons not belonging to the same genome. These observations suggested that Bsr partition systems could have a common ancestry but that evolution mostly erased the possibilities of cross-reactions between them, in particular to prevent replicon incompatibility. To detect novel similarities between Bsr partition systems, we have analyzed the binding of six Bsr parS sequences and a wide collection of modified derivatives, to their cognate ParB. The study was carried out by Surface Plasmon Resonance imaging (SPRi mulitplex analysis enabling a systematic survey of each nucleotide position within the centromere. We found that in each parS some positions could be changed while maintaining binding to ParB. Each centromere displays its own pattern of changes, but some positions are shared more or less widely. In addition from these changes we could speculate evolutionary links between these centromeres.

Inferential statistics, power estimates, and study design formalities continue to suppress biomedical innovation

OpenAIRE

Kern, Scott E.

2014-01-01

Innovation is the direct intended product of certain styles in research, but not of others. Fundamental conflicts between descriptive vs inferential statistics, deductive vs inductive hypothesis testing, and exploratory vs pre-planned confirmatory research designs have been played out over decades, with winners and losers and consequences. Longstanding warnings from both academics and research-funding interests have failed to influence effectively the course of these battles. The NIH publicly...

Par Pond Fish, Water, and Sediment Chemistry

International Nuclear Information System (INIS)

Paller, M.H.; Wike, L.D.

1996-06-01

The objectives of this report are to describe the Par Pond fish community and the impact of the drawdown and refill on the community, describe contaminant levels in Par Pond fish, sediments, and water and indicate how contaminant concentrations and distributions were affected by the drawdown and refill, and predict possible effects of future water level fluctuations in Par Pond

Par Pond Fish, Water, and Sediment Chemistry

Energy Technology Data Exchange (ETDEWEB)

Paller, M.H. [Westinghouse Savannah River Company, AIKEN, SC (United States); Wike, L.D.

1996-06-01

The objectives of this report are to describe the Par Pond fish community and the impact of the drawdown and refill on the community, describe contaminant levels in Par Pond fish, sediments, and water and indicate how contaminant concentrations and distributions were affected by the drawdown and refill, and predict possible effects of future water level fluctuations in Par Pond.

Antecedents of CIOs' Innovation Capability in Hospitals: Results of an Empirical Study.

Science.gov (United States)

Liebe, Jan-David; Esdar, Moritz; Thye, Johannes; Hübner, Ursula

2017-01-01

CIOs' innovation capability is regarded as a precondition of successful HIT adoption in hospitals. Based on the data of 142 CIOs, this study aimed at identifying antecedents of perceived innovation capability. Eight features describing the status quo of the hospital IT management (e.g. use of IT governance frameworks), four features of the hospital structure (e.g. functional diversification) and four CIO characteristics (e.g. duration of employment) were tested as potential antecedents in an exploratory stepwise regression approach. Perceived innovation capability in its entirety and its three sub-dimensions served as criterion. The results show that CIOs' perceived innovation capability could be explained significantly (R2=0.34) and exclusively by facts that described the degree of formalism and structure of IT management in a hospital, e.g. intensive and formalised strategic communication, the existence of an IT strategy and the use of IT governance frameworks. Breaking down innovation capability into its constituents revealed that "innovative organisational culture" contributed to a large extent (R2=0.26) to the overall result sharing several predictors. In contrast, "intrapreneurial personality" (R2=0.11) and "openness towards users" (R2=0.18) could be predicted less well. These results hint at the relationship between working in a well-structured, formalised and strategy oriented environment and the overall feeling of being capable to promote IT innovation.

48 CFR 52.219-8 - Utilization of small business concerns.

Science.gov (United States)

2010-10-01

... management and daily business operations of which are controlled by one or more veterans. Women-owned small... Clauses 52.219-8 Utilization of small business concerns. As prescribed in 19.708(a), insert the following clause: Utilization of Small Business Concerns (MAY 2004) (a) It is the policy of the United States that...

50 CFR 216.219 - Renewal and modifications of Letters of Authorization.

Science.gov (United States)

2010-10-01

... OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Explosive Severance.... Gulf of Mexico § 216.219 Renewal and modifications of Letters of Authorization. (a) A Letter of...

Concerning the dynamic instability of actin homolog ParM

International Nuclear Information System (INIS)

Popp, David; Yamamoto, Akihiro; Iwasa, Mitsusada; Narita, Akihiro; Maeda, Kayo; Maeda, Yuichiro

2007-01-01

Using in vitro TIRF- and electron-microscopy, we reinvestigated the dynamics of native ParM, a prokaryotic DNA segregation protein and actin homolog. In contrast to a previous study, which used a cysteine ParM mutant, we find that the polymerization process of wild type ATP-ParM filaments consists of a polymerization phase and a subsequent steady state phase, which is dynamically unstable, like that of microtubules. We find that the apparent bidirectional polymerization of ParM, is not due to the intrinsic nature of this filament, but results from ParM forming randomly oriented bundles in the presence of crowding agents. Our results imply, that in the bacterium, ParM filaments spontaneously form bipolar bundles. Due to their intrinsic dynamic instability, ParM bundles can efficiently 'search' the cytoplasmic lumen for DNA, bind it equally well at the bipolar ends and segregate it approximately symmetrically, by the insertion of ParM subunits at either end

Le Centre d'innovation pour la résilience de l'Afrique de l'Est | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

D'ici 2025, la pauvreté sera essentiellement concentrée dans les pays africains à faible revenu touchés par des conflits et de la violence. ... International Water Resources Association, in close collaboration with IDRC, is holding a webinar titled “Climate change and adaptive water management: Innovative solutions from the ...

uPAR as anti-cancer target

DEFF Research Database (Denmark)

Lund, Ida K; Illemann, Martin; Thurison, Tine

2011-01-01

, and a potential diagnostic and predictive impact of the different uPAR forms has been reported. Hence, pericellular proteolysis seems to be a suitable target for anti-cancer therapy and numerous approaches have been pursued. Targeting of this process may be achieved by preventing the binding of uPA to u...... using mouse monoclonal antibodies (mAbs) against mouse uPA or uPAR. These reagents will target uPA and uPAR in both stromal cells and cancer cells, and their therapeutic potential can now be assessed in syngenic mouse cancer models....

Protease-activated receptor (PAR2, but not PAR1, is involved in collateral formation and anti-inflammatory monocyte polarization in a mouse hind limb ischemia model.

Directory of Open Access Journals (Sweden)

Lisa G van den Hengel

Full Text Available AIMS: In collateral development (i.e. arteriogenesis, mononuclear cells are important and exist as a heterogeneous population consisting of pro-inflammatory and anti-inflammatory/repair-associated cells. Protease-activated receptor (PAR1 and PAR2 are G-protein-coupled receptors that are both expressed by mononuclear cells and are involved in pro-inflammatory reactions, while PAR2 also plays a role in repair-associated responses. Here, we investigated the physiological role of PAR1 and PAR2 in arteriogenesis in a murine hind limb ischemia model. METHODS AND RESULTS: PAR1-deficient (PAR1-/-, PAR2-deficient (PAR2-/- and wild-type (WT mice underwent femoral artery ligation. Laser Doppler measurements revealed reduced post-ischemic blood flow recovery in PAR2-/- hind limbs when compared to WT, while PAR1-/- mice were not affected. Upon ischemia, reduced numbers of smooth muscle actin (SMA-positive collaterals and CD31-positive capillaries were found in PAR2-/- mice when compared to WT mice, whereas these parameters in PAR1-/- mice did not differ from WT mice. The pool of circulating repair-associated (Ly6C-low monocytes and the number of repair-associated (CD206-positive macrophages surrounding collaterals in the hind limbs were increased in WT and PAR1-/- mice, but unaffected in PAR2-/- mice. The number of repair-associated macrophages in PAR2-/- hind limbs correlated with CD11b- and CD115-expression on the circulating monocytes in these animals, suggesting that monocyte extravasation and M-CSF-dependent differentiation into repair-associated cells are hampered. CONCLUSION: PAR2, but not PAR1, is involved in arteriogenesis and promotes the repair-associated response in ischemic tissues. Therefore, PAR2 potentially forms a new pro-arteriogenic target in coronary artery disease (CAD patients.

Apoplejía pituitaria con parálisis del III par craneal: Reporte de caso

Directory of Open Access Journals (Sweden)

Miguel Pinto Valdivia

2011-10-01

Full Text Available Se describe el caso de un varón de 65 años de edad, sin antecedentes patológicos de importancia, que acudió a emergencia del Hospital Nacional Cayetano Heredia por presentar cefalea intensa y ptosis palpebral izquierda. El examen físico mostró parálisis aislada del III par craneal izquierdo. Los análisis de laboratorio mostraron hiponatremia e hipopituitarismo y la resonancia magnética nuclear un adenoma pituitario con áreas de hemorragia e invasión de los senos cavernosos. El tratamiento incluyó glucocorticoides y descompresión quirúrgica transesfenoidal. La anatomía patológica confirmó el diagnóstico de infarto hemorrágico de un adenoma pituitario. El paciente fue dado de alta con terapia sustitutiva de levotiroxina y prednisona. La ptosis palpebral izquierda se recuperó en forma parcial. La apoplejía pituitaria es un síndrome clínico producido por un proceso expansivo dentro de la silla turca, secundario a hemorragia o infarto de un adenoma pituitario, que se caracteriza por cefalea, déficit visual, oftalmoplejía y alteración del nivel de conciencia. Este proceso expansivo puede comprimir los pares craneales en los senos cavernosos, produciendo diferentes grados de parálisis de los músculos oculomotores. La parálisis aislada del III par craneal es rara.(Rev Med Hered 2011;22:186-189.

Copenhagen uPAR prostate cancer (CuPCa) database

DEFF Research Database (Denmark)

Lippert, Solvej; Berg, Kasper D; Høyer-Hansen, Gunilla

2016-01-01

AIM: Urokinase plasminogen activator receptor (uPAR) plays a central role during cancer invasion by facilitating pericellular proteolysis. We initiated the prospective 'Copenhagen uPAR Prostate Cancer' study to investigate the significance of uPAR levels in prostate cancer (PCa) patients. METHODS...

Recombination in the human Pseudoautosomal region PAR1.

Directory of Open Access Journals (Sweden)

Anjali G Hinch

2014-07-01

Full Text Available The pseudoautosomal region (PAR is a short region of homology between the mammalian X and Y chromosomes, which has undergone rapid evolution. A crossover in the PAR is essential for the proper disjunction of X and Y chromosomes in male meiosis, and PAR deletion results in male sterility. This leads the human PAR with the obligatory crossover, PAR1, to having an exceptionally high male crossover rate, which is 17-fold higher than the genome-wide average. However, the mechanism by which this obligatory crossover occurs remains unknown, as does the fine-scale positioning of crossovers across this region. Recent research in mice has suggested that crossovers in PAR may be mediated independently of the protein PRDM9, which localises virtually all crossovers in the autosomes. To investigate recombination in this region, we construct the most fine-scale genetic map containing directly observed crossovers to date using African-American pedigrees. We leverage recombination rates inferred from the breakdown of linkage disequilibrium in human populations and investigate the signatures of DNA evolution due to recombination. Further, we identify direct PRDM9 binding sites using ChIP-seq in human cells. Using these independent lines of evidence, we show that, in contrast with mouse, PRDM9 does localise peaks of recombination in the human PAR1. We find that recombination is a far more rapid and intense driver of sequence evolution in PAR1 than it is on the autosomes. We also show that PAR1 hotspot activities differ significantly among human populations. Finally, we find evidence that PAR1 hotspot positions have changed between human and chimpanzee, with no evidence of sharing among the hottest hotspots. We anticipate that the genetic maps built and validated in this work will aid research on this vital and fascinating region of the genome.

Knowledge Management Orientation: An Innovative Perspective to Hospital Management.

Science.gov (United States)

Ghasemi, Matina; Ghadiri Nejad, Mazyar; Bagzibagli, Kemal

2017-12-01

By considering innovation as a new project in hospitals, all the project management's standard steps should be followed in execution. This study investigated the validation of a new set of measures in terms of providing a procedure for knowledge management-oriented innovation that enriches the hospital management system. The relation between innovation and all the knowledge management areas, as the main constructs of project management, was illustrated by referring to project management standard steps and previous studies. Through consultations and meetings with a committee of professional project managers, a questionnaire was developed to measure ten knowledge management areas in hospital's innovation process. Additionally, a group of experts from hospital managers were invited to comment on the applicability of the questionnaires by considering if the items are measurable in hospitals practically. A close-ended, Likert-type scale items, consisted of ten sections, were developed based on project management body of knowledge thorough Delphi technique. It enables the managers to evaluate hospitals' situation to be aware whether the organization follows the knowledge management standards in innovation process or not. By pilot study, confirmatory factor analysis and exploratory factor analysis were conducted to ensure the validity and reliability of the measurement items. The developed items seem to have a potential to help hospital managers and subsequently delivering new products/services successfully based on the standard procedures in their organization. In all innovation processes, the knowledge management areas and their standard steps help hospital managers by a new tool as questionnaire format.

Plasma suPAR is lowered by smoking cessation

DEFF Research Database (Denmark)

Eugen-Olsen, Jesper; Ladelund, Steen; Sørensen, Lars Tue

2016-01-01

BACKGROUND: Soluble urokinase plasminogen activator receptor (suPAR) is a stable inflammatory biomarker. In patients, suPAR is a marker of disease presence, severity and prognosis. In the general population, suPAR is predictive of disease development, such as diabetes and cardiovascular disease a...

20 CFR 219.31 - Evidence of a valid ceremonial marriage.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Evidence of a valid ceremonial marriage. 219... marriage. (a) Preferred evidence. Preferred evidence of a ceremonial marriage is— (1) A copy of the public record of the marriage, certified by the custodian of the record or by a Board employee; (2) A copy of a...

Linking energy efficiency and innovation practices: Empirical evidence from the foundry sector

International Nuclear Information System (INIS)

Cagno, Enrico; Ramirez-Portilla, Andres; Trianni, Andrea

2015-01-01

The Europe 2020 strategy currently promotes energy efficiency and innovation through disconnected targets focusing on either energy or R&D. Similar policies indicate that in practice, these two concepts are usually perceived as mutually exclusive. Furthermore, evidence in the literature regarding the relationship between R&D and energy efficiency is still highly limited. This exploratory study aims to address this gap by investigating the link between innovation practices and energy efficiency through a multiple case study of 30 foundries in Northern Italy. We analysed the firms' innovativeness, measured by internal R&D and Open Innovation practices (inbound and outbound), and energy efficiency, measured by specific energy consumption, level of adoption of energy-efficient technologies and barriers to energy efficiency. The results seem to show that those foundries complementing internal R&D with inbound practices have a higher level of energy efficiency, a higher level of adoption of available technologies, and a lower perception of barriers to efficiency improvements. This finding suggests that diversifying innovation practices could lead to better performance with respect to all three indicators of energy efficiency analysed. This study contributes to understanding how more innovative firms can be more energy efficient, providing interesting highlights for managers and policymakers. -- Highlights: •The relation between innovation practices and energy efficiency is articulated. •The link between innovation practices and energy efficiency is tested for foundries. •Energy efficiency is measured with three different indicators. •Analyses of the relations between these indicators support the link with innovation. •Concurrent adoption of internal R&D and inbound practices leads to higher efficiency

Audiology, Entrepreneurship and Innovation: A perspective on private practice

Directory of Open Access Journals (Sweden)

Alex Antonites

2013-12-01

Full Text Available Objective: This paper investigates the correlation and contact points between entrepreneurship as a discipline and the profession of audiology. The research focuses on specific areas of entrepreneurship (e.g. innovation as an entrepreneurial skill and the impact it has on audiology private practices as key role players in the biotechnology industry. Design: This study used a two-stage research design comprising of an exploratory study and a formal study to survey the entrepreneurial and business skills of audiologists as entrepreneurs in private practice. Findings: The findings describe severe deficiencies - specifically the business and entrepreneurial skill sets of the professional audiologist as an entrepreneur. The mind-set of the audiologist is not that of an entrepreneur, but rather of a small business owner. A lack of self-confidence to be creative, take risks, and identify new opportunities or innovate in terms of products, process and services was found. Audiologists are not necessarily concerned about the creation of employment, or the growth and profitability of their practices. Autonomy and security are the primary objectives of most practice owners. Keywords: Innovation, Entrepreneurs, Women Entrepreneurs, Entrepreneurship, Audiology, Biotechnology

Foreign board members and firm innovativeness: An exploratory analysis for setting a research agenda

DEFF Research Database (Denmark)

Makkonen, Teemu; Williams, Allan; Habersetzer, Antoine

2018-01-01

Purpose This paper aims to assess the often repeated, but empirically unconfirmed, supposition that there is a positive connection between foreign board members (FBMs) and firm innovativeness and to set a research agenda for future studies on the topic. Design/methodology/approach The analyses ar...

The inflammatory marker suPAR after cardiac arrest

DEFF Research Database (Denmark)

Rundgren, Malin; Lyngbaek, Stig; Fisker, Helle

2015-01-01

. This pilot study aimed at investigating suPAR levels in relation to outcome after CA and mild induced hypothermia. METHODS: suPAR levels were measured at 6, 36, and 72 hours in patients treated with hypothermia after CA. suPAR levels were analyzed in relation to survival after 6 months. Receiver operating...

Evaluation des activités antioxydante et antibactérienne de l’huile essentielle de Citrus limon (variété Lisbon extraite par hydrodistillation

Directory of Open Access Journals (Sweden)

Louiza HIMED

2016-03-01

Full Text Available La présente étude porte sur l’évaluation des propriétés antioxydante et antibactérienne de l’huile essentielle de Citrus limon (Lisbon extraite par hydrodistillation et analysée par GC-MS. Le pouvoir antioxydant est évalué par le test au DPPH et le test de blanchissement du β-carotène. L’activité antibactérienne vis-à-vis de neuf souches bactériennes (deux à Gram positif et sept à Gram négatif est évaluée par la méthode des aromatogrammes et la méthode de dilution d’agar pour déterminer les CMI. L’extraction a donné un rendement moyen de 1,34±0,012%. Cette huile essentielle a montré des propriétés antioxydante et antibactérienne importantes. La concentration efficace qui réduit 50 % du DPPH en solution est de 0,09±0,001 µg/ml qui exprime une activité antioxydante plus importante que celle de α-tocopherol, ce résultat a été confirmé par le test de blanchissement du β-carotène. Les bactéries testées ont montré une sensibilité à l’huile essentielle. Ces activités sont liées à la richesse de l’huile essentielle en monoterpènes (81,01%.

How the question of innovation is addressed by the social sciences

Directory of Open Access Journals (Sweden)

Jean Corneloup

2009-07-01

Full Text Available Although innovation has today become a topical notion, given its fundamental importance in understanding the economy and the way our society adapts to its development goals, its characteristics and principles nevertheless need to be defined. While the 20th century was marked by important technological, political, economic and cultural changes, the current era seems to be increasingly bent on imposing innovation as a motor for the development of society. It is therefore important to understand how the question of innovation is currently being addressed, and in turn this involves looking at the different ways in which the innovative process is interpreted. Between the notional approach, which often remains vague and somewhat basic, and the theoretical approaches that attempt to present different perspectives for ways of understanding the innovation process, the path of knowledge is very often compartmentalized by the different scientific disciplines. In this paper, we will attempt to show the tensions and combinations that exist between the different approaches adopted by the management sciences, sociology, economics and geography in attempting to understand the innovative process. To do so, we will focus our study on the firm and the territory (as the spatial dimension of innovation, elements that have already been the subject of numerous studies to understand the forces participating in the production of novelty.Si l’innovation est devenue aujourd’hui une notion d’actualité tant elle apparaît comme fondamentale pour penser l’économie et l’adaptation de notre société à son projet de développement, reste à en définir les caractéristiques et les principes. Si le XX° siècle a été marqué par des changements importants sur un plan technologique, politique, économique ou encore culturel, l’époque actuelle semble redoubler d’efforts pour imposer l’innovation comme moteur du développement de la société. Reste alors �

It's quicker "Par Avignon"!

CERN Multimedia

2005-01-01

For a few years, the CERN Library has been receiving books from the University of Hanover sent via Avignon, at least that's what it says on the envelope. Such a detour would mean that parcels were travelling 720 km more than the distance separating Geneva and Hanover, which would be a very strange state of affairs. The explanation lies in a spelling mistake. The sender has been stamping parcels with a stamp that says "Par Avignon prioritaire" (first-class via Avignon) instead of "Par Avion prioritaire" (First Class Air Mail), a source of much amusement to the librarians!

Considering Materials Management in Construction: An Exploratory Study

Directory of Open Access Journals (Sweden)

Zakaria Dakhli

2018-03-01

Full Text Available While materials count for a considerable amount of construction costs, the way materials are managed seems to be improvised rather than approached methodically. This study investigates the practice of novel techniques used to manage materials in the construction industry. Techniques that have already proven themselves to be efficient ways to manage the production pace within the industry include the pull system, Just-In-Time, Kitting and off-site fabrication. These are explained and assessed in the context of the French construction industry through an exploratory study, supported by a questionnaire completed by contractors. The results reveal that a clear plan to manage materials on-site is lacking among the respondents, creating common inventory problems. This research provides evidence to support the central role played by an efficient management of material flow on-site. It also highlights the obstacles that hinder the adoption of innovative techniques, such as sub-contractor coordination.

The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

Science.gov (United States)

Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

2014-04-01

α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

CONFLICTS AND OPERATIONAL HURDLES IN THE MANAGEMENT OF INNOVATIVE PROJECTS: AN EMPIRICAL STUDY

Directory of Open Access Journals (Sweden)

José Varela Donato

2013-12-01

Full Text Available This article aims at describing how conflicts and operational hurdles manifest themselves in the management of innovative projects in a development bank (DB. The research characterizes itself as a qualitative and exploratory approach; the data collection consisted of interviews with consultants and project managers and by documents on management projects in Development Bank; the interviews have undergone the content analysis by utilizing the Atlas.ti. The research revealed that the project management in its new implemented model faces difficulties similar to those observed in traditional hierarchies. It was observed that conflicts regarding interests, values, psychological aspects and operational hurdles are intrinsic to the life cycle of innovative projects, which implementation requires a lot of political capacity from their leaders to be effective.

Serum suPAR in patients with FSGS: trash or treasure?

Science.gov (United States)

Maas, Rutger J H; Deegens, Jeroen K J; Wetzels, Jack F M

2013-07-01

The urokinase-type plasminogen activator receptor (uPAR) has important functions in cell migration. uPAR can be shed from the cell membrane resulting in soluble uPAR (suPAR). Further cleavage gives rise to shorter fragments with largely unknown functions. Recent studies have demonstrated that both overexpression of uPAR on podocytes and the administration of suPAR cause proteinuria in mice. The common pathogenic mechanism involves the activation of podocyte β3-integrin. Increased activation of β3-integrin is also observed in patients with focal and segmental glomerulosclerosis (FSGS). These observations form the basis for the hypothesis that suPAR may be the circulating factor causing FSGS. A recent study fosters this idea by demonstrating increased suPAR levels in the serum of patients with FSGS and reporting an association with recurrence after transplantation and response to plasmapheresis. However, this study was heavily biased, and subsequent studies have given conflicting results. Although the experimental work is very suggestive, at present there is no proof that any known human suPAR fragment causes FSGS in humans. We therefore suggest that the measurement of suPAR using currently available assays has absolutely no value at the present time in decision-making in routine clinical practice.

Proteinase-Activated Receptor 1 (PAR1 regulates leukemic stem cell functions.

Directory of Open Access Journals (Sweden)

Nicole Bäumer

Full Text Available External signals that are mediated by specific receptors determine stem cell fate. The thrombin receptor PAR1 plays an important role in haemostasis, thrombosis and vascular biology, but also in tumor biology and angiogenesis. Its expression and function in hematopoietic stem cells is largely unknown. Here, we analyzed expression and function of PAR1 in primary hematopoietic cells and their leukemic counterparts. AML patients' blast cells expressed much lower levels of PAR1 mRNA and protein than CD34+ progenitor cells. Constitutive Par1-deficiency in adult mice did not affect engraftment or stem cell potential of hematopoietic cells. To model an AML with Par1-deficiency, we retrovirally introduced the oncogene MLL-AF9 in wild type and Par1-/- hematopoietic progenitor cells. Par1-deficiency did not alter initial leukemia development. However, the loss of Par1 enhanced leukemic stem cell function in vitro and in vivo. Re-expression of PAR1 in Par1-/- leukemic stem cells delayed leukemogenesis in vivo. These data indicate that Par1 contributes to leukemic stem cell maintenance.

Proteinase-Activated Receptor 1 (PAR1) regulates leukemic stem cell functions.

Science.gov (United States)

Bäumer, Nicole; Krause, Annika; Köhler, Gabriele; Lettermann, Stephanie; Evers, Georg; Hascher, Antje; Bäumer, Sebastian; Berdel, Wolfgang E; Müller-Tidow, Carsten; Tickenbrock, Lara

2014-01-01

External signals that are mediated by specific receptors determine stem cell fate. The thrombin receptor PAR1 plays an important role in haemostasis, thrombosis and vascular biology, but also in tumor biology and angiogenesis. Its expression and function in hematopoietic stem cells is largely unknown. Here, we analyzed expression and function of PAR1 in primary hematopoietic cells and their leukemic counterparts. AML patients' blast cells expressed much lower levels of PAR1 mRNA and protein than CD34+ progenitor cells. Constitutive Par1-deficiency in adult mice did not affect engraftment or stem cell potential of hematopoietic cells. To model an AML with Par1-deficiency, we retrovirally introduced the oncogene MLL-AF9 in wild type and Par1-/- hematopoietic progenitor cells. Par1-deficiency did not alter initial leukemia development. However, the loss of Par1 enhanced leukemic stem cell function in vitro and in vivo. Re-expression of PAR1 in Par1-/- leukemic stem cells delayed leukemogenesis in vivo. These data indicate that Par1 contributes to leukemic stem cell maintenance.

Mr Gary Nairn MP, Chair of the Standing Committee on Science and Innovation, Australia

CERN Multimedia

Maximilien Brice

2003-01-01

Photos 01,04,06,07: Mr Gary Nairn MP, Chair of the Standing Committee on Science and Innovation, Australia,visiting the silicon test laboratory, April 2003. Photos 02,03: From left to right: Mr Gary Nairn MP, Chair of the Standing Committee on Science and Innovation, Australia,visiting the silicon test laboratory with Prof. Steinar Stapnes, Physicist in the ATLAS experiment, April 2003. Photos 02,09: Mrs Kerrye Nairn, Australia,visiting the silicon test laboratory, April 2003

Serum suPAR in patients with FSGS: trash or treasure?

NARCIS (Netherlands)

Maas, R.J.H.; Deegens, J.K.J.; Wetzels, J.F.M.

2013-01-01

The urokinase-type plasminogen activator receptor (uPAR) has important functions in cell migration. uPAR can be shed from the cell membrane resulting in soluble uPAR (suPAR). Further cleavage gives rise to shorter fragments with largely unknown functions. Recent studies have demonstrated that both

Accouchement par forceps: indications et pronostic materno-foetal ...

African Journals Online (AJOL)

L'accouchement par voie basse, peut être parfois compromis par des facteurs maternels, foetaux ou materno-foetaux nécessitant des moyens thérapeutiques comme le forceps pour achever l'accouchement par voie naturelle. Le forceps, une méthode qui n'est pas sans risque pour la mère et le nouveau-né. Nous avons ...

Association between in-hospital mortality and renal dysfunction in 186,219 patients hospitalized for acute stroke in the Emilia-Romagna region of Italy.

Science.gov (United States)

Fabbian, Fabio; Gallerani, Massimo; Pala, Marco; De Giorgi, Alfredo; Salmi, Raffaella; Dentali, Francesco; Ageno, Walter; Manfredini, Roberto

2014-11-01

Using a regional Italian database, we evaluated the relationship between renal dysfunction and in-hospital mortality (IHM) in patients with acute stroke (ischemic/hemorrhagic). Patients were classified on the basis of renal damage: without renal dysfunction, with chronic kidney disease (CKD), and with end-stage renal disease (ESRD). Of a total of 186,219 patients with a first episode of stroke, 1626 (0.9%) had CKD and 819 (0.4%) had ESRD. Stroke-related IHM (total cases) was independently associated with CKD, ESRD, atrial fibrillation (AF), age, and Charlson comorbidity index (CCI). In patients with ischemic stroke (n=154,026), IHM remained independently associated with CKD, ESRD, AF, and CCI. In patients with hemorrhagic stroke (n=32,189), variables that were independently associated with IHM were CKD, ESRD, and AF. Renal dysfunction is associated with IHM related to stroke, both ischemic and hemorrhagic, with even higher odds ratios than those of other established risk factors, such as age, comorbidities, and AF. © The Author(s) 2013.

Entrepreneurs’ Exploratory Perseverance in Learning Settings

NARCIS (Netherlands)

Muehlfeld, K.S.; Urbig, Diemo; Weitzel, Utz

We introduce “exploratory perseverance” as a novel construct that captures perseverant behavior in settings in which several alternatives can be explored and evaluated. We suggest that entrepreneurs display exploratory perseverance reflected by a tendency to keep exploring broader sets of

Drivers of multidimensional eco-innovation: empirical evidence from the Brazilian industry.

Science.gov (United States)

da Silva Rabêlo, Olivan; de Azevedo Melo, Andrea Sales Soares

2018-03-08

The study analyses the relationships between the main drivers of eco-innovation introduced by innovative industries, focused on cooperation strategy. Eco-innovation is analysed by means of a multidimensional identification strategy, showing the relationships between the independent variables and the variable of interest. The literature discussing environmental innovation is different from the one discussing other types of innovation inasmuch as it seeks to grasp its determinants and to mostly highlight the relevance of environmental regulation. The key feature of this paper is that it ascribes special relevance to cooperation strategy with external partners and to the propensity of innovative industry introducing eco-innovation. A sample of 35,060 Brazilian industries were analysed, between 2003 and 2011, by means of Binomial, Multinomial and Ordinal logistic regressions with microdata collected with the research and innovation department (PINTEC) from the Brazilian Institute of Geography and Statistics (Instituto Brasileiro de Geografia e Estatística). The econometric results estimated by the Logit Multinomial method suggest that the cooperation with external partners practiced by innovative industries facilitates the adoption of eco-innovation in dimension 01 with probability of 64.59%, 57.63% in dimension 02 and 81.02% in dimension 03. The data reveal that the higher the degree of eco-innovation complexity, the harder industries seek to obtain cooperation with external partners. When calculating with the Logit Ordinal and Binomial models, cooperation increases the probability that the industry is eco-innovative in 65.09% and 89.34%, respectively. Environmental regulation and innovation in product and information management were also positively correlated as drivers of eco-innovation.

48 CFR 1852.219-74 - Use of rural area small businesses.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Use of rural area small... and Clauses 1852.219-74 Use of rural area small businesses. As prescribed in 1819.7103, insert the following clause: Use of Rural Area Small Business (SEP 1990) (a) Definitions. Rural area means any county...

48 CFR 3052.219-72 - Evaluation of prime contractor participation in the DHS mentor-protégé program.

Science.gov (United States)

2010-10-01

... contractor participation in the DHS mentor-protégé program. 3052.219-72 Section 3052.219-72 Federal... Evaluation of prime contractor participation in the DHS mentor-protégé program. As prescribed in (HSAR) 48... the DHS Mentor-Protégé Program (JUN 2006) This solicitation contains a source selection factor or...

PERCEPTION AND COMMUNICATION OF INNOVATION IN RETAIL TRADE (CASE STUDY APPLIED TO BRICOLAGE PRODUCTS

Directory of Open Access Journals (Sweden)

Pop Nicolae Al.

2012-07-01

Full Text Available Starting from the specific features of bricolage retail trade (which is part of the ‘Do It Yourself’ – DYI commercial format, this study aims to clarify the concept and structure of innovation in this field, and to present how innovation is perceived and communicated by sellers to customers. The initial literature review is followed by the design of a three-stage research, which consists of a variety of methods, techniques and tools of selective market research. The objectives are to establish the main forms of innovation in DIY trade, the perception and communication of innovation to the customer, and the internal marketing techniques which could deliver higher marketing advantages to the seller. This paper covers only the results of a pilot research conducted via qualitative exploratory research among 13 managers of the bricolage stores in Bucharest. Five hypotheses were tested and confirmed through research. All premises are ready for the scientific construction of research tools for the second and third stages of the study.

Long non-coding RNA TUG1 promotes progression of oral squamous cell carcinoma through upregulating FMNL2 by sponging miR-219.

Science.gov (United States)

Yan, Guangqi; Wang, Xue; Yang, Mingliang; Lu, Li; Zhou, Qing

2017-01-01

Oral squamous cell carcinoma (OSCC) is a prevalent oral disease with a high morbidity and mortality rate. Several long non-coding RNAs (lncRNAs) were identified as important regulators of carcinogenesis. However, the pathogenic implications of TUG1 in OSCC are still unclear. In the present study, the expression of TUG1 was increased in OSCC cells. Knockdown of TUG1 inhibited cell proliferation, migration, and invasion, and induced cell cycle arrest at G0/G1 phase, whereas overexpression of TUG1 exerted the opposite effect on OSCC cells. A reciprocal repressive interaction between TUG1 and miR-219 was found, and miR-219 inhibition abolished the tumor-suppressive effect of TUG1 knockdown on cell growth and motility. Furthermore, bioinformatics analysis and luciferase reporter assay showed that FMNL2 was a direct target of miR-219. Restoration of FMNL2 abrogated the miR-219-induced inhibition of cell proliferation, cell cycle progression, migration, and invasion. Besides, overexpression of TUG1 promoted tumor growth and metastasis in vivo . Clinically, the expression of TUG1 and FMNL2 were increased, but miR-219 was decreased in primary tumors compared to non-tumor tissues. Both the upregulated TUG1, and FMNL2 and the downregulated miR-219 was associated with advanced stage of OSCC and poor overall survival. Notably, multivariate analyses confirmed that FMNL2 was an independent risk factor for OSCC. In conclusion, our data revealed that TUG1 confers oncogenic function in OSCC and TUG1/miR-219/FMNL2 axis may be a novel therapeutic strategy in this disease.

Why Innovations in Agriculture are Necessary?

Indian Academy of Sciences (India)

... of people living below poverty line (21.9%, 2011-12). Ensuring food security for increasing population and for millions of people living below poverty line (21.9%, 2011-12). Major source of livelihood (about 54.5% workers are engaged in agriculture). Major demand driver for the growth of other sectors of the economy.

How do social networks and faculty development courses affect clinical supervisors' adoption of a medical education innovation? An exploratory study.

Science.gov (United States)

Jippes, Erik; Steinert, Yvonne; Pols, Jan; Achterkamp, Marjolein C; van Engelen, Jo M L; Brand, Paul L P

2013-03-01

To examine the impact of social networks and a two-day faculty development course on clinical supervisors' adoption of an educational innovation. During 2007-2010, 571 residents and 613 clinical supervisors in four specialties in the Netherlands were invited to complete a Web-based questionnaire. Residents rated their clinical supervisors' adoption of an educational innovation, the use of structured and constructive (S&C) feedback. Clinical supervisors self-assessed their adoption of this innovation and rated their communication intensity with other clinical supervisors in their department. For each supervisor, a centrality score was calculated, representing the extent to which the supervisor was connected to departmental colleagues. The authors analyzed the effects of supervisor centrality and participation in a two-day Teach-the-Teacher course on the degree of innovation adoption using hierarchical linear modeling, adjusting for age, gender, and attitude toward the S&C feedback innovation. Respondents included 370 (60%) supervisors and 357 (63%) residents. Although Teach-the-Teacher course participation (n=172; 46.5%) was significantly related to supervisors' self-assessments of adoption (P=.001), it had no effect on residents' assessments of supervisors' adoption (P=.371). Supervisor centrality was significantly related to innovation adoption in both residents' assessments (P=.023) and supervisors' self-assessments (P=.024). A clinical supervisor's social network may be as important as faculty development course participation in determining whether the supervisor adopts an educational innovation. Faculty development initiatives should use faculty members' social networks to improve the adoption of educational innovations and help build and maintain communities of practice.

Trenching as an exploratory method

International Nuclear Information System (INIS)

Hatheway, A.W.; Leighton, F.B.

1979-01-01

The critical nature of siting nuclear power plants has led to increased emphasis on exploratory trenching. Trenching is the most definitive of all subsurface exploratory methods; it permits inspection of a continuous geologic section by both geologists and regulatory authorities and makes possible the preparation of a graphic log that delineates both obvious and subtle geologic features. About one of every two nuclear plant licensing efforts utilizes exploratory trenching. Many geologic hazards, such as ''capable'' faults, can be detected from trench exposures; they may otherwise remain undetected. Trenches must be judiciously located, survey-controlled, excavated safely and adequately shored, logged in detail, and properly diagnosed. Useful techniques of trench logging include thorough cleaning of the trench walls, teamwork between geologist and recorder, logging against a carefully surveyed baseline and vertical reference grid, and panoramic photography.Soils, including paleosols, and glacial and glaciofluvial deposits present some of the most difficult media to log. Trench logs must be thoroughly interpreted and correlated so that they document the geologic conditions governing suitability of the site. Age-determination techniques utilized in exploratory trenching include petrographic analyses, quartz inclusion studies, clay mineralogic analyses, and radiometric methods

Innovation based on value co-creation: An alternative for Brazilian wine?

Directory of Open Access Journals (Sweden)

Borges Martiele Cortes

2016-01-01

Full Text Available The Brazilian wine industry has been facing obstacles such as competition and high tax rates. Innovation is an alternative towards this scenario being it a major factor for any company's survival and growth in the market. Besides this, technological advances and access to information provide consumers with a larger number of choices and knowledge for an informed decision making. Despite differentiation efforts consumers did not obtain satisfaction. Customer interaction provides another way to generate innovation from its involvement in the production process (co-creation of value. The research was held in an awarded winery located in Bento Gonçalves (Brazil with the objective of understanding how the process of value co-creation between Brazilian award-winning wineries and consumers influences innovation generation. It is an exploratory and qualitative study collected through in-depth interviews with a semi-structured script. The winery identifies beneficial effects in the production process resulting from interactions because it narrows the bond with the consumer creating a better understanding of the consumers as well as develop a more tailored offer regarding value. The innovations generated based on co-creation can be taken as an alternative to imposed barriers in the current Brazilian wine sector.

Longitudinal view of the psychological correlates and antecedents of subjectively assessed psychosomatic problems

Czech Academy of Sciences Publication Activity Database

Slezáčková, Alena; Blatný, Marek; Millová, Katarína; Jelínek, Martin

2011-01-01

Roč. 26, č. 2 (2011), s. 219-219 ISSN 0887-0446. [European Health Psychology Conference: Engaging with Other Health Professions: Challenges and Perspectives /25./. 20.09.2011-24.09.2011, Hersonissos, Kréta] R&D Projects: GA ČR GAP407/10/2410 Institutional research plan: CEZ:AV0Z70250504 Keywords : psychosomatic problems * middle adulthood * subjectively assessed health Subject RIV: AN - Psychology

48 CFR 653.219-71 - DOS form DS-4053, Department of State Mentor-Protégé Program Application.

Science.gov (United States)

2010-10-01

..., Department of State Mentor-Protégé Program Application. 653.219-71 Section 653.219-71 Federal Acquisition...-4053, Department of State Mentor-Protégé Program Application. As prescribed in 619.102-70(i), DS-4053 is prescribed for use in applying for an agreement under the Department of State Mentor-Protégé...

16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...

Introgression of Blast Resistance Genes (Putative Pi-b and Pi-kh) into Elite Rice Cultivar MR219 through Marker-Assisted Selection

Science.gov (United States)

Tanweer, Fatah A.; Rafii, Mohd Y.; Sijam, Kamaruzaman; Rahim, Harun A.; Ahmed, Fahim; Ashkani, Sadegh; Latif, Mohammad A.

2015-01-01

Blast is the most common biotic stress leading to the reduction of rice yield in many rice-growing areas of the world, including Malaysia. Improvement of blast resistance of rice varieties cultivated in blast endemic areas is one of the most important objectives of rice breeding programs. In this study, the marker-assisted backcrossing strategy was applied to improve the blast resistance of the most popular Malaysian rice variety MR219 by introgressing blast resistance genes from the Pongsu Seribu 2 variety. Two blast resistance genes, Pi-b and Pi-kh, were pyramided into MR219. Foreground selection coupled with stringent phenotypic selection identified 15 plants homozygous for the Pi-b and Pi-kh genes, and background selection revealed more than 95% genome recovery of MR219 in advanced blast resistant lines. Phenotypic screening against blast disease indicated that advanced homozygous blast resistant lines were strongly resistant against pathotype P7.2 in the blast disease endemic areas. The morphological, yield, grain quality, and yield-contributing characteristics were significantly similar to those of MR219. The newly developed blast resistant improved lines will retain the high adoptability of MR219 by farmers. The present results will also play an important role in sustaining the rice production of Malaysia. PMID:26734013

48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

Protease-Activated Receptor 4 (PAR4): A Promising Target for Antiplatelet Therapy.

Science.gov (United States)

Rwibasira Rudinga, Gamariel; Khan, Ghulam Jilany; Kong, Yi

2018-02-14

Cardiovascular diseases (CVDs) are currently among the leading causes of death worldwide. Platelet aggregation is a key cellular component of arterial thrombi and major cause of CVDs. Protease-activated receptors (PARs), including PAR1, PAR2, PAR3 and PAR4, fall within a subfamily of seven-transmembrane G-protein-coupled receptors (GPCR). Human platelets express PAR1 and PAR4, which contribute to the signaling transduction processes. In association with CVDs, PAR4 not only contributes to platelet activation but also is a modulator of cellular responses that serve as hallmarks of inflammation. Although several antiplatelet drugs are available on the market, they have many side effects that limit their use. Emerging evidence shows that PAR4 targeting is a safer strategy for preventing thrombosis and consequently may improve the overall cardiac safety profile. Our present review summarizes the PAR4 structural characteristics, activation mechanism, role in the pathophysiology of diseases and understanding the association of PAR4 targeting for improved cardiac protection. Conclusively, this review highlights the importance of PAR4 antagonists and its potential utility in different CVDs.

Innovation pour la santé des mères et des enfants d'Afrique | CRDI ...

International Development Research Centre (IDRC) Digital Library (Canada)

L'initiative Innovation pour la santé des mères et des enfants d'Afrique (ISMEA) cherche à améliorer la santé des mères, des nouveau-nés et des enfants en ... Cette initiative de 36 millions de dollars sur sept ans – financée conjointement par les Instituts de recherche en santé du Canada, Affaires mondiales Canada et le ...

Innovative culture in long-term care settings: the influence of organizational characteristics.

Science.gov (United States)

Nieboer, Anna P; Strating, Mathilde M H

2012-01-01

Innovative cultures have been reported to enhance the creation and implementation of new ideas and working methods in organizations. Although there is considerable research on the impact of organizational context on the innovativeness of organizations, the same is not the case for research on the organizational characteristics responsible for an innovative culture in (long-term) care settings. The aim of this study was to identify organizational characteristics that explain innovative culture in the (long-term) care sector. A large cross-sectional study in Dutch long-term care-nursing homes and/or elderly homes, care organizations for the handicapped, and long-term mental health care organizations-was conducted. A total of 432 managers and care professionals in 37 organizations participated. The Group Innovation Inventory was used to measure innovative culture in long-term care organizations. Structural characteristics of the organization were centralization and formalization, environmental dynamism and competitiveness, internal and external exchange of information, leadership style, commitment to quality improvement, and the organization's innovative strategy. The determinants of an innovative culture were estimated with a two-level random-intercepts and fixed-slopes model. Multilevel regression models were used to account for the organizational clustering of individuals within the 37 care organizations. Environmental dynamism, job codification, formal external exchange of information, transformational leadership, commitment to quality, and an exploratory and exploitative innovation strategy were all significantly correlated with an innovative culture in the multivariate multilevel analysis; the other characteristics were not. The explained organizational- and individual-level variance was 52.5% and 49.2%, respectively. The results point to substantial differences in innovative cultures between and within care organizations that can, in part, be explained by

PAR1 activation affects the neurotrophic properties of Schwann cells.

Science.gov (United States)

Pompili, Elena; Fabrizi, Cinzia; Somma, Francesca; Correani, Virginia; Maras, Bruno; Schininà, Maria Eugenia; Ciraci, Viviana; Artico, Marco; Fornai, Francesco; Fumagalli, Lorenzo

2017-03-01

Protease-activated receptor-1 (PAR1) is the prototypic member of a family of four G-protein-coupled receptors that signal in response to extracellular proteases. In the peripheral nervous system, the expression and/or the role of PARs are still poorly investigated. High PAR1 mRNA expression was found in the rat dorsal root ganglia and the signal intensity of PAR1 mRNA increased in response to sciatic nerve transection. In the sciatic nerve, functional PAR1 receptor was reported at the level of non-compacted Schwann cell myelin microvilli of the nodes of Ranvier. Schwann cells are the principal population of glial cells of the peripheral nervous system which myelinate axons playing an important role during axonal regeneration and remyelination. The present study was undertaken in order to determine if the activation of PAR1 affects the neurotrophic properties of Schwann cells. Our results suggest that the stimulation of PAR1 could potentiate the Schwann cell ability to favour nerve regeneration. In fact, the conditioned medium obtained from Schwann cell cultures challenged with a specific PAR1 activating peptide (PAR1 AP) displays increased neuroprotective and neurotrophic properties with respect to the culture medium from untreated Schwann cells. The proteomic analysis of secreted proteins in untreated and PAR1 AP-treated Schwann cells allowed the identification of factors differentially expressed in the two samples. Some of them (such as macrophage migration inhibitory factor, matrix metalloproteinase-2, decorin, syndecan 4, complement C1r subcomponent, angiogenic factor with G patch and FHA domains 1) appear to be transcriptionally regulated after PAR1 AP treatment as shown by RT-PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

Protease-Activated Receptor 4 (PAR4: A Promising Target for Antiplatelet Therapy

Directory of Open Access Journals (Sweden)

Gamariel Rwibasira Rudinga

2018-02-01

Full Text Available Cardiovascular diseases (CVDs are currently among the leading causes of death worldwide. Platelet aggregation is a key cellular component of arterial thrombi and major cause of CVDs. Protease-activated receptors (PARs, including PAR1, PAR2, PAR3 and PAR4, fall within a subfamily of seven-transmembrane G-protein-coupled receptors (GPCR. Human platelets express PAR1 and PAR4, which contribute to the signaling transduction processes. In association with CVDs, PAR4 not only contributes to platelet activation but also is a modulator of cellular responses that serve as hallmarks of inflammation. Although several antiplatelet drugs are available on the market, they have many side effects that limit their use. Emerging evidence shows that PAR4 targeting is a safer strategy for preventing thrombosis and consequently may improve the overall cardiac safety profile. Our present review summarizes the PAR4 structural characteristics, activation mechanism, role in the pathophysiology of diseases and understanding the association of PAR4 targeting for improved cardiac protection. Conclusively, this review highlights the importance of PAR4 antagonists and its potential utility in different CVDs.

Update of the exploratory report Acrolein

NARCIS (Netherlands)

Slooff W; Bont PFH; Janus JA; Pronk MEJ; Ros JPM; ECO; PPCbv; ACT; LAE

1994-01-01

The report is an update of the exploratory report acrolein (Slooff et al., 1991) that served as a basis for the discussion during the exploratory meeting on acrolein in March 1992. The meeting supported the conclusion that priority should be given to the compartment air and to the risks to humans.

Low income product innovation

Directory of Open Access Journals (Sweden)

Maria Cecília Sobral

2008-10-01

Full Text Available At affluent markets, the literature on product development management tells us to aggregate value and technology, to differentiate products and to launch fast. And at the low-income markets? This exploratory research defines a popular product, characterizes and measures their markets in Brazil, and identifies innovation strategies for them. The results suggest that the effective strategic orientation differs from affluent markets. It includes: to enhance the auto service component; to identify and service the key functionalities to the targeted public; to standardize products and increase the production scale; to extend the product life cycle; to use convenient distribution and marketing channels; to build product images that have appeal in the popular market; to offer longer financing horizons with befittingly lower installments. Data came from market researches and general demographic census. General media published stories were used to identify companies and their strategies. And a few case studies allowed the authors a deeper exploration of the relevant themes.

Vote par sondage uniforme incorruptible

OpenAIRE

Blanchard , Nicolas

2016-01-01

International audience; Introduit en 2012 par David Chaum, le vote par sondage uniforme (random-sample voting) est un protocole de vote basé sur un choix d'une sous-population représentative , permettant de limiter les coûts tout en ayant de nombreux avantages, principalement lorsqu'il est couplé a d'autres techniques comme ThreeBallot. Nous analysons un problème de corruptibilité potentielle où les votants peuvent vendre leur vote au plus offrant et proposons une variation du protocole reméd...

I219V polymorphism in hMLH1 gene in patients affected with ulcerative colitis.

Science.gov (United States)

Vietri, Maria Teresa; Riegler, Gabriele; De Paola, Marialaura; Simeone, Serena; Boggia, Maria; Improta, Alessia; Parisi, Mariarita; Molinari, Anna Maria; Cioffi, Michele

2009-04-01

hMLH1 gene, lying on chromosome 3p21-23, is a key factor of the mismatch repair (MMR) complex, which amends DNA replication errors. MMR alterations are involved in the development of both hereditary and sporadic forms of colorectal carcinoma related to ulcerative colitis (UC). I219V Polymorphism is located on exon 8 of hMLH1 and provides an aminoacidic substitution of isoleucine to valine, on the protein codon 219. This may affect the speed and fidelity of protein synthesis because of a tRNA paucity or changes in the mRNA secondary structure. Most of the hereditary nonpolyposis colon cancer-associated missense mutations of hMLH1 cause structural changes of the amino- or carboxy-terminal regions, involving the domains that interact with ATP and hPMS2. In this study, we analyzed the hMLH1 I219V polymorphism frequency in colectomized patients with UC. Venous blood from 100 ulcerative patients and 97 apparently healthy subjects has been collected. Out of 100 patients affected with UC, 75 noncolectomized showed an alternating course of disease, while 25 did not respond to the common drugs, and underwent colectomy. Genotyping was performed by polymerase chain reaction and following enzymatic digestion by BccI. No significant differences were found between patients with UC and controls both for genotype and allele frequencies. However, our data show a significant association when colectomized and noncolectomized patients are compared. The frequencies of G homozygosity were 28% in colectomized and 10.7% in noncolectomized patients (p < 0.05, chi(2) = 4.4, Odds ratio = 3.3). The allele frequencies of allele A were 52% in colectomized and 68% in noncolectomized patients; while those of allele G were 48% and 32%, respectively. I219V polymorphism in hMLH1 could influence the clinical course of the disease and lead to resistance to therapy.

Designing and Validating a Model for Measuring Sustainability of Overall Innovation Capability of Small and Medium-Sized Enterprises

Directory of Open Access Journals (Sweden)

Mohd Nizam Ab Rahman

2015-01-01

Full Text Available The business environment is currently characterized by intensified competition at both the national and firm levels. Many studies have shown that innovation positively affect firms in enhancing their competitiveness. Innovation is a dynamic process that requires a continuous, evolving, and mastered management. Evaluating the sustainability of overall innovation capability of a business is a major means of determining how well this firm effectively and efficiently manages its innovation process. A psychometrically valid scale of evaluating the sustainability of overall innovation capability of a firm is still insufficient in the current innovation literature. Thus, this study developed a reliable and valid scale of measuring the sustainability of overall innovation capability construct. The unidimensionality, reliability, and several validity components of the developed scale were tested using the data collected from 175 small and medium-sized enterprises in Iran. A series of systematic statistical analyses were performed. Results of the reliability measures, exploratory and confirmatory factor analyses, and several components of validity tests strongly supported an eight-dimensional (8D scale of measuring the sustainability of overall innovation capability construct. The dimensions of the scale were strategic management, supportive culture and structure, resource allocation, communication and networking, knowledge and technology management, idea management, project development, and commercialization capabilities.

The double par locus of virulence factor pB171: DNA segregation is correlated with oscillation of ParA

DEFF Research Database (Denmark)

Ebersbach, G; Gerdes, K; Charbon, Gitte Ebersbach

2001-01-01

Prokaryotic plasmids and chromosomes encode partitioning (par) loci that segregate DNA to daughter cells before cell division. Recent database analyses showed that almost all known par loci encode an ATPase and a DNA-binding protein, and one or more cis-acting regions where the proteins act. All...

48 CFR 52.219-20 - Notice of Emerging Small Business Set-Aside.

Science.gov (United States)

2010-10-01

... Clauses 52.219-20 Notice of Emerging Small Business Set-Aside. As prescribed in 19.1008(b), insert the following provision: Notice of Emerging Small Business Set-Aside (JAN 1991) Offers or quotations under this acquisition are solicited from emerging small business concerns only. Offers that are not from an emerging...

48 CFR 52.219-7 - Notice of Partial Small Business Set-Aside.

Science.gov (United States)

2010-10-01

... Clauses 52.219-7 Notice of Partial Small Business Set-Aside. As prescribed in 19.508(d), insert the following clause: Notice of Partial Small Business Set-Aside (JUN 2003) (a) Definitions. Small business..., and qualified as a small business under the size standards in this solicitation. (b) General. (1) A...

The role of pars flaccida in human middle ear sound transmission.

Science.gov (United States)

Aritomo, H; Goode, R L; Gonzalez, J

1988-04-01

The role of the pars flaccida in middle ear sound transmission was studied with the use of twelve otoscopically normal, fresh, human temporal bones. Peak-to-peak umbo displacement in response to a constant sound pressure level at the tympanic membrane was measured with a noncontacting video measuring system capable of repeatable measurements down to 0.2 micron. Measurements were made before and after pars flaccida modifications at 18 frequencies between 100 and 4000 Hz. Four pars flaccida modifications were studied: (1) acoustic insulation of the pars flaccida to the ear canal with a silicone rubber baffle, (2) stiffening the pars flaccida with cyanoacrylate cement, (3) decreasing the tension of the pars flaccida with a nonperforating incision, and (4) perforation of the pars flaccida. All of the modifications (except the perforation) had a minimal effect on umbo displacement; this seems to imply that the pars flaccida has a minor acoustic role in human beings.

Implications of Reverse Innovation for Socio-Economic Sustainability: A Case Study of Philips China

Directory of Open Access Journals (Sweden)

Juan Shan

2016-06-01

Full Text Available The idea of reverse innovation, local innovation happening in emerging markets for the global market, has gained much academic and managerial attention in recent years. The purpose of this study is to understand how reverse innovation has successfully diffused into the product and market development strategies at Philips Inc., a prominent multinational company (MNC of the modern era. Furthermore, the study presents the success achieved by these innovations at both the domestic and global levels, along with their implications regarding socio-economic sustainability in emerging markets. In order to investigate the research questions, a case study of Philips China was conducted involving three product innovations that were found to be suitable examples of reverse innovation. After the study of extant literature on the topic, drawing from research databases, newspaper articles, and company press releases, five semi-structuredinterviews were conducted with key managers and a market practitioner to gain sufficient understanding for this exploratory study. Subsequent case analysis concludes that these innovations are examples of reverse innovation representing a new paradigm change in innovation flow. This flow of innovation from emerging markets to developed markets as confirmed by Corsi’s framework could potentially disrupt developed markets as well as contribute to ensure healthy living conditions for the population living in developing countries. If so, this represents a sustainable socio-economic change in-line with the United Nations' Sustainable Development Goal (SDG of “ensuring healthy lives and promoting well-being for all at all ages.” This is relevant as Philips aspires to be a prominent private sector player in achieving the above-stated goal by defeating non-communicable disease and strengthening local healthcare systems.

Cross-Cultural Management Learning through Innovative Pedagogy: An Exploratory Study of Globally Distributed Student Teams

Science.gov (United States)

Bartel-Radic, Anne; Moos, J. Chris; Long, Suzanna K.

2015-01-01

This article presents an innovative pedagogy based on student participation in globally distributed project teams. The study questions the link between student learning of intercultural competence and the global teaming experience. Data was collected from 115 students participating in 22 virtual intercultural teams. Results revealed that students…

18 CFR 430.11 - Advance notice of exploratory drilling.

Science.gov (United States)

2010-04-01

... exploratory drilling. 430.11 Section 430.11 Conservation of Power and Water Resources DELAWARE RIVER BASIN... exploratory drilling. The Commission encourages consultation with any project sponsor who is considering... project and prior to initiation of exploratory drilling. (a) Any person, firm corporation or other entity...

Movement and equipositioning of plasmids by ParA filament disassembly

DEFF Research Database (Denmark)

Ringgaard, Simon; van Zon, Jeroen; Howard, Martin

2009-01-01

, plasmids consistently migrate behind disassembling ParA cytoskeletal structures, suggesting that ParA filaments pull plasmids by depolymerization. The perpetual cycles of ParA assembly and disassembly result in continuous relocation of plasmids, which, on time averaging, results in equidistribution...

Open innovations, innovation communities and firm's innovative activities

Directory of Open Access Journals (Sweden)

Getejanc Vesna

2016-01-01

Full Text Available The open innovation paradigm emphasizes the fact that firms can improve their performance by opening their business models and reduce their R&D costs by effective incorporation of external knowledge. In other words, companies are able to capture value through knowledge that exists outside the boundaries of their organization. The shift from closed to open model of innovation has imposed the necessity to adopt more open approach to innovation within traditional academic view of business strategy. The adoption of this innovative approach is emphasized even more, by the necessity for stronger connection and cooperation among the participants of the innovation process. Free will and collaboration are the main characteristics of open source software, which is recognized in literature as the role model of open innovation and is a rapidly growing method of technology development. Furthermore, innovative communities represent a great opportunity for improvement of the companies' innovation activities, since they have become an important source for identifying the needs and problems of the users. Their development has been fostered by information technologies and recent social changes in user behavior. Recognizing and better understanding the motivation of the members of the innovation communities that guide them to participate in the process of idea generation, can have significant influence on their incorporation within the innovation process. Equally important is to define the incentives that are suited for stimulating and fostering innovative user activities. Taking this topic in consideration, the purpose of this article is to address the following questions: In what way does the collaboration in open source software projects have positive effect on companies' innovation performance? What are the innovation communities and how can companies establish successful interaction with them? Why does the interaction with innovation communities lead to

PAR-1 contributes to the innate immune response during viral infection

Science.gov (United States)

Antoniak, Silvio; Owens, A. Phillip; Baunacke, Martin; Williams, Julie C.; Lee, Rebecca D.; Weithäuser, Alice; Sheridan, Patricia A.; Malz, Ronny; Luyendyk, James P.; Esserman, Denise A.; Trejo, JoAnn; Kirchhofer, Daniel; Blaxall, Burns C.; Pawlinski, Rafal; Beck, Melinda A.; Rauch, Ursula; Mackman, Nigel

2013-01-01

Coagulation is a host defense system that limits the spread of pathogens. Coagulation proteases, such as thrombin, also activate cells by cleaving PARs. In this study, we analyzed the role of PAR-1 in coxsackievirus B3–induced (CVB3-induced) myocarditis and influenza A infection. CVB3-infected Par1–/– mice expressed reduced levels of IFN-β and CXCL10 during the early phase of infection compared with Par1+/+ mice that resulted in higher viral loads and cardiac injury at day 8 after infection. Inhibition of either tissue factor or thrombin in WT mice also significantly increased CVB3 levels in the heart and cardiac injury compared with controls. BM transplantation experiments demonstrated that PAR-1 in nonhematopoietic cells protected mice from CVB3 infection. Transgenic mice overexpressing PAR-1 in cardiomyocytes had reduced CVB3-induced myocarditis. We found that cooperative signaling between PAR-1 and TLR3 in mouse cardiac fibroblasts enhanced activation of p38 and induction of IFN-β and CXCL10 expression. Par1–/– mice also had decreased CXCL10 expression and increased viral levels in the lung after influenza A infection compared with Par1+/+ mice. Our results indicate that the tissue factor/thrombin/PAR-1 pathway enhances IFN-β expression and contributes to the innate immune response during single-stranded RNA viral infection. PMID:23391721

48 CFR 52.219-6 - Notice of Total Small Business Set-Aside.

Science.gov (United States)

2010-10-01

... Clauses 52.219-6 Notice of Total Small Business Set-Aside. As prescribed in 19.508(c), insert the following clause: Notice of Total Small Business Set-Aside (JUN 2003) (a) Definition. Small business concern... qualified as a small business under the size standards in this solicitation. (b) General. (1) Offers are...

Analysis of Innovation and Its Environmental Impacts on the Chemical Industry

Directory of Open Access Journals (Sweden)

Dusan Schreiber

2016-01-01

Full Text Available Globalization of the economy and the need to achieve competitiveness drive organizations to invest in technology and in innovation, in order to find solutions that will provide advantages in an ever-more competitive market. The conflict between dwindling natural resources and the demand for economic growth has created a growing need to find means for making environmental conservation compatible with economic growth. The objective of this study is to contribute to the debate by analyzing the innovations implemented by chemical companies in the Sinos Valley region, Rio Grande do Sul, Brazil, and by identifying the motivations that drive them to develop environmental technologies. The study is exploratory and descriptive, with a quantitative data collection component in the form of a survey sent to all chemical companies in the Sinos Valley region, listed in a local business association database. The study results indicate that development of innovations is predominantly of an incremental nature and that novelty is generally restricted to the new-for-firm level. The environmental technologies implemented are generally designed to prevent or remedy environmental damage and are primarily motivated by the need to comply with environmental standards and legislation.

The Case For Corporate Responsibility: An Exploratory Study

Directory of Open Access Journals (Sweden)

Lucy da Piedade

2006-11-01

Full Text Available Stakeholder demands and the introduction of the ‘triple bottom line’ as a means of reporting corporate performance, make it critical that South African companies assess why they should undertake corporate responsibility initiatives. This exploratory study (part two of a two-part study investigated the issues that are being or should be addressed by companies under the banner of corporate responsibility and the reasons for this. The views of a convenience snowball sample of consultants, academics and practitioners of corporate responsibility, was gained by means of a Delphi technique. Content analysis was employed to categorise the views into themes. The findings indicate the need for corporate responsibility action in the areas of ecology, the environment, health and well-being, building human capital and in the encouragement of economic development. Cost benefit and defensive arguments dominate the case for corporate responsibility. There is little indication that organisations have identified the opportunity of corporate responsibility initiatives to increase innovation and organisational learning and its contribution to risk management. Recommendations are made regarding the assessment of investment in this area.

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...

Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik

Peptide-Based Optical uPAR Imaging for Surgery

DEFF Research Database (Denmark)

Juhl, Karina; Christensen, Anders; Persson, Morten

2016-01-01

Near infrared intra-operative optical imaging is an emerging technique with clear implications for improved cancer surgery by enabling a more distinct delineation of the tumor margins during resection. This modality has the potential to increase the number of patients having a curative radical...... tumor resection. In the present study, a new uPAR-targeted fluorescent probe was developed and the in vivo applicability was evaluated in a human xenograft mouse model. Most human carcinomas express high level of uPAR in the tumor-stromal interface of invasive lesions and uPAR is therefore considered...... an ideal target for intra-operative imaging. Conjugation of the flourophor indocyanine green (ICG) to the uPAR agonist (AE105) provides an optical imaging ligand with sufficiently high receptor affinity to allow for a specific receptor targeting in vivo. For in vivo testing, human glioblastoma xenograft...

DIŞ ÇEVRE VE BİREYSEL GÜÇ ODAKLI STRATEJİ GELİŞTİRME SÜREÇLERİNİN ARAŞTIRMACI VE FIRSATÇI YENİLİKÇİLİK ÜZERİNDEKİ ETKİSİ-THE IMPACT OF ENFORCED CHOICE AND COMMAND STRATEGY DEVELOPMENT PROCESSES ON EXPLORATORY AND EXPLOITATIVE INNOVATIVENESS

Directory of Open Access Journals (Sweden)

İbrahim PINAR

2012-06-01

strategy development processes which occur in organizations, it is widely understood that strategy development is multidimensional in nature. In an organization, innovation may emerge in two different forms; either upgrading the existing products, services and processes (exploitative innovation, or inventing totally new and different products, services and processes (exploratory innovation. In this study, the relationship between strategy development processes and innovation forms was examined on a sample of 246 companies. Alpha coefficients were calculated to ensure the reliability of the scales and factor analysis yielded two factors, exploratory and exploitative innovativeness, which fit the theory. Regression analysis was also used in order to test the hypotheses. Whilst the results revealed a negative effect between the command type of strategy development process on both exploitative and exploratory innovation forms, no relationship between the enforced choice type of strategy development process and innovation forms was found.

48 CFR 1852.219-77 - NASA Mentor-Protégé Program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NASA Mentor-ProtégÃ... and Clauses 1852.219-77 NASA Mentor-Protégé Program. As prescribed in 1819.7215, insert the following clause: NASA Mentor-Protégé Program (MAY 2009) (a) Prime contractors are encouraged to participate in the...

48 CFR 752.219-70 - USAID Mentor-Protégé Program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false USAID Mentor-ProtégÃ....219-70 USAID Mentor-Protégé Program. As prescribed in 719.273-11(a), insert the following provision: USAID Mentor-Protégé Program (July 13, 2007) (a) Large and small business are encouraged to participate...

48 CFR 552.219-75 - GSA Mentor-Protégé Program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false GSA Mentor-ProtégÃ....219-75 GSA Mentor-Protégé Program. As prescribed in 519.7017(a), insert the following clause: GSA Mentor-ProtéGé Program (SEP 2009) (a) Prime contractors, including small businesses, are encouraged to...

Dynamic Filament Formation by a Divergent Bacterial Actin-Like ParM Protein.

Directory of Open Access Journals (Sweden)

Anthony J Brzoska

Full Text Available Actin-like proteins (Alps are a diverse family of proteins whose genes are abundant in the chromosomes and mobile genetic elements of many bacteria. The low-copy-number staphylococcal multiresistance plasmid pSK41 encodes ParM, an Alp involved in efficient plasmid partitioning. pSK41 ParM has previously been shown to form filaments in vitro that are structurally dissimilar to those formed by other bacterial Alps. The mechanistic implications of these differences are not known. In order to gain insights into the properties and behavior of the pSK41 ParM Alp in vivo, we reconstituted the parMRC system in the ectopic rod-shaped host, E. coli, which is larger and more genetically amenable than the native host, Staphylococcus aureus. Fluorescence microscopy showed a functional fusion protein, ParM-YFP, formed straight filaments in vivo when expressed in isolation. Strikingly, however, in the presence of ParR and parC, ParM-YFP adopted a dramatically different structure, instead forming axial curved filaments. Time-lapse imaging and selective photobleaching experiments revealed that, in the presence of all components of the parMRC system, ParM-YFP filaments were dynamic in nature. Finally, molecular dissection of the parMRC operon revealed that all components of the system are essential for the generation of dynamic filaments.

First (18)F-labeled ligand for PET imaging of uPAR

DEFF Research Database (Denmark)

Persson, Morten; Liu, Hongguang; Madsen, Jacob

2013-01-01

Urokinase-type plasminogen activator receptor (uPAR) is overexpressed in human prostate cancer and uPAR has been found to be associated with metastatic disease and poor prognosis. AE105 is a small linear peptide with high binding affinity to uPAR. We synthesized an N-terminal NOTA......-conjugated version (NOTA-AE105) for development of the first (18)F-labeled uPAR positron-emission-tomography PET ligand using the Al(18)F radiolabeling method. In this study, the potential of (18)F-AlF-NOTA-AE105 to specifically target uPAR-positive prostate tumors was investigated....

The Emergence of Inclusive Exploratory Talk in Primary Students' Peer Interaction

Science.gov (United States)

Rajala, Antti; Hilppo, Jaakko; Lipponen, Lasse

2012-01-01

In this study, we examine a prominent type of classroom talk, exploratory talk, in primary school peer interactions. Exploratory talk has been shown to be productive in facilitating problem solving and fostering school achievement. However, within the growing body of research concerning exploratory talk, the relation between exploratory talk and…

Narrative Identities and the Plebiscite in Pará: An Analysis of the Front Pages for O Liberal and Diário do Pará

Directory of Open Access Journals (Sweden)

Alda Cristina Silva da Costa

2017-05-01

Full Text Available On December 11, 2011, a plebiscite was held in Pará proposing to create two separatist states, Carajás and Tapajós, out of the state of Pará. The public voted against both projects. This article analyzes the narrative identities found on the front pages of O Liberal and Diário do Pará newspapers about the plebiscite in Pará. Depth Hermeneutics (DH, as proposed by Thompson (2011, was used as the methodological reference. DH emphasizes the object of analysis as a meaningful symbolic construction requiring interpretation. Narrative analysis, as proposed by Motta (2007, was the main research technique used to highlight the movement of construction of journalistic (discursive characters. The narrative identities built by the two newspapers showed that both were against the creation of the new states, but for very different reasons. The flag of Pará was the main object used to induce the idea of unity. Em 11 de dezembro de 2011, o plebiscito no Pará propôs a criação dos estados de Carajás e de Tapajós a partir da divisão do estado do Pará. O resultado da consulta pública foi negativo aos dois projetos. O artigo analisa as identidades narrativas constituídas pelas primeiras páginas dos jornais O Liberal e Diário do Pará sobre o plebiscito no Pará. Utilizou-se como referencial metodológico a Hermenêutica em Profundidade (HP, proposta por Thompson (2011. A HP evidencia o fato de que o objeto de análise é uma construção simbólica significativa, que exige uma interpretação. Como principal técnica de pesquisa, a análise narrativa, proposta por Motta (2007, com ênfase no movimento de construção de personagens jornalísticas (discursivas. As identidades narrativas construídas pelos dois jornais indicaram que ambos eram contrários à criação dos novos estados, porém por motivos divergentes. A bandeira do Pará foi o principal elemento utilizado para evocar a ideia de unidade. En 11 de diciembre de 2011, el plebiscito en

Limnological database for Par Pond: 1959 to 1980

International Nuclear Information System (INIS)

Tilly, L.J.

1981-03-01

A limnological database for Par Pond, a cooling reservoir for hot reactor effluent water at the Savannah River Plant, is described. The data are derived from a combination of research and monitoring efforts on Par Pond since 1959. The approximately 24,000-byte database provides water quality, primary productivity, and flow data from a number of different stations, depths, and times during the 22-year history of the Par Pond impoundment. The data have been organized to permit an interpretation of the effects of twenty years of cooling system operations on the structure and function of an aquatic ecosystem

Soluble urokinase plasminogen activator receptor (suPAR) in acute care

DEFF Research Database (Denmark)

Rasmussen, Line Jee Hartmann; Ladelund, Steen; Haupt, Thomas Huneck

2016-01-01

for age, sex, Charlson score and C reactive protein. Area under the curve for receiver operating characteristics curve analysis of suPAR for 30-day mortality was 0.84 (95% CI 0.81 to 0.86). Furthermore, in the entire cohort, women had slightly higher suPAR compared with men, and suPAR was associated...

From strategy to action: how top managers' support increases middle managers' commitment to innovation implementation in health care organizations.

Science.gov (United States)

Birken, Sarah A; Lee, Shoou-Yih Daniel; Weiner, Bryan J; Chin, Marshall H; Chiu, Michael; Schaefer, Cynthia T

2015-01-01

Evidence suggests that top managers' support influences middle managers' commitment to innovation implementation. What remains unclear is how top managers' support influences middle managers' commitment. Results may be used to improve dismal rates of innovation implementation. We used a mixed-method sequential design. We surveyed (n = 120) and interviewed (n = 16) middle managers implementing an innovation intended to reduce health disparities in 120 U.S. health centers to assess whether top managers' support directly influences middle managers' commitment; by allocating implementation policies and practices; or by moderating the influence of implementation policies and practices on middle managers' commitment. For quantitative analyses, multivariable regression assessed direct and moderated effects; a mediation model assessed mediating effects. We used template analysis to assess qualitative data. We found support for each hypothesized relationship: Results suggest that top managers increase middle managers' commitment by directly conveying to middle managers that innovation implementation is an organizational priority (β = 0.37, p = .09); allocating implementation policies and practices including performance reviews, human resources, training, and funding (bootstrapped estimate for performance reviews = 0.09; 95% confidence interval [0.03, 0.17]); and encouraging middle managers to leverage performance reviews and human resources to achieve innovation implementation. Top managers can demonstrate their support directly by conveying to middle managers that an initiative is an organizational priority, allocating implementation policies and practices such as human resources and funding to facilitate innovation implementation, and convincing middle managers that innovation implementation is possible using available implementation policies and practices. Middle managers may maximize the influence of top managers' support on their commitment by communicating with top

The Exploratory Modeling Workbench : An open source toolkit for exploratory modeling, scenario discovery, and (multi-objective) robust decision making

NARCIS (Netherlands)

Kwakkel, J.H.

2017-01-01

There is a growing interest in model-based decision support under deep uncertainty, reflected in a variety of approaches being put forward in the literature. A key idea shared among these is the use of models for exploratory rather than predictive purposes. Exploratory modeling aims at exploring

CRITICAL SUCCESS FACTORS IN THE SOFTWARE INDUSTRY AND THEIR RELATION WITH STRATEGIC BUSINESS ORIENTATION: AN EMPIRICAL-EXPLORATORY STUDY

Directory of Open Access Journals (Sweden)

Manuel Rodenes Adam

2007-05-01

Full Text Available This article presents the results of an empirical-exploratory study applied to companies of the Software Industry (IndSw sector. One of the objectives pursued was to know the Critical Success Factors (CSF of the SWInd and their relation with the business strategic orientation. The CSF identified and analyzed were: Government Support, Human Capital, Marketing, Quality and Innovation. The research results reveal that it is possible to identify the existence of at least two main groups of strategic orientation (cost and differentiation within this sector. The analysis of the relation between business strategic orientation and the CSF emphasizes the following CSF: Human Capital, Quality and Innovation, the remaining factors present a little significant relation. The empirical study was made through multivariate analysis techniques. The analysis of results is based on data collected through the application of a web survey (Internet to Mexican software companies. The survey was applied in July 2005.

48 CFR 852.219-71 - VA mentor-protégé program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false VA mentor-protégÃ....219-71 VA mentor-protégé program. As prescribed in 819.7115(a), insert the following clause: VA Mentor-Protégé Program (DEC 2009) (a) Large businesses are encouraged to participate in the VA Mentor-Protégé...

48 CFR 3052.219-71 - DHS mentor-protégé program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false DHS mentor-protégÃ... CONTRACT CLAUSES Text of Provisions and Clauses 3052.219-71 DHS mentor-protégé program. As prescribed in (HSAR) 48 CFR 3019.708-70(b), insert the following clause: DHS Mentor-Protégé Program (JUN 2006) (a...

Can Entrepreneurial Thinking Help Innovation in Established Mature Technology Corporations? An Exploratory Study in a Power Sector Multinational Firm

OpenAIRE

Weber, Thomas Karl-Heinz

2012-01-01

Just like nature, also technologies and industries, products and companies go through life cycles -- from 'birth' through maturity to 'death'. Innovativeness gives birth to new technologies and products, and innovation is written on the (business) storybook of many entrepreneurial undertakings and ventures. Those again appear habitually as starting or turning points in company and industry pedigrees. Further down the road, companies achieve maturity by managing consistently production and del...

Intact and cleaved uPAR forms: diagnostic and prognostic value in cancer

DEFF Research Database (Denmark)

Rasch, M.G.; Lund, I.K.; Hoyer-Hansen, G.

2008-01-01

identified in tissue and body fluids. It is well-established, that the total amount of all uPAR forms is a strong prognostic marker in different types of cancer. Using immunoassays, measuring the individual uPAR forms, has revealed that the cleaved uPAR forms are even stronger prognostic markers and have...... diagnostic utility. This review will focus on the mechanism of uPAR cleavage and the functional consequences, as well as the clinical applicability of cleaved uPAR forms Udgivelsesdato: 2008...

Innovation in the plural of the alpine cre-actors

Directory of Open Access Journals (Sweden)

Andréa Finger-Stich

2009-06-01

Full Text Available The capacity to innovate for a sustainable development of alpine territories cannot depend only on economic, legal and political conditions defined by the State at national and international levels. It depends also on local conditions that situate historically and geographically the actors in a continuity of social and ecological relationships. This approach highlights the collective – thus organisational – dimensions of the innovation process, including the imagination, the development, the implementation and even the diffusion of a new practice. Our point of view is that for contributing to the sustainable development of the Alps, innovations need to change the ecological, political, social and cultural relationships engaging the actors in these territories. This change affects as much the object territory as the subject actor of the territory. This is why innovating in the Alps means also innovating the Alps and the alpine actors (Cosalp, 2008. Based on a research about local people’s participation in the management of alpine communal forests, the article shows the importance of local interactions involving actors of diverse occupation, gender, age and origins1.La capacité d’innovation pour un développement durable des territoires alpins ne peut dépendre uniquement de conditions économiques, légales et politiques définies par les Etats aux échelles nationale et internationale. Elle dépend aussi de conditions locales, qui situent historiquement et géographiquement les acteurs dans une continuité de relations sociales et écologiques. Cette perspective accentue l’importance de la dimension collective, donc organisationnelle, du processus d’innovation, allant de l’imagination, puis au développement, à la réalisation – voire la diffusion – d’une nouvelle pratique. Le point de vue de cet article est qu’une innovation, pour contribuer au développement durable des Alpes, doit changer les relations �

L’innovation au pluriel des cré-acteurs alpins

Directory of Open Access Journals (Sweden)

Andréa Finger-Stich

2009-06-01

Full Text Available La capacité d’innovation pour un développement durable des territoires alpins ne peut dépendre uniquement de conditions économiques, légales et politiques définies par les Etats aux échelles nationale et internationale. Elle dépend aussi de conditions locales, qui situent historiquement et géographiquement les acteurs dans une continuité de relations sociales et écologiques. Cette perspective accentue l’importance de la dimension collective, donc organisationnelle, du processus d’innovation, allant de l’imagination, puis au développement, à la réalisation – voire la diffusion – d’une nouvelle pratique. Le point de vue de cet article est qu’une innovation, pour contribuer au développement durable des Alpes, doit changer les relations écologique, politique, sociale et culturelle, qui engagent les acteurs du territoire. Ce changement affecte tant l’objet territoire que le sujet acteur du territoire. C’est pourquoi, innover dans les Alpes revient aussi à innover les Alpes et les acteurs alpins(Cosalp, 2008. Sur la base d’une recherche sur la participation des populations locales dans la gestion de forêts communales alpines, l’article relève l’importance des interactions locales impliquant les acteurs d’occupations, genres, âges et origines divers1.The capacity to innovate for a sustainable development of alpine territories cannot depend only on economic, legal and political conditions defined by the State at national and international levels. It depends also on local conditions that situate historically and geographically the actors in a continuity of social and ecological relationships. This approach highlights the collective - thus organisational - dimensions of the innovation process, including the imagination, the development, the implementation and even the diffusion of a new practice. Our point of view is that for contributing to the sustainable development of the Alps, innovations need to

Exploratory research and development FY90

International Nuclear Information System (INIS)

Struble, G.L.; Middleton, C.; Baldwin, G.; Cherniak, J.; Clements, W.; Donohue, M.L.; Francke, A.; Kirvel, R.D.; MacGregor, P.; Shaw, G.

1990-01-01

In general, the Exploratory Research and Development (ER ampersand D) Program supports research projects considered too basic or long-range to be funded by other Lawrence Livermore National Laboratory (LLNL) programs. This Program is managed for the Laboratory Director by a special assistant who chairs the LLNL's IR ampersand D Review Committee. Membership in the Review Committee comprises senior LLNL scientists, engineers, and managers whose areas of expertise span the range of scientific disciplines pursued at the Laboratory. The research supported by the Program falls into three categories: Exploratory Research in the Disciplines, Director's Initiatives, and Laboratory-Wide Competition. The first two, Exploratory Research and Director's Initiatives, promote pioneering work in the various scientific disciplines and programmatic areas. Laboratory departments and divisions propose and manage projects in the Exploratory Research category. The Laboratory Director, with the advice of the Review Committee, selects several larger projects to fund as Director's Initiative. These projects, which are proposed and managed by the responsible associate director, are intended to enhance the scope of existing programs or establish new technical directions and programs for the Laboratory. All FY90 projects are described in detail in this report. Other publications on ER ampersand D projects are included in the Publications List at the back of this report

Book of short papers : International symposium on convective heat and mass transfer in sustainable energy Conv - 09. Volume 1

International Nuclear Information System (INIS)

2009-01-01

This book contains the short papers from the International Symposium on Convective heat and Mass Transfer in sustainable Energy ( Conv-09), organized on behalf of the International Centre for Heat and Mass Transfer, it was held on April 26- 1st May, In Hammamet, Tunisia. The objective of this conference is to bring together researchers in a forum to exchange innovative ideas, methods and results, and visions of the future related to the general theme of convective heat and mass transfer

Book of short papers : International symposium on convective heat and mass transfer in sustainable energy conv - 09. Volume 2

International Nuclear Information System (INIS)

2009-01-01

This book contains the short papers from the International Symposium on convective heat and Mass Transfer in sustainable Energy ( conv-09), organized on behalf of the International Centre for Heat and Mass Transfer, it was held on April 26- 1st May, In Hammamet, Tunisia. The objective of this conference is to bring together researchers in a forum to exchange innovative ideas, methods and results, and visions of the future related to the general theme of convective heat and mass transfer

Trenching as a exploratory method

International Nuclear Information System (INIS)

Hatheway, A.W.; Leighton, F.B.

1979-01-01

The critical nature of siting nuclear power plants has led to increased emphasis on exploratory methods; it permits inspection of a continuous geologic section by both geologists and regulatory authorities and makes possible the preparation of a graphic log that delineates both obvious and subtle geologic features. About one of every two nuclear plant licensing efforts utilizes exploratory trenching. Many geologic hazards, such as ''capable'' faults, can be detected from trench exposures; they may otherwise remain undetected. Trenches must be judiciously located, survey-controlled, excavated safetly and adequately shored, logged in detail, and properly diagnosed. Useful techniques of trench logging include thorough cleaning of the trench walls, teamwork between geologist and recorder, logging against a carefully surveyed baseline and vertical reference grid, and panoramic photography. Soils, including paleosols, and glacial and glaciofluvial deposits present some of the most difficult media to log. Trench logs must be thoroughly interpreted and correlated so that they document the geologic conditions governing suitability of the site. Age-determination techniques utilized in exploratory trenching include petrographic analyses, quartz inclusion studies, clay mineralogic analyses, and radiometric methods

Afecções podais em vacas da bacia leiteira de Rondon do Pará Foot disorders in cows from basin milk of Rondon do Pará

Directory of Open Access Journals (Sweden)

José Alcides S. Silveira

2009-11-01

Full Text Available As doenças digitais estão entre as principais causas de performance reduzida de rebanhos leiteiros. Com o objetivo de determinar a prevalência, classificar clinicamente e estabelecer os fatores epidemiológicos das enfermidades podais em vacas da bacia leiteira de Rondon do Pará, foram avaliadas 1.236 vacas, das quais 275 apresentaram pelo menos um tipo de lesão podal. Identificou-se 655 lesões, o que resultou em uma prevalência de 22,25%. As enfermidades mais frequentes foram hiperplasia interdigital (80,92%, necrobacilose interdigital (6,11% e cascos com crescimento excessivo (6,42%. Os membros pélvicos foram os mais acometidos (61,83% e o espaço interdigital, tanto nos membros torácicos (36,34%, quanto nos pélvicos (48,09%, a região digital acometida com maior frequência. O estudo epidemiológico mostrou que características ambientais tais como relevo montanhoso, pastagem em formação com presença de troncos e galhos de árvores, irregularidades nos pisos dos currais, presença de piçarra e lama podem favorecer o aparecimento das lesões podais. Constatou-se a ausência de medidas de controle e profilaxia de afecções que acometem os cascos em 95,5% das propriedades estudadas. O exame clínico específico do casco foi eficiente no diagnóstico das enfermidades.Foot diseases are some of the main causes of low performance in dairy cows. In order to determine the prevalence, clinical classification and to establish the epidemio-logical factors of foot diseases in cows from basin milk of Rondon do Pará, 1,236 cows were evaluated and 275 had at least one type of foot injury. A total of 655 lesions was showed which a prevalence of 22.25%. Most frequent lesions were interdigital hyperplasia (80.92%, claw overgrowth (6.42%, and interdigital necrobacillosis (6.11%. Hind limbs were most frequently affected (61.83%, and lesions affecting the interdigital space were the most common in both the thoracic (36.34% and hind limbs (48.09

A Bipolar Spindle of Antiparallel ParM Filaments Drives Bacterial Plasmid Segregation

DEFF Research Database (Denmark)

Gayathri, P; Fujii, T; Møller-Jensen, Jakob

2012-01-01

the spindle between ParRC complexes on sister plasmids. Using a combination of structural work and total internal reflection fluorescence microscopy, we show that ParRC bound and could accelerate growth at only one end of polar ParM filaments, mechanistically resembling eukaryotic formins. The architecture...... of ParM filaments enabled two ParRC-bound filaments to associate in an antiparallel orientation, forming a bipolar spindle. The spindle elongated as a bundle of at least two antiparallel filaments, thereby pushing two plasmid clusters toward the poles....

Exploratory behaviour, emotional wellbeing and childcare quality in preschool education

Directory of Open Access Journals (Sweden)

Alexander Barandiaran

2015-05-01

Full Text Available The aim of this study was to examine the relationship between children exploratory behaviour and the quality of structural childcare and process in preschools. The study also examined how childcare quality affects the relationship between emotional wellbeing and exploratory behaviour. The sample comprised 206 children from 40 classrooms in 20 preschools, together with their teachers. The children's age ranged between 37 and 64 months (M = 50.96, SD = 6.54. The results indicated that children cared for by more sensitive teachers engaged in more exploratory behavior. However, no moderating effect was found of teacher sensitivity on the positive relationship between exploratory behavior and wellbeing. Finally, some factors linked to the quality of structural childcare also influenced exploratory behavior, although to a lesser extent.

PAR-2 expression in the gingival crevicular fluid reflects chronic periodontitis severity

Directory of Open Access Journals (Sweden)

Henrique FUKUSHIMA

Full Text Available Abstract Recent studies investigating protease-activated receptor type 2 (PAR-2 suggest an association between the receptor and periodontal inflammation. It is known that gingipain, a bacterial protease secreted by the important periodontopathogen Porphyromonas gingivalis can activate PAR-2. Previous studies by our group found that PAR-2 is overexpressed in the gingival crevicular fluid (GCF of patients with moderate chronic periodontitis (MP. The present study aimed at evaluating whether PAR-2 expression is associated with chronic periodontitis severity. GCF samples and clinical parameters, including plaque and bleeding on probing indices, probing pocket depth and clinical attachment level, were collected from the control group (n = 19 at baseline, and from MP patients (n = 19 and severe chronic periodontitis (SP (n = 19 patients before and 6 weeks after periodontal non-surgical treatment. PAR-2 and gingipain messenger RNA (mRNA in the GCF of 4 periodontal sites per patient were evaluated by Reverse Transcription Polymerase Chain Reaction (RT-qPCR. PAR-2 and gingipain expressions were greater in periodontitis patients than in control group patients. In addition, the SP group presented increased PAR-2 and gingipain mRNA levels, compared with the MP group. Furthermore, periodontal treatment significantly reduced (p <0.05 PAR-2 expression in patients with periodontitis. In conclusion, PAR-2 is associated with chronic periodontitis severity and with gingipain levels in the periodontal pocket, thus suggesting that PAR-2 expression in the GCF reflects the severity of destruction during periodontal infection.

Energy autonomy in Le Mené: A French case of grassroots innovation

International Nuclear Information System (INIS)

Yalçın-Riollet, Melike; Garabuau-Moussaoui, Isabelle; Szuba, Mathilde

2014-01-01

Local citizen-led initiatives relating to energy are developing strongly in Anglo-Saxon countries and a growing body of research is examining their innovative potential. In France, similar grassroots initiatives – albeit with certain specificities – only began to emerge recently and so far, very few studies have dealt with them. The purpose of this article is to propose an exploratory and in-depth analysis of one advanced French case: Le Mene', a pioneer in local energy autonomy. We examine the conditions under which the initiative emerged and the processes through which a grassroots innovation is formed. In studying this case (interviews, analysis of documents), comparing it with other sources of data (expert interviews, comparative observation of other initiatives) and taking stock of various social sciences studies, we show that a social innovation was produced in Le Mene' through the hybridisation of actors, sociotechniques and discourses. This initiative was innovative not only in terms of the scope of the mechanisms implemented, but also in terms of the social organisation behind the development of the projects and the capacity to use energy production as a social resource. Finally, we reflect on the possible diffusion of these grassroots initiatives and their policy implications in France. - Highlights: • The case study is the Le Mené, a pioneer case for local energy autonomy. • This case is an emerging grassroots innovation in France. • Hybridisation (combining diversity and frames) is at the centre of the innovation. • This study focuses on the hybridisation of actors, sociotechniques and discourses. • Examines the potential diffusion of grassroots initiatives in France

An Exploratory Investigation of Teaching Innovations and Learning Factors in a Lean Manufacturing Systems Engineering Course

Science.gov (United States)

Choomlucksana, Juthamas; Doolen, Toni L.

2017-01-01

The use of collaborative activities and simulation sessions in engineering education has been explored previously. However, few studies have investigated the relationship of these types of teaching innovations with other learner characteristics, such as self-efficacy and background knowledge. This study explored the effects of collaborative…

Structures of actin-like ParM filaments show architecture of plasmid-segregating spindles.

Science.gov (United States)

Bharat, Tanmay A M; Murshudov, Garib N; Sachse, Carsten; Löwe, Jan

2015-07-02

Active segregation of Escherichia coli low-copy-number plasmid R1 involves formation of a bipolar spindle made of left-handed double-helical actin-like ParM filaments. ParR links the filaments with centromeric parC plasmid DNA, while facilitating the addition of subunits to ParM filaments. Growing ParMRC spindles push sister plasmids to the cell poles. Here, using modern electron cryomicroscopy methods, we investigate the structures and arrangements of ParM filaments in vitro and in cells, revealing at near-atomic resolution how subunits and filaments come together to produce the simplest known mitotic machinery. To understand the mechanism of dynamic instability, we determine structures of ParM filaments in different nucleotide states. The structure of filaments bound to the ATP analogue AMPPNP is determined at 4.3 Å resolution and refined. The ParM filament structure shows strong longitudinal interfaces and weaker lateral interactions. Also using electron cryomicroscopy, we reconstruct ParM doublets forming antiparallel spindles. Finally, with whole-cell electron cryotomography, we show that doublets are abundant in bacterial cells containing low-copy-number plasmids with the ParMRC locus, leading to an asynchronous model of R1 plasmid segregation.

Comment est abordée la question de l’innovation dans les sciences sociales ?

Directory of Open Access Journals (Sweden)

Jean Corneloup

2009-07-01

Full Text Available Si l’innovation est devenue aujourd’hui une notion d’actualité tant elle apparaît comme fondamentale pour penser l’économie et l’adaptation de notre société à son projet de développement, reste à en définir les caractéristiques et les principes. Si le XXe siècle a été marqué par des changements importants sur un plan technologique, politique, économique ou encore culturel, l’époque actuelle semble redoubler d’efforts pour imposer l’innovation comme moteur du développement de la société. Reste alors à comprendre la manière dont cette question est abordée actuellement qui renvoie à différentes lectures de cet objet. Entre l’approche notionnelle qui reste bien souvent floue et assez sommaire et les approches théoriques qui tentent de nous présenter différentes perspectives pour comprendre la démarche innovante, le chemin de la connaissance est bien souvent compartimenté par disciplines scientifiques. Dans le cadre de cet écrit, on tentera de montrer l’existence de tensions et de combinaisons entre les approches en sciences de gestion, en sociologie, en économie et en géographie dans leur façon d’aborder le processus innovant. Pour exposer ce mouvement, on prendra comme sujet d’étude l’entreprise et le territoire qui sont l’objet de nombreux travaux pour comprendre les forces qui participent à la production de la nouveauté.Although innovation has today become a topical notion, given its fundamental importance in understanding the economy and the way our society adapts to its development goals, its characteristics and principles nevertheless need to be defined. While the 20th century was marked by important technological, political, economic and cultural changes, the current era seems to be increasingly bent on imposing innovation as a motor for the development of society. It is therefore important to understand how the question of innovation is currently being addressed, and in turn

Par and IR reflectance, transmittance, and absorptance of four crop canopies

International Nuclear Information System (INIS)

Wanjura, D.F.; Hatfield, J.L.

1986-01-01

Reflectance, transmittance and absorptance of electromagnetic radiation by cotton, soybeans, grain sorghum, and sunflower was measured at three growth stages in two wavebands (PAR: 0.4 to 0.7 pun and IR: 0.7 to 1.1 yim). As leaf area increased in each crop there were increases in IR reflectance and PAR absorptance and decreases in PAR reflectance and both PAR and IR transmittance. IR radiation was concentrated at the soil surface between rows by reflectance from the sides of canopies when crop cover was less than 80%. Across all crops one parameter, leaf overlap index, explained 81 and 71% of the PAR reflectance and another, crop cover, explained 86 and 94% of IR reflectance from rows and interrows, respectively. Attenuation of PAR radiation through the canopies of cotton and sunflower was similar (K = 0.62 and 0.67) but different from that of soybeans and grain sorghum (K = 0.46 and 0.43) which were the same

Épidémiologie de l'intoxication par envenimation chez les enfants ...

African Journals Online (AJOL)

Introduction: L'intoxication par envenimation est l'ensemble des manifestations locales et générales induites par la pénétration dans l'organisme d'une substance toxique produite par un animal venimeux. Le but de notre travail était d'étudier les signes cliniques des intoxications par envenimation chez les enfants de 0 à 15 ...

Innovative welding technology’s impact on the productivity of small and medium enterprises in Bulawayo, Zimbabwe

Directory of Open Access Journals (Sweden)

Albert Makore

2013-06-01

Full Text Available This research paper focuses on the evaluation of innovative welding technology’s impact on the productivity of Small and Medium Enterprises (SMEs. The paper examines business operational sector and size, technology currently in use, customer/supplier relationships, and technical knowledge levels, skills in use on the shop floor level, training, safety standards implementation and quality control aspects in the SMEs. The companies are evaluated on their use of Oxygen and Acetylene gas welding, Manual Metal Arc Welding (MMA, Metal Inert Gas Welding (MIG and Tungsten Inert Gas Welding (TIG for maintenance and productive purposes. Both exploratory and descriptive research designs are applied in this study. A structured survey instrument was administered to seventy five (75 SMEs selected based the researcher’s judgement of companies’ industrial classification. The findings are that technological innovativeness has both positive and negative effects on the commercial success of companies,however management in SMEs do not leverage on the use of innovative welding technology. The findings on the nonsignificance of the influence of technological innovativeness of welding processes can be as a result internal managerial controllable factors and outward uncontrollable environmental factors.

PARs for combustible gas control in advanced light water reactors

International Nuclear Information System (INIS)

Hosler, J.; Sliter, G.

1997-01-01

This paper discusses the progress being made in the United States to introduce passive autocatalytic recombiner (PAR) technology as a cost-effective alternative to electric recombiners for controlling combustible gas produced in postulated accidents in both future Advanced Light Water Reactors (ALWRs) and certain U. S. operating nuclear plants. PARs catalytically recombine hydrogen and oxygen, gradually producing heat and water vapor. They have no moving parts and are self-starting and self-feeding, even under relatively cold and wet containment conditions. Buoyancy of the hot gases they create sets up natural convective flow that promotes mixing of combustible gases in a containment. In a non-inerted ALWR containment, two approaches each employing a combination of PARs and igniters are being considered to control hydrogen in design basis and severe accidents. In pre-inerted ALWRs, PARs alone control radiolytic oxygen produced in either accident type. The paper also discusses regulatory feedback regarding these combustible gas control approaches and describes a test program being conducted by the Electric Power Research Institute (EPRI) and Electricite de France (EdF) to supplement the existing PAR test database with performance data under conditions of interest to U.S. plants. Preliminary findings from the EPRI/EdF PAR model test program are included. Successful completion of this test program and confirmatory tests being sponsored by the U. S. NRC are expected to pave the way for use of PARs in ALWRs and operating plants. (author)

Brulure par Plaque de Bistouri Electrique: a Propos de Quatre Cas

Science.gov (United States)

Khales, A.; Achbouk, A.; Belmir, R.; Cherkab, L.; Ennouhi, M.A.; Ababou, K.; Ihrai, H.

2010-01-01

Summary La brûlure par plaque de bistouri électrique est un accident rare mais grave par la profondeur de la lésion et par sa localisation, surtout quand qu’elle survient dans un contexte chirurgical dont le vécu reste difficile de la part du malade et du chirurgien. Cette brûlure bien que imprévisible reste grave par la profondeur et la localisation de la brûlure et par sa survenue dans un contexte opératoire, chez des patients malades. La prise en charge de la brûlure doit se faire en milieu spécialisé. La prévention reste le seul moyen d’éviter ce type d’accident. PMID:21991216

The Brazilian Wine Industry: a case study on geographical proximity and innovation dynamics

Directory of Open Access Journals (Sweden)

Claudio Vinicius Silva Farias

2014-09-01

Full Text Available This paper aims to analyze the cooperation and learning processes in the local system of vitiviniculture production of Serra Gaúcha's region (Rio Grande do Sul, Brazil, in order to characterize the dynamics of innovation of the firms located there. In methodological terms, a non-probabilistic exploratory study has been conducted. Field research in 20 wineries as well as interviews with related organizations were carried out in order to understand which learning mechanisms support innovative strategies adopted by enterprises. Since learning processes are also the result of local interactions, it was necessary to understand whether these interactions produced cooperative links. The results showed that innovations made by the firms were basically incremental. To do so, they use their intrinsic learning processes as well as external agents. These agents can be located in the region or elsewhere. The geographical proximity becomes more relevant for smaller firms. It was still possible to perceive the existence of cooperation in both vertical and horizontal level. Most frequent actions of vertical cooperation occur especially between firms and their suppliers. When horizontal cooperation occurs between enterprises, it takes place particularly in international trading.

Knowledge Mobilization, Collaboration, and Social Innovation: Leveraging Investments in Higher Education

Directory of Open Access Journals (Sweden)

Naomi Nichols

2013-05-01

, appuyer des stratégies d’innovation sociale qui contribuent au bien commun? Notre évaluation indique qu’il y a beaucoup d’influences réciproques entre les collaborations communautaires/académiques, la mobilisation du savoir et l’innovation sociale, surtout que la mobilisation du savoir facilite la collaboration et vice versa. En effet, avec une mobilisation du savoir suffisante, les collaborations communautaires/académiques stimulent l’innovation sociale. Cet article se termine par des recommandations provenant de notre analyse documentaire.

Elusloom lennukiga puhkusele / Inge Parring

Index Scriptorium Estoniae

Parring, Inge

2003-01-01

Ilmunud ka: Delovõje Vedomosti 1. okt. lk. 13. Air Cargo Estonia/ACE Logisticsi müügijuht Inge Parring tutvustab elusloomade transpordivõimalusi. Vt. samas: Loomade transportimiseks vajalikud dokumendid

suPAR

DEFF Research Database (Denmark)

Eugen-Olsen, Jesper; Giamarellos-Bourboulis, Evangelos J

2015-01-01

Investigation of biomarkers that can promptly predict unfavourable outcome of critically illness is an emerging necessity taking into consideration the need for early intervention, the shortage of available beds in intensive care units and the considerable cost of hospitalisation. The most...... promising biomarker is soluble urokinase-type plasminogen activator receptor (suPAR). Three studies in large populations of critically ill patients and patients admitted to the emergency department have shown that concentrations >12ng/mL can safely predict unfavourable outcome. This review presents...

Urine suPAR levels compared with plasma suPAR levels as predictors of post-consultation mortality risk among individuals assumed to be TB-negative: a prospective cohort study

DEFF Research Database (Denmark)

Rabna, Paulo; Andersen, Andreas; Wejse, Christian

2010-01-01

-suPAR was measured using a commercial ELISA (suPARnostic®). We found that U-suPAR carried significant prognostic information on mortality for HIV-infected subjects with an area under the ROC curve of 0.75. For HIV-negative individuals, little or no prognostic effect was observed. However, in both HIV positives...... and negatives, the predictive effect of U-suPAR was found to be inferior to that of P-suPAR....

Brésil : La contamination par le mercure en Amazonie | CRDI ...

International Development Research Centre (IDRC) Digital Library (Canada)

11 janv. 2011 ... En tentant de déceler la source de la contamination de l'Amazone par le ... par Jean-Rémy Davy Guimaraes de l'Université fédérale de Rio de Janeiro ... ces mattes est circonscrite par la conservation et la restauration en rive.

48 CFR 352.219-71 - Mentor-protégé program reporting requirements.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Mentor-protégé program... Clauses 352.219-71 Mentor-protégé program reporting requirements. As prescribed in 319.270-1(b), the Contracting Officer shall insert the following clause: Mentor-Protégé Program Reporting Requirements (January...

Exploratory studies into strategies to enhance innovation-driven international competitiveness in a port context : Toward ambidextrous ports

NARCIS (Netherlands)

R.M.A. Hollen (Rick)

2015-01-01

markdownabstractResearch has highlighted that firms competing in dynamic environments have to balance exploitative (efficiency-directed) activities with explorative (innovation-directed) ones in order to remain internationally competitive. In economically advanced countries, whose competitiveness is

Exploratory research and development FY90

Energy Technology Data Exchange (ETDEWEB)

Struble, G.L.; Middleton, C.; Baldwin, G.; Cherniak, J.; Clements, W.; Donohue, M.L.; Francke, A.; Kirvel, R.D.; MacGregor, P.; Shaw, G. (eds.)

1990-01-01

In general, the Exploratory Research and Development (ER D) Program supports research projects considered too basic or long-range to be funded by other Lawrence Livermore National Laboratory (LLNL) programs. This Program is managed for the Laboratory Director by a special assistant who chairs the LLNL's IR D Review Committee. Membership in the Review Committee comprises senior LLNL scientists, engineers, and managers whose areas of expertise span the range of scientific disciplines pursued at the Laboratory. The research supported by the Program falls into three categories: Exploratory Research in the Disciplines, Director's Initiatives, and Laboratory-Wide Competition. The first two, Exploratory Research and Director's Initiatives, promote pioneering work in the various scientific disciplines and programmatic areas. Laboratory departments and divisions propose and manage projects in the Exploratory Research category. The Laboratory Director, with the advice of the Review Committee, selects several larger projects to fund as Director's Initiative. These projects, which are proposed and managed by the responsible associate director, are intended to enhance the scope of existing programs or establish new technical directions and programs for the Laboratory. All FY90 projects are described in detail in this report. Other publications on ER D projects are included in the Publications List at the back of this report.

Sociometric Indicators of Leadership: An Exploratory Analysis

Science.gov (United States)

2018-01-01

Research Report 2015 Sociometric Indicators of Leadership : An Exploratory Analysis Elizabeth R. Uhl U.S. Army...2017 4. TITLE AND SUBTITLE Sociometric Indicators of Leadership : An Exploratory Analysis 5a. CONTRACT NUMBER W5J9CQ-11-D-0001 5b...objectives and a discussion of the strengths and weaknesses of the wearable sensor technology. 15. SUBJECT TERMS Leadership ; Social Network; Sociometric

Are All Young Farmers the Same? An Exploratory Analysis of On-Farm Innovation on Dairy and Drystock Farms in the Republic of Ireland

Science.gov (United States)

McKillop, Jessica; Heanue, Kevin; Kinsella, Jim

2018-01-01

Purpose: Research on young farmers traditionally focused on the future of the agricultural sector or else compared the innovativeness, efficiency or entrepreneurialism of young to older farmers. By contrast, this paper examines the differences in innovation within young farmers. Methodology: Innovativeness is defined here as the adoption of…

Factors affecting construction performance: exploratory factor analysis

Science.gov (United States)

Soewin, E.; Chinda, T.

2018-04-01

The present work attempts to develop a multidimensional performance evaluation framework for a construction company by considering all relevant measures of performance. Based on the previous studies, this study hypothesizes nine key factors, with a total of 57 associated items. The hypothesized factors, with their associated items, are then used to develop questionnaire survey to gather data. The exploratory factor analysis (EFA) was applied to the collected data which gave rise 10 factors with 57 items affecting construction performance. The findings further reveal that the items constituting ten key performance factors (KPIs) namely; 1) Time, 2) Cost, 3) Quality, 4) Safety & Health, 5) Internal Stakeholder, 6) External Stakeholder, 7) Client Satisfaction, 8) Financial Performance, 9) Environment, and 10) Information, Technology & Innovation. The analysis helps to develop multi-dimensional performance evaluation framework for an effective measurement of the construction performance. The 10 key performance factors can be broadly categorized into economic aspect, social aspect, environmental aspect, and technology aspects. It is important to understand a multi-dimension performance evaluation framework by including all key factors affecting the construction performance of a company, so that the management level can effectively plan to implement an effective performance development plan to match with the mission and vision of the company.

Electron microscope study of vacancy clusters produced by quenching in magnesium; Etude par microscopie electronique des amas de lacunes crees par trempe dans le magnesium

Energy Technology Data Exchange (ETDEWEB)

Levy, V; Espinasse, J; Mairy, C; Hillairet, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1969-07-01

Vacancy clustering in quenched magnesium has been studied by transmission electron microscopy. The nature of the vacancy loops observed, seems to depend essentially on the impurity content of the metal; this effect can be attributed to a variation of the stacking fault energy of magnesium due to impurities. (authors) [French] On a etudie par microscopie electronique en transmission les defauts crees par trempe dans le magnesium. Un effet considerable des impuretes du metal sur la nature des boucles obtenues par condensation de lacunes a ete mis en evidence; cet effet semble s'expliquer de facon satisfaisante par un abaissement de l'energie de faute d'empilement du magnesium du aux impuretes. (auteur)

ParABS Systems of the Four Replicons of Burkholderia cenocepacia: New Chromosome Centromeres Confer Partition Specificity†

Science.gov (United States)

Dubarry, Nelly; Pasta, Franck; Lane, David

2006-01-01

Most bacterial chromosomes carry an analogue of the parABS systems that govern plasmid partition, but their role in chromosome partition is ambiguous. parABS systems might be particularly important for orderly segregation of multipartite genomes, where their role may thus be easier to evaluate. We have characterized parABS systems in Burkholderia cenocepacia, whose genome comprises three chromosomes and one low-copy-number plasmid. A single parAB locus and a set of ParB-binding (parS) centromere sites are located near the origin of each replicon. ParA and ParB of the longest chromosome are phylogenetically similar to analogues in other multichromosome and monochromosome bacteria but are distinct from those of smaller chromosomes. The latter form subgroups that correspond to the taxa of their hosts, indicating evolution from plasmids. The parS sites on the smaller chromosomes and the plasmid are similar to the “universal” parS of the main chromosome but with a sequence specific to their replicon. In an Escherichia coli plasmid stabilization test, each parAB exhibits partition activity only with the parS of its own replicon. Hence, parABS function is based on the independent partition of individual chromosomes rather than on a single communal system or network of interacting systems. Stabilization by the smaller chromosome and plasmid systems was enhanced by mutation of parS sites and a promoter internal to their parAB operons, suggesting autoregulatory mechanisms. The small chromosome ParBs were found to silence transcription, a property relevant to autoregulation. PMID:16452432

A New View at the Planning Marketing Popular Products: Exploratory Study Electronics Sector with Companies in Brazil.

Directory of Open Access Journals (Sweden)

Evange Elias Assis

2015-06-01

Full Text Available The increased consumption of appliance and electronic products by lower-income population represented a growth opportunity for companies in the sector. The overall objective of this paper is to investigate how appliance and electronic product manufacturers draw up their marketing planning for low-end products. An exploratory approach was taken in this study, comprising the literature review and the empirical research which was conducted in two stages by combining the qualitative and quantitative approaches. The study group comprised companies affiliated with National Association of Appliance and Electronic Product Manufacturers (ELETROS. Results indicate that in 87.5% of cases the marketing planning focuses on the product. The companies are concerned to differentiate the low-end products on the market mainly by design (87.5% and innovation (62.5%. Within this context, it seems that the opportunity for growth of the appliance and electronic product companies can be boosted when implementing specific marketing planning for low-end products. Innovation is needed in all processes from project design of the product to its distribution. 

MODIS-derived daily PAR simulation from cloud-free images and its validation

Energy Technology Data Exchange (ETDEWEB)

Chen, Liangfu; Gu, Xingfa; Tian, Guoliang [State Key Laboratory of Remote Sensing Science, Jointly Sponsored by Institute of Remote Sensing Applications of Chinese Academy of Sciences and Beijing Normal University, Beijing 100101 (China); The Center for National Spaceborne Demonstration, Beijing 100101 (China); Gao, Yanhua [State Key Laboratory of Remote Sensing Science, Jointly Sponsored by Institute of Remote Sensing Applications of Chinese Academy of Sciences and Beijing Normal University, Beijing 100101 (China); Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences, Beijing 100101 (China); Yang, Lei [State Key Laboratory of Remote Sensing Science, Jointly Sponsored by Institute of Remote Sensing Applications of Chinese Academy of Sciences and Beijing Normal University, Beijing 100101 (China); Jilin University, Changchun 130026 (China); Liu, Qinhuo [State Key Laboratory of Remote Sensing Science, Jointly Sponsored by Institute of Remote Sensing Applications of Chinese Academy of Sciences and Beijing Normal University, Beijing 100101 (China)

2008-06-15

In this paper, a MODIS-derived daily PAR (photosynthetically active radiation) simulation model from cloud-free image over land surface has been developed based on Bird and Riordan's model. In this model, the total downwelling spectral surface irradiance is divided into two parts: one is beam irradiance, and another is diffuse irradiance. The attenuation of solar beam irradiance comprises scattering by the gas mixture, absorption by ozone, the gas mixture and water vapor, and scattering and absorption by aerosols. The diffuse irradiance is scattered out of the direct beam and towards the surface. The multiple ground-air interactions have been taken into account in the diffuse irradiance model. The parameters needed in this model are atmospheric water vapor content, aerosol optical thickness and spectral albedo ranging from 400 nm to 700 nm. They are all retrieved from MODIS data. Then, the instantaneous photosynthetically available radiation (IPAR) is integrated by using a weighted sum at each of the visible MODIS wavebands. Finally, a daily PAR is derived by integration of IPAR. In order to validate the MODIS-derived PAR model, we compared the field PAR measurements in 2003 and 2004 against the simulated PAR. The measurements were made at the Qianyanzhou ecological experimental station, Chinese Ecosystem Research Network. A total of 54 days of cloud-free MODIS L1B level images were used for the PAR simulation. Our results show that the simulated PAR is consistent with field measurements, where the correlation coefficient of linear regression between calculated PAR and measured PAR is 0.93396. However, there were some uncertainties in the comparison of 1 km pixel PAR with the tower flux stand measurement. (author)

PAR-2 expression in the gingival crevicular fluid reflects chronic periodontitis severity.

Science.gov (United States)

Fukushima, Henrique; Alves, Vanessa Tubero Euzebio; Carvalho, Verônica Franco de; Ambrósio, Lucas Macedo Batitucci; Eichler, Rosangela Aparecida Dos Santos; Carvalho, Maria Helena Catelli de; Saraiva, Luciana; Holzhausen, Marinella

2017-01-26

Recent studies investigating protease-activated receptor type 2 (PAR-2) suggest an association between the receptor and periodontal inflammation. It is known that gingipain, a bacterial protease secreted by the important periodontopathogen Porphyromonas gingivalis can activate PAR-2. Previous studies by our group found that PAR-2 is overexpressed in the gingival crevicular fluid (GCF) of patients with moderate chronic periodontitis (MP). The present study aimed at evaluating whether PAR-2 expression is associated with chronic periodontitis severity. GCF samples and clinical parameters, including plaque and bleeding on probing indices, probing pocket depth and clinical attachment level, were collected from the control group (n = 19) at baseline, and from MP patients (n = 19) and severe chronic periodontitis (SP) (n = 19) patients before and 6 weeks after periodontal non-surgical treatment. PAR-2 and gingipain messenger RNA (mRNA) in the GCF of 4 periodontal sites per patient were evaluated by Reverse Transcription Polymerase Chain Reaction (RT-qPCR). PAR-2 and gingipain expressions were greater in periodontitis patients than in control group patients. In addition, the SP group presented increased PAR-2 and gingipain mRNA levels, compared with the MP group. Furthermore, periodontal treatment significantly reduced (p periodontitis. In conclusion, PAR-2 is associated with chronic periodontitis severity and with gingipain levels in the periodontal pocket, thus suggesting that PAR-2 expression in the GCF reflects the severity of destruction during periodontal infection.

Occurrence of rhyolytic tuffs at deep sea drilling project site 219 on the Laccadive Ridge

Digital Repository Service at National Institute of Oceanography (India)

Siddiquie, H.N.; Sukheswala, R.N.

A study of thin sections from the lower and middle parts of Unit 5 (Paleocene) from Site 219 shows that these largely consist of acidic or rhyolitic tuffs. The overlying limestones in Unit 5 (Paleocene) and Unit 4 (Lower Eocene) also contain...

Molecular mechanism of bundle formation by the bacterial actin ParM

Energy Technology Data Exchange (ETDEWEB)

Popp, David, E-mail: dpopp@imcb.a-star.edu.sg [ERATO ' Actin Filament Dynamics' Project, Japan Science and Technology Corporation, c/o RIKEN Harima Institute at Spring 8, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, 138673 Singapore (Singapore); Narita, Akihiro [ERATO ' Actin Filament Dynamics' Project, Japan Science and Technology Corporation, c/o RIKEN Harima Institute at Spring 8, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Nagoya University Graduate School of Science, Structural Biology Research Center and Division of Biological Sciences, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Iwasa, Mitsusada [ERATO ' Actin Filament Dynamics' Project, Japan Science and Technology Corporation, c/o RIKEN Harima Institute at Spring 8, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Maeda, Yuichiro [ERATO ' Actin Filament Dynamics' Project, Japan Science and Technology Corporation, c/o RIKEN Harima Institute at Spring 8, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Nagoya University Graduate School of Science, Structural Biology Research Center and Division of Biological Sciences, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Robinson, Robert C. [Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, 138673 Singapore (Singapore)

2010-01-22

The actin homolog ParM plays a microtubule-like role in segregating DNA prior to bacterial cell division. Fluorescence and cryo-electron microscopy have shown that ParM forms filament bundles between separating DNA plasmids in vivo. Given the lack of ParM bundling proteins it remains unknown how ParM bundles form at the molecular level. Here we show using time-lapse TIRF microscopy, under in vitro molecular crowding conditions, that ParM-bundle formation consists of two distinct phases. At the onset of polymerization bundle thickness and shape are determined in the form of nuclei of short helically disordered filaments arranged in a liquid-like lattice. These nuclei then undergo an elongation phase whereby they rapidly increase in length. At steady state, ParM bundles fuse into one single large aggregate. This behavior had been predicted by theory but has not been observed for any other cytomotive biopolymer, including F-actin. We employed electron micrographs of ParM rafts, which are 2-D analogs of 3-D bundles, to identify the main molecular interfilament contacts within these suprastructures. The interface between filaments is similar for both parallel and anti-parallel orientations and the distribution of filament polarity is random within a bundle. We suggest that the interfilament interactions are not due to the interactions of specific residues but rather to long-range, counter ion mediated, electrostatic attractive forces. A randomly oriented bundle ensures that the assembly is rigid and that DNA may be captured with equal efficiency at both ends of the bundle via the ParR binding protein.

Nuclear technology and chronic diseases: an exploratory study evolving the clinical physician perception

International Nuclear Information System (INIS)

Sato, Renato Cesar

2010-01-01

This research is an exploratory cross-sectional study about the relationship of chronic disease and the use of nuclear technology. There is a concern over the increase of the prevalence of chronic disease in developing countries and it should hence be carefully evaluated in the context of societies, organizations and individuals. The technological advances experienced in the last decades especially in the nuclear technology area have created expectations to deal more efficiently with the challenge of chronic diseases. However little has been explored in this area under the point-of-view of medical doctors as agents who make this system of relations between disease and technology. The necessity for public and private planning to deal with this set of problems can benefit through an initial evaluation about the forthcoming theme, but should incorporate the agenda of health and technology planning for the following years. Using mixed methodology, made up of qualitative and quantitative approach, this research sought to reveal and configure important dimensions around the theme of this study. The field research was made up of interviews analyzed using techniques of fundamental theory and also of questionnaires sent by web analyzed statistically using exploratory factor analysis. These ventures allowed dimensions to be revealed that make up the perception of chronic disease and the use of nuclear technology. These dimensions presented in a form of a theoretical construct that were then discussed under the point of view of social theory and technological innovation. (author)

Par Pond vegetation status Summer 1995 -- October survey descriptive summary

International Nuclear Information System (INIS)

Mackey, H.E. Jr.; Riley, R.S.

1995-11-01

The water level of Par Pond was lowered approximately 20 feet in mid-1991 in order to protect downstream residents from possible dam failure suggested by subsidence on the downstream slope of the dam and to repair the dam. This lowering exposed both emergent and nonemergent macrophyte beds to drying conditions resulting in extensive losses. A survey of the emergent shoreline aquatic plant communities began in June 1995, three months after the refilling of Par Pond to approximately 200 feet above mean sea level and continued with this late October survey. Communities similar to the pre-drawdown Par Pond aquatic plant communities are becoming re-established; especially, beds of maiden cane, lotus, waterlily, and watershield are now extensive and well established. Cattail occurrence continues to increase, but large beds common to Par Pond prior to the drawdown have not formed. Future surveys throughout 1996 and 1997, along with the continued evaluation of satellite data to map the areal extent of the macrophyte beds of Par Pond, are planned

Par Pond vegetation status Summer 1995 -- September survey descriptive summary

International Nuclear Information System (INIS)

Mackey, H.E. Jr.; Riley, R.S.

1995-09-01

The water level of Par Pond was lowered approximately 20 feet in mid-1991 in order to protect downstream residents from possible dam failure suggested by subsidence on the downstream slope of the dam and to repair the dam. This lowering exposed both emergent and nonemergent macrophyte beds to drying conditions resulting in extensive losses. A survey of the emergent shoreline aquatic plant communities began in June 1995, three months after the refilling of Par Pond to approximately 200 feet above mean sea level and continued with this mid-September survey. Communities similar to the pre-drawdown Par Pond aquatic plant communities are becoming re-established; especially, beds of maidencane, lotus, waterlily, and watershield are now extensive and well established. Cattail occurrence continues to increase, but large beds common to Par Pond prior to the drawdown have not formed. Future surveys during the late growing seasons of 1995, and throughout 1996 and 1997, along with the evaluation of satellite data to map the areal extent of the macrophyte beds of Par Pond, are planned

Improved Satellite-based Photosysnthetically Active Radiation (PAR) for Air Quality Studies

Science.gov (United States)

Pour Biazar, A.; McNider, R. T.; Cohan, D. S.; White, A.; Zhang, R.; Dornblaser, B.; Doty, K.; Wu, Y.; Estes, M. J.

2015-12-01

One of the challenges in understanding the air quality over forested regions has been the uncertainties in estimating the biogenic hydrocarbon emissions. Biogenic volatile organic compounds, BVOCs, play a critical role in atmospheric chemistry, particularly in ozone and particulate matter (PM) formation. In southeastern United States, BVOCs (mostly as isoprene) are the dominant summertime source of reactive hydrocarbon. Despite significant efforts in improving BVOC estimates, the errors in emission inventories remain a concern. Since BVOC emissions are particularly sensitive to the available photosynthetically active radiation (PAR), model errors in PAR result in large errors in emission estimates. Thus, utilization of satellite observations to estimate PAR can help in reducing emission uncertainties. Satellite-based PAR estimates rely on the technique used to derive insolation from satellite visible brightness measurements. In this study we evaluate several insolation products against surface pyranometer observations and offer a bias correction to generate a more accurate PAR product. The improved PAR product is then used in biogenic emission estimates. The improved biogenic emission estimates are compared to the emission inventories over Texas and used in air quality simulation over the period of August-September 2013 (NASA's Discover-AQ field campaign). A series of sensitivity simulations will be performed and evaluated against Discover-AQ observations to test the impact of satellite-derived PAR on air quality simulations.

SAFARI 2000 PAR Measurements, Kalahari Transect, Botswana, Wet Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — Ceptometer data from a Decagon AccuPAR (Model PAR-80) were collected at four sites in Botswana during the SAFARI 2000 Kalahari Transect Wet Season Campaign (March,...

Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Lumbar lordosis and pars interarticularis fractures: a case-control study

International Nuclear Information System (INIS)

Bugg, William G.; Lewis, Mark; Juette, Arne; Cahir, John G.; Toms, Andoni P.

2012-01-01

The aim of this study is to examine the relationship between lumbar lordosis and pars interarticularis fractures. In this retrospective case-control study we compare the angle of lumbar lordosis and the angle of the S1 vertebral endplate (as a measure of pelvic tilt) in patients with bilateral L5 pars interarticularis fractures with age- and sex-matched control cases with normal MRI examinations of the lumbar spine. Twenty-nine cases of bilateral L5 pars interarticularis fractures with matched control-cases were identified on MRI (16 male, 13 female, age 9-63 years). The angle of lordosis was measured between the inferior L4 and superior S1 vertebral endplates on a standing lateral lumbar spine radiograph for both groups. The mean angle of lordosis about the L5 vertebra was 36.9 (SD = 6.5 ) in the pars interarticularis fracture group, and 30.1 (SD = 6.4 ) in the control group. The difference between the two groups was significant (mean difference 6.8 , Student's t test: P < 0.001). The mean angle of sacral tilt measured was 122.2 (SD = 10.16 ) for controls and 136.4 (SD = 10.86 ) for patients with pars defects. The difference in the means of 14.2 was statistically significantly different (P < 0.0001). Sacral tilt represented by a steeply angled superior endplate of S1 is associated with a significantly increased angle of lordosis, between L4 and S1, and pars fractures at L5. Steep angulation of the first sacral vertebral segment maybe the predisposing biomechanical factor that leads to pincer-like impingement of the pars interarticularis and then spondylolysis. (orig.)

Lumbar lordosis and pars interarticularis fractures: a case-control study

Energy Technology Data Exchange (ETDEWEB)

Bugg, William G; Lewis, Mark; Juette, Arne; Cahir, John G; Toms, Andoni P [Cotman Centre, Norwich Radiology Academy, Norwich, Norfolk (United Kingdom)

2012-07-15

The aim of this study is to examine the relationship between lumbar lordosis and pars interarticularis fractures. In this retrospective case-control study we compare the angle of lumbar lordosis and the angle of the S1 vertebral endplate (as a measure of pelvic tilt) in patients with bilateral L5 pars interarticularis fractures with age- and sex-matched control cases with normal MRI examinations of the lumbar spine. Twenty-nine cases of bilateral L5 pars interarticularis fractures with matched control-cases were identified on MRI (16 male, 13 female, age 9-63 years). The angle of lordosis was measured between the inferior L4 and superior S1 vertebral endplates on a standing lateral lumbar spine radiograph for both groups. The mean angle of lordosis about the L5 vertebra was 36.9 (SD = 6.5 ) in the pars interarticularis fracture group, and 30.1 (SD = 6.4 ) in the control group. The difference between the two groups was significant (mean difference 6.8 , Student's t test: P < 0.001). The mean angle of sacral tilt measured was 122.2 (SD = 10.16 ) for controls and 136.4 (SD = 10.86 ) for patients with pars defects. The difference in the means of 14.2 was statistically significantly different (P < 0.0001). Sacral tilt represented by a steeply angled superior endplate of S1 is associated with a significantly increased angle of lordosis, between L4 and S1, and pars fractures at L5. Steep angulation of the first sacral vertebral segment maybe the predisposing biomechanical factor that leads to pincer-like impingement of the pars interarticularis and then spondylolysis. (orig.)

Lumbar lordosis and pars interarticularis fractures: a case-control study

Energy Technology Data Exchange (ETDEWEB)

Bugg, William G.; Lewis, Mark; Juette, Arne; Cahir, John G.; Toms, Andoni P. [Cotman Centre, Norwich Radiology Academy, Norwich, Norfolk (United Kingdom)

2012-07-15

The aim of this study is to examine the relationship between lumbar lordosis and pars interarticularis fractures. In this retrospective case-control study we compare the angle of lumbar lordosis and the angle of the S1 vertebral endplate (as a measure of pelvic tilt) in patients with bilateral L5 pars interarticularis fractures with age- and sex-matched control cases with normal MRI examinations of the lumbar spine. Twenty-nine cases of bilateral L5 pars interarticularis fractures with matched control-cases were identified on MRI (16 male, 13 female, age 9-63 years). The angle of lordosis was measured between the inferior L4 and superior S1 vertebral endplates on a standing lateral lumbar spine radiograph for both groups. The mean angle of lordosis about the L5 vertebra was 36.9 (SD = 6.5 ) in the pars interarticularis fracture group, and 30.1 (SD = 6.4 ) in the control group. The difference between the two groups was significant (mean difference 6.8 , Student's t test: P < 0.001). The mean angle of sacral tilt measured was 122.2 (SD = 10.16 ) for controls and 136.4 (SD = 10.86 ) for patients with pars defects. The difference in the means of 14.2 was statistically significantly different (P < 0.0001). Sacral tilt represented by a steeply angled superior endplate of S1 is associated with a significantly increased angle of lordosis, between L4 and S1, and pars fractures at L5. Steep angulation of the first sacral vertebral segment maybe the predisposing biomechanical factor that leads to pincer-like impingement of the pars interarticularis and then spondylolysis. (orig.)

Croissance epitaxiale de GaAs sur substrats de Ge par epitaxie par faisceaux chimiques

Science.gov (United States)

Belanger, Simon

La situation energetique et les enjeux environnementaux auxquels la societe est confrontee entrainent un interet grandissant pour la production d'electricite a partir de l'energie solaire. Parmi les technologies actuellement disponibles, la filiere du photovoltaique a concentrateur solaire (CPV pour concentrator photovoltaics) possede un rendement superieur et mi potentiel interessant a condition que ses couts de production soient competitifs. La methode d'epitaxie par faisceaux chimiques (CBE pour chemical beam epitaxy) possede plusieurs caracteristiques qui la rendent interessante pour la production a grande echelle de cellules photovoltaiques a jonctions multiples a base de semi-conducteurs III-V. Ce type de cellule possede la meilleure efficacite atteinte a ce jour et est utilise sur les satellites et les systemes photovoltaiques a concentrateur solaire (CPV) les plus efficaces. Une des principales forces de la technique CBE se trouve dans son potentiel d'efficacite d'utilisation des materiaux source qui est superieur a celui de la technique d'epitaxie qui est couramment utilisee pour la production a grande echelle de ces cellules. Ce memoire de maitrise presente les travaux effectues dans le but d'evaluer le potentiel de la technique CBE pour realiser la croissance de couches de GaAs sur des substrats de Ge. Cette croissance constitue la premiere etape de fabrication de nombreux modeles de cellules solaires a haute performance decrites plus haut. La realisation de ce projet a necessite le developpement d'un procede de preparation de surface pour les substrats de germanium, la realisation de nombreuses sceances de croissance epitaxiale et la caracterisation des materiaux obtenus par microscopie optique, microscopie a force atomique (AFM), diffraction des rayons-X a haute resolution (HRXRD), microscopie electronique a transmission (TEM), photoluminescence a basse temperature (LTPL) et spectrometrie de masse des ions secondaires (SIMS). Les experiences ont permis

ParTIES: a toolbox for Paramecium interspersed DNA elimination studies.

Science.gov (United States)

Denby Wilkes, Cyril; Arnaiz, Olivier; Sperling, Linda

2016-02-15

Developmental DNA elimination occurs in a wide variety of multicellular organisms, but ciliates are the only single-celled eukaryotes in which this phenomenon has been reported. Despite considerable interest in ciliates as models for DNA elimination, no standard methods for identification and characterization of the eliminated sequences are currently available. We present the Paramecium Toolbox for Interspersed DNA Elimination Studies (ParTIES), designed for Paramecium species, that (i) identifies eliminated sequences, (ii) measures their presence in a sequencing sample and (iii) detects rare elimination polymorphisms. ParTIES is multi-threaded Perl software available at https://github.com/oarnaiz/ParTIES. ParTIES is distributed under the GNU General Public Licence v3. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Medical innovation laws: an unnecessary innovation.

Science.gov (United States)

Richards, Bernadette

2016-06-01

Objective This paper aims to demonstrate that any suggestion that there is a need for specific innovation laws is flawed. Innovation is central to good medical practice and is adequately supported by current law. Methods The paper reviews the nature of medical innovation and outlines recent attempts in the UK to introduce specific laws aimed at 'encouraging' and 'supporting' innovation. The current legal framework is outlined and the role of the law in relation to medical innovation explored. Results The analysis demonstrates the cyclic relationship between medical advancement and the law and concludes that there is no requirement for specific innovation laws. Conclusions The law not only supports innovation and development in medical treatment but encourages it as central to a functioning medical system. There is no need to introduce specific laws aimed at medical innovation; to do so represents an unnecessary legal innovation and serves to complicate matters. What is known about the topic? Over recent months, there has been a great deal of discussion surrounding the law in the context of medical innovation. This was driven by the attempts in the UK to introduce specific laws in the Medical Innovation Bill. The general subject matter - negligence and the expected standard of care in the provision of treatment - is very well understood, but not in cases where the treatment can be described as innovative. The general rhetoric in both the UK and Australia around the Medical Innovation Bill demonstrates a lack of understanding of the position of the law with regards to innovative treatment. What does this paper add? This paper adds clarity to the debate. It presents the law and explains the manner in which the law can operate around innovative treatment. The paper asserts that medical innovation is both supported and encouraged by existing legal principles. What are the implications for practitioners? The paper presents an argument that can guide the policy position

Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound

Effect of simvastatin and ezetimibe on suPAR levels and outcomes

DEFF Research Database (Denmark)

Hodges, Gethin W; Bang, Casper N; Forman, Julie L

2018-01-01

-lowering therapy also lowers suPAR levels is unknown. METHODS: We investigated whether treatment with Simvastatin 40 mg and Ezetimibe 10 mg lowered plasma suPAR levels in 1838 patients with mild-moderate, asymptomatic aortic stenosis, included in the Simvastatin and Ezetimibe in Aortic Stenosis (SEAS) study, using...... and Ezetimibe treatment impeded the progression of the time-related increase in plasma suPAR levels. Year-1 suPAR was associated with all-cause mortality, MCE, and AVE irrespective of baseline levels (SEAS study: NCT00092677)....... cardiovascular events (MCE) composed of ischemic cardiovascular events (ICE) and aortic valve related events (AVE). RESULTS: After 4.3 years of follow-up, suPAR levels had increased by 9.2% (95% confidence interval [CI]: 7.0%-11.5%) in the placebo group, but only by 4.1% (1.9%-6.2%) in the group with lipid...

Impaired exploratory eye movements in children with Asperger's syndrome.

Science.gov (United States)

Ohya, Takashi; Morita, Kiichiro; Yamashita, Yushiro; Egami, Chiyomi; Ishii, Youhei; Nagamitsu, Shinichiro; Matsuishi, Toyojiro

2014-03-01

Previous eye-tracking studies using an eye mark recorder have reported that disturbances in exploratory eye movements in adult schizophrenic patients are associated with social functioning. The current study sought to determine whether exploratory eye-movement disturbances are present in children with Asperger's syndrome (AS) compared with typically developing (TD) children. MATERIALS/PARTICIPANTS: The participants were 23 children with AS and 23 age-matched TD children. We measured exploratory eye movements using an EMR-8B eye mark recorder and an exploratory eye movement-measuring device. Eye movements were recorded while participants freely observed a geometric figure (free viewing task), and while they complied with the instructions of an experimenter (repeat-comparison task). We assessed eye fixation points (EFPs) and total eye scanning length (TESL) in all tasks, and measured the responsive search score (RSS) in the repeat-comparison task. In the free viewing task, children with AS exhibited significantly shorter TESL compared with TD children. In the repeat-comparison task, children with AS exhibited significantly lower RSS. Autism Spectrum Screening Questionnaire scores were negatively correlated with both EFP and TESL, but not RSS. The current results revealed that children with AS exhibited dysfunction in exploratory eye movements. Thus, assessing exploratory eye movements in a repeat-comparison task may be useful for detecting social impairment among children with AS. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Industrialized Innovation: The Connection of Science & Technology Innovation with Industrial Innovation

Institute of Scientific and Technical Information of China (English)

Yinxing Hong; Yao Lu; Jianghuai Zheng

2017-01-01

In light of the relationship and the current disconnection between science & technology (S&T) innovation and industrial innovation in China,it is necessary to put forward and emphasize the concept of industrialized innovation.Industrialized innovation is the bridge and intermediation between S&T innovation and industrial innovation,which is not only a concept,but also a mechanism and combination force.There are two ways to achieve industrialized innovation:through industry-university-research coordination and through technology entrepreneurship.The meaning of industry-university-research coordination is not about coordination among industry,university and research sectors in an institutional sense;rather it is about the coordination of the functions of cultivation and development in new industries,new technologies,and new talents of industrialized innovation.The incentive mechanism for industrialized innovation should motivate not only innovation but also coordination.Technology entrepreneurship is the industrialization of new technology through business start-ups,which occurs beyond the stage of incubation and development of new technology.The capital of technology entrepreneurship is the set consisting of knowledge capital manifested through technological innovation,human capital manifested through entrepreneurs,and physical capital in the form of venture capital.While physical capital is indispensable,knowledge capital and human capital play the decisive role in technology entrepreneurship.The industrialization of technological innovation involves two requirements:one is to enable the new technology industry to achieve a large scale rapidly,and the other is to fully realize the potential value of the new technology.Both requirements are reliant on effective innovation in business models.

Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

Directory of Open Access Journals (Sweden)

Ravshan Burikhanov

2014-01-01

Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

Efficacy and safety of the pars plana clip in the Ahmed valve device inserted via the pars plana in patients with refractory glaucoma

Directory of Open Access Journals (Sweden)

Manuel Diaz-Llopis

2010-05-01

Full Text Available Manuel Diaz-Llopis1,2,3, David Salom1,3, Salvador García-Delpech1,2,3, Patricia Udaondo1,3, Jose Maria Millan3,5, J Fernando Arevalo61Department of Ophthalmology, La Fe University Hospital of Valencia, Valencia, Spain; 2Department of Ophthalmology of the Valencia University, Valencia, Spain; 3Biomedical Network Research Centre on Rare Diseases (CIBERER, Valencia, Spain; 4Catholic University San Vicente Martir, Valencia, Spain; 5Department of Genetics, La Fe University Hospital of Valencia, Valencia, Spain; 6Clinica Oftalmologica Centro Caracas, Retina and VItreous Service, Caracas, DC, VenezuelaPurpose: To evaluate the efficacy and safety of the pars plana clip (PPC in the Ahmed valve tube inserted via the pars plana in patients with secondary refractory glaucomas.Methods: Prospective and interventional case series that included 10 patients with secondary refractory glaucoma. The pars plana vitrectomy and the implant of the modified tube were performed during the same surgery. Control of intraocular pressure (IOP and the development of intra- and postoperative complications were evaluated during the follow-up.Results: Follow-up time was twelve months in all the patients. Control of IOP was achieved in 90% of patients, and 70% needed no antiglaucoma treatment. The complications that occurred were transient hypotony in three cases, choroidal detachment in two cases, and one case of intraocular hemorrhage. No case of tube extrusion or tube kink was observed.Conclusions: Our data suggests that implantation of the Ahmed tube modified with the PPC via the pars plana is safe and effective in patients with secondary refractory glaucomas. Keywords: pars plana clip, Ahmed valve, refractory glaucoma, pars plana vitrectomy

Exploratory shaft conceptual design report: Permian Basin

International Nuclear Information System (INIS)

1983-07-01

This conceptual design report summarizes the conceptualized design for an exploratory shaft facility at a representative site in the Permian Basin locatd in the western part of Texas. Conceptualized designs for other possible locations (Paradox Basin in Utah and Gulf Interior Region salt domes in Louisiana and Mississippi) are summarized in separate reports. The purpose of the exploratory shaft facility is to provide access to the reference repository horizon to permit in situ testing of the salt. The in situ testing is necessary to verify repository salt design parameters, evaluate isotropy and homogeneity of the salt, and provide a demonstration of the constructability and confirmation of the design to gain access to the repository. The fundamental purpose of this conceptual design report is to assure the feasibility of the exploratory shaft project and to develop a reliable cost estimate and realistic schedule. Because a site has not been selected and site-specific subsurface data are not available, it has been necessary to make certain assumptions in order to develop a conceptual design for an exploratory shaft facility in salt. As more definitive information becomes available to support the design process, adjustments in the projected schedule and estimated costs will be required

Exploratory shaft conceptual design report: Paradox Basin

International Nuclear Information System (INIS)

1983-07-01

This conceptual design report summarizes the conceptualized design for an exploratory shaft facility at a representative site in the Paradox Basin located in the southeastern part of Utah. Conceptualized designs for other possible locations (Permian Basin in Texas and Gulf Interior Region salt domes in Louisiana and Mississippi) are summarized in separate reports. The purpose of the exploratory shaft facility is to provide access to the reference repository horizon to permit in situ testing of the salt. The in-situ testing is necessary to verify repository salt design parameters, evaluate isotropy and homogeneity of the salt, and provide a demonstration of the constructability and confirmation of the design to gain access to the repository. The fundamental purpose of this conceptual design report is to assure the feasibility of the exploratory shaft project and to develop a reliable cost estimate and realistic schedule. Because a site has not been selected and site-specific subsurface data are not available, it has been necessary to make certain assumptions in order to develop a conceptual design for an exploratory shaft facility in salt. As more definitive information becomes available to support the design process, adjustments in the projected schedule and estimated costs will be required

Innover en illustration jeunesse : les focalisations

Directory of Open Access Journals (Sweden)

Anne Guibert-Lassalle

2010-09-01

Full Text Available L’activité éditoriale pour la jeunesse est caractérisée en France depuis 1990 par une très forte multiplication du nombre d’acteurs et un accroissement constant du nombre de publications. L’innovation est considérée comme la principale voie de survie. Ces enjeux culturels et économiques contribuent à promouvoir l’originalité de l’illustration. Pourtant le succès commercial ne couronne pas toujours les inventions graphiques. Une enquête sur l’émergence, dans les années 2000, d’une tendance porteuse, fondée sur un usage nouveau des focalisations, révèle le caractère intuitif, étroitement daté et collaboratif, de l’innovation en illustration pour la jeunesse.Innovating in illustration for the youth: the focalisationsSince 1990, publishing for the youth in France is a sector of activity where the number of actors and items produced has been constantly increased. Innovation is considered as the main way for survival. These cultural and economical stakes tend to promote originality in illustration. Since, commercial profit does not always reward graphic inventiveness. A sociological enquiry upon the emerging in the 2000’ of a successful trend, based on a fresh use of focalisations, reveals how intuitive, strictly dated and joint can be innovating in illustration for the youth.La innovación en las revistas ilustradas para jóvenes. La focalizaciónLa actividad editorial para la juventud se ha caracterizado en Francia desde 1990 por un fuerte aumento de agentes y por un crecimiento constante del número de publicaciones. La innovación es la vía esencial para sobrevivir. Las apuestas culturales y económicas contribuyen a promover la originalidad de las ilustraciones. Sin embargo el éxito comercial no siempre subraya la originalidad de estas. A principios de este siglo, una encuesta acerca de la emergencia de una tendencia prometedora, basada en una manera diferente de efectuar las focalizaciones, ha revelado el

Gay, Mostly Gay, or Bisexual Leaning Gay? An Exploratory Study Distinguishing Gay Sexual Orientations Among Young Men.

Science.gov (United States)

Savin-Williams, Ritch C; Cash, Brian M; McCormack, Mark; Rieger, Gerulf

2017-01-01

This exploratory study assessed physiological, behavioral, and self-report measures of sexual and romantic indicators of sexual orientation identities among young men (mean age = 21.9 years) with predominant same-sex sexual and romantic interests: those who described themselves as bisexual leaning gay (n = 11), mostly gay (n = 17), and gay (n = 47). Although they were not significantly distinguishable based on physiological (pupil dilation) responses to nude stimuli, on behavioral and self-report measures a descending linear trend toward the less preferred sex (female) was significant regarding sexual attraction, fantasy, genital contact, infatuation, romantic relationship, sex appeal, and gazing time to the porn stimuli. Results supported a continuum of sexuality with distinct subgroups only for the self-report measure of sexual attraction. The other behavioral and self-report measures followed the same trend but did not significantly differ between the bisexual leaning gay and mostly gay groups, likely the result of small sample size. Results suggest that romantic indicators are as good as sexual measures in assessing sexual orientation and that a succession of logically following groups from bisexual leaning gay, mostly gay, to gay. Whether these three groups are discrete or overlapping needs further research.

Effects of solar PAR and UV radiation on tropical biofouling communities

KAUST Repository

Dobretsov, SV

2010-03-08

We investigated the effect of solar ultraviolet radiation (UVR) and photosynthetically active radiation (PAR) on the development of tropical micro- and macrofouling communities for 30 d. The experimental design involved 3 treatments: full spectrum (PAR+UVR), PAR only, and minimal light (reduced PAR and UVR). Terminal restriction fragment length polymorphism analysis demonstrated that different light conditions resulted in the formation of highly different microbial communities. The lowest densities of bacteria were found under the full spectrum treatment, while the lowest densities of diatoms were found in the minimal light treatment. Macrofouling communities consisted of 13 species and differed among light treatments. In the presence of UVR, communities had low species diversity, evenness, and richness, while in minimal light and PAR treatments, communities had high species diversity, evenness, and richness. Similarity percentage (SIMPER) analysis revealed that the tubeworm Hydroides elegans, the alga Ulva (Enteromorpha) sp., and the bivalve Perna viridis were the species responsible for most of the dissimilarities in macrofouling communities among treatments. While densities of H. elegans were similar in the PAR and minimal light treatments, this polychaete had higher growth rates under minimal light conditions. We conclude that UVR and PAR directly control the development of shallow micro- and macrofouling communities by inhibiting the recruitment and growth of sensitive species and promoting the growth of resistant species, but also that these forms of solar radiation influence the surface cues available to competent larvae by altering the development of the microbial community.

Paternal age related schizophrenia (PARS): Latent subgroups detected by k-means clustering analysis.

Science.gov (United States)

Lee, Hyejoo; Malaspina, Dolores; Ahn, Hongshik; Perrin, Mary; Opler, Mark G; Kleinhaus, Karine; Harlap, Susan; Goetz, Raymond; Antonius, Daniel

2011-05-01

Paternal age related schizophrenia (PARS) has been proposed as a subgroup of schizophrenia with distinct etiology, pathophysiology and symptoms. This study uses a k-means clustering analysis approach to generate hypotheses about differences between PARS and other cases of schizophrenia. We studied PARS (operationally defined as not having any family history of schizophrenia among first and second-degree relatives and fathers' age at birth ≥ 35 years) in a series of schizophrenia cases recruited from a research unit. Data were available on demographic variables, symptoms (Positive and Negative Syndrome Scale; PANSS), cognitive tests (Wechsler Adult Intelligence Scale-Revised; WAIS-R) and olfaction (University of Pennsylvania Smell Identification Test; UPSIT). We conducted a series of k-means clustering analyses to identify clusters of cases containing high concentrations of PARS. Two analyses generated clusters with high concentrations of PARS cases. The first analysis (N=136; PARS=34) revealed a cluster containing 83% PARS cases, in which the patients showed a significant discrepancy between verbal and performance intelligence. The mean paternal and maternal ages were 41 and 33, respectively. The second analysis (N=123; PARS=30) revealed a cluster containing 71% PARS cases, of which 93% were females; the mean age of onset of psychosis, at 17.2, was significantly early. These results strengthen the evidence that PARS cases differ from other patients with schizophrenia. Hypothesis-generating findings suggest that features of PARS may include a discrepancy between verbal and performance intelligence, and in females, an early age of onset. These findings provide a rationale for separating these phenotypes from others in future clinical, genetic and pathophysiologic studies of schizophrenia and in considering responses to treatment. Copyright © 2011 Elsevier B.V. All rights reserved.

The impact of the EU ETS on the sectoral innovation system for power generation technologies - Findings for Germany

International Nuclear Information System (INIS)

Rogge, Karoline S.; Hoffmann, Volker H.

2010-01-01

This paper provides an overview of early changes in the sectoral innovation system for power generation technologies which have been triggered by the European Emission Trading System (EU ETS). Based on a broad definition of the sector, our research analyses the impact of the EU ETS on the four building blocks 'knowledge and technologies', 'actors and networks', 'institutions', and 'demand' by combining two streams of literature, namely systems of innovation and environmental economics. Our analysis for Germany is based on 42 exploratory interviews with experts in the field of the EU ETS, the power sector, and technological innovation. We find that the EU ETS mainly affects the rate and direction of technological change of power generation technologies within the large-scale, coal-based power generation technological regime, to which carbon capture technologies are added as a new technological trajectory. While this impact can be interpreted as the defensive behaviour of incumbents, the observed changes should not be underestimated. We argue that the EU ETS' impact on corporate CO 2 culture and routines may prepare the ground for the transition to a low-carbon sectoral innovation system for power generation technologies.

Par Pond vegetation status Summer 1995 -- June survey descriptive summary

International Nuclear Information System (INIS)

Mackey, H.E. Jr.; Riley, R.S.

1995-06-01

The water level of Par Pond was lowered approximately 20 feet in mid-1991 in order to protect downstream residents from possible dam failure suggested by subsidence on the downstream slope of the dam and to repair the dam. This lowering exposed both emergent and nonemergent macrophyte beds to drying conditions resulting in extensive losses. A survey of the shoreline aquatic plant communities in June 1995, three months after the refilling of Par Pond to approximately 200 feet above mean sea level, indicated that much of the original plant communities and the intermediate shoreline communities present on the exposed sediments have been lost. The extensive old-field and emergent marsh communities that were present on the exposed shoreline during the drawdown have been flooded and much of the pre-drawdown Par Pond aquatic plant communities have not had sufficient time for re-establishment. The shoreline does, however, have extensive beds of maidencane which extend from the shoreline margin to areas as deep as 2 and perhaps 3 meters. Scattered individual plants of lotus and watershield are common and may indicate likely directions of future wetland development in Par Pond. In addition, within isolated coves, which apparently received ground water seepage and/or stream surface flows during the period of the Par Pond draw down, extensive beds of waterlilies and spike rush are common. Invasion of willow and red maple occurred along the lake shoreline as well. Although not absent from this survey, evidence of the extensive redevelopment of the large cattail and eel grass beds was not observed in this first survey of Par Pond. Future surveys during the growing seasons of 1995, 1996, and 1997 along with the evaluation of satellite date to map the areal extent of the macrophyte beds of Par Pond are planned

Climate for work group creativity and innovation: Norwegian validation of the team climate inventory (TCI).

Science.gov (United States)

Mathisen, Gro Ellen; Einarsen, Ståle; Jørstad, Kari; Brønnick, Kolbjørn S

2004-11-01

The present study assessed the psychometric properties and the validity of the Norwegian translation of the Team Climate Inventory (TCI). The TCI is a measure of climate for innovation within groups at work and is based on the four-factor theory of climate for innovation (West, 1990). Cronbach's alpha revealed satisfactory reliabilities and exploratory factor analysis successfully extracted the four original factors as well as a fifth factor that has also been reported in other studies (N = 195 teams from a wide range of professions). Results from confirmatory factor analysis, using a different sample (N = 106 teams from the Norwegian public postal service), suggested that the five-factor solution had the most parsimonious fit. Criterion validity was explored by correlating TCI scores from 92 post offices and 395 postal distribution teams with customer satisfaction scores. Significant positive relationships were found between three of four TCI scales and customer satisfaction.

PROJECT - RESOURCE MANAGEMENT OF INNOVATIONS IN EDUCATION: ANTHROPOLOGICAL PROJECTION

Directory of Open Access Journals (Sweden)

Galina Aleksandrovna Ignat’eva

2015-08-01

Full Text Available The purpose of the research was to denote a way to solve the problem of education mana-gement ΄s insufficient efficiency considered from the point of view of education opportunities to influence on the formation of mechanisms for sustainable development of society as a whole and its educational component. The concept «project-resource management of innovation in education» regarded on the basis of the anthropological project-transforming paradigm. Conceptually-categorical context presented by conceptual cluster composed of coordinated concepts «project», «resource», «educational reality», «organizational-resource potential», «project commonality». In the theoretical part of the study on the basis of analysis of the normative and exploratory approaches to educational innovations organization and management it was established the search approach ΄s leading role in the methodological substantiation of project-resource management. The study have indicated that in the presence of variable models of innovation management in education, corresponding to various predictive models of continuing education post-industrial society, project-resource management is an universal mechanism for the transition from separate innovation΄s precedents to the an authentic reality of innovative education. In the technological part of the study the main concern was to submit the project-resource management by the management goal’s system, each of which includes the specific management actions, projected results and the organizational forms. The project-resource management ΄s professional – activity context of the study showed evolution of managerial positions: an effective performer – an effective leader – strategist, implemented during the transition from directly directive management to the project management and further to the project-resource management. Based on the findings identified the key factors of initiatively-problem projects

48 CFR 652.219-72 - Department of State Mentor-Protégé Program.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Department of State Mentor....219-72 Department of State Mentor-Protégé Program. As prescribed in 619.202-70(o)(1), insert the following provision: Department of State Mentor-Protégé Program (APR 2004) (a) Large and small businesses...

[Ambroise Paré, his death and his historians].

Science.gov (United States)

Dumaître, P

2001-01-01

Ambroise Paré died December the 20th., 1590. What happened after his death and what are we knowing about his life? Never forgotten, though a lack of care, we were waiting till the XIXth. century to get recollection upon a subject sustained only by accounts of his travels. After Percy, a surgeon who tried to write Paré's biography through the "Biographie universelle ancienne et moderne, de Michaud (1822)" and some second rank authors, Malgaigne is the first who inside a printing of the "Oeuvres complétes de Paré (1840-41)" has a fine look upon the question, though his work is incomplete and allows many mistakes. Doctors Chéreau and Jal, an historian, analysing civil status records, gave new information enlarged by doctors Le Paulmier, Turner and the U.S. native Janet Doe.

Where are All the Female Innovators? Nurses as Innovators in a Public Sector Innovation

Directory of Open Access Journals (Sweden)

Johanna Nählinder

2010-03-01

Full Text Available The field of innovation does not see the innovator and is therefore gender-blind. Still, there is an implicit understanding of who is innovative, and this understanding includes gender and profession of the innovator. The female nurse is not seen as innovative and few innovation policies target her. The lack of innovativeness is due to many factors and two of these are tested empirically in this article: that women work in professions which are not associated with innovation and that women lack confidence to carry out innovative work. The empirical investigation presents evidence in line with both hypothesis and also notes that men and women ends their innovative efforts for different reasons. Therefore, innovation policy targeting these groups mobilises otherwise dormant potential innovators.

iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.

Bacterial mitosis: Partitioning protein ParA oscillates in spiral-shaped structures and positions plasmids at mid-cell

DEFF Research Database (Denmark)

Ebersbach, G.; Gerdes, Kenn

2004-01-01

The par2 locus of Escherichia coli plasmid pB171 encodes oscillating ATPase ParA, DNA binding protein ParB and two cis-acting DNA regions to which ParB binds (parC1 and parC2). Three independent techniques were used to investigate the subcellular localization of plasmids carrying par2. In cells......A-GFP oscillated in spiral-shaped structures. Amino acid substitutions in ParA simultaneously abolished ParA spiral formation, oscillation and either plasmid localization or plasmid separation at mid-cell. Therefore, our results suggest that ParA spirals position plasmids at the middle of the bacterial nucleoid...

Innovation af innovation

DEFF Research Database (Denmark)

Harste, Gorm

2009-01-01

, at innovation af innovationen forsøges gennemført på en måde, hvor tiden kræves at forholde sig til sin egen tidslighed i form af fremtid, nutid, fortid og ikke mindst i form af samtidighed. I tiden skal vi iagttage, hvordan vi iagttager tiden. Vi dobbelt-koder tiden på samme måde, som forskning forsker i...... organisationssystemerne. De to typer systemer kan noget helt bestemt med fænomenet tid. De kan synkronisere. Analyseres organisationssystemer ser vi, imidlertid at innovation kræver ro. Stærkt innovative systemer er militærsystemet og kunstsystemet, der også inddrages, og hvor vi ser paradokset mellem innovation og...... involution. Tid er med et medium og ikke et lufttomt rum. Tid er end ikke en gasart, men udgør et solidt fluidum, som samfundet bader i og flyder i, konstant i bevægelse. Reformer forudsætter former, og innovation forudsætter involution. Kun sådan muliggøres evolution....

LINEAR ACCELERATOR FOR USE IN RADIOTHERAPY TREATMENT: STUDY OF PROCESS INNOVATION IN A SUS HOSPITAL OF SERRA GAÚCHA

Directory of Open Access Journals (Sweden)

Andréa Cristina Fermiano Fidelis

2017-03-01

Full Text Available The growth of health structures and their complexity have led Clinical Engineering professionals to carry out studies to develop and implement health technology management programs. In this way, employees of this area, integrated with the health system teams, have contributed to make feasible the use of technologies that offer greater security, functionality and reliability. The radiotherapy area, with the increase in the incidence of new cases of cancer, together with the contingency of the financial resources for health, high cost and complexity of the equipment, motivate studies for its adequate management. This research aimed to identify the technologies applied in the radiotherapy treatment, in particular the linear accelerator, as well as the concept of innovation, innovation in services, innovation in processes and the competitiveness acquired with the aid of innovation. The method used in the research has a qualitative approach, with an exploratory and descriptive objective, with semistructured and open questions and involved bibliographic research on the topic of Innovation and on Linear Accelerator, document analysis, Unit of High Complexity in Oncology visit and interviews at the General Hospital of Caxias do Sul South, presenting, finally, the impacts suffered in the hospital and in the community after the arrival of the Line Accelerator. The results showed that there was process and product innovation, incrementally, in the services offered by the hospital.

TMS suppression of right pars triangularis, but not pars opercularis, improves naming in aphasia

Science.gov (United States)

Naeser, Margaret A.; Martin, Paula I.; Theoret, Hugo; Kobayashi, Masahito; Fregni, Felipe; Nicholas, Marjorie; Tormos, Jose M.; Steven, Megan S.; Baker, Errol H.; Pascual-Leone, Alvaro

2011-01-01

This study sought to discover if an optimum 1 cm2 area in the non-damaged right hemisphere (RH) was present, which could temporarily improve naming in chronic, nonfluent aphasia patients when suppressed with repetitive transcranial magnetic stimulation (rTMS). Ten minutes of slow, 1 Hz rTMS was applied to suppress different RH ROIs in eight aphasia cases. Picture naming and response time (RT) were examined before, and immediately after rTMS. In aphasia patients, suppression of right pars triangularis (PTr) led to significant increase in pictures named, and significant decrease in RT. Suppression of right pars opercularis (POp), however, led to significant increase in RT, but no change in number of pictures named. Eight normals named all pictures correctly; similar to aphasia patients, RT significantly decreased following rTMS to suppress right PTr, versus right POp. Differential effects following suppression of right PTr versus right POp suggest different functional roles for these regions. PMID:21864891

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...

Evaluation of 3 Inch SN-219 Failure and S and SX Tank Farm Saltwell Piping

International Nuclear Information System (INIS)

ELSEN, J.J.

2000-01-01

Evaluation of direct buried piping currently in use or designated for future Saltwell pumping in S and SX Farms. Documented evaluation of failed S-103 saltwell pumping transfer line 3 inch SN-219. This evaluation is intended to reflect current status of Saltwell piping, when taken in context with referenced documents

29 CFR 779.219 - Unified operation may be achieved without common control or common ownership.

Science.gov (United States)

2010-07-01

... Act May Apply; Enterprise Coverage Unified Operation Or Common Control § 779.219 Unified operation may... through “unified operation.” It is clear from the definition that if the described activities are performed through unified operation they will be part of the enterprise whether they are performed by one...

Rat beta-LPH, gamma-LPH and beta-endorphin biosynthesized by isolated cells of pars intermedia and pars distalis

International Nuclear Information System (INIS)

Gianoulakis, C.; Seidah, N.G.; Routhier, R.; Chretien, M.

1980-01-01

Rats pars intermedia cells were incubated for 3 h with the following amino-acids: a) 35 S-methionine and 3 H-phenylalamine; b) 3 H-valine; and c) 3 H-valine and 3 H-lysine. Radioactive gamma-lipotropin, beta-lipotropin and beta-endorphin were purified on carboxy- methyl-cellulose and characterized by polyacrylamide disc gel electrophoresis af pH 4.5, molecular weight estimation and microsequencing. Rat gamma-lipotropin was shown to differ slightly from ovine gamma-lipotropin in its NH 2 -terminal amino acid sequence, in containing no methionine and having phenylalanine at position 6, valine at positions 13 and 27, and lysine at position 20. The same variations were observed in the sequence of rat beta-lipotropin, while rat beta-endorphin was shown to be identical to the ovine beta-endorphin. Following a 3-h pulse of rat pars distalis, the cells were extracted with care to avoid beta-lipotropin degradation by proteolytic enzymes. A peptide was purified and identified to be rat beta-endorphin, thus demonstrating that beta-endorphin is biosynthesized in pars distalis and is not an extraction artifact. (author)

Identification of a new epitope in uPAR as a target for the cancer therapeutic monoclonal antibody ATN-658, a structural homolog of the uPAR binding integrin CD11b (αM.

Directory of Open Access Journals (Sweden)

Xiang Xu

Full Text Available The urokinase plasminogen activator receptor (uPAR plays a role in tumor progression and has been proposed as a target for the treatment of cancer. We recently described the development of a novel humanized monoclonal antibody that targets uPAR and has anti-tumor activity in multiple xenograft animal tumor models. This antibody, ATN-658, does not inhibit ligand binding (i.e. uPA and vitronectin to uPAR and its mechanism of action remains unclear. As a first step in understanding the anti-tumor activity of ATN-658, we set out to identify the epitope on uPAR to which ATN-658 binds. Guided by comparisons between primate and human uPAR, epitope mapping studies were performed using several orthogonal techniques. Systematic site directed and alanine scanning mutagenesis identified the region of aa 268-275 of uPAR as the epitope for ATN-658. No known function has previously been attributed to this epitope Structural insights into epitope recognition were obtained from structural studies of the Fab fragment of ATN-658 bound to uPAR. The structure shows that the ATN-658 binds to the DIII domain of uPAR, close to the C-terminus of the receptor, corroborating the epitope mapping results. Intriguingly, when bound to uPAR, the complementarity determining region (CDR regions of ATN-658 closely mimic the binding regions of the integrin CD11b (αM, a previously identified uPAR ligand thought to be involved in leukocyte rolling, migration and complement fixation with no known role in tumor progression of solid tumors. These studies reveal a new functional epitope on uPAR involved in tumor progression and demonstrate a previously unrecognized strategy for the therapeutic targeting of uPAR.

The protein kinase SIK downregulates the polarity protein Par3

DEFF Research Database (Denmark)

Vanlandewijck, Michael; Dadras, Mahsa Shahidi; Lomnytska, Marta

2018-01-01

on Par3. Functionally, this mechanism impacts on tight junction downregulation. Furthermore, SIK contributes to the loss of epithelial polarity and examination of advanced and invasive human cancers of diverse origin displayed high levels of SIK expression and a corresponding low expression of Par3...

Innovation

DEFF Research Database (Denmark)

Nielsen, Janni; Yaganeh, Suzanne; Bloch Rasmussen, Leif

2013-01-01

This paper contributes to a theoretical discussion of creation of innovation with participants in, or outside, organisations. We address the creation of innovation with a complex theoretical understanding drawing on the Scandinavian and the Participatory Design tradition introducing two approaches...... to the processes of innovation. We ask if innovation can be initiated and enhanced looking at two collaborative approaches; participatory innovation (PIN) and cooperative innovation (COIN). We invite to dialogue and reflections on PIN’s conflict and creative frictions on one side and COIN’s complexity......, complementarity in diversity and the didactic scaffolding of the innovation process on the other side. Our contribution focuses on the methods and practices for facilitation of co-creating activities between different groups leading to cooperation, and innovation in thinking....

PET imaging of urokinase-type plasminogen activator receptor (uPAR) in prostate cancer

DEFF Research Database (Denmark)

Skovgaard, Dorthe; Persson, Morten; Kjaer, Andreas

2016-01-01

Overexpression of urokinase-type plasminogen activator receptors (uPAR) represents an important biomarker for aggressiveness in most common malignant diseases, including prostate cancer (PC). Accordingly, uPAR expression either assessed directly in malignant PC tissue or assessed directly in plasma...... and prognostic imaging method. In this review, we will focus on the recent development of uPAR PET and the relevance within prostate cancer imaging. Novel antibody and small-molecule radiotracers-targeting uPAR, including a series of uPAR-targeting PET ligands, based on the high affinity peptide ligand AE105......, have been synthesized and tested in vitro and in vivo in preclinical murine xenograft models and, recently, in a first-ever clinical uPAR PET study in cancer patients, including patients with PC. In this phase I study, a high and specific uptake of the tracer 64Cu-DOTA-AE105 was found in both primary...

Exploratory multivariate analysis by example using R

CERN Document Server

Husson, Francois; Pages, Jerome

2010-01-01

Full of real-world case studies and practical advice, Exploratory Multivariate Analysis by Example Using R focuses on four fundamental methods of multivariate exploratory data analysis that are most suitable for applications. It covers principal component analysis (PCA) when variables are quantitative, correspondence analysis (CA) and multiple correspondence analysis (MCA) when variables are categorical, and hierarchical cluster analysis.The authors take a geometric point of view that provides a unified vision for exploring multivariate data tables. Within this framework, they present the prin

Exploratory Bi-factor Analysis: The Oblique Case

OpenAIRE

Jennrich, Robert L.; Bentler, Peter M.

2011-01-01

Bi-factor analysis is a form of confirmatory factor analysis originally introduced by Holzinger and Swineford (1937). The bi-factor model has a general factor, a number of group factors, and an explicit bi-factor structure. Jennrich and Bentler (2011) introduced an exploratory form of bi-factor analysis that does not require one to provide an explicit bi-factor structure a priori. They use exploratory factor analysis and a bi-factor rotation criterion designed to produce a rotated loading mat...

Barriers to using consumer science information in food technology innovations: An exploratory study using Delphi methodology

Directory of Open Access Journals (Sweden)

Marian E. Raley

2016-04-01

Full Text Available Food technology innovation has the potential to deliver many benefits to society, although some technologies have been problematic in terms of public acceptance. In promoting the commercial success of innovative technological processes and resultant products it will be important to incorporate information relating to consumer preferences and concerns during their development. The barriers to the utilisation of consumer information during technological development was explored using a two round Delphi study involving 75 experts with an interest in new food technology (food technologists and consumer scientists. There was overall agreement that consumer information should be used in technology implementation and product design, and that good communication between key actors at pivotal stages during the development of new food technologies and products was important. However disciplinary differences were perceived to be a barrier to communication, as were difficulties associated with producing consumer information usable by food technologists. A strategy to improve inter-disciplinary communication is proposed, involving the creation of multi-disciplinary teams working together throughout the development project’s duration, including those with interdisciplinary experience. Deficiencies in the specification of the information required from consumer scientists need to be overcome. Consumer science results need to be concrete and presented as salient to and usable by food technologists.

Dicty_cDB: Contig-U03373-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available gia romanica mitochondrial par... 62 8e-09 AJ344064_1( AJ344064 |pid:none) Plagiochila asplenioides mitochon...99526 |pid:none) Andreaea nivalis mitochondrial par... 62 8e-09 AJ299548_1( AJ299548 |pid:none) Plagio

Par3L enhances colorectal cancer cell survival by inhibiting Lkb1/AMPK signaling pathway

International Nuclear Information System (INIS)

Li, Taiyuan; Liu, Dongning; Lei, Xiong; Jiang, Qunguang

2017-01-01

Partitioning defective 3-like protein (Par3L) is a recently identified cell polarity protein that plays an important role in mammary stem cell maintenance. Previously, we showed that high expression of Par3L is associated with poor survival in malignant colorectal cancer (CRC), but the underlying mechanism remained unknown. To this end, we established a Par3L knockout colorectal cancer cell line using the CRISPR/Cas system. Interestingly, reduced proliferation, enhanced cell death and caspase-3 activation were observed in Par3L knockout (KO) cells as compared with wildtype (WT) cells. Consistent with previous studies, we showed that Par3L interacts with a tumor suppressor protein liver kinase B1 (Lkb1). Moreover, Par3L depletion resulted in abnormal activation of Lkb1/AMPK signaling cascade. Knockdown of Lkb1 in these cells could significantly reduce AMPK activity and partially rescue cell death caused by Par3L knockdown. Furthermore, we showed that Par3L KO cells were more sensitive to chemotherapies and irradiation. Together, these results suggest that Par3L is essential for colorectal cancer cell survival by inhibiting Lkb1/AMPK signaling pathway, and is a putative therapeutic target for CRC. - Highlights: • Par3L knockout using the CRISPR/Cas system induces apoptosis in colorectal cancer cells. • Par3L interacts with Lkb1 and regulates the activity of AMPK signaling cascade. • Par3L knockout cells are more sensitive to treatment of different chemotherapy drugs and irradiation.

Profils des enfants infectes par le vih en debut du traitement ...

African Journals Online (AJOL)

But : Décrire les profils des enfants infectés par le VIH au début du traitement antirétroviral. Matériels et méthode: Les dossiers des enfants infectés par le VIH dans la région maritime ont été analysés de mai 2008 à février 2010 par le comité thérapeutique. Résultats: Parmi les 96 dossiers analysés, 66,67% venaient du ...

From Innovation Community to Community Innovation User-initiated Innovation in Wireless Leiden

NARCIS (Netherlands)

van Oost, Elizabeth C.J.; Verhaegh, Stefan; Oudshoorn, Nelly E.J.

2009-01-01

The role of users in innovation processes has gained increasing attention in innovation studies, technology studies, and media studies. Scholars have identified users and use practices as a source of innovation. So far, however, little insight has been generated in innovation processes in which

Brief communication: Population variation in human maxillary premolar accessory ridges (MxPAR).

Science.gov (United States)

Burnett, Scott E; Hawkey, Diane E; Turner, Christy G

2010-02-01

The purpose of this brief communication is to report the results of an analysis of maxillary premolar accessory ridges (MxPAR), a common but understudied accessory ridge that may occur both mesial and distal to the central ridge of the buccal cusp of upper premolars. We developed a new five-grade scoring plaque to better categorize MxPAR variation. Subsequently, we conducted a population analysis of MxPAR frequency in 749 dental casts of South African Indian, American Chinese, Alaskan Eskimo, Tohono O'odham (Papago), Akimel O'odham (Pima), Solomon Islander, South African Bantu, and both American and South African Whites. Northeast Asian and Asian-derived populations exhibited the highest MxPAR frequencies while Indo-European samples (South African Indians, American and South African Whites) exhibited relatively low frequencies. The Solomon Islanders and South African Bantu samples exhibited intermediate frequencies. Our analysis indicates that statistically significant differences in MxPAR frequency exist between major geographic populations. As a result, the MxPAR plaque has now been added to the Arizona State University Dental Anthropology System, an important contribution as maxillary premolar traits are underrepresented in analyses of dental morphology. 2009 Wiley-Liss, Inc.

What Drives Innovativeness? Entrepreneurship and Regional Clustering in Three Biotechnology Hotspots L’entreprenariat et les réseaux régionaux d’entreprises, moteurs de l’innovation dans trois bioclusters

Directory of Open Access Journals (Sweden)

Jerry Haar

2009-10-01

Full Text Available Cet article s’attache à mettre en évidence le lien entre innovation, entreprenariat et développement de réseaux d’entreprises au sein de pôles régionaux. L’innovation y est ainsi abordée à la fois dans sa relation avec l’entreprenariat et dans sa dimension géographique. L’accent est plus particulièrement mis sur les facteurs et les forces qui alimentent l’innovation dans un secteur d’activité dont l’importance va croissant, celui des biotechnologies. L’exemple de trois pôles régionaux, respectivement situés autour de la Baie de San Francisco, à Boston et dans sa périphérie, et dans une zone couvrant une partie de la Pennsylvanie et la vallée de la Delaware, montre que l’innovation résulte de processus qui varient considérablement d’une région à l’autre. En effet, si les trois bioclusters qu’étudie l’article sont caractérisés par un taux élevé d’activité innovante, un équilibre différent dans chaque cas s’y est établi entre les variables liées à l’entreprenariat et celles qui sont relatives à la constitution d’un réseau régional d’entreprises. Il n’existe donc pas de formule éprouvée pour stimuler l’innovation. Une conclusion s’impose, toutefois : l’entreprenariat et la constitution de clusters sont des facteurs de première importance.

Intoxication par la paraphényléne-diamine

African Journals Online (AJOL)

raoul

9 mars 2011 ... remède contre la douleur par Averbukh [8], ou contre la constipation par Schemesh [9], mais l´utilisation à des fins autolytique reste toujours prédominante. Le tableau clinique de l´intoxication à ... une anurie ayant nécessité le recours à l´hémodialyse. Ce taux de survenue d´IRA anurique est relativement ...

Exploratory wine consumer behavior in a transitional market: The case of Poland

Directory of Open Access Journals (Sweden)

Renata Schaefer

2018-06-01

Full Text Available This paper investigates exploratory behavior among wine consumers in Poland where the country's wine culture is in a state of rapid change. This study investigates the extent to which demographics, values, and wine preferences relate to exploratory behavior.Data obtained from 198 Polish wine consumers was used in the analysis. Exploratory behavior was measured using the VARSEEK scale adapted to wine. Other measures included the Schwartz Value Inventory, wine knowledge and involvement, and measures relevant for wine purchasing behavior. Demographic variables were also used to profile consumers.The findings show that Polish wine consumers’ level of exploratory behavior is not related to demographics, but is influenced by personal values. The consumers who were most likely to engage in exploratory behavior valued creativity, fun, and risk taking and were less concerned about behaving properly. They also had more global outlook as they were more likely to purchase wine in other countries and desired more wines from regions outside Poland.The findings are useful for wine marketers when developing strategies for wine consumers in transitional markets based on their unique needs and expectations.This is the first known research conducted in Poland focusing on wine consumers’ exploratory behavior and subsequent wine preferences. Keywords: Polish wine market, Consumer behavior, Exploratory behavior, Consumer segmentation

Social Enterprises in Brazil: Socially Produced Knowledge Versus Social Innovation.

Directory of Open Access Journals (Sweden)

Edileusa Godói-de-Sousa

2013-04-01

Full Text Available This study investigated whether socially produced knowledge in social ventures in Brazil has promoted social innovation and local development. The research is exploratory and descriptive, and was developed in two stages. At first, the sample group was composed of 378 projects selected from the mapping of Solidarity Economic Enterprises, conducted by the National Secretary of Solidarity Economy (Secretaria Nacional de Economia Solidária. The sample was surveyed to verify the main characteristics of these enterprises. After that, interviews were conducted with key managers in a sample of 32 projects. The results indicate challenges in the long path of favoring dynamic learning, with a generation of knowledge from the collective experiences of socialization: there is a lack of joint discussion and a predominance of individualized learning actions.

Sustainable Innovation: A Competitive Advantage for Innovation Ecosystems

OpenAIRE

Oksanen, Kaisa; Hautamäki, Antti

2015-01-01

In this article, we elaborate the emerging concept of sustainable innovation and analyze the relevance of innovation as a means to solve wicked problems and enhancing sustainable well-being. We also examine the changing conditions for innovation creation: building global knowledge hubs and local innovation ecosystems. As a result, the drivers of innovation and opportunities to utilize the untapped innovation potential of people outside traditional innovation contexts are expand...

Group Innovation Ability of Agricultural Technological Innovation Strategic Alliance

Institute of Scientific and Technical Information of China (English)

Chishun; MA; Jintian; YU

2013-01-01

Agricultural technological innovation strategic alliance, as an important form of strategic alliance, has steadily strengthened the collaborative management among organizations and raised competitive power with the backing of improved group innovation ability. This article studies innovation ability from individual innovation ability to the group innovation ability. Firstly, basic connotation of group innovation ability is to be concluded through the comparison of individual and group innovation ability. Secondly, evaluation index system is to be established based on the influencing factors of the group innovation ability of agricultural technological innovation strategic alliance and evaluation is based on three dimensions, namely organization technological innovation ability, alliance collaborative innovation ability as well as innovation environment. Furthermore, basic methods for promoting the group innovation ability of alliance are to be proposed.

40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...

Profiling gene expression induced by protease-activated receptor 2 (PAR2 activation in human kidney cells.

Directory of Open Access Journals (Sweden)

Jacky Y Suen

Full Text Available Protease-Activated Receptor-2 (PAR2 has been implicated through genetic knockout mice with cytokine regulation and arthritis development. Many studies have associated PAR2 with inflammatory conditions (arthritis, airways inflammation, IBD and key events in tumor progression (angiogenesis, metastasis, but they have relied heavily on the use of single agonists to identify physiological roles for PAR2. However such probes are now known not to be highly selective for PAR2, and thus precisely what PAR2 does and what mechanisms of downstream regulation are truly affected remain obscure. Effects of PAR2 activation on gene expression in Human Embryonic Kidney cells (HEK293, a commonly studied cell line in PAR2 research, were investigated here by comparing 19,000 human genes for intersecting up- or down-regulation by both trypsin (an endogenous protease that activates PAR2 and a PAR2 activating hexapeptide (2f-LIGRLO-NH(2. Among 2,500 human genes regulated similarly by both agonists, there were clear associations between PAR2 activation and cellular metabolism (1,000 genes, the cell cycle, the MAPK pathway, HDAC and sirtuin enzymes, inflammatory cytokines, and anti-complement function. PAR-2 activation up-regulated four genes more than 5 fold (DUSP6, WWOX, AREG, SERPINB2 and down-regulated another six genes more than 3 fold (TXNIP, RARG, ITGB4, CTSD, MSC and TM4SF15. Both PAR2 and PAR1 activation resulted in up-regulated expression of several genes (CD44, FOSL1, TNFRSF12A, RAB3A, COPEB, CORO1C, THBS1, SDC4 known to be important in cancer. This is the first widespread profiling of specific activation of PAR2 and provides a valuable platform for better understanding key mechanistic roles of PAR2 in human physiology. Results clearly support the development of both antagonists and agonists of human PAR2 as potential disease modifying therapeutic agents.

par genes in Mycobacterium bovis and Mycobacterium smegmatis are arranged in an operon transcribed from "SigGC" promoters

Directory of Open Access Journals (Sweden)

Casart Yveth

2008-03-01

Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.

Innovation in retail: impact on creating a positive experience when buying fashion products

Directory of Open Access Journals (Sweden)

Cristinel Vasiliu

2015-05-01

Full Text Available Innovation in fashion retail is critical in order to ensure competitive advantage in a constantly evolving market, in terms of consumer expectations. The modern customer is mobile, permanently connected to the Internet, well-informed about international trends, mindful of the quality of products, but more price sensitive and less loyal to a brand. The shopping experience provided by retailers is a crucial factor in purchase decision, encompassing all these variables in a complex concept of exogenous variable. As retailers’ efforts to provide excellence in shopping experience are focused on operating costs and thus on the profit margins, it is important to consider and identify which are the most relevant variables that form the perception of excellence for Romanian customers, so that retailers can innovate according to their expectations. The purpose of this article was to highlight the role of innovation in creating a positive experience for consumers buying clothes, shoes and accessories. The approach was based on the conduct of exploratory research. The research ? represented by five original objectives and as many different working scenarios ? resulted in the identification of thematic outlined exploratory opinions, exploiting a first investigation of its kind in Romania, less Pearson coefficients used in the analysis of ordinal variables or hierarchical, but quickly assessed using SPSS, version 21. As a pioneering research emphasis was on identifying potential associations and quantified correlations and less on rigorous delimitation of exogenous or endogenous quality in general, leaving room for future studies, sharper and with a higher degree of representation. Thus, we could highlight some useful aspects of the investigated retailers, by the dominant character of interested customers’ opinions according to their volunteer responses. Consumers are accustomed to using the Internet to obtain information; they rarely express opinions on

The work of local healthcare innovation: a qualitative study of GP-led integrated diabetes care in primary health care.

Science.gov (United States)

Foster, Michele; Burridge, Letitia; Donald, Maria; Zhang, Jianzhen; Jackson, Claire

2016-01-14

Service delivery innovation is at the heart of efforts to combat the growing burden of chronic disease and escalating healthcare expenditure. Small-scale, locally-led service delivery innovation is a valuable source of learning about the complexities of change and the actions of local change agents. This exploratory qualitative study captures the perspectives of clinicians and managers involved in a general practitioner-led integrated diabetes care innovation. Data on these change agents' perspectives on the local innovation and how it works in the local context were collected through focus groups and semi-structured interviews at two primary health care sites. Transcribed data were analysed thematically. Normalization Process Theory provided a framework to explore perspectives on the individual and collective work involved in putting the innovation into practice in local service delivery contexts. Twelve primary health care clinicians, hospital-based medical specialists and practice managers participated in the study, which represented the majority involved in the innovation at the two sites. The thematic analysis highlighted three main themes of local innovation work: 1) trusting and embedding new professional relationships; 2) synchronizing services and resources; and 3) reconciling realities of innovation work. As a whole, the findings show that while locally-led service delivery innovation is designed to respond to local problems, convincing others to trust change and managing the boundary tensions is core to local work, particularly when it challenges taken-for-granted practices and relationships. Despite this, the findings also show that local innovators can and do act in both discretionary and creative ways to progress the innovation. The use of Normalization Process Theory uncovered some critical professional, organizational and structural factors early in the progression of the innovation. The key to local service delivery innovation lies in building

Open innovation with an effective open innovation team.

OpenAIRE

Vanvoorden, Jonas

2014-01-01

This master's thesis explores how open innovation teams can successfully support open innovation inside of an organisation. Open innovation is a paradigm introduced by Henry Chesbrough (2003) a decade ago. It expands the innovation potential of organisations by opening them up to new ways of working with external partners. To implement open innovation, many companies rely on a small group of managers named open innovation teams. Although open innovation teams can potentially be vital for impl...

Par-4-mediated recruitment of Amida to the actin cytoskeleton leads to the induction of apoptosis

International Nuclear Information System (INIS)

Boosen, Meike; Vetterkind, Susanne; Koplin, Ansgar; Illenberger, Susanne; Preuss, Ute

2005-01-01

Par-4 (prostate apoptosis response-4) sensitizes cells to apoptotic stimuli, but the exact mechanisms are still poorly understood. Using Par-4 as bait in a yeast two-hybrid screen, we identified Amida as a novel interaction partner, a ubiquitously expressed protein which has been suggested to be involved in apoptotic processes. Complex formation of Par-4 and Amida occurs in vitro and in vivo and is mediated via the C-termini of both proteins, involving the leucine zipper of Par-4. Amida resides mainly in the nucleus but displays nucleo-cytoplasmic shuttling in heterokaryons. Upon coexpression with Par-4 in REF52.2 cells, Amida translocates to the cytoplasm and is recruited to actin filaments by Par-4, resulting in enhanced induction of apoptosis. The synergistic effect of Amida/Par-4 complexes on the induction of apoptosis is abrogated when either Amida/Par-4 complex formation or association of these complexes with the actin cytoskeleton is impaired, indicating that the Par-4-mediated relocation of Amida to the actin cytoskeleton is crucial for the pro-apoptotic function of Par-4/Amida complexes in REF52.2 cells. The latter results in enhanced phosphorylation of the regulatory light chain of myosin II (MLC) as has previously been shown for Par-4-mediated recruitment of DAP-like kinase (Dlk), suggesting that the recruitment of nuclear proteins involved in the regulation of apoptotic processes to the actin filament system by Par-4 represents a potent mechanism how Par-4 can trigger apoptosis

Improving Alcohol Screening for College Students: Screening for Alcohol Misuse amongst College Students with a Simple Modification to the CAGE Questionnaire

Science.gov (United States)

Taylor, Purcell; El-Sabawi, Taleed; Cangin, Causenge

2016-01-01

Objective: To improve the CAGE (Cut down, Annoyed, Guilty, Eye opener) questionnaire's predictive accuracy in screening college students. Participants: The sample consisted of 219 midwestern university students who self-administered a confidential survey. Methods: Exploratory factor analysis, confirmatory factor analysis, receiver operating…

Se démarquer dans l’industrie du bien-être. Transnationalisme, innovation et indianité Standing out in the wellness industry. Transnationalism, innovation and indianness

Directory of Open Access Journals (Sweden)

Laurent Pordié

2011-11-01

Full Text Available L’industrie du bien-être se caractérise à la fois par un fort potentiel d’innovation dans le domaine thérapeutique et par une prétention à l’ancienneté de ces nouvelles thérapies. Cet article propose d’analyser ce paradoxe en étudiant les logiques à l’œuvre dans la construction d’une marque identifiant et distinguant Mango Spa, une chaîne indienne de centres de soins et de remise en forme. Il s’intéresse aux sens et aux implications de l’innovation thérapeutique dans le cas d’une firme qui revendique l’authenticité de ses traitements tout en puisant dans des ressources d’influences multiples afin de s’adapter à une clientèle cosmopolite. Ces services et ces produits fondent leur légitimité sur la tradition ayurvédique, mais ils doivent toutefois la défier afin d’acquérir leur propre visibilité. C’est ainsi que Mango Spa se démarque de ses concurrents. De nouvelles thérapies « indiennes » sont créées en mobilisant clients internationaux, thérapeutes de cultures disparates et industriels établis hors de l’Inde. La marque est produite au travers d’un faisceau complexe de relations transnationales. En examinant les forces globales et le caractère multidimensionnel de la production d’une marque indienne, cet article renseigne plus généralement sur la circulation et la transformation des idées, des objets et des pratiques.The wellness industry is characterized by both a high innovation potential in the therapeutic field and a claim to the antiquity of these new therapies. This article aims to analyze this paradox by studying the logic at work in the construction of a brand identifying and distinguishing Mango Spa, an Indian chain of health and fitness centers. Particularly interesting are the meanings and implications of therapeutic innovation in the case of a firm claiming the authenticity of its treatments while drawing on multiples resources and influences to adapt them to a

Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...

Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...

Prognostic value of suPAR and hs-CRP on cardiovascular disease

DEFF Research Database (Denmark)

Diederichsen, Marie Zöga; Diederichsen, Søren Zöga; Mickley, Hans

2018-01-01

Background and aims: Studies have shown that soluble urokinase Plasminogen Activator Receptor (suPAR) and CRP (both inflammatory markers) and coronary artery calcification (CAC) are independent risk predictors for cardiovascular (CV) disease. The aim of this study is to assess whether suPAR and CRP...... have an increased predictive prognostic value beyond the traditional CV risk factors and the CAC score. Methods: A population sample of 1179 subjects, free of CV disease was included. The subjects underwent traditional CV risk evaluation, CAC assessment and blood sampling for suPAR and CRP. CV events...

mTORC2 activation is regulated by the urokinase receptor (uPAR) in bladder cancer.

Science.gov (United States)

Hau, Andrew M; Leivo, Mariah Z; Gilder, Andrew S; Hu, Jing-Jing; Gonias, Steven L; Hansel, Donna E

2017-01-01