WorldWideScience

Sample records for panorama phylogenetic diversity

  1. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  3. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  4. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  5. Maximizing the phylogenetic diversity of seed banks.

    Science.gov (United States)

    Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard

    2015-04-01

    Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.

  6. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  7. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  8. A comparative test of phylogenetic diversity indices.

    Science.gov (United States)

    Schweiger, Oliver; Klotz, Stefan; Durka, Walter; Kühn, Ingolf

    2008-09-01

    Traditional measures of biodiversity, such as species richness, usually treat species as being equal. As this is obviously not the case, measuring diversity in terms of features accumulated over evolutionary history provides additional value to theoretical and applied ecology. Several phylogenetic diversity indices exist, but their behaviour has not yet been tested in a comparative framework. We provide a test of ten commonly used phylogenetic diversity indices based on 40 simulated phylogenies of varying topology. We restrict our analysis to a topological fully resolved tree without information on branch lengths and species lists with presence-absence data. A total of 38,000 artificial communities varying in species richness covering 5-95% of the phylogenies were created by random resampling. The indices were evaluated based on their ability to meet a priori defined requirements. No index meets all requirements, but three indices turned out to be more suitable than others under particular conditions. Average taxonomic distinctness (AvTD) and intensive quadratic entropy (J) are calculated by averaging and are, therefore, unbiased by species richness while reflecting phylogeny per se well. However, averaging leads to the violation of set monotonicity, which requires that species extinction cannot increase the index. Total taxonomic distinctness (TTD) sums up distinctiveness values for particular species across the community. It is therefore strongly linked to species richness and reflects phylogeny per se weakly but satisfies set monotonicity. We suggest that AvTD and J are best applied to studies that compare spatially or temporally rather independent communities that potentially vary strongly in their phylogenetic composition-i.e. where set monotonicity is a more negligible issue, but independence of species richness is desired. In contrast, we suggest that TTD be used in studies that compare rather interdependent communities where changes occur more gradually by

  9. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  10. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  11. Phylogenetically diverse macrophyte community promotes species diversity of mobile epi-benthic invertebrates

    Science.gov (United States)

    Nakamoto, Kenta; Hayakawa, Jun; Kawamura, Tomohiko; Kodama, Masafumi; Yamada, Hideaki; Kitagawa, Takashi; Watanabe, Yoshiro

    2018-07-01

    Various aspects of plant diversity such as species diversity and phylogenetic diversity enhance the species diversity of associated animals in terrestrial systems. In marine systems, however, the effects of macrophyte diversity on the species diversity of associated animals have received little attention. Here, we sampled in a subtropical seagrass-seaweed mixed bed to elucidate the effect of the macrophyte phylogenetic diversity based on the taxonomic relatedness as well as the macrophyte species diversity on species diversity of mobile epi-benthic invertebrates. Using regression analyses for each macrophyte parameter as well as multiple regression analyses, we found that the macrophyte phylogenetic diversity (taxonomic diversity index: Delta) positively influenced the invertebrate species richness and diversity index (H‧). Although the macrophyte species richness and H‧ also positively influenced the invertebrate species richness, the best fit model for invertebrate species richness did not include them, suggesting that the macrophyte species diversity indirectly influenced invertebrate species diversity. Possible explanations of the effects of macrophyte Delta on the invertebrate species diversity were the niche complementarity effect and the selection effect. This is the first study which demonstrates that macrophyte phylogenetic diversity has a strong effect on the species diversity of mobile epi-benthic invertebrates.

  12. The mean and variance of phylogenetic diversity under rarefaction

    OpenAIRE

    Nipperess, David A.; Matsen, Frederick A.

    2013-01-01

    Phylogenetic diversity (PD) depends on sampling intensity, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD. We have derived exact formulae for t...

  13. Host specialization and phylogenetic diversity of Corynespora cassiicola.

    Science.gov (United States)

    Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E

    2009-09-01

    The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya.

  14. Fast Computations for Measures of Phylogenetic Beta Diversity.

    Directory of Open Access Journals (Sweden)

    Constantinos Tsirogiannis

    Full Text Available For many applications in ecology, it is important to examine the phylogenetic relations between two communities of species. More formally, let [Formula: see text] be a phylogenetic tree and let A and B be two samples of its tips, representing the examined communities. We want to compute a value that expresses the phylogenetic diversity between A and B in [Formula: see text]. There exist several measures that can do this; these are the so-called phylogenetic beta diversity (β-diversity measures. Two popular measures of this kind are the Community Distance (CD and the Common Branch Length (CBL. In most applications, it is not sufficient to compute the value of a beta diversity measure for two communities A and B; we also want to know if this value is relatively large or small compared to all possible pairs of communities in [Formula: see text] that have the same size. To decide this, the ideal approach is to compute a standardised index that involves the mean and the standard deviation of this measure among all pairs of species samples that have the same number of elements as A and B. However, no method exists for computing exactly and efficiently this index for CD and CBL. We present analytical expressions for computing the expectation and the standard deviation of CD and CBL. Based on these expressions, we describe efficient algorithms for computing the standardised indices of the two measures. Using standard algorithmic analysis, we provide guarantees on the theoretical efficiency of our algorithms. We implemented our algorithms and measured their efficiency in practice. Our implementations compute the standardised indices of CD and CBL in less than twenty seconds for a hundred pairs of samples on trees with 7 ⋅ 10(4 tips. Our implementations are available through the R package PhyloMeasures.

  15. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  16. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  17. Incorporating phylogenetic information for the definition of floristic districts in hyper-diverse Amazon forests: implications for conservation

    NARCIS (Netherlands)

    Guevara, J.E.; Pitman, N.C.A.; ter Steege, H.; Mogollón, H.; Ceron, C.; Palacios, W.; Oleas, N.; Fine, P.V.A.

    2017-01-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the

  18. Turnover of plant lineages shapes herbivore phylogenetic beta diversity along ecological gradients.

    Science.gov (United States)

    Pellissier, Loïc; Ndiribe, Charlotte; Dubuis, Anne; Pradervand, Jean-Nicolas; Salamin, Nicolas; Guisan, Antoine; Rasmann, Sergio

    2013-05-01

    Understanding drivers of biodiversity patterns is of prime importance in this era of severe environmental crisis. More diverse plant communities have been postulated to represent a larger functional trait-space, more likely to sustain a diverse assembly of herbivore species. Here, we expand this hypothesis to integrate environmental, functional and phylogenetic variation of plant communities as factors explaining the diversity of lepidopteran assemblages along elevation gradients in the Swiss Western Alps. According to expectations, we found that the association between butterflies and their host plants is highly phylogenetically structured. Multiple regression analyses showed the combined effect of climate, functional traits and phylogenetic diversity in structuring butterfly communities. Furthermore, we provide the first evidence that plant phylogenetic beta diversity is the major driver explaining butterfly phylogenetic beta diversity. Along ecological gradients, the bottom up control of herbivore diversity is thus driven by phylogenetically structured turnover of plant traits as well as environmental variables. © 2013 Blackwell Publishing Ltd/CNRS.

  19. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  20. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).

  1. Characteristics of phylogenetic diversity in airborne bacterial populations in China

    Science.gov (United States)

    Chaudhry, Zahra; Santarpia, Joshua L.; Martins, J. V.

    2011-05-01

    Considering their potential implications for human health, agricultural productivity, and ecosystem stability, surprisingly little is known about the composition or dynamics of the atmosphere's biological aerosols. The few studies that have examined phylogenetic diversity in China focused on a single sampling period, whereas this study spans 3 months and includes over 300 samples. The 300+ samples were categorized by month and direction of their back-trajectory. DNA extraction was carried out on the pooled samples in a quantitative manner to allow for comparison between the amount of extracted material and the amount of initial total aerosol mass. Within an individual month, samples originating from similar land types and approximately equidistant to the sampling location exhibited similar diversity, whereas samples originating from much greater distances and from different land types included phyla unique to that location. Phyla from the same origin also varied from one month to the next. The biological diversity found from the Phylochips reinforces the hypothesis that air samples carry a biological record of their history.

  2. The mean and variance of phylogenetic diversity under rarefaction.

    Science.gov (United States)

    Nipperess, David A; Matsen, Frederick A

    2013-06-01

    Phylogenetic diversity (PD) depends on sampling depth, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD.We have derived exact formulae for the mean and variance of PD under rarefaction. We confirm that these formulae are correct by comparing exact solution mean and variance to that calculated by repeated random (Monte Carlo) subsampling of a dataset of stem counts of woody shrubs of Toohey Forest, Queensland, Australia. We also demonstrate the application of the method using two examples: identifying hotspots of mammalian diversity in Australasian ecoregions, and characterising the human vaginal microbiome.There is a very high degree of correspondence between the analytical and random subsampling methods for calculating mean and variance of PD under rarefaction, although the Monte Carlo method requires a large number of random draws to converge on the exact solution for the variance.Rarefaction of mammalian PD of ecoregions in Australasia to a common standard of 25 species reveals very different rank orderings of ecoregions, indicating quite different hotspots of diversity than those obtained for unrarefied PD. The application of these methods to the vaginal microbiome shows that a classical score used to quantify bacterial vaginosis is correlated with the shape of the rarefaction curve.The analytical formulae for the mean and variance of PD under rarefaction are both exact and more efficient than repeated subsampling. Rarefaction of PD allows for many applications where comparisons of samples of different depth is required.

  3. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    Science.gov (United States)

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  4. Continental scale patterns and predictors of fern richness and phylogenetic diversity

    Directory of Open Access Journals (Sweden)

    Nathalie eNagalingum

    2015-04-01

    Full Text Available Because ferns have a wide range of habitat preferences and are widely distributed, they are an ideal group for understanding how diversity is distributed. Here we examine fern diversity on a broad-scale using standard and corrected richness measures as well as phylogenetic indices; in addition we determine the environmental predictors of each diversity metric. Using the combined records of Australian herbaria, a dataset of over 60,000 records was obtained for 89 genera to infer richness. A phylogenetic tree of all the genera was constructed and combined with the herbarium records to obtain phylogenetic diversity patterns. A hotspot of both taxic and phylogenetic diversity occurs in the Wet Tropics of northeastern Australia. Although considerable diversity is distributed along the eastern coast, some important regions of diversity are identified only after sample-standardization of richness and through the phylogenetic metric. Of all of the metrics, annual precipitation was identified as the most explanatory variable, in part, in agreement with global and regional fern studies. Precipitation was combined with a different variable for each different metric. For corrected richness, precipitation is combined with temperature seasonality, while correlation of phylogenetic diversity to precipitation plus radiation indicates support for the species-energy hypothesis. Significantly high and significantly low phylogenetic diversity were found in geographically separate areas. These areas are correlated with different climatic conditions such as seasonality in precipitation. The use of phylogenetic metrics identifies additional areas of significant diversity, some of which have not been revealed using traditional taxonomic analyses, suggesting that different ecological and evolutionary processes have operated over the continent. Our study demonstrates that it is possible and vital to incorporate evolutionary metrics when inferring biodiversity hotspots

  5. Phylogenetic diversity of macromycetes and woody plants along an elevational gradient in Eastern Mexico

    Science.gov (United States)

    Marko Gomez-Hernandez; Guadalupe Williams-Linera; D. Jean Lodge; Roger Guevara; Eduardo Ruiz-Sanchez; Etelvina Gandara

    2016-01-01

    Phylogenetic information provides insight into the ecological and evolutionary processes that organize species assemblages. We compared patterns of phylogenetic diversity among macromycete and woody plant communities along a steep elevational gradient in eastern Mexico to better understand the evolutionary processes that structure their communities. Macrofungi and...

  6. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Directory of Open Access Journals (Sweden)

    Bráulio A Santos

    Full Text Available Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (<80 ha forest fragments. This was attributed to a reduction of 11% in the average phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  7. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Science.gov (United States)

    Santos, Bráulio A; Arroyo-Rodríguez, Víctor; Moreno, Claudia E; Tabarelli, Marcelo

    2010-09-08

    Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  8. Phylogenetic and chemical diversity of MAR4 streptomycete lineage

    Directory of Open Access Journals (Sweden)

    Marisa Paulino

    2014-06-01

    To date, phylogenetic characterization of 6 representative isolates, based on partial sequence of gene encoding 16S rRNA, confirm that these strains belong to the specie Streptomyces aculeolatus. Figure 2. Neighbour-joining phylogenetic tree created from 6 partial 16S rRNA gene sequence from Streptomyces aculeolatus strains cultured from Madeira Archipelago, based on 1000 bootstrap replicates. BLAST matches (deposited in GenBank are included with species and strain name followed by accession number. Verrucosispora maris and Micromonospora aurantiaca were used as outgroups.

  9. Local-scale Partitioning of Functional and Phylogenetic Beta Diversity in a Tropical Tree Assemblage.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Zhang, Guocheng; Ci, Xiuqin; Cao, Min; Sha, Liqing; Li, Jie; Ferry Slik, J W; Lin, Luxiang

    2015-08-03

    The relative degree to which stochastic and deterministic processes underpin community assembly is a central problem in ecology. Quantifying local-scale phylogenetic and functional beta diversity may shed new light on this problem. We used species distribution, soil, trait and phylogenetic data to quantify whether environmental distance, geographic distance or their combination are the strongest predictors of phylogenetic and functional beta diversity on local scales in a 20-ha tropical seasonal rainforest dynamics plot in southwest China. The patterns of phylogenetic and functional beta diversity were generally consistent. The phylogenetic and functional dissimilarity between subplots (10 × 10 m, 20 × 20 m, 50 × 50 m and 100 × 100 m) was often higher than that expected by chance. The turnover of lineages and species function within habitats was generally slower than that across habitats. Partitioning the variation in phylogenetic and functional beta diversity showed that environmental distance was generally a better predictor of beta diversity than geographic distance thereby lending relatively more support for deterministic environmental filtering over stochastic processes. Overall, our results highlight that deterministic processes play a stronger role than stochastic processes in structuring community composition in this diverse assemblage of tropical trees.

  10. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  11. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities

    Directory of Open Access Journals (Sweden)

    Anthony Stuart Amend

    2015-02-01

    Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.

  12. Phylogenetic and Functional Diversity of Fleshy-Fruited Plants Are Positively Associated with Seedling Diversity in a Tropical Montane Forest

    Directory of Open Access Journals (Sweden)

    Marcia C. Muñoz

    2017-08-01

    Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of

  13. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  14. High phylogenetic diversity is preserved in species-poor high-elevation temperate moth assemblages

    NARCIS (Netherlands)

    Zou, Yi; Sang, Weiguo; Hausmann, Axel; Axmacher, Jan Christoph

    2016-01-01

    Understanding the diversity and composition of species assemblages and identifying underlying biotic and abiotic determinants represent great ecological challenges. Addressing some of these issues, we investigated the α-diversity and phylogenetic composition of species-rich geometrid moth

  15. Soil phosphorus heterogeneity promotes tree species diversity and phylogenetic clustering in a tropical seasonal rainforest.

    Science.gov (United States)

    Xu, Wumei; Ci, Xiuqin; Song, Caiyun; He, Tianhua; Zhang, Wenfu; Li, Qiaoming; Li, Jie

    2016-12-01

    The niche theory predicts that environmental heterogeneity and species diversity are positively correlated in tropical forests, whereas the neutral theory suggests that stochastic processes are more important in determining species diversity. This study sought to investigate the effects of soil nutrient (nitrogen and phosphorus) heterogeneity on tree species diversity in the Xishuangbanna tropical seasonal rainforest in southwestern China. Thirty-nine plots of 400 m 2 (20 × 20 m) were randomly located in the Xishuangbanna tropical seasonal rainforest. Within each plot, soil nutrient (nitrogen and phosphorus) availability and heterogeneity, tree species diversity, and community phylogenetic structure were measured. Soil phosphorus heterogeneity and tree species diversity in each plot were positively correlated, while phosphorus availability and tree species diversity were not. The trees in plots with low soil phosphorus heterogeneity were phylogenetically overdispersed, while the phylogenetic structure of trees within the plots became clustered as heterogeneity increased. Neither nitrogen availability nor its heterogeneity was correlated to tree species diversity or the phylogenetic structure of trees within the plots. The interspecific competition in the forest plots with low soil phosphorus heterogeneity could lead to an overdispersed community. However, as heterogeneity increase, more closely related species may be able to coexist together and lead to a clustered community. Our results indicate that soil phosphorus heterogeneity significantly affects tree diversity in the Xishuangbanna tropical seasonal rainforest, suggesting that deterministic processes are dominant in this tropical forest assembly.

  16. Cyanobacterial nitrogenases: phylogenetic diversity, regulation and functional predictions

    Directory of Open Access Journals (Sweden)

    Alberto A. Esteves-Ferreira

    2017-03-01

    Full Text Available Abstract Cyanobacteria is a remarkable group of prokaryotic photosynthetic microorganisms, with several genera capable of fixing atmospheric nitrogen (N2 and presenting a wide range of morphologies. Although the nitrogenase complex is not present in all cyanobacterial taxa, it is spread across several cyanobacterial strains. The nitrogenase complex has also a high theoretical potential for biofuel production, since H2 is a by-product produced during N2 fixation. In this review we discuss the significance of a relatively wide variety of cell morphologies and metabolic strategies that allow spatial and temporal separation of N2 fixation from photosynthesis in cyanobacteria. Phylogenetic reconstructions based on 16S rRNA and nifD gene sequences shed light on the evolutionary history of the two genes. Our results demonstrated that (i sequences of genes involved in nitrogen fixation (nifD from several morphologically distinct strains of cyanobacteria are grouped in similarity with their morphology classification and phylogeny, and (ii nifD genes from heterocytous strains share a common ancestor. By using this data we also discuss the evolutionary importance of processes such as horizontal gene transfer and genetic duplication for nitrogenase evolution and diversification. Finally, we discuss the importance of H2 synthesis in cyanobacteria, as well as strategies and challenges to improve cyanobacterial H2 production.

  17. Evolution and Phylogenetic Diversity of Yam Species (Dioscorea spp.: Implication for Conservation and Agricultural Practices.

    Directory of Open Access Journals (Sweden)

    Marie Florence Sandrine Ngo Ngwe

    Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.

  18. Decoupling phylogenetic and functional diversity to reveal hidden signals in community assembly

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Šmilauer, P.; Diniz-Filho, J. A. F.; Carmona, C. P.; Lososová, Z.; Herben, Tomáš; Götzenberger, Lars

    2017-01-01

    Roč. 8, č. 10 (2017), s. 1200-1211 ISSN 2041-210X R&D Projects: GA ČR(CZ) GA16-15012S; GA ČR GB14-36079G EU Projects: European Commission(XE) 267243 Institutional support: RVO:67985939 Keywords : community ecology * phylogenetic diversity * functional diversity Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 5.708, year: 2016

  19. White-tailed deer are a biotic filter during community assembly, reducing species and phylogenetic diversity.

    Science.gov (United States)

    Begley-Miller, Danielle R; Hipp, Andrew L; Brown, Bethany H; Hahn, Marlene; Rooney, Thomas P

    2014-06-09

    Community assembly entails a filtering process, where species found in a local community are those that can pass through environmental (abiotic) and biotic filters and successfully compete. Previous research has demonstrated the ability of white-tailed deer (Odocoileus virginianus) to reduce species diversity and favour browse-tolerant plant communities. In this study, we expand on our previous work by investigating deer as a possible biotic filter altering local plant community assembly. We used replicated 23-year-old deer exclosures to experimentally assess the effects of deer on species diversity (H'), richness (SR), phylogenetic community structure and phylogenetic diversity in paired browsed (control) and unbrowsed (exclosed) plots. Additionally, we developed a deer-browsing susceptibility index (DBSI) to assess the vulnerability of local species to deer. Deer browsing caused a 12 % reduction in H' and 17 % reduction in SR, consistent with previous studies. Furthermore, browsing reduced phylogenetic diversity by 63 %, causing significant phylogenetic clustering. Overall, graminoids were the least vulnerable to deer browsing based on DBSI calculations. These findings demonstrate that deer are a significant driver of plant community assembly due to their role as a selective browser, or more generally, as a biotic filter. This study highlights the importance of knowledge about the plant tree of life in assessing the effects of biotic filters on plant communities. Application of such knowledge has considerable potential to advance our understanding of plant community assembly. Published by Oxford University Press on behalf of the Annals of Botany Company.

  20. Phylogenetic diversity of bacteria associated with toxic and non-toxic ...

    African Journals Online (AJOL)

    Phylogenetic diversity of bacteria associated with toxic and non-toxic strains of Alexandrium minutum. L Palacios, B Reguera, J Franco, I Marín. Abstract. Marine planktonic dinoflagellates are usually associated with bacteria, some of which seem to have a symbiotic relation with the dinoflagellate cells. The role of bacteria in ...

  1. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  2. Seed plant phylogenetic diversity and species richness in conservation planning within a global biodiversity hotspot in eastern Asia.

    Science.gov (United States)

    Li, Rong; Kraft, Nathan J B; Yu, Haiying; Li, Heng

    2015-12-01

    One of the main goals of conservation biology is to understand the factors shaping variation in biodiversity across the planet. This understanding is critical for conservation planners to be able to develop effective conservation strategies. Although many studies have focused on species richness and the protection of rare and endemic species, less attention has been paid to the protection of the phylogenetic dimension of biodiversity. We explored how phylogenetic diversity, species richness, and phylogenetic community structure vary in seed plant communities along an elevational gradient in a relatively understudied high mountain region, the Dulong Valley, in southeastern Tibet, China. As expected, phylogenetic diversity was well correlated with species richness among the elevational bands and among communities. At the community level, evergreen broad-leaved forests had the highest levels of species richness and phylogenetic diversity. Using null model analyses, we found evidence of nonrandom phylogenetic structure across the region. Evergreen broad-leaved forests were phylogenetically overdispersed, whereas other vegetation types tended to be phylogenetically clustered. We suggest that communities with high species richness or overdispersed phylogenetic structure should be a focus for biodiversity conservation within the Dulong Valley because these areas may help maximize the potential of this flora to respond to future global change. In biodiversity hotspots worldwide, we suggest that the phylogenetic structure of a community may serve as a useful measure of phylogenetic diversity in the context of conservation planning. © 2015 Society for Conservation Biology.

  3. Phylogenetic diversity of stress signalling pathways in fungi

    Directory of Open Access Journals (Sweden)

    Stansfield Ian

    2009-02-01

    Full Text Available Abstract Background Microbes must sense environmental stresses, transduce these signals and mount protective responses to survive in hostile environments. In this study we have tested the hypothesis that fungal stress signalling pathways have evolved rapidly in a niche-specific fashion that is independent of phylogeny. To test this hypothesis we have compared the conservation of stress signalling molecules in diverse fungal species with their stress resistance. These fungi, which include ascomycetes, basidiomycetes and microsporidia, occupy highly divergent niches from saline environments to plant or mammalian hosts. Results The fungi displayed significant variation in their resistance to osmotic (NaCl and sorbitol, oxidative (H2O2 and menadione and cell wall stresses (Calcofluor White and Congo Red. There was no strict correlation between fungal phylogeny and stress resistance. Rather, the human pathogens tended to be more resistant to all three types of stress, an exception being the sensitivity of Candida albicans to the cell wall stress, Calcofluor White. In contrast, the plant pathogens were relatively sensitive to oxidative stress. The degree of conservation of osmotic, oxidative and cell wall stress signalling pathways amongst the eighteen fungal species was examined. Putative orthologues of functionally defined signalling components in Saccharomyces cerevisiae were identified by performing reciprocal BLASTP searches, and the percent amino acid identities of these orthologues recorded. This revealed that in general, central components of the osmotic, oxidative and cell wall stress signalling pathways are relatively well conserved, whereas the sensors lying upstream and transcriptional regulators lying downstream of these modules have diverged significantly. There was no obvious correlation between the degree of conservation of stress signalling pathways and the resistance of a particular fungus to the corresponding stress. Conclusion Our

  4. Phylogenetic diversity and biogeography of the Mamiellophyceae lineage of eukaryotic phytoplankton across the oceans.

    Science.gov (United States)

    Monier, Adam; Worden, Alexandra Z; Richards, Thomas A

    2016-08-01

    High-throughput diversity amplicon sequencing of marine microbial samples has revealed that members of the Mamiellophyceae lineage are successful phytoplankton in many oceanic habitats. Indeed, these eukaryotic green algae can dominate the picoplanktonic biomass, however, given the broad expanses of the oceans, their geographical distributions and the phylogenetic diversity of some groups remain poorly characterized. As these algae play a foundational role in marine food webs, it is crucial to assess their global distribution in order to better predict potential changes in abundance and community structure. To this end, we analyzed the V9-18S small subunit rDNA sequences deposited from the Tara Oceans expedition to evaluate the diversity and biogeography of these phytoplankton. Our results show that the phylogenetic composition of Mamiellophyceae communities is in part determined by geographical provenance, and do not appear to be influenced - in the samples recovered - by water depth, at least at the resolution possible with the V9-18S. Phylogenetic classification of Mamiellophyceae sequences revealed that the Dolichomastigales order encompasses more sequence diversity than other orders in this lineage. These results indicate that a large fraction of the Mamiellophyceae diversity has been hitherto overlooked, likely because of a combination of size fraction, sequencing and geographical limitations. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Community phylogenetic diversity of cyanobacterial mats associated with geothermal springs along a tropical intertidal gradient.

    Science.gov (United States)

    Jing, Hongmei; Lacap, Donnabella C; Lau, Chui Yim; Pointing, Stephen B

    2006-04-01

    The 16S rRNA gene-defined bacterial diversity of tropical intertidal geothermal vents subject to varying degrees of seawater inundation was investigated. Shannon-Weaver diversity estimates of clone library-derived sequences revealed that the hottest pools located above the mean high-water mark that did not experience seawater inundation were most diverse, followed by those that were permanently submerged below the mean low-water mark. Pools located in the intertidal were the least biodiverse, and this is attributed to the fluctuating conditions caused by periodic seawater inundation rather than physicochemical conditions per se. Phylogenetic analysis revealed that a ubiquitous Oscillatoria-like phylotype accounted for 83% of clones. Synechococcus-like phylotypes were also encountered at each location, whilst others belonging to the Chroococcales, Oscillatoriales, and other non-phototrophic bacteria occurred only at specific locations along the gradient. All cyanobacterial phylotypes displayed highest phylogenetic affinity to terrestrial thermophilic counterparts rather than marine taxa.

  6. Microbial network, phylogenetic diversity and community membership in the active layer across a permafrost thaw gradient.

    Science.gov (United States)

    Mondav, Rhiannon; McCalley, Carmody K; Hodgkins, Suzanne B; Frolking, Steve; Saleska, Scott R; Rich, Virginia I; Chanton, Jeff P; Crill, Patrick M

    2017-08-01

    Biogenic production and release of methane (CH 4 ) from thawing permafrost has the potential to be a strong source of radiative forcing. We investigated changes in the active layer microbial community of three sites representative of distinct permafrost thaw stages at a palsa mire in northern Sweden. The palsa site (intact permafrost and low radiative forcing signature) had a phylogenetically clustered community dominated by Acidobacteria and Proteobacteria. The bog (thawing permafrost and low radiative forcing signature) had lower alpha diversity and midrange phylogenetic clustering, characteristic of ecosystem disturbance affecting habitat filtering. Hydrogenotrophic methanogens and Acidobacteria dominated the bog shifting from palsa-like to fen-like at the waterline. The fen (no underlying permafrost, high radiative forcing signature) had the highest alpha, beta and phylogenetic diversity, was dominated by Proteobacteria and Euryarchaeota and was significantly enriched in methanogens. The Mire microbial network was modular with module cores consisting of clusters of Acidobacteria, Euryarchaeota or Xanthomonodales. Loss of underlying permafrost with associated hydrological shifts correlated to changes in microbial composition, alpha, beta and phylogenetic diversity associated with a higher radiative forcing signature. These results support the complex role of microbial interactions in mediating carbon budget changes and climate feedback in response to climate forcing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change.

    Science.gov (United States)

    Potter, Kevin M; Woodall, Christopher W

    2012-03-01

    Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones

  8. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  9. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Directory of Open Access Journals (Sweden)

    David Lee Erickson

    2014-11-01

    Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for

  10. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Hannah L. Buckley

    2014-09-01

    Full Text Available The role of species’ interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran’s eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners’ genetic variation. Different lichen taxa showed some variation in

  11. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity.

    Science.gov (United States)

    Buckley, Hannah L; Rafat, Arash; Ridden, Johnathon D; Cruickshank, Robert H; Ridgway, Hayley J; Paterson, Adrian M

    2014-01-01

    The role of species' interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran's eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners' genetic variation. Different lichen taxa showed some variation in their phylogenetic congruence

  12. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  13. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Science.gov (United States)

    Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of

  14. Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

    Science.gov (United States)

    Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

    2016-02-24

    Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic

  15. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  16. AST: an automated sequence-sampling method for improving the taxonomic diversity of gene phylogenetic trees.

    Science.gov (United States)

    Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying

    2014-01-01

    A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.

  17. Phylogenetic diversity does not capture body size variation at risk in the world's mammals

    DEFF Research Database (Denmark)

    Fritz, Susanne A; Purvis, Andy

    2010-01-01

    Mammals contribute to important ecosystem processes and services, but many mammalian species are threatened with extinction. We compare how global patterns in three measures of mammalian diversity--species richness, phylogenetic diversity (PD) and body mass variance (BMV)--would change if all...... currently threatened species were lost. Given that many facets of species' ecology and life history scale predictably with body mass, the BMV in a region roughly reflects the diversity of species' roles within ecosystems and so is a simple proxy for functional diversity (FD). PD is also often considered...... more BMV than under random extinction, while only 11 per cent would lose significantly more PD. Ecosystem consequences of these selective losses may be profound, especially throughout the tropics, but are not captured by PD. This low surrogacy stresses a need for conservation prioritization based...

  18. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    DEFF Research Database (Denmark)

    Feng, Gang; Mi, Xiangcheng; Bøcher, Peder Klith

    2014-01-01

    their relative roles in determining woody plant phylogenetic and functional diversity in this important hotspot for woody plant diversity. Local disturbance was the best predictor of functional diversity as represented by maximum canopy height (Hmax), probably reflecting the dominant role of competition...... studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM) climate as well as local disturbance regimes to study...

  19. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  20. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  1. Biodiversity assessment among two Nebraska prairies: a comparison between traditional and phylogenetic diversity indices.

    Science.gov (United States)

    Aust, Shelly K; Ahrendsen, Dakota L; Kellar, P Roxanne

    2015-01-01

    Conservation of the evolutionary diversity among organisms should be included in the selection of priority regions for preservation of Earth's biodiversity. Traditionally, biodiversity has been determined from an assessment of species richness (S), abundance, evenness, rarity, etc. of organisms but not from variation in species' evolutionary histories. Phylogenetic diversity (PD) measures evolutionary differences between taxa in a community and is gaining acceptance as a biodiversity assessment tool. However, with the increase in the number of ways to calculate PD, end-users and decision-makers are left wondering how metrics compare and what data are needed to calculate various metrics. In this study, we used massively parallel sequencing to generate over 65,000 DNA characters from three cellular compartments for over 60 species in the asterid clade of flowering plants. We estimated asterid phylogenies from character datasets of varying nucleotide quantities, and then assessed the effect of varying character datasets on resulting PD metric values. We also compared multiple PD metrics with traditional diversity indices (including S) among two endangered grassland prairies in Nebraska (U.S.A.). Our results revealed that PD metrics varied based on the quantity of genes used to infer the phylogenies; therefore, when comparing PD metrics between sites, it is vital to use comparable datasets. Additionally, various PD metrics and traditional diversity indices characterize biodiversity differently and should be chosen depending on the research question. Our study provides empirical results that reveal the value of measuring PD when considering sites for conservation, and it highlights the usefulness of using PD metrics in combination with other diversity indices when studying community assembly and ecosystem functioning. Ours is just one example of the types of investigations that need to be conducted across the tree of life and across varying ecosystems in order to build

  2. Factors shaping bacterial phylogenetic and functional diversity in coastal waters of the NW Mediterranean Sea

    Science.gov (United States)

    Boras, Julia A.; Vaqué, Dolors; Maynou, Francesc; Sà, Elisabet L.; Weinbauer, Markus G.; Sala, Maria Montserrat

    2015-03-01

    To evaluate the main factors shaping bacterioplankton phylogenetic and functional diversity in marine coastal waters, we carried out a two-year study based on a monthly sampling in Blanes Bay (NW Mediterranean). We expected the key factors driving bacterial diversity to be (1) temperature and nutrient concentration, together with chlorophyll a concentration as an indicator of phytoplankton biomass and, hence, a carbon source for bacteria (here called bottom-up factors), and (2) top-down pressure (virus- and protist-mediated mortality of bacteria). Phylogenetic diversity was analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA. Functional diversity was assessed by using monomeric carbon sources in Biolog EcoPlates and by determining the activity of six extracellular enzymes. Our results indicate that the bacterial phylogenetic and functional diversity in this coastal system is shaped mainly by bottom-up factors. A dendrogram analysis of the DGGE banding patterns revealed three main sample clusters. Two clusters differed significantly in temperature, nitrate and chlorophyll a concentration, and the third was characterized by the highest losses of bacterial production due to viral lysis detected over the whole study period. Protistan grazing had no effect on bacterial functional diversity, since there were no correlations between protist-mediated mortality (PMM) and extracellular enzyme activities, and utilization of only two out of the 31 carbon sources (N-acetyl-D-glucosamine and α-cyclodextrin) was correlated with PMM. In contrast, virus-mediated mortality correlated with changes in the percentage of use of four carbon sources, and also with specific leu-aminopeptidase and β-glucosidase activity. This suggests that viral lysate provides a pool of labile carbon sources, presumably including amino acids and glucose, which may inhibit proteolytic and glucosidic activity. Our results indicate that bottom-up factors play a more important role than

  3. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  4. Environmental quality of a stream can be better predicted by phylogenetic than by taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Koperski Paweł

    2017-01-01

    Full Text Available Different indices of taxonomic diversity (TD and phylogenetic diversity (PD of the macrobenthos were compared to determine the efficient predictors of environmental quality (EQ in different types of watercourses in Poland. Archived data of 864 samples of benthic invertebrates identified to the family level were analysed on the basis of linear and non-linear multiply regression. The strengths of the correlations between two measures of EQ:BMWPpl (British Monitoring Working Party score system, Polish modification and MMI (Multimetric Macroinvertebrate Index and the values of taxonomic richness and three well-known TD indices: Shannon, Margalef and J' Evenness were compared to those for values of three PD indices, based on taxonomic distinctness. Taxonomic richness and all PD indices correlated more strongly with both measures of EQ than all TD indices. Correlations with both types of diversity indices were visibly stronger for BMWPpl when compared with MMI. We suggest that analysed indices of PD, especially MDis (mean phylogenetic distance between families in a sample, are related with EQ strongly enough to be taken into account as potential metrics in selection procedures of biological assessment.

  5. Structure and phylogenetic diversity of post-fire ectomycorrhizal communities of maritime pine.

    Science.gov (United States)

    Rincón, A; Santamaría, B P; Ocaña, L; Verdú, M

    2014-02-01

    Environmental disturbances define the diversity and assemblage of species, affecting the functioning of ecosystems. Fire is a major disturbance of Mediterranean pine forests. Pines are highly dependent on the ectomycorrhizal (EM) fungal symbiosis, which is critical for tree recruitment under primary succession. To determine the effects of time since fire on the structure and recovery of EM fungal communities, we surveyed the young Pinus pinaster regenerate in three sites differing in the elapsed time after the last fire event. Pine roots were collected, and EM fungi characterized by sequencing the internal transcribed spacer (ITS) and the large subunit (LSU) regions of the nuclear ribosomal (nr)-DNA. The effects of the elapsed time after fire on the EM community structure (richness, presence/absence of fungi, phylogenetic diversity) and on soil properties were analysed.Fungal richness decreased with the elapsed time since the fire; although, the phylogenetic diversity of the EM community increased. Soil properties were different depending on the elapsed time after fire and particularly, the organic matter, carbon-to-nitrogen (C/N) ratio, nitrogen and iron significantly correlated with the assemblage of fungal species. Ascomycetes, particularly Tuberaceae and Pezizales, were significantly over-represented on saplings in the burned site. On seedlings, a significant over-representation of Rhizopogonaceae and Atheliaceae was observed in the most recently burned site, while other fungi (i.e. Cortinariaceae) were significantly under-represented. Our results are consistent with the hypothesis that fire can act as a selective agent by printing a phylogenetic signal on the EM fungal communities associated with naturally regenerated pines, pointing out to some groups as potential fire-adapted fungi.

  6. Partitioning the regional and local drivers of phylogenetic and functional diversity along temperate elevational gradients on an East Asian peninsula.

    Science.gov (United States)

    Chun, Jung-Hwa; Lee, Chang-Bae

    2018-02-12

    Species-centric approaches to biodiversity in ecological research are limited in their ability to reflect the evolutionary history and functional diversity of community assembly. Recently, the introduction of alternative facets of biodiversity, such as phylogenetic and functional diversity, has shed light on this problem and improved our understanding of the processes underlying biodiversity patterns. Here, we investigated the phylogenetic and functional diversity patterns of α, β and γ components in woody plant assemblages along regional and local elevational gradients in South Korea. Although the patterns of phylogenetic and functional diversity varied along regional and local elevational transects, the main drivers were partitioned into two categories: regional area or climate for phylogenetic diversity, depending on whether the transect was at a regional or local scale; and habitat heterogeneity for functional diversity, which was derived in elevational bands. Moreover, environmental distance was more important than was geographic distance for phylogenetic and functional β diversity between paired elevational bands. These results support the hypothesis that niche-based deterministic processes such as environmental filtering and competitive exclusion are fundamental in structuring woody plant assemblages along temperate elevational gradients regardless of scale (regional vs. local) in our study areas.

  7. The Role of the Phylogenetic Diversity Measure, PD, in Bio-informatics: Getting the Definition Right

    Directory of Open Access Journals (Sweden)

    Daniel P. Faith

    2006-01-01

    Full Text Available A recent paper in this journal (Faith and Baker, 2006 described bio-informatics challenges in the application of the PD (phylogenetic diversity measure of Faith (1992a, and highlighted the use of the root of the phylogenetic tree, as implied by the original definition of PD. A response paper (Crozier et al. 2006 stated that 1 the (Faith, 1992a PD definition did not include the use of the root of the tree, and 2 Moritz and Faith (1998 changed the PD definition to include the root. Both characterizations are here refuted. Examples from Faith (1992a,b document the link from the definition to the use of the root of the overall tree, and a survey of papers over the past 15 years by Faith and colleagues demonstrate that the stated PD definition has remained the same as that in the original 1992 study. PD’s estimation of biodiversity at the level of “feature diversity” is seen to have provided the original rationale for the measure’s consideration of the root of the phylogenetic tree.

  8. Diversity Dynamics in Nymphalidae Butterflies: Effect of Phylogenetic Uncertainty on Diversification Rate Shift Estimates

    Science.gov (United States)

    Peña, Carlos; Espeland, Marianne

    2015-01-01

    The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC) is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE) and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution. PMID:25830910

  9. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  10. Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.

    Science.gov (United States)

    Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana

    2011-01-01

    We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Diversity dynamics in Nymphalidae butterflies: effect of phylogenetic uncertainty on diversification rate shift estimates.

    Directory of Open Access Journals (Sweden)

    Carlos Peña

    Full Text Available The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.

  12. [Phylogenetic diversity of microorganisms associated with the deep-water sponge Baikalospongia intermedia].

    Science.gov (United States)

    Kalyzhnaya, O V; Itskovich, V B

    2014-07-01

    The diversity of bacteria associated with deep-water sponge Baikalospongia intermedia was evaluated by sequence analysis of 16S rRNA genes from two sponge samples collected in Lake Baikal from depths of 550 and 1204 m. A total of 64 operational taxonomic units, belonging to nine bacterial phyla, Proteobacteria (classes Alphaproteobacteria,. Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria), Actinobacteria, Planctomycetes, Cloroflexi, Verrucomicrobia, Acidobacteria, Chlorobi, and Nitrospirae, including candidate phylum WS5, were identified. Phylogenetic analysis showed that the examined communities contained phylotypes exhibiting homology to uncultured bacteria from different lake ecosystems, freshwater sediments, soil and geological formations. Moreover, a number of phylotypes were relative to psychrophilic, methane-oxidizing, sulfate-reducing bacteria, and to microorganisms resistant to the influence of heavy metals. It seems likely that the unusual habitation conditions of deep-water sponges contribute to the taxonomic diversity of associated bacteria and have an influence on the presence of functionally important microorganisms in bacterial communities.

  13. Phylogenetic niche conservatism explains an inverse latitudinal diversity gradient in freshwater arthropods

    Science.gov (United States)

    Morinière, Jérôme; van Dam, Matthew H.; Hawlitschek, Oliver; Bergsten, Johannes; Michat, Mariano C.; Hendrich, Lars; Ribera, Ignacio; Toussaint, Emmanuel F. A.; Balke, Michael

    2016-05-01

    The underlying mechanisms responsible for the general increase in species richness from temperate regions to the tropics remain equivocal. Many hypotheses have been proposed to explain this astonishing pattern but additional empirical studies are needed to shed light on the drivers at work. Here we reconstruct the evolutionary history of the cosmopolitan diving beetle subfamily Colymbetinae, the majority of which are found in the Northern hemisphere, hence exhibiting an inversed latitudinal diversity gradient. We reconstructed a dated phylogeny using 12 genes, to investigate the biogeographical history and diversification dynamics in the Colymbetinae. We aimed to identify the role that phylogenetic niche conservatism plays in the inversed diversification pattern seen in this group. Our results suggest that Colymbetinae originated in temperate climates, which supports the hypothesis that their distribution is the result of an ancestral adaptation to temperate environmental conditions rather than tropical origins, and that temperate niche conservatism can generate and/or maintain inverse latitudinal diversity gradients.

  14. Phylogenetic diversity and biological activity of culturable Actinobacteria isolated from freshwater fish gut microbiota.

    Science.gov (United States)

    Jami, Mansooreh; Ghanbari, Mahdi; Kneifel, Wolfgang; Domig, Konrad J

    2015-06-01

    The diversity of Actinobacteria isolated from the gut microbiota of two freshwater fish species namely Schizothorax zarudnyi and Schizocypris altidorsalis was investigated employing classical cultivation techniques, repetitive sequence-based PCR (rep-PCR), partial and full 16S rDNA sequencing followed by phylogenetic analysis. A total of 277 isolates were cultured by applying three different agar media. Based on rep-PCR profile analysis a subset of 33 strains was selected for further phylogenetic investigations, antimicrobial activity testing and diversity analysis of secondary-metabolite biosynthetic genes. The identification based on 16S rRNA gene sequencing revealed that the isolates belong to eight genera distributed among six families. At the family level, 72% of the 277 isolates belong to the family Streptomycetaceae. Among the non-streptomycetes group, the most dominant group could be allocated to the family of Pseudonocardiaceae followed by the members of Micromonosporaceae. Phylogenetic analysis clearly showed that many of the isolates in the genera Streptomyces, Saccharomonospora, Micromonospora, Nocardiopsis, Arthrobacter, Kocuria, Microbacterium and Agromyces formed a single and distinct cluster with the type strains. Notably, there is no report so far about the occurrence of these Actinobacteria in the microbiota of freshwater fish. Of the 33 isolates, all the strains exhibited antibacterial activity against a set of tested human and fish pathogenic bacteria. Then, to study their associated potential capacity to synthesize diverse bioactive natural products, diversity of genes associated with secondary-metabolite biosynthesis including PKS I, PKS II, NRPS, the enzyme PhzE of the phenazine pathways, the enzyme dTGD of 6-deoxyhexoses glycosylation pathway, the enzyme Halo of halogenation pathway and the enzyme CYP in polyene polyketide biosynthesis were investigated among the isolates. All the strains possess at least two types of the investigated

  15. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  16. Exploring the determinants of phylogenetic diversity and assemblage structure in conifers across temporal, spatial, and taxonomic scales

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Borchsenius, Finn; Sandel, Brody Steven

    -environmental models are important elements in this framework. Here, we integrate both types of data in order to explore the determinants of forest tree diversity using the conifers as a model group. Conifers are an old, diverse (ca. 650 spp. in 6 families) and widespread group of woody plants of high ecological...... and economic importance. They are better studied than most other globally distributed groups of forest trees, allowing integrative studies with high phylogenetic and spatial resolution. We analyse phylogenetic diversity, assemblage structure, and diversification rates for regional conifer assemblages...

  17. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008.

    Science.gov (United States)

    Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R

    2016-03-15

    An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely

  18. Phylogenetic and structural diversity in the feline leukemia virus env gene.

    Directory of Open Access Journals (Sweden)

    Shinya Watanabe

    Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.

  19. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Science.gov (United States)

    Howard, Marion G; McDonald, William J F; Forster, Paul I; Kress, W John; Erickson, David; Faith, Daniel P; Shapcott, Alison

    2016-01-01

    Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than

  20. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Directory of Open Access Journals (Sweden)

    Marion G Howard

    Full Text Available Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ, Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD measures as well as species richness (SR for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD. Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness

  1. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008

    Directory of Open Access Journals (Sweden)

    Seon Young Choi

    2016-03-01

    Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.

  2. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

    Science.gov (United States)

    Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

    2011-12-01

    Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

  3. Diversity of heavy metal resistant bacteria from Kalimas Surabaya: A phylogenetic taxonomy approach

    Science.gov (United States)

    Zulaika, Enny; Utomo, Andry Prio; Prima, Adisya; Alami, Nur Hidayatul; Kuswytasari, Nengah Dwianita; Shovitri, Maya; Sembiring, Langkah

    2017-06-01

    Bacterial resistance to heavy metal is a genetic and physiological adaptation to the environment which contaminated by heavy metal. Kalimas is an important river in Surabaya that is contaminated by some heavy metals and probably as a habitat for heavy metal resistance bacteria. Bacterial resistance to heavy metals are different for each species, and their diversity can be studied by phylogenetic taxonomy approach. Isolates screening was done using nutrient agar which contained 1 mg/L HgCl2, CdCl2 and K2Cr2O7. Bacterial viability were observed by nutrient broth which contained 10 mg/L HgCl2, 30 mg/L CdCl2 and 50 mg/L K2Cr2O7. Isolates that resistant to heavy metal and viable after exposure to heavy metal were identified using 16S rRNA gene marker by Polymerase Chain Reaction (PCR). Phylogenetic tree reconstruction was done by the neighbor-joining algorithm. Genetic assignment showed isolates that resist and viable after exposure of Hg, Cd and Cr are Bacillus S1, SS19 and DA11. Based on BLAST analysis from NCBI gene bank, 16S rRNA sequences, those isolates were similar with the member of Bacillus cereus. Depend on 16S rRNA nucleotide alignment by the neighbor-joining algorithm, Bacillus S1, SS19 and DA11 were belong to Bacillus cereus sensu-lato group.

  4. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Science.gov (United States)

    Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633

  5. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities.

    Science.gov (United States)

    Amend, Anthony S; Matulich, Kristin L; Martiny, Jennifer B H

    2015-01-01

    Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity (PD). This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between PD and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial PD, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of 66 days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial PD failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which PD predicts ecosystem function will depend on environmental context.

  6. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Directory of Open Access Journals (Sweden)

    Marisa Skaljac

    2017-10-01

    Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.

  7. Phylogenetic insights into the diversity of homocytous cyanobacteria from Amazonian rivers.

    Science.gov (United States)

    Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Melo, Itamar Soares de

    2017-11-01

    The Amazon Rainforest holds great tropical biodiversity, mainly because of its favourable climatic conditions. The high temperatures, luminosity and humidity coupled with the nutritional simplicity of cyanobacteria allow undiscovered diversity to flourish within this group of microorganisms. Some efforts to reveal this diversity have been attempted; however, most were focused on the microscopic observation of environmental samples without any genetic information. Very few studies focusing on morphological, ecological and molecular criteria have been conducted, and none have been devoted to homocytous cyanobacteria forms in Amazonia region. Therefore, the genetic relationships amongst strains retrieved from this ecosystem with regard to other environments from Brazil and the world have not been tested and, consequently, the Amazonian strains would naturally be assumed as novel to science. To examine these relationships, cultured homocytous cyanobacteria isolated from two Amazonian rivers (Amazonas and Solimões) were evaluated using a phylogenetic perspective, considering the 16S rRNA gene sequence. A total of eleven homocytous cyanobacterial strains were isolated. Morphologically, they were identified as Pseudanabaena, Leptolyngbya, Planktothrix and Phormidium, but genetically they were included in the typical clusters of Planktothrix, Pseudanabaena, Cephalothrix, Pantanalinema and Alkalinema. These three latter genera have been detected in other Brazilian ecosystems only (Pantanal, Atlantic Rainforest and Pampa), while those remaining have been extensively found in many parts of the world. The data provided here indicate that Amazonian rivers support a homocytous cyanobacterial diversity previously reported from other geographical and ecological environments. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

    Directory of Open Access Journals (Sweden)

    Mikihiko eKawai

    2014-03-01

    Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

  9. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  10. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  11. Phylogenetic analysis in Myrcia section Aulomyrcia and inferences on plant diversity in the Atlantic rainforest.

    Science.gov (United States)

    Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve

    2015-04-01

    Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas

  12. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  13. Phylogenetic diversity and ecological pattern of ammonia-oxidizing archaea in the surface sediments of the western Pacific.

    Science.gov (United States)

    Cao, Huiluo; Hong, Yiguo; Li, Meng; Gu, Ji-Dong

    2011-11-01

    The phylogenetic diversity of ammonia-oxidizing archaea (AOA) was surveyed in the surface sediments from the northern part of the South China Sea (SCS). The distribution pattern of AOA in the western Pacific was discussed through comparing the SCS with other areas in the western Pacific including Changjiang Estuary and the adjacent East China Sea where high input of anthropogenic nitrogen was evident, the tropical West Pacific Continental Margins close to the Philippines, the deep-sea methane seep sediments in the Okhotsk Sea, the cold deep sea of Northeastern Japan Sea, and the hydrothermal field in the Southern Okinawa Trough. These various environments provide a wide spectrum of physical and chemical conditions for a better understanding of the distribution pattern and diversities of AOA in the western Pacific. Under these different conditions, the distinct community composition between shallow and deep-sea sediments was clearly delineated based on the UniFrac PCoA and Jackknife Environmental Cluster analyses. Phylogenetic analyses showed that a few ammonia-oxidizing archaeal subclades in the marine water column/sediment clade and endemic lineages were indicative phylotypes for some environments. Higher phylogenetic diversity was observed in the Philippines while lower diversity in the hydrothermal vent habitat. Water depth and possibly with other environmental factors could be the main driving forces to shape the phylogenetic diversity of AOA observed, not only in the SCS but also in the whole western Pacific. The multivariate regression tree analysis also supported this observation consistently. Moreover, the functions of current and other climate factors were also discussed in comparison of phylogenetic diversity. The information collectively provides important insights into the ecophysiological requirements of uncultured ammonia-oxidizing archaeal lineages in the western Pacific Ocean.

  14. Dimensions of biodiversity loss: Spatial mismatch in land-use impacts on species, functional and phylogenetic diversity of European bees.

    Science.gov (United States)

    De Palma, Adriana; Kuhlmann, Michael; Bugter, Rob; Ferrier, Simon; Hoskins, Andrew J; Potts, Simon G; Roberts, Stuart P M; Schweiger, Oliver; Purvis, Andy

    2017-12-01

    Agricultural intensification and urbanization are important drivers of biodiversity change in Europe. Different aspects of bee community diversity vary in their sensitivity to these pressures, as well as independently influencing ecosystem service provision (pollination). To obtain a more comprehensive understanding of human impacts on bee diversity across Europe, we assess multiple, complementary indices of diversity. One Thousand four hundred and forty six sites across Europe. We collated data on bee occurrence and abundance from the published literature and supplemented them with the PREDICTS database. Using Rao's Quadratic Entropy, we assessed how species, functional and phylogenetic diversity of 1,446 bee communities respond to land-use characteristics including land-use class, cropland intensity, human population density and distance to roads. We combined these models with statistically downscaled estimates of land use in 2005 to estimate and map-at a scale of approximately 1 km 2 -the losses in diversity relative to semi-natural/natural baseline (the predicted diversity of an uninhabited grid square, consisting only of semi-natural/natural vegetation). We show that-relative to the predicted local diversity in uninhabited semi-natural/natural habitat-half of all EU27 countries have lost over 10% of their average local species diversity and two-thirds of countries have lost over 5% of their average local functional and phylogenetic diversity. All diversity measures were generally lower in pasture and higher-intensity cropland than in semi-natural/natural vegetation, but facets of diversity showed less consistent responses to human population density. These differences have led to marked spatial mismatches in losses: losses in phylogenetic diversity were in some areas almost 20 percentage points (pp.) more severe than losses in species diversity, but in other areas losses were almost 40 pp. less severe. These results highlight the importance of exploring

  15. Phylogenetic diversity of dissimilatory ferric iron reducers in paddy soil of Hunan, South China

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xin-Jun [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Graduate Univ., Chinese Academy of Sciences, BJ (China); Yang Jing; Chen Xue-Ping; Sun Guo-Xin [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Zhu Yong-Guan [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Key Lab. of Urban Environment and Health, Inst. of Urban Environment, Chinese Academy of Sciences, Xiamen (China)

    2009-12-15

    Purpose: Dissimilatory iron-reducing bacteria have been described by both culture-dependent and -independent methods in various environments, including freshwater, marine sediments, natural wetlands, and contaminated aquifers. However, little is known about iron-reducing microbial communities in paddy soils. The goal of this study was to characterize iron-reducing microbial communities in paddy soil. Moreover, the effect of dissolved and solid-phase iron (III) species on the iron-reducing microbial communities was also investigated by enrichment cultures. Methods: Ferric citrate and ferrihydrite were used respectively to set up enrichment cultures of dissimilatory ironreducing microorganisms using 1% inoculum of soil samples, and the iron reduction was measured. Moreover, bacterial DNA was extracted and 16S rRNA genes were PCR-amplified, and subsequently analyzed by the clone library and terminal restriction fragment length polymorphism (T-RFLP). Results: Phylogenetic analysis of 16S rRNA gene sequences extracted from the enrichment cultures revealed that Bradyrhizobium, Bacteroides, Clostridium and Ralstonia species were the dominant bacteria in the ferric citrate enrichment. However, members of the genera Clostridium, Bacteroides, and Geobacter were the dominant micro-organisms in the ferrihydrite enrichment. Analysis of enrichment cultures by T-RFLP strongly supported the cloning and sequencing results. Conclusions: The present study demonstrated that dissimilatory iron-reducing consortia in As-contaminated paddy soil are phylogenetically diverse. Moreover, iron (III) sources as a key factor have a strong effect on the iron (III)-reducing microbial community structure and relative abundance in the enrichments. In addition, Geobacter species are selectively enriched by ferrihydrite enrichment cultures. (orig.)

  16. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  17. Phylogenetic diversity of Pasteurellaceae and horizontal gene transfer of leukotoxin in wild and domestic sheep.

    Science.gov (United States)

    Kelley, Scott T; Cassirer, E Frances; Weiser, Glen C; Safaee, Shirin

    2007-01-01

    Wild and domestic animal populations are known to be sources and reservoirs of emerging diseases. There is also a growing recognition that horizontal genetic transfer (HGT) plays an important role in bacterial pathogenesis. We used molecular phylogenetic methods to assess diversity and cross-transmission rates of Pasteurellaceae bacteria in populations of bighorn sheep, Dall's sheep, domestic sheep and domestic goats. Members of the Pasteurellaceae cause an array of deadly illnesses including bacterial pneumonia known as "pasteurellosis", a particularly devastating disease for bighorn sheep. A phylogenetic analysis of a combined dataset of two RNA genes (16S ribosomal RNA and RNAse P RNA) revealed remarkable evolutionary diversity among Pasteurella trehalosi and Mannheimia (Pasteurella) haemolytica bacteria isolated from sheep and goats. Several phylotypes appeared to associate with particular host species, though we found numerous instances of apparent cross-transmission among species and populations. Statistical analyses revealed that host species, geographic locale and biovariant classification, but not virulence, correlated strongly with Pasteurellaceae phylogeny. Sheep host species correlated with P. trehalosi isolates phylogeny (PTP test; P=0.002), but not with the phylogeny of M. haemolytica isolates, suggesting that P. trehalosi bacteria may be more host specific. With regards to populations within species, we also discovered a strong correlation between geographic locale and isolate phylogeny in the Rocky Mountain bighorn sheep (PTP test; P=0.001). We also investigated the potential for HGT of the leukotoxin A (lktA) gene, which produces a toxin that plays an integral role in causing disease. Comparative analysis of the combined RNA gene phylogeny and the lktA phylogenies revealed considerable incongruence between the phylogenies, suggestive of HGT. Furthermore, we found identical lktA alleles in unrelated bacterial species, some of which had been isolated

  18. Spatial Patterns of Species Diversity and Phylogenetic Structure of Plant Communities in the Tianshan Mountains, Arid Central Asia

    Directory of Open Access Journals (Sweden)

    Hong-Xiang Zhang

    2017-12-01

    Full Text Available The Tianshan Mountains, located in arid Central Asia, have a humid climate and are biodiversity hotspots. Here, we aimed to clarify whether the pattern of species diversity and the phylogenetic structure of plant communities is affected by environmental variables and glacial refugia. In this study, plant community assemblies of 17 research sites with a total of 35 sample plots were investigated at the grassland/woodland boundaries on the Tianshan Mountains. Community phylogeny of these plant communities was constructed based on two plant DNA barcode regions. The indices of phylogenetic diversity and phylogenetic community structure were calculated for these sample plots. We first estimated the correlation coefficients between species richness (SR and environmental variables as well as the presence of glacial refugia. We then mapped the significant values of indices of community phylogeny (PD, RPD, NRI, and NTI to investigate the correlation between community phylogeny and environmental structure or macrozones in the study area. The results showed that a significantly higher value of SR was obtained for the refugial groups than for the colonizing groups (P < 0.05; presence of refugia and environmental variables were highly correlated to the pattern of variation in SR. Indices of community phylogeny were not significantly different between refugial and colonizing regions. Comparison with the humid western part showed that plant communities in the arid eastern part of the Tianshan Mountains tended to display more significant phylogenetic overdispersion. The variation tendency of the PhyloSor index showed that the increase in macro-geographical and environmental distance did not influence obvious phylogenetic dissimilarities between different sample plots. In conclusion, glacial refugia and environmental factors profoundly influenced the pattern of SR, but community phylogenetic structure was not affected by glacial refugia among different plant

  19. Diversity structure of culturable bacteria isolated from the Fildes Peninsula (King George Island, Antarctica): A phylogenetic analysis perspective.

    Science.gov (United States)

    González-Rocha, Gerardo; Muñoz-Cartes, Gabriel; Canales-Aguirre, Cristian B; Lima, Celia A; Domínguez-Yévenes, Mariana; Bello-Toledo, Helia; Hernández, Cristián E

    2017-01-01

    It has been proposed that Antarctic environments select microorganisms with unique biochemical adaptations, based on the tenet 'Everything is everywhere, but, the environment selects' by Baas-Becking. However, this is a hypothesis that has not been extensively evaluated. This study evaluated the fundamental prediction contained in this hypothesis-in the sense that species are structured in the landscape according to their local habitats-, using as study model the phylogenetic diversity of the culturable bacteria of Fildes Peninsula (King George Island, Antarctica). Eighty bacterial strains isolated from 10 different locations in the area, were recovered. Based on phylogenetic analysis of 16S rRNA gene sequences, the isolates were grouped into twenty-six phylotypes distributed in three main clades, of which only six are exclusive to Antarctica. Results showed that phylotypes do not group significantly by habitat type; however, local habitat types had phylogenetic signal, which support the phylogenetic niche conservatism hypothesis and not a selective role of the environment like the Baas-Becking hypothesis suggests. We propose that, more than habitat selection resulting in new local adaptations and diversity, local historical colonization and species sorting (i.e. differences in speciation and extinction rates that arise by interaction of species level traits with the environment) play a fundamental role on the culturable bacterial diversity in Antarctica.

  20. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  1. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Tasting soil fungal diversity with earth tongues: phylogenetic test of SATe alignments for environmental ITS data.

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    Full Text Available An abundance of novel fungal lineages have been indicated by DNA sequencing of the nuclear ribosomal ITS region from environmental samples such as soil and wood. Although phylogenetic analysis of these novel lineages is a key component of unveiling the structure and diversity of complex communities, such analyses are rare for environmental ITS data due to the difficulties of aligning this locus across significantly divergent taxa. One potential approach to this issue is simultaneous alignment and tree estimation. We targeted divergent ITS sequences of the earth tongue fungi (Geoglossomycetes, a basal class in the Ascomycota, to assess the performance of SATé, recent software that combines progressive alignment and tree building. We found that SATé performed well in generating high-quality alignments and in accurately estimating the phylogeny of earth tongue fungi. Drawing from a data set of 300 sequences of earth tongues and progressively more distant fungal lineages, 30 insufficiently identified ITS sequences from the public sequence databases were assigned to the Geoglossomycetes. The association between earth tongues and plants has been hypothesized for a long time, but hard evidence is yet to be collected. The ITS phylogeny showed that four ectomycorrhizal isolates shared a clade with Geoglossum but not with Trichoglossum earth tongues, pointing to the significant potential inherent to ecological data mining of environmental samples. Environmental sampling holds the key to many focal questions in mycology, and simultaneous alignment and tree estimation, as performed by SATé, can be a highly efficient companion in that pursuit.

  3. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan

    2014-05-12

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  4. Phylogenetically Diverse Burkholderia Associated with Midgut Crypts of Spurge Bugs, Dicranocephalus spp. (Heteroptera: Stenocephalidae).

    Science.gov (United States)

    Kuechler, Stefan Martin; Matsuura, Yu; Dettner, Konrad; Kikuchi, Yoshitomo

    2016-06-25

    Diverse phytophagous heteropteran insects, commonly known as stinkbugs, are associated with specific gut symbiotic bacteria, which have been found in midgut cryptic spaces. Recent studies have revealed that members of the stinkbug families Coreidae and Alydidae of the superfamily Coreoidea are consistently associated with a specific group of the betaproteobacterial genus Burkholderia, called the "stinkbug-associated beneficial and environmental (SBE)" group, and horizontally acquire specific symbionts from the environment every generation. However, the symbiotic system of another coreoid family, Stenocephalidae remains undetermined. We herein investigated four species of the stenocephalid genus Dicranocephalus. Examinations via fluorescence in situ hybridization (FISH) and transmission electron microscopy (TEM) revealed the typical arrangement and ultrastructures of midgut crypts and gut symbionts. Cloning and molecular phylogenetic analyses of bacterial genes showed that the midgut crypts of all species are colonized by Burkholderia strains, which were further assigned to different subgroups of the genus Burkholderia. In addition to the SBE-group Burkholderia, a number of stenocephalid symbionts belonged to a novel clade containing B. sordidicola and B. udeis, suggesting a specific symbiont clade for the Stenocephalidae. The symbiotic systems of stenocephalid bugs may provide a unique opportunity to study the ongoing evolution of symbiont associations in the stinkbug-Burkholderia interaction.

  5. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan; Yang, Chen; Horn, Hannes; Hajjar, Dina A.; Ravasi, Timothy; Hentschel, Ute

    2014-01-01

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  6. [New isolation methods and phylogenetic diversity of actinobacteria from hypersaline beach in Aksu].

    Science.gov (United States)

    Zhang, Yao; Xia, Zhanfeng; Cao, Xinbo; Li, Jun; Zhang, Lili

    2013-08-04

    We explored 4 new methods to improve the isolation of actinobacterial resources from high salt areas. Optimized media based on 4 new strategies were used for isolating actinobacteria from hypersaline beaches. Glycerin-arginine, trehalose-creatine, glycerol-asparticacid, mannitol-casein, casein-mannitol, mannitol-alanine, chitosan-asparagineand GAUZE' No. 1 were used as basic media. New isolation strategy includes 4 methods: ten-fold dilution culture, simulation of the original environment, actinobacterial culture guided by uncultured molecular technology detected, and reference of actinobacterial media for brackish marine environment. The 16S rRNA genes of the isolates were amplified with bacterial universal primers. The results of 16S rRNA gene sequences were compared with sequences obtained from GenBank databases. We constructed phylogenetic tree with the neighbor-joining method. No actinobacterial strains were isolated by 8 media of control group, while 403 strains were isolated by new strategies. The isolates by new methods were members of 14 genera (Streptomyces, Streptomonospora, Saccharomonospora, Plantactinospora, Nocardia, Amycolatopsis, Glycomyces, Micromonospora, Nocardiopsis, Isoptericola, Nonomuraea, Thermobifida, Actinopolyspora, Actinomadura) of 10 families in 8 suborders. The most abundant and diverse isolates were the two suborders of Streptomycineae (69.96%) and Streptosporangineaesuborder (9.68%) within the phylum Actinobacteria, including 9 potential novel species. New isolation methods significantly improved the actinobacterial culturability of hypersaline areas, and obtained many potential novel species, which provided a new and more effective way to isolate actinobacteria resources in hypersaline environments.

  7. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  8. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  9. Phylogenetic Diversity of Archaea and Bacteria in the Anoxic Zone of a Meromictic Lake (Lake Pavin, France)▿ †

    Science.gov (United States)

    Lehours, Anne-Catherine; Evans, Paul; Bardot, Corinne; Joblin, Keith; Gérard, Fonty

    2007-01-01

    The compositions of archaeal and bacterial populations at different depths (60 m [mixolimnion-chemocline interface], 70 m [chemocline-subchemocline interface], 90 m, and 92 m [the water-sediment interface]) in the anoxic zone of the water column in Lake Pavin, a freshwater permanently stratified mountain lake in France, were determined. Phylogenetic trees were constructed from sequences to assess archaeal and bacterial diversity at the four sites. PMID:17261512

  10. Stereo reconstruction from multiperspective panoramas.

    Science.gov (United States)

    Li, Yin; Shum, Heung-Yeung; Tang, Chi-Keung; Szeliski, Richard

    2004-01-01

    A new approach to computing a panoramic (360 degrees) depth map is presented in this paper. Our approach uses a large collection of images taken by a camera whose motion has been constrained to planar concentric circles. We resample regular perspective images to produce a set of multiperspective panoramas and then compute depth maps directly from these resampled panoramas. Our panoramas sample uniformly in three dimensions: rotation angle, inverse radial distance, and vertical elevation. The use of multiperspective panoramas eliminates the limited overlap present in the original input images and, thus, problems as in conventional multibaseline stereo can be avoided. Our approach differs from stereo matching of single-perspective panoramic images taken from different locations, where the epipolar constraints are sine curves. For our multiperspective panoramas, the epipolar geometry, to the first order approximation, consists of horizontal lines. Therefore, any traditional stereo algorithm can be applied to multiperspective panoramas with little modification. In this paper, we describe two reconstruction algorithms. The first is a cylinder sweep algorithm that uses a small number of resampled multiperspective panoramas to obtain dense 3D reconstruction. The second algorithm, in contrast, uses a large number of multiperspective panoramas and takes advantage of the approximate horizontal epipolar geometry inherent in multiperspective panoramas. It comprises a novel and efficient 1D multibaseline matching technique, followed by tensor voting to extract the depth surface. Experiments show that our algorithms are capable of producing comparable high quality depth maps which can be used for applications such as view interpolation.

  11. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  12. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation. PMID:25978319

  13. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Directory of Open Access Journals (Sweden)

    Julian Martin Corbelli

    Full Text Available The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD, functional (FBD and phylogenetic (PBD facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants from two contrasting biomes (subtropical forest and grassland and land uses (tree plantations and cropfields in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland, and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  14. Phylogenetic Diversity of aprA Genes in Subseafloor Sediments on the Northwestern Pacific Margin off Japan.

    Science.gov (United States)

    Aoki, Masataka; Kakiuchi, Ryota; Yamaguchi, Takashi; Takai, Ken; Inagaki, Fumio; Imachi, Hiroyuki

    2015-01-01

    Markedly diverse sequences of the adenosine-5'-phosphosulfate reductase alpha subunit gene (aprA), which encodes a key enzyme in microbial sulfate reduction and sulfur oxidation, were detected in subseafloor sediments on the northwestern Pacific off Japan. The aprA gene sequences were grouped into 135 operational taxonomic units (90% sequence identity), including genes related to putative sulfur-oxidizing bacteria predominantly detected in sulfate-depleted deep sediments. Our results suggest that microbial ecosystems in the subseafloor biosphere have phylogenetically diverse genetic potentials to mediate cryptic sulfur cycles in sediments, even where sulfate is rarely present.

  15. Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

    Science.gov (United States)

    Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

    2015-02-19

    'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

  16. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    Science.gov (United States)

    Miyake, Sou; Ngugi, David K.; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  17. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou

    2016-03-14

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  18. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou; Ngugi, David; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  19. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya.

    Science.gov (United States)

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    The environment of high-altitudinal cold deserts of Western Himalaya is characterized by extensive development of biological soil crusts, with cyanobacteria as dominant component. The knowledge of their taxonomic composition and dependency on soil chemistry and elevation is still fragmentary. We studied the abundance and the phylogenetic diversity of the culturable cyanobacteria and eukaryotic microalgae in soil crusts along altitudinal gradients (4600-5900 m) at two sites in the dry mountains of Ladakh (SW Tibetan Plateau and Eastern Karakoram), using both microscopic and molecular approaches. The effects of environmental factors (altitude, mountain range, and soil physico-chemical parameters) on the composition and biovolume of phototrophs were tested by multivariate redundancy analysis and variance partitioning. Both phylogenetic diversity and composition of morphotypes were similar between Karakorum and Tibetan Plateau. Phylogenetic analysis of 16S rRNA gene revealed strains belonging to at least five genera. Besides clusters of common soil genera, e.g., Microcoleus, Nodosilinea, or Nostoc, two distinct clades of simple trichal taxa were newly discovered. The most abundant cyanobacterial orders were Oscillatoriales and Nostacales, whose biovolume increased with increasing elevation, while that of Chroococales decreased. Cyanobacterial species richness was low in that only 15 morphotypes were detected. The environmental factors accounted for 52 % of the total variability in microbial data, 38.7 % of which was explained solely by soil chemical properties, 14.5 % by altitude, and 8.4 % by mountain range. The elevation, soil phosphate, and magnesium were the most important predictors of soil phototrophic communities in both mountain ranges despite their different bedrocks and origin. The present investigation represents a first record on phylogenetic diversity of the cyanobacterial community of biological soil crusts from Western Himalayas and first record

  20. Environmental constraints on the compositional and phylogenetic beta-diversity of tropical forest snake assemblages.

    Science.gov (United States)

    Moura, Mario R; Costa, Henrique C; Argôlo, Antônio J S; Jetz, Walter

    2017-09-01

    The ongoing biodiversity crisis increases the importance and urgency of studies addressing the role of environmental variation on the composition and evolutionary history of species assemblages, but especially the tropics and ectotherms remain understudied. In regions with rainy summers, coexistence of tropical ectothermic species may be determined by the partitioning of the climatic niche, as ectotherms can rely on water availability and thermoregulatory behaviour to buffer constraints along their climatic niche. Conversely, tropical ectotherms facing dry summers would have fewer opportunities to climatic niche partitioning and other processes rather than environmental filtering would mediate species coexistence. We used 218 snake assemblages to quantify the compositional (CBD) and phylogenetic (PBD) beta-diversity of snakes in the Atlantic Forest (AF) hotspot, South America. We identify two AF regions with distinct climatological regimes: dry summers in the northern-AF and rainy summers in the southern-AF. While accounting for the influence of multiscale spatial processes, we disentangle the relative contribution of thermal, water-related and topographic conditions in structuring the CBD and PBD of snake assemblages, and determine the extent in which snake assemblages under distinct climatological regimes are affected by environmental filtering. Thermal conditions best explain CBD and PBD of snakes for the whole AF, whereas water-related factors best explain the structure of snake assemblages within a same climatological regime. CBD and PBD patterns are similarly explained by spatial factors but snake assemblages facing dry summers are more affected by spatial processes operating at fine to intermediate spatial scale, whereas those assemblages in regions with rainy summers have a stronger signature of coarse-scale processes. As expected, environmental filtering plays a stronger role in southern-AF than northern-AF, and the synergism between thermal and water

  1. Phylogenetic diversity of dominant bacterial communities during bioremediation of crude oil-polluted soil

    Directory of Open Access Journals (Sweden)

    Eugene Thomas Cloete

    2011-08-01

    Full Text Available Bioremediation of hydrocarbon pollutants is advantageous owing to the cost-effectiveness of the technology and the ubiquity of hydrocarbon degrading microorganisms in the soil. Soil microbial diversity is affected by hydrocarbon perturbation thus selective enrichment of hydrocarbon utilizers occurs. Hydrocarbons interact with the soil matrix and soil microorganisms determining the fate of the contaminants relative to their chemical nature and microbial degradative capabilities respectively. Bacterial dynamics in crude oil-polluted soil microcosms undergoing bioremediation were investigated over a 42-day period. Four out of the five microcosms containing 4kg of pristine soil each were contaminated with 4% Arabian light crude oil. Three microcosms were amended with either 25g of NPK fertilizer, calcium ammonium nitrate or poultry droppings respectively while the fourth designated oil-contaminated control was unamended. The fifth microcosm had only pristine soil and was set up to ascertain indigenous bacterial community structure pre-contamination. Biostimulated soils were periodically tilled and watered. Hydrocarbon degradation was measured throughout the experimental period by gas chromatography. Gas chromatographic tracing of residual hydrocarbons in biostimulated soils showed marked attenuation of contaminants starting from the second (day 14 till the sixth (day 42 week after contamination whereas no significant reduction in hydrocarbon peaks was seen in the oil contaminated control soil throughout the 6-week experimental period. Molecular fingerprints of bacterial communities involved in aerobic biodegradation of crude oil hydrocarbons in biostimulated soils and controls were generated with DGGE using PCR-amplification of 16S rRNA gene obtained from extracted total soil community DNA. DGGE fingerprints demonstrated that NPK, calcium ammonium nitrate and poultry droppings selected different bacterial populations during the active phase of oil

  2. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  3. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    Directory of Open Access Journals (Sweden)

    Jianbin Liu

    Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.

  4. Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity.

    Directory of Open Access Journals (Sweden)

    Koen Illeghems

    Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.

  5. Phylogenetic and functional diversity of metagenomic libraries of phenol degrading sludge from petroleum refinery wastewater treatment system.

    Science.gov (United States)

    Silva, Cynthia C; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; Kruger, Ricardo H; Rodrigues, Marili Vn; Costa, Gustavo Gl; Vidal, Ramon O; Sousa, Maíra P; Torres, Ana Paula R; Santiago, Vânia Mj; Oliveira, Valéria M

    2012-03-27

    In petrochemical refinery wastewater treatment plants (WWTP), different concentrations of pollutant compounds are received daily in the influent stream, including significant amounts of phenolic compounds, creating propitious conditions for the development of particular microorganisms that can rapidly adapt to such environment. In the present work, the microbial sludge from a refinery WWTP was enriched for phenol, cloned into fosmid vectors and pyrosequenced. The fosmid libraries yielded 13,200 clones and a comprehensive bioinformatic analysis of the sequence data set revealed a complex and diverse bacterial community in the phenol degrading sludge. The phylogenetic analyses using MEGAN in combination with RDP classifier showed a massive predominance of Proteobacteria, represented mostly by the genera Diaphorobacter, Pseudomonas, Thauera and Comamonas. The functional classification of phenol degrading sludge sequence data set generated by MG-RAST showed the wide metabolic diversity of the microbial sludge, with a high percentage of genes involved in the aerobic and anaerobic degradation of phenol and derivatives. In addition, genes related to the metabolism of many other organic and xenobiotic compounds, such as toluene, biphenyl, naphthalene and benzoate, were found. Results gathered herein demonstrated that the phenol degrading sludge has complex phylogenetic and functional diversities, showing the potential of such community to degrade several pollutant compounds. This microbiota is likely to represent a rich resource of versatile and unknown enzymes which may be exploited for biotechnological processes such as bioremediation.

  6. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Science.gov (United States)

    Erwin, Patrick M; Olson, Julie B; Thacker, Robert W

    2011-01-01

    Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient

  7. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Patrick M Erwin

    Full Text Available Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP, might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods.We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6% of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil.The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the

  8. Partitioning the impact of environment and spatial structure on alpha and beta components of taxonomic, functional, and phylogenetic diversity in European ants.

    Science.gov (United States)

    Arnan, Xavier; Cerdá, Xim; Retana, Javier

    2015-01-01

    We analyze the relative contribution of environmental and spatial variables to the alpha and beta components of taxonomic (TD), phylogenetic (PD), and functional (FD) diversity in ant communities found along different climate and anthropogenic disturbance gradients across western and central Europe, in order to assess the mechanisms structuring ant biodiversity. To this aim we calculated alpha and beta TD, PD, and FD for 349 ant communities, which included a total of 155 ant species; we examined 10 functional traits and phylogenetic relatedness. Variation partitioning was used to examine how much variation in ant diversity was explained by environmental and spatial variables. Autocorrelation in diversity measures and each trait's phylogenetic signal were also analyzed. We found strong autocorrelation in diversity measures. Both environmental and spatial variables significantly contributed to variation in TD, PD, and FD at both alpha and beta scales; spatial structure had the larger influence. The different facets of diversity showed similar patterns along environmental gradients. Environment explained a much larger percentage of variation in FD than in TD or PD. All traits demonstrated strong phylogenetic signals. Our results indicate that environmental filtering and dispersal limitations structure all types of diversity in ant communities. Strong dispersal limitations appear to have led to clustering of TD, PD, and FD in western and central Europe, probably because different historical and evolutionary processes generated different pools of species. Remarkably, these three facets of diversity showed parallel patterns along environmental gradients. Trait-mediated species sorting and niche conservatism appear to structure ant diversity, as evidenced by the fact that more variation was explained for FD and that all traits had strong phylogenetic signals. Since environmental variables explained much more variation in FD than in PD, functional diversity should be a

  9. Genetic diversity and phylogenetic analysis of Tams1 of Theileria annulata isolates from three continents between 2000 and 2012.

    Science.gov (United States)

    Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang

    2014-01-01

    Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.

  10. Patterns of species diversity and phylogenetic structure of vascular plants on the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Yan, Yujing; Yang, Xian; Tang, Zhiyao

    2013-11-01

    Large-scale patterns of species richness and the underlying mechanisms regulating these patterns have long been the central issues in biogeography and macroecology. Phylogenetic community structure is a result of combined effects of contemporary ecological interactions, environmental filtering, and evolutionary history, and it links community ecology with biogeography and trait evolution. The Qinghai-Tibetan Plateau provides a good opportunity to test the influence of contemporary climate on shaping species richness because of its unique geological history, cold climate, and high biodiversity. In this study, based on high-resolution distributions of ˜9000 vascular plant species, we explored how species richness and phylogenetic structure of vascular plants correlate with climates on the highest (and species rich) plateau on the Earth. The results showed that most of the vascular plants were distributed on the eastern part of the plateau; there was a strong association between species richness and climate, even after the effects of habitat heterogeneity were controlled. However, the responses of richness to climate remarkably depended on life-forms. Richness of woody plants showed stronger climatic associations than that of herbaceous plants; energy and water availability together regulated richness pattern of woody plants; whereas water availability predominantly regulated richness pattern of herbaceous plants. The phylogenetic structure of vascular species clustered in most areas of the plateau, suggesting that rapid speciation and environment filtering dominated the assembly of communities on the plateau. We further propose that biodiversity conservation in this area should better take into account ecological features for different life-forms and phylogenetic lineages.

  11. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    OpenAIRE

    Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts dete...

  12. Phylogenetic diversity and community structure of sponge-associated bacteria from mangroves of the Caribbean Sea

    KAUST Repository

    Yang, Jiangke

    2011-02-08

    To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.

  13. Phylogenetic and population genetic analyses of diploid Leucaena (Leguminosae; Mimosoideae) reveal cryptic species diversity and patterns of divergent allopatric speciation.

    Science.gov (United States)

    Govindarajulu, Rajanikanth; Hughes, Colin E; Bailey, C Donovan

    2011-12-01

    Leucaena comprises 17 diploid species, five tetraploid species, and a complex series of hybrids whose evolutionary histories have been influenced by human seed translocation, cultivation, and subsequent spontaneous hybridization. Here we investigated patterns of evolutionary divergence among diploid Leucaena through comprehensively sampled multilocus phylogenetic and population genetic approaches to address species delimitation, interspecific relationships, hybridization, and the predominant mode of speciation among diploids. Parsimony- and maximum-likelihood-based phylogenetic approaches were applied to 59 accessions sequenced for six SCAR-based nuclear loci, nrDNA ITS, and four cpDNA regions. Population genetic comparisons included 1215 AFLP loci representing 42 populations and 424 individuals. Phylogenetic results provided a well-resolved hypothesis of divergent species relationships, recovering previously recognized clades of diploids as well as newly resolved relationships. Phylogenetic and population genetic assessments identified two cryptic species that are consistent with geography and morphology. Findings from this study highlight the importance and utility of multilocus data in the recovery of complex evolutionary histories. The results are consistent with allopatric divergence representing the predominant mode of speciation among diploid Leucaena. These findings contrast with the potential hybrid origin of several tetraploid species and highlight the importance of human translocation of seed to the origin of these tetraploids. The recognition of one previously unrecognized species (L. cruziana) and the elevation of another taxon (L. collinsii subsp. zacapana) to specific status (L. zacapana) is consistent with a growing number of newly diagnosed species from neotropical seasonally dry forests, suggesting these communities harbor greater species diversity than previously recognized.

  14. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    DEFF Research Database (Denmark)

    Machac, Antonin; Janda, Milan; Dunn, Robert R.

    2011-01-01

    A central focus of ecology and biogeography is to determine the factors that govern spatial variation in biodiversity. Here, we examined patterns of ant diversity along climatic gradients in three temperate montane systems: Great Smoky Mountains National Park (USA), Chiricahua Mountains (USA......), and Vorarlberg (Austria). To identify the factors which potentially shape these elevational diversity gradients, we analyzed patterns of community phylogenetic structure (i.e. the evolutionary relationships among species coexisting in local communities). We found that species at low-elevation sites tended...... to be evenly dispersed across phylogeny, suggesting that these communities are structured by interspecific competition. In contrast, species occurring at high-elevation sites tended to be more closely related than expected by chance, implying that these communities are structured primarily by environmental...

  15. Opportunity Captures 'Lion King' Panorama

    Science.gov (United States)

    2004-01-01

    [figure removed for brevity, see original site] Click on the image for Opportunity Captures 'Lion King' Panorama (QTVR) This approximate true-color panorama, dubbed 'Lion King,' shows 'Eagle Crater' and the surrounding plains of Meridiani Planum. It was obtained by the Mars Exploration Rover Opportunity's panoramic camera on sols 58 and 60 using infrared (750-nanometer), green (530-nanometer) and blue (430-nanometer) filters. This is the largest panorama obtained yet by either rover. It was taken in eight segments using six filters per segment, for a total of 558 images and more than 75 megabytes of data. Additional lower elevation tiers were added to ensure that the entire crater was covered in the mosaic. This panorama depicts a story of exploration including the rover's lander, a thorough examination of the outcrop, a study of the soils at the near-side of the lander, a successful exit from Eagle Crater and finally the rover's next desination, the large crater dubbed 'Endurance'.

  16. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  17. Species richness, but not phylogenetic diversity, influences community biomass production and temporal stability in a re-examination of 16 grassland biodiversity studies

    NARCIS (Netherlands)

    Venail, P.; Gross, K.; Oakley, T.H.; Narwani, A.; Allan, E.; Flombaum, P.; Isbell, F.; Joshi, J.; Reich, P.B.; Tilman, D.; Ruijven, van J.; Cardinale, B.J.

    2015-01-01

    1.Hundreds of experiments have now manipulated species richness of various groups of organisms and examined how this aspect of biological diversity influences ecosystem functioning. Ecologists have recently expanded this field to look at whether phylogenetic diversity among species, often quantified

  18. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Directory of Open Access Journals (Sweden)

    Paula Nilda Fergnani

    Full Text Available The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR is informative in terms of ecological diversity (ED, an approximation to functional diversity and phylogenetic diversity (AvPD using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans, mid-Cenozoic immigrants (hystricognaths, primates and newcomers (carnivorans, artiodactyls. If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths or temperate semideserts (xenarthrans; newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in

  19. The evolution of reproductive diversity in Afrobatrachia: A phylogenetic comparative analysis of an extensive radiation of African frogs

    Science.gov (United States)

    Portik, Daniel M.; Blackburn, David C.

    2016-01-01

    The reproductive modes of anurans (frogs and toads) are the most diverse of terrestrial vertebrates, and a major challenge is identifying selective factors that promote the evolution or retention of reproductive modes across clades. Terrestrialized anuran breeding strategies have evolved repeatedly from the plesiomorphic fully aquatic reproductive mode, a process thought to occur through intermediate reproductive stages. Several selective forces have been proposed for the evolution of terrestrialized reproductive traits, but factors such as water systems and co‐evolution with ecomorphologies have not been investigated. We examined these topics in a comparative phylogenetic framework using Afrobatrachian frogs, an ecologically and reproductively diverse clade representing more than half of the total frog diversity found in Africa (∼400 species). We infer direct development has evolved twice independently from terrestrialized reproductive modes involving subterranean or terrestrial oviposition, supporting evolution through intermediate stages. We also detect associations between specific ecomorphologies and oviposition sites, and demonstrate arboreal species exhibit an overall shift toward using lentic water systems for breeding. These results indicate that changes in microhabitat use associated with ecomorphology, which allow access to novel sites for reproductive behavior, oviposition, or larval development, may also promote reproductive mode diversity in anurans. PMID:27402182

  20. Spirit's West Valley Panorama

    Science.gov (United States)

    2008-01-01

    NASA'S Mars Exploration Rover Spirit captured this westward view from atop a low plateau where Sprit spent the closing months of 2007. After several months near the base of the plateau called 'Home Plate' in the inner basin of the Columbia Hills range inside Gusev Crater, Spirit climbed onto the eastern edge of the plateau during the rover's 1,306th Martian day, or sol, (Sept. 5, 2007). It examined rocks and soils at several locations on the southern half of Home Plate during September and October. It was perched near the western edge of Home Plate when it used its panoramic camera (Pancam) to take the images used in this view on sols 1,366 through 1,369 (Nov. 6 through Nov. 9, 2007). With its daily solar-energy supply shrinking as Martian summer turned to fall, Spirit then drove to the northern edge of Home Plate for a favorable winter haven. The rover reached that northward-tilting site in December, in time for the fourth Earth-year anniversary of its landing on Mars. Spirit reached Mars on Jan. 4, 2004, Universal Time (Jan. 3, 2004, Pacific Standard Time). It landed at a site at about the center of the horizon in this image. This panorama covers a scene spanning left to right from southwest to northeast. The western edge of Home Plate is in the foreground, generally lighter in tone than the more distant parts of the scene. A rock-dotted hill in the middle distance across the left third of the image is 'Tsiolkovski Ridge,' about 30 meters or 100 feet from the edge of Home Plate and about that same distance across. A bump on the horizon above the left edge of Tsiolkovski Ridge is 'Grissom Hill,' about 8 kilometers or 5 miles away. At right, the highest point of the horizon is 'Husband Hill,' to the north and about 800 meters or half a mile away. This view combines separate images taken through Pancam filters centered on wavelengths of 753 nanometers, 535 nanometers and 432 nanometers to produce an approximately true-color panorama.

  1. The eastern Asian and eastern and western North American floristic disjunction: congruent phylogenetic patterns in seven diverse genera.

    Science.gov (United States)

    Xiang, Q Y; Soltis, D E; Soltis, P S

    1998-10-01

    One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have

  2. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  3. Phylogenetic diversity of hpnP, the hopanoid methylase, and its implications for 2-methylhopanoids as biomarkers

    Science.gov (United States)

    Ricci, J. N.; Coleman, M. L.; Osburn, M. R.; Sessions, A. L.; Spear, J. R.; Newman, D. K.

    2011-12-01

    Hopanoids are a class of sterols produced by bacteria. Their hydrocarbon skeletons are resistant to degradation making their diagenetic products, hopanes, attractive biomarkers. Particular attention has been paid to 2-methylhopanes, which have been found at discrete times and locations in Earth history as far back as 2,500 Myr. Previously, they were inferred to be markers of oxygenic photosynthesis in cyanobacteria, but the discovery of an anoxygenic phototroph, Rhodopseudomonas palustris TIE-1, capable of producing significant quantities of 2-methylbacteriohopanetetrol, the parent molecule of the fossil 2-methylhopane, challenged this interpretation. In this study, we sought to determine the diversity and origin of the enzyme responsible for methylating hopanoids, HpnP. To accomplish this task, we surveyed a diversity of Yellowstone hot springs using degenerate PCR primers and searched publically available metagenomic databases for hpnP-like sequences. The Yellowstone hot spring samples were dominated by cyanobacterial-like hpnP sequences, while the metagenomic data contained many hpnP-like sequences from a diversity of environments that grouped with all known hpnP-containing phyla. With these additional hpnP sequences, we will report updated phylogenetic trees that attempt to determine the origin of hpnP. Understanding the distribution of 2-methylhopanoid production throughout the tree of life and its origin is important to be able to use 2-methylhopanes as biomarkers for any particular taxonomic group.

  4. Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

    Science.gov (United States)

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

  5. Population structure and phylogenetic relationships in a diverse panel of Brassica rapa L

    Science.gov (United States)

    The crop species Brassica rapa L. has significant economic importance around the globe. Crop domestication and improvement has resulted in extreme phenotypic diversity and subspecies that are used for oilseed, food for human consumption and fodder for livestock. However, the global distribution and ...

  6. PHYLOGENETIC AND FUNCTIONAL DIVERSITY OF SEAGULL AND CANADIAN GEESE FECAL MICROBIAL COMMUNITIES

    Science.gov (United States)

    In spite of increasing public health concerns on the risks associated with swimming in waters contaminated with waterfowl feces, there is little information on the gut microbial communities of aquatic birds. To address the molecular microbial diversity of waterfowl, 16S rDNA and ...

  7. Phylogenetic and Functional Diversity of Total (DNA) and Expressed (RNA) Bacterial Communities in Urban Green Infrastructure Bioswale Soils.

    Science.gov (United States)

    Gill, Aman S; Lee, Angela; McGuire, Krista L

    2017-08-15

    New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation ( cbbL-R [ cbbL gene, red-like subunit] and apsA ), nitrogen cycling ( noxZ and amoA ), and contaminant degradation ( bphA ); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a

  8. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  9. Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs.

    Science.gov (United States)

    Amarouche-Yala, Samia; Benouadah, Ali; El Ouahab Bentabet, Abd; López-García, Purificación

    2014-11-01

    Geothermal springs in Algeria have been known since the Roman Empire. They mainly locate in Eastern Algeria and are inhabited by thermophilic organisms, which include cyanobacteria forming mats and concretions. In this work, we have investigated the cyanobacterial diversity of these springs. Cyanobacteria were collected from water, concretions and mats in nine hot springs with water temperatures ranging from 39 to 93 °C. Samples were collected for isolation in culture, microscopic morphological examination, and molecular diversity analysis based on 16S rRNA gene sequences. Nineteen different cyanobacterial morphotypes were identified, the most abundant of which were three species of Leptolyngbya, accompanied by members of the genera Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Synechocystis, Microcoleus, Cyanobacterium, Chroococcus and Geitlerinema. Molecular diversity analyses were in good general agreement with classical identification and allowed the detection of additional species in three springs with temperatures higher than 50 °C. They corresponded to a Synechococcus clade and to relatives of the intracellularly calcifying Candidatus Gloeomargarita lithophora. The hottest springs were dominated by members of Leptolyngbya, Synechococcus-like cyanobacteria and Gloeomargarita, whereas Oscillatoriales other than Leptolyngbya, Chroococcales and Stigonematales dominated lower temperature springs. The isolation of some of these strains sets the ground for future studies on the biology of thermophilic cyanobacteria.

  10. Phylogenetic diversity and functional characterization of the Manila clam microbiota: a culture-based approach.

    Science.gov (United States)

    Leite, Laura; Jude-Lemeilleur, Florence; Raymond, Natalie; Henriques, Isabel; Garabetian, Frédéric; Alves, Artur

    2017-09-01

    According to the hologenome theory, the microbiota contributes to the fitness of the holobiont having an important role in its adaptation, survival, development, health, and evolution. Environmental stress also affects the microbiota and its capability to assist the holobiont in coping with stress factors. Here, we analyzed the diversity of cultivable bacteria associated with Manila clam tissues (mantle, gills, hemolymph) in two non-contaminated sites (Portugal and France) and one metal-contaminated site (Portugal). A total of 240 isolates were obtained. Representative isolates (n = 198) of the overall diversity were identified by 16S rDNA sequencing and subjected to functional characterization. Isolates affiliated with Proteobacteria, Actinobacteria, Firmicutes, and Bacteroidetes. Proteobacteria (mostly Pseudoalteromonadaceae and Vibrionaceae) were dominant in non-contaminated sites while Actinobacteria (mostly Microbacteriaceae) dominated in the metal-contaminated site. The main factor affecting the microbiota composition was contamination. No significant differences were observed between clam tissues and geographic regions. Several isolates tested positive for antibacterial activity, biofilm formation, protease, and siderophore production. The results show that the Manila clam harbors a diverse microbiota that may contribute to clam protection and overall fitness, as well as to its adaptation to stressful environments. In addition, the Manila clam microbiota is revealed as a promising source of novel probiotics with potential application in aquaculture.

  11. Phylogenetic diversity of ceftriaxone resistance and the presence of extended-spectrum β-lactamase genes in the culturable soil resistome.

    Science.gov (United States)

    Pagaling, Eulyn; Gatica, Joao; Yang, Kun; Cytryn, Eddie; Yan, Tao

    2016-09-01

    The aim of this study was to determine the phylogenetic diversity of ceftriaxone resistance and the presence of known extended-spectrum β-lactamase (ESBL) genes in culturable soil resistomes. Libraries of soil bacterial isolates resistant to ceftriaxone were established from six physicochemically diverse soils collected in Hawaii (USA) and Israel. The phylogenetic affiliation, ceftriaxone and multidrug resistance levels, and presence of known ESBL genes of the isolates were determined. The soil bacterial isolates were phylogenetically grouped with the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes and Bacteroidetes. Ceftriaxone minimum inhibitory concentrations (MICs) largely followed the phylogeny structure and higher levels of ceftriaxone resistance corresponded to higher multidrug resistance. Three distinct blaTEM variants were detected in soil bacterial isolates belonging to nine different genera. In conclusion, the culturable soil resistomes for ceftriaxone exhibited high phylogenetic diversity and multidrug resistance. blaTEM was the only known ESBL detected in the soil resistomes, and its distribution in different phylogenetic groups suggests its ubiquitous presence and/or possible horizontal gene transfer within the soil microbiomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  12. Genetic diversity and phylogenetic analysis of Aleutian mink disease virus isolates in north-east China.

    Science.gov (United States)

    Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui

    2018-05-01

    Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.

  13. Diversity and phylogenetic analyses of bacteria from a shallow-waterhydrothermal vent in Milos island (Greece

    Directory of Open Access Journals (Sweden)

    Donato eGiovannelli

    2013-07-01

    Full Text Available Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34×108 cells g-1. The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94 %, revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  14. Phylogenetic diversity and environment-specific distributions of glycosyl hydrolase family 10 xylanases in geographically distant soils.

    Directory of Open Access Journals (Sweden)

    Guozeng Wang

    Full Text Available BACKGROUND: Xylan is one of the most abundant biopolymers on Earth. Its degradation is mediated primarily by microbial xylanase in nature. To explore the diversity and distribution patterns of xylanase genes in soils, samples of five soil types with different physicochemical characters were analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Partial xylanase genes of glycoside hydrolase (GH family 10 were recovered following direct DNA extraction from soil, PCR amplification and cloning. Combined with our previous study, a total of 1084 gene fragments were obtained, representing 366 OTUs. More than half of the OTUs were novel (identities of <65% with known xylanases and had no close relatives based on phylogenetic analyses. Xylanase genes from all the soil environments were mainly distributed in Bacteroidetes, Proteobacteria, Acidobacteria, Firmicutes, Actinobacteria, Dictyoglomi and some fungi. Although identical sequences were found in several sites, habitat-specific patterns appeared to be important, and geochemical factors such as pH and oxygen content significantly influenced the compositions of xylan-degrading microbial communities. CONCLUSION/SIGNIFICANCE: These results provide insight into the GH 10 xylanases in various soil environments and reveal that xylan-degrading microbial communities are environment specific with diverse and abundant populations.

  15. Peptide-Like Nylon-3 Polymers with Activity against Phylogenetically Diverse, Intrinsically Drug-Resistant Pathogenic Fungi.

    Science.gov (United States)

    Rank, Leslie A; Walsh, Naomi M; Lim, Fang Yun; Gellman, Samuel H; Keller, Nancy P; Hull, Christina M

    2018-01-01

    Understanding the dimensions of fungal diversity has major implications for the control of diseases in humans, plants, and animals and in the overall health of ecosystems on the planet. One ancient evolutionary strategy organisms use to manage interactions with microbes, including fungi, is to produce host defense peptides (HDPs). HDPs and their synthetic analogs have been subjects of interest as potential therapeutic agents. Due to increases in fungal disease worldwide, there is great interest in developing novel antifungal agents. Here we describe activity of polymeric HDP analogs against fungi from 18 pathogenic genera composed of 41 species and 72 isolates. The synthetic polymers are members of the nylon-3 family (poly-β-amino acid materials). Three different nylon-3 polymers show high efficacy against surprisingly diverse fungi. Across the phylogenetic spectrum (with the exception of Aspergillus species), yeasts, dermatophytes, dimorphic fungi, and molds were all sensitive to the effects of these polymers. Even fungi intrinsically resistant to current antifungal drugs, such as the causative agents of mucormycosis ( Rhizopus spp.) and those with acquired resistance to azole drugs, showed nylon-3 polymer sensitivity. In addition, the emerging pathogens Pseudogymnoascus destructans (cause of white nose syndrome in bats) and Candida auris (cause of nosocomial infections of humans) were also sensitive. The three nylon-3 polymers exhibited relatively low toxicity toward mammalian cells. These findings raise the possibility that nylon-3 polymers could be useful against fungi for which there are only limited and/or no antifungal agents available at present. IMPORTANCE Fungi reside in all ecosystems on earth and impart both positive and negative effects on human, plant, and animal health. Fungal disease is on the rise worldwide, and there is a critical need for more effective and less toxic antifungal agents. Nylon-3 polymers are short, sequence random, poly

  16. Phylogenetic diversity of fungal communities in areas accessible and not accessible to tourists in Naracoorte Caves.

    Science.gov (United States)

    Adetutu, Eric M; Thorpe, Krystal; Bourne, Steven; Cao, Xiangsheng; Shahsavari, Esmaeil; Kirby, Greg; Ball, Andrew S

    2011-01-01

    The fungal diversity in areas accessible and not accessible to tourists at UNESCO World Heritage-listed Naracoorte Caves was investigated with culture-dependent and culture-independent techniques for assistance in cave management protocol development. The caves were selected based on tourist numbers and configurations: Stick Tomato (open, high numbers), Alexandra (lockable openings, high numbers) and Strawhaven (control; no access). Culture-based survey revealed Ascomycota dominance irrespective of sampling area with Microascales (Trichurus sp.) being most frequently isolated. Some Hypocreales-like sequences belonging to Fusarium sp., Trichoderma sp. and Neonectria sp. (Stick Tomato) were cultured only from areas not accessible to tourists. These orders also were detected by DGGE assay irrespective of sampling area. The predominance of Ascomycota (especially Microascales) suggested their important ecological roles in these caves. Culture-independent analysis showed higher Shannon fungal diversity values (from ITS-based DGGE profiles) in tourist-accessible areas of these caves than in inaccessible areas with the fungal community banding patterns being substantially different in Stick Tomato Cave. Further investigations are needed to determine the cause of the differences in the fungal communities of Stick Tomato Cave, although cave-related factors such as use, configuration and sediment heterogeneity might have contributed to these differences.

  17. Comparative Analysis of Glycoside Hydrolases Activities from Phylogenetically Diverse Marine Bacteria of the Genus Arenibacter

    Directory of Open Access Journals (Sweden)

    Valery Mikhailov

    2013-06-01

    Full Text Available A total of 16 marine strains belonging to the genus Arenibacter, recovered from diverse microbial communities associated with various marine habitats and collected from different locations, were evaluated in degradation of natural polysaccharides and chromogenic glycosides. Most strains were affiliated with five recognized species, and some presented three new species within the genus Arenibacter. No strains contained enzymes depolymerizing polysaccharides, but synthesized a wide spectrum of glycosidases. Highly active β-N-acetylglucosaminidases and α-N-acetylgalactosaminidases were the main glycosidases for all Arenibacter. The genes, encoding two new members of glycoside hydrolyses (GH families, 20 and 109, were isolated and characterized from the genomes of Arenibacter latericius. Molecular genetic analysis using glycosidase-specific primers shows the absence of GH27 and GH36 genes. A sequence comparison with functionally-characterized GH20 and GH109 enzymes shows that both sequences are closest to the enzymes of chitinolytic bacteria Vibrio furnissii and Cellulomonas fimi of marine and terrestrial origin, as well as human pathogen Elisabethkingia meningoseptica and simbionts Akkermansia muciniphila, gut and non-gut Bacteroides, respectively. These results revealed that the genus Arenibacter is a highly taxonomic diverse group of microorganisms, which can participate in degradation of natural polymers in marine environments depending on their niche and habitat adaptations. They are new prospective candidates for biotechnological applications due to their production of unique glycosidases.

  18. Linking phylogenetic and functional diversity to nutrient spiraling in microbial mats from Lower Kane Cave (USA).

    Science.gov (United States)

    Engel, Annette Summers; Meisinger, Daniela B; Porter, Megan L; Payn, Robert A; Schmid, Michael; Stern, Libby A; Schleifer, K H; Lee, Natuschka M

    2010-01-01

    Microbial mats in sulfidic cave streams offer unique opportunities to study redox-based biogeochemical nutrient cycles. Previous work from Lower Kane Cave, Wyoming, USA, focused on the aerobic portion of microbial mats, dominated by putative chemolithoautotrophic, sulfur-oxidizing groups within the Epsilonproteobacteria and Gammaproteobacteria. To evaluate nutrient cycling and turnover within the whole mat system, a multidisciplinary strategy was used to characterize the anaerobic portion of the mats, including application of the full-cycle rRNA approach, the most probable number method, and geochemical and isotopic analyses. Seventeen major taxonomic bacterial groups and one archaeal group were retrieved from the anaerobic portions of the mats, dominated by Deltaproteobacteria and uncultured members of the Chloroflexi phylum. A nutrient spiraling model was applied to evaluate upstream to downstream changes in microbial diversity based on carbon and sulfur nutrient concentrations. Variability in dissolved sulfide concentrations was attributed to changes in the abundance of sulfide-oxidizing microbial groups and shifts in the occurrence and abundance of sulfate-reducing microbes. Gradients in carbon and sulfur isotopic composition indicated that released and recycled byproduct compounds from upstream microbial activities were incorporated by downstream communities. On the basis of the type of available chemical energy, the variability of nutrient species in a spiraling model may explain observed differences in microbial taxonomic affiliations and metabolic functions, thereby spatially linking microbial diversity to nutrient spiraling in the cave stream ecosystem.

  19. Phylogenetic, Metabolic, and Taxonomic Diversities Shape Mediterranean Fruit Fly Microbiotas during Ontogeny

    Science.gov (United States)

    Aharon, Yael; Pasternak, Zohar; Ben Yosef, Michael; Behar, Adi; Lauzon, Carol; Yuval, Boaz

    2013-01-01

    The Mediterranean fruit fly (medfly) (Ceratitis capitata) lays eggs in fruits, where larvae subsequently develop, causing large-scale agricultural damage. Within its digestive tract, the fly supports an extended bacterial community that is composed of multiple strains of a variety of enterobacterial species. Most of these bacteria appear to be functionally redundant, with most strains sustaining diazotrophy and/or pectinolysis. At least some of these bacteria were shown to be vertically inherited, but colonization, structural, and metabolic aspects of the community's dynamics have not been investigated. We used fluorescent in situ hybridization, metabolic profiling, plate cultures, and pyrosequencing to show that an initial, egg-borne, diverse community expands throughout the fly's life cycle. While keeping “core” diazotrophic and pectinolytic functions, it also harbors diverse and fluctuating populations that express varied metabolic capabilities. We suggest that the metabolic and compositional plasticity of the fly's microbiota provides potential adaptive advantages to the medfly host and that its acquisition and dynamics are affected by mixed processes that include stochastic effects, host behavior, and molecular barriers. PMID:23104413

  20. The Cladistic Basis for the Phylogenetic Diversity (PD Measure Links Evolutionary Features to Environmental Gradients and Supports Broad Applications of Microbial Ecology’s “Phylogenetic Beta Diversity” Framework

    Directory of Open Access Journals (Sweden)

    Rob Knight

    2009-11-01

    Full Text Available The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional specieslevel ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.

  1. Activity and Phylogenetic Diversity of Bacterial Cells with High and Low Nucleic Acid Content and Electron Transport System Activity in an Upwelling Ecosystem

    OpenAIRE

    Longnecker, K.; Sherr, B. F.; Sherr, E. B.

    2005-01-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters...

  2. Phylogenetic and functional diversity of the cultivable bacterial community associated with the paralytic shellfish poisoning dinoflagellate Gymnodinium catenatum.

    Science.gov (United States)

    Green, David H; Llewellyn, Lyndon E; Negri, Andrew P; Blackburn, Susan I; Bolch, Christopher J S

    2004-03-01

    Gymnodinium catenatum is one of several dinoflagellates that produce a suite of neurotoxins called the paralytic shellfish toxins (PST), responsible for outbreaks of paralytic shellfish poisoning in temperate and tropical waters. Previous research suggested that the bacteria associated with the surface of the sexual resting stages (cyst) were important to the production of PST by G. catenatum. This study sought to characterise the cultivable bacterial diversity of seven different strains of G. catenatum that produce both high and abnormally low amounts of PST, with the long-term aim of understanding the role the bacterial flora has in bloom development and toxicity of this alga. Sixty-one bacterial isolates were cultured and phylogenetically identified as belonging to the Proteobacteria (70%), Bacteroidetes (26%) or Actinobacteria (3%). The Alphaproteobacteria were the most numerous both in terms of the number of isolates cultured (49%) and were also the most abundant type of bacteria in each G. catenatum culture. Two phenotypic (functional) traits inferred from the phylogenetic data were shown to be a common feature of the bacteria present in each G. catenatum culture: firstly, Alphaproteobacteria capable of aerobic anoxygenic photosynthesis, and secondly, Gammaproteobacteria capable of hydrocarbon utilisation and oligotrophic growth. In relation to reports of autonomous production of PST by dinoflagellate-associated bacteria, PST production by bacterial isolates was investigated, but none were shown to produce any PST-like toxins. Overall, this study has identified a number of emergent trends in the bacterial community of G. catenatum which are mirrored in the bacterial flora of other dinoflagellates, and that are likely to be of especial relevance to the population dynamics of natural and harmful algal blooms.

  3. Diversity of bacteria carried by pinewood nematode in USA and phylogenetic comparison with isolates from other countries.

    Directory of Open Access Journals (Sweden)

    Diogo Neves Proença

    Full Text Available Pine wilt disease (PWD is native to North America and has spread to Asia and Europe. Lately, mutualistic relationship has been suggested between the pinewood nematode (PWN, Bursaphelenchus xylophilus the causal nematode agent of PWD, and bacteria. In countries where PWN occurs, nematodes from diseased trees were reported to carry bacteria from several genera. However no data exists for the United States. The objective of this study was to evaluate the diversity of the bacterial community carried by B. xylophilus, isolated from different Pinus spp. with PWD in Nebraska, United States. The bacteria carried by PWN belonged to Gammaproteobacteria (79.9%, Betaproteobacteria (11.7%, Bacilli (5.0%, Alphaproteobacteria (1.7% and Flavobacteriia (1.7%. Strains from the genera Chryseobacterium and Pigmentiphaga were found associated with the nematode for the first time. These results were compared to results from similar studies conducted from other countries of three continents in order to assess the diversity of bacteria with associated with PWN. The isolates from the United States, Portugal and China belonged to 25 different genera and only strains from the genus Pseudomonas were found in nematodes from all countries. The strains from China were closely related to P. fluorescens and the strains isolated from Portugal and USA were phylogenetically related to P. mohnii and P. lutea. Nematodes from the different countries are associated with bacteria of different species, not supporting a relationship between PWN with a particular bacterial species. Moreover, the diversity of the bacteria carried by the pinewood nematode seems to be related to the geographic area and the Pinus species. The roles these bacteria play within the pine trees or when associated with the nematodes, might be independent of the presence of the nematode in the tree and only related on the bacteria's relationship with the tree.

  4. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

    Directory of Open Access Journals (Sweden)

    Jessica Joerling

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112 are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates.

  6. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

    Science.gov (United States)

    Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

    2018-01-01

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112) are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs) or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates. PMID:29324785

  7. Microenvironment and phylogenetic diversity of Prochloron inhabiting the surface of crustose didemnid ascidians.

    Science.gov (United States)

    Nielsen, Daniel A; Pernice, Mathieu; Schliep, Martin; Sablok, Gaurav; Jeffries, Thomas C; Kühl, Michael; Wangpraseurt, Daniel; Ralph, Peter J; Larkum, Anthony W D

    2015-10-01

    The cyanobacterium Prochloron didemni is primarily found in symbiotic relationships with various marine hosts such as ascidians and sponges. Prochloron remains to be successfully cultivated outside of its host, which reflects a lack of knowledge of its unique ecophysiological requirements. We investigated the microenvironment and diversity of Prochloron inhabiting the upper, exposed surface of didemnid ascidians, providing the first insights into this microhabitat. The pH and O2 concentration in this Prochloron biofilm changes dynamically with irradiance, where photosynthetic activity measurements showed low light adaptation (Ek ∼ 80 ± 7 μmol photons m(-2) s(-1)) but high light tolerance. Surface Prochloron cells exhibited a different fine structure to Prochloron cells from cloacal cavities in other ascidians, the principle difference being a central area of many vacuoles dissected by single thylakoids in the surface Prochloron. Cyanobacterial 16S rDNA pyro-sequencing of the biofilm community on four ascidians resulted in 433 operational taxonomic units (OTUs) where on average -85% (65-99%) of all sequence reads, represented by 136 OTUs, were identified as Prochloron via blast search. All of the major Prochloron-OTUs clustered into independent, highly supported phylotypes separate from sequences reported for internal Prochloron, suggesting a hitherto unexplored genetic variability among Prochloron colonizing the outer surface of didemnids. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Tiny worms from a mighty continent: high diversity and new phylogenetic lineages of African monogeneans.

    Science.gov (United States)

    Přikrylová, Iva; Vanhove, Maarten P M; Janssens, Steven B; Billeter, Paul A; Huyse, Tine

    2013-04-01

    The family Gyrodactylidae contains one of the most significant radiations of platyhelminth fish parasites. The so-called hyperviviparity is very rare in the animal kingdom, and the rapid generation time can lead to an explosive population growth, which can cause massive losses in farmed fish. Here we present the first molecular phylogeny including all-but-one African genera, inferred from ITS and 18S rDNA sequences. The validity of nominal genera is discussed in relation to the systematic value of morphological characters traditionally used for generic identification. New complete 18S rDNA sequences of 18 gyrodactylid species of eight genera together with ITS rDNA gene sequences of eight species representing seven genera were generated and complemented with GenBank sequences. The maximum likelihood and Bayesian analyses pointed to a paraphyletic nature of African Gyrodactylus species. They formed well-supported clades possibly indicating speciation within host taxa: (1) parasites of cichlids (Cichlidae); (2) parasites of catfishes (Siluriformes), consisting of a lineage infecting mochokids and one infecting clariids. Macrogyrodactylus spp. firmly clustered into a monophyletic group. We found that Swingleus and Fundulotrema are very closely related and clearly cluster within Gyrodactylus. This supports earlier claims as to the paraphyly of the nominal genus Gyrodactylus as it is currently defined, and necessitates a revision of Swingleus and Fundulotrema. Molecular dating estimates confirmed a relatively young, certainly post-Gondwanan, origin of gyrodactylid lineages. Building on the previously suggested South-American origin of viviparous gyrodactylids, the dataset suggests subsequent intercontinental dispersal to Africa and from there repeated colonisation of the Holarctic. Even though the African continent has been heavily under sampled, the present diversity is far greater than in the intensively studied European fauna, probably because of the high endemicity

  9. Eukaryotic Cell Panorama

    Science.gov (United States)

    Goodsell, David S.

    2011-01-01

    Diverse biological data may be used to create illustrations of molecules in their cellular context. This report describes the scientific results that support an illustration of a eukaryotic cell, enlarged by one million times to show the distribution and arrangement of macromolecules. The panoramic cross section includes eight panels that extend…

  10. Evidence of Increased Antibiotic Resistance in Phylogenetically-Diverse Aeromonas Isolates from Semi-Intensive Fish Ponds Treated with Antibiotics.

    Science.gov (United States)

    Patil, Hemant J; Benet-Perelberg, Ayana; Naor, Alon; Smirnov, Margarita; Ofek, Tamir; Nasser, Ahmed; Minz, Dror; Cytryn, Eddie

    2016-01-01

    The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain the effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically to fingerling stocks and water column-associated Aeromonas were monitored periodically over an 11-month fish fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a 3-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas isolates were initially screened for sulfadiazine resistance and further screened against five additional antimicrobials. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamicin, and chloramphenicol resistances were low. Multidrug resistant strains as well as sul1, tetA , and intI1 gene-harboring strains were significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically distinct Aeromonas clusters were identified using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were identified, including an A. salmonicida

  11. Evidence of increased antibiotic resistance in phylogenetically-diverse Aeromonas isolates from semi-intensive fish ponds treated with antibiotics

    Directory of Open Access Journals (Sweden)

    Hemant J Patil

    2016-11-01

    Full Text Available The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically upon fingerling stocking and water column-associated Aeromonas were monitored periodically over an eleven-month fish-fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a three-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas spp. were isolated, initially screened for sulfadiazine resistance and further screened against five additional antibiotics. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamycin and chloramphenicol resistances were low. Abundance of multi-drug resistant strains as well as sul1, tetA and intI1 gene-harboring strains was significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically-distinct Aeromonas clusters were revealed using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were

  12. Metagenomic-based study of the phylogenetic and functional gene diversity in Galápagos land and marine iguanas.

    Science.gov (United States)

    Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh; Cann, Isaac; Mackie, Roderick I

    2015-02-01

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  13. Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

    Science.gov (United States)

    Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

    2012-06-01

    This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  14. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying

    2014-12-19

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  15. Combining phylogenetic and demographic inferences to assess the origin of the genetic diversity in an isolated wolf population.

    Directory of Open Access Journals (Sweden)

    Luca Montana

    Full Text Available The survival of isolated small populations is threatened by both demographic and genetic factors. Large carnivores declined for centuries in most of Europe due to habitat changes, overhunting of their natural prey and direct persecution. However, the current rewilding trends are driving many carnivore populations to expand again, possibly reverting the erosion of their genetic diversity. In this study we reassessed the extent and origin of the genetic variation of the Italian wolf population, which is expanding after centuries of decline and isolation. We genotyped wolves from Italy and other nine populations at four mtDNA regions (control-region, ATP6, COIII and ND4 and 39 autosomal microsatellites. Results of phylogenetic analyses and assignment procedures confirmed in the Italian wolves a second private mtDNA haplotype, which belongs to a haplogroup distributed mostly in southern Europe. Coalescent analyses showed that the unique mtDNA haplotypes in the Italian wolves likely originated during the late Pleistocene. ABC simulations concordantly showed that the extant wolf populations in Italy and in south-western Europe started to be isolated and declined right after the last glacial maximum. Thus, the standing genetic variation in the Italian wolves principally results from the historical isolation south of the Alps.

  16. Application of the major capsid protein as a marker of the phylogenetic diversity of Emiliania huxleyi viruses.

    Science.gov (United States)

    Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W

    2011-05-01

    Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.

  17. A revised root for the human Y chromosomal phylogenetic tree: the origin of patrilineal diversity in Africa.

    Science.gov (United States)

    Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea; Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria

    2011-06-10

    To shed light on the structure of the basal backbone of the human Y chromosome phylogeny, we sequenced about 200 kb of the male-specific region of the human Y chromosome (MSY) from each of seven Y chromosomes belonging to clades A1, A2, A3, and BT. We detected 146 biallelic variant sites through this analysis. We used these variants to construct a patrilineal tree, without taking into account any previously reported information regarding the phylogenetic relationships among the seven Y chromosomes here analyzed. There are several key changes at the basal nodes as compared with the most recent reference Y chromosome tree. A different position of the root was determined, with important implications for the origin of human Y chromosome diversity. An estimate of 142 KY was obtained for the coalescence time of the revised MSY tree, which is earlier than that obtained in previous studies and easier to reconcile with plausible scenarios of modern human origin. The number of deep branchings leading to African-specific clades has doubled, further strengthening the MSY-based evidence for a modern human origin in the African continent. An analysis of 2204 African DNA samples showed that the deepest clades of the revised MSY phylogeny are currently found in central and northwest Africa, opening new perspectives on early human presence in the continent. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  18. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource.

    Science.gov (United States)

    Sharpton, Thomas J; Jospin, Guillaume; Wu, Dongying; Langille, Morgan G I; Pollard, Katherine S; Eisen, Jonathan A

    2012-10-13

    New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as "Sifting Families," or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology-based analyses. We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/).

  19. Phylogenetic and functional diversity within toluene-degrading, sulphate-reducing consortia enriched from a contaminated aquifer.

    Science.gov (United States)

    Kuppardt, Anke; Kleinsteuber, Sabine; Vogt, Carsten; Lüders, Tillmann; Harms, Hauke; Chatzinotas, Antonis

    2014-08-01

    Three toluene-degrading microbial consortia were enriched under sulphate-reducing conditions from different zones of a benzene, toluene, ethylbenzene and xylenes (BTEX) plume of two connected contaminated aquifers. Two cultures were obtained from a weakly contaminated zone of the lower aquifer, while one culture originated from the highly contaminated upper aquifer. We hypothesised that the different habitat characteristics are reflected by distinct degrader populations. Degradation of toluene with concomitant production of sulphide was demonstrated in laboratory microcosms and the enrichment cultures were phylogenetically characterised. The benzylsuccinate synthase alpha-subunit (bssA) marker gene, encoding the enzyme initiating anaerobic toluene degradation, was targeted to characterise the catabolic diversity within the enrichment cultures. It was shown that the hydrogeochemical parameters in the different zones of the plume determined the microbial composition of the enrichment cultures. Both enrichment cultures from the weakly contaminated zone were of a very similar composition, dominated by Deltaproteobacteria with the Desulfobulbaceae (a Desulfopila-related phylotype) as key players. Two different bssA sequence types were found, which were both affiliated to genes from sulphate-reducing Deltaproteobacteria. In contrast, the enrichment culture from the highly contaminated zone was dominated by Clostridia with a Desulfosporosinus-related phylotype as presumed key player. A distinct bssA sequence type with high similarity to other recently detected sequences from clostridial toluene degraders was dominant in this culture. This work contributes to our understanding of the niche partitioning between degrader populations in distinct compartments of BTEX-contaminated aquifers.

  20. Phylogenetics and genetic diversity of the Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae), biological control agents of lepidopteran stemborers.

    Science.gov (United States)

    Muirhead, Kate A; Murphy, Nicholas P; Sallam, Nader; Donnellan, Stephen C; Austin, Andrew D

    2012-06-01

    The Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae) are economically important for the biological control of lepidopteran stemboring pests associated with gramineous crops. Some members of the complex successfully parasitize numerous stemborer pest species, however certain geographic populations have demonstrated variation in the range of hosts that they parasitize. In addition, the morphology of the complex is highly conserved and considerable confusion surrounds the identity of species and host-associated biotypes. We generated nucleotide sequence data for two mtDNA genes (COI, 16S) and three anonymous nuclear loci (CfBN, CfCN, CfEN) for the C. flavipes complex. To analyze genetic variation and relationships among populations we used (1) concatenated mtDNA and nDNA data, (2) a nDNA multilocus network approach, and (3) two species tree inference methods, i.e. Bayesian estimation of species trees (BEST) and Bayesian inference of species trees from multilocus data with (*)BEAST. All phylogenetic analyses provide strong support for monophyly of the complex and the presence of at least four species, C. chilonis (from China and Japan), C. sesamiae (from Africa), C. flavipes (originating from the Indo-Asia region but introduced into Africa and the New World), and C. nonagriae (from Australia and Papua New Guinea). Haplotype diversity of geographic populations relates to historical biogeographic barriers and biological control introductions, and reflects previous reports of ecological variation in these species. Strong discordance was found between the mitochondrial and nuclear markers in the Papua New Guinea haplotypes, which may be an outcome of hybridization and introgression of C. flavipes and C. nonagriae. The position of Cotesia flavipes from Japan was not well supported in any analysis and was the sister taxon to C. nonagriae (mtDNA, (*)BEAST), C. flavipes (nDNA) or C. flavipes+C. nonagriae (BEST) and, may represent a cryptic species. The

  1. The effects of habitat management on the species, phylogenetic and functional diversity of bees are modified by the environmental context.

    Science.gov (United States)

    Sydenham, Markus A K; Moe, Stein R; Stanescu-Yadav, Diana N; Totland, Ørjan; Eldegard, Katrine

    2016-02-01

    Anthropogenic landscape elements, such as roadsides, hedgerows, field edges, and power line clearings, can be managed to provide important habitats for wild bees. However, the effects of habitat improvement schemes in power line clearings on components of diversity are poorly studied. We conducted a large-scale experiment to test the effects of different management practices on the species, phylogenetic, and functional diversity of wild bees in power line clearings (n = 19 sites across southeastern Norway) and explored whether any treatment effects were modified by the environmental context. At each site, we conducted the following treatments: (1) Cut: all trees cut and left to decay in the clearing; (2) Cut + Remove: all trees cut and removed from the plot; and (3) Uncut: uncleared. The site-specific environmental context (i.e., elevation and floral diversity) influenced the species, phylogenetic, and functional diversity within bee species assemblages. The largest number of species was found in the Cut + Remove treatment in plots with a high forb species richness, indicating that the outcome of management practices depends on the environmental context. Clearing of treatment plots with many forb species also appeared to alter the phylogenetic composition of bee species assemblages, that is, more closely related species were found in the Cut and the Cut + Remove plots than in the Uncut plots. Synthesis and applications: Our experimental simulation of management practices in power line clearings influenced the species, phylogenetic, and functional diversity of bee species assemblages. Frequent clearing and removal of the woody debris at low elevations with a high forb species richness can increase the value of power line clearings for solitary bees. It is therefore important for managers to consider the environmental context when designing habitat improvement schemes for solitary bees.

  2. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  3. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

    Directory of Open Access Journals (Sweden)

    Sharpton Thomas J

    2012-10-01

    Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.

  4. Activity and phylogenetic diversity of bacterial cells with high and low nucleic acid content and electron transport system activity in an upwelling ecosystem.

    Science.gov (United States)

    Longnecker, K; Sherr, B F; Sherr, E B

    2005-12-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.

  5. Phylogenetic diversity of culturable fungi from the deep-sea sediments of the central Indian Basin and their growth characteristics

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    of sporulating cultures mostly matched either with 18S or ITS sequences but seldom with both the sequences. Phylogenetic analysis of ascomycetes using 18S sequence data grouped them into 7 clusters belonging to Aspergillus sp., Sagenomella sp., Exophiala sp...

  6. A Whale of a Panorama

    Science.gov (United States)

    2005-01-01

    [figure removed for brevity, see original site] Click on the image for A Whale of a Panorama (QTVR) More than 1.5 years into their exploration of Mars, both of NASA's Mars Exploration Rovers continue to send a cornucopia of images to Earth. The results are so spectacular that Deputy Project Manager John Callas recently described them as 'an embarrassment of riches.' Spirit produced this image mosaic, nicknamed the 'Whale Panorama,' two-thirds of the way to the summit of 'Husband Hill,' where the rover investigated martian rocks. On the right side of the panorama is a tilted layer of rocks dubbed 'Larry's Outcrop,' one of several tilted outcrops that scientists examined in April, 2005. They used spatial information to create geologic maps showing the compass orientation and degree of tilting of rock formations in the vicinity. Such information is key to geologic fieldwork because it helps establish if rock layers have been warped since they formed. In this case, scientists have also been studying the mineral and chemical differences, which show that some rocks have been more highly altered than others. In the foreground, in the middle of the image mosaic, Spirit is shown with the scientific instruments at the end of its robotic arm positioned on a rock target known as 'Ahab.' The rover was busy collecting elemental chemistry and mineralogy data on the rock at the same time that it was taking 50 individual snapshots with its five panoramic camera filters to create this stunning view of the martian scenery. The twin tracks of the rover's all-terrain wheels are clearly visible on the left. This mosaic of images spans about 220 degrees from left to right and is an approximate true-color rendering of the Mars terrain acquired through the panoramic camera's 750-, 530-, and 430-nanometer filters. Spirit collected these images from its 497th martian day, or sol, through its 500th sol (May 27 through May 30, 2005).

  7. Opportunity's 'Rub al Khali' Panorama

    Science.gov (United States)

    2005-01-01

    [figure removed for brevity, see original site] Click on the image for Opportunity's 'Rub al Khali' Panorama (QTVR) This panoramic image, dubbed 'Rub al Khali,' was acquired by NASA's Mars Exploration Rover Opportunity on the plains of Meridiani during the period from the rover's 456th to 464th sols on Mars (May 6 to May 14, 2005). Opportunity was about 2 kilometers (1.2 miles) south of 'Endurance Crater' at a place known informally as 'Purgatory Dune.' The rover was stuck in the dune's deep fine sand for more than a month. 'Rub al Khali' (Arabic translation: 'the empty quarter') was chosen as the name for this panorama because it is the name of a similarly barren, desolate part of the Saudi Arabian desert on Earth. The view spans 360 degrees. It consists of images obtained in 97 individual pointings of the panoramic camera. The camera took images with five camera filters at each pointing. This 22,780-by-6,000-pixel mosaic is an approximately true-color rendering generated using the images acquired through filters admitting light wavelengths of 750, 530, and 480 nanometers. Lighting varied during the nine sols it took to acquire this panorama, resulting in some small image seams within the mosaic. These seams have been smoothed in sky parts of the mosaic to better simulate the vista that a person would see if able to view it all at the same time on Mars. Opportunity's tracks leading back to the north (center of the panorama) are a reminder of the rover's long trek from Endurance Crater. The deep ruts dug by Opportunity's wheels as it became stuck in the sand appear in the foreground. The crest and trough of the last ripple the rover crossed before getting stuck is visible in the center. These wind-formed sand features are only about 10 to 15 centimeters (4 to 6 inches) tall. The crest of the actual ripple where the rover got stuck can be seen just to the right of center. The tracks and a few other places on and near ripple crests can be seen in this color image to

  8. Panorama: a targeted proteomics knowledge base.

    Science.gov (United States)

    Sharma, Vagisha; Eckels, Josh; Taylor, Greg K; Shulman, Nicholas J; Stergachis, Andrew B; Joyner, Shannon A; Yan, Ping; Whiteaker, Jeffrey R; Halusa, Goran N; Schilling, Birgit; Gibson, Bradford W; Colangelo, Christopher M; Paulovich, Amanda G; Carr, Steven A; Jaffe, Jacob D; MacCoss, Michael J; MacLean, Brendan

    2014-09-05

    Panorama is a web application for storing, sharing, analyzing, and reusing targeted assays created and refined with Skyline,1 an increasingly popular Windows client software tool for targeted proteomics experiments. Panorama allows laboratories to store and organize curated results contained in Skyline documents with fine-grained permissions, which facilitates distributed collaboration and secure sharing of published and unpublished data via a web-browser interface. It is fully integrated with the Skyline workflow and supports publishing a document directly to a Panorama server from the Skyline user interface. Panorama captures the complete Skyline document information content in a relational database schema. Curated results published to Panorama can be aggregated and exported as chromatogram libraries. These libraries can be used in Skyline to pick optimal targets in new experiments and to validate peak identification of target peptides. Panorama is open-source and freely available. It is distributed as part of LabKey Server,2 an open source biomedical research data management system. Laboratories and organizations can set up Panorama locally by downloading and installing the software on their own servers. They can also request freely hosted projects on https://panoramaweb.org , a Panorama server maintained by the Department of Genome Sciences at the University of Washington.

  9. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  10. The influence of biogeographic history on the functional and phylogenetic diversity of passerine birds in savannas and forests of the Brazilian Amazon.

    Science.gov (United States)

    Almeida, Sara Miranda; Juen, Leandro; Sobral, Fernando Landa; Santos, Marcos Pérsio Dantas

    2018-04-01

    Passeriformes is the largest and most diverse avian order in the world and comprises the Passeri and Tyranni suborders. These suborders constitute a monophyletic group, but differ in their ecology and history of occupation of South America. We investigated the influence of biogeographic history on functional and phylogenetic diversities of Passeri and Tyranni in forest and savanna habitats in the Brazilian Amazon. We compiled species composition data for 34 Passeriformes assemblages, 12 in savannas and 22 in forests. We calculated the functional (Rao's quadratic entropy, FD Q ) and phylogenetic diversities (mean pairwise distance, MPD, and mean nearest taxon distance, MNTD), and the functional beta diversity to investigate the potential role of biogeographic history in shaping ecological traits and species lineages of both suborders. The functional diversity of Passeri was higher than for Tyranni in both habitats. The MPD for Tyranni was higher than for Passeri in forests; however, there was no difference between the suborders in savannas. In savannas, Passeri presented higher MNTD than Tyranni, while in forest areas, Tyranni assemblages showed higher MNTD than Passeri. We found a high functional turnover (~75%) between Passeri and Tyranni in both habitats. The high functional diversity of Passeri in both habitats is due to the high diversity of ecological traits exhibited by species of this group, which enables the exploitation of a wide variety of resources and foraging strategies. The higher Tyranni MPD and MNTD in forests is likely due to Tyranni being older settlers in this habitat, resulting in the emergence and persistence of more lineages. The higher Passeri MNTD in savannas can be explained by the existence of a larger number of different Passeri lineages adapted to this severe habitat. The high functional turnover between the suborders in both habitats suggests an ecological strategy to avoid niche overlap.

  11. High genetic diversity of equine infectious anaemia virus strains from Slovenia revealed upon phylogenetic analysis of the p15 gag gene region.

    Science.gov (United States)

    Kuhar, U; Malovrh, T

    2016-03-01

    The equine infectious anaemia virus (EIAV), which belongs to the Retroviridae family, infects equids almost worldwide. Every year, sporadic EIAV cases are detected in Slovenia. To characterise the Slovenian EIAV strains in the p15 gag gene region phylogenetically in order to compare the Slovenian EIAV strains with EIAV strains from abroad, especially with the recently published European strains. Cross-sectional study using material derived from post mortem examination. In total, 29 EIAV serologically positive horses from 18 different farms were examined in this study. Primers were designed to amplify the p15 gag gene region. Amplicons of 28 PCRs were subjected to direct DNA sequencing and phylogenetic analysis. Altogether, 28 EIAV sequences were obtained from 17 different farms and were distributed between 4 separate monophyletic groups and 9 branches upon phylogenetic analysis. Among EIAV strains from abroad, the closest relatives to Slovenian EIAV strains were European EIAV strains from Italy. Phylogenetic analysis also showed that some animals from distantly located farms were most probably infected with the same EIAV strains, as well as animals from the same farm and animals from farms located in the same geographical region. This is the first report of such high genetic diversity of EIAV strains from one country. This led to speculation that there is a potential virus reservoir among the populations of riding horses, horses kept for pleasure and horses for meat production, with some farmers or horse-owners not following legislation, thus enabling the spread of infection with EIAV. The low sensitivity of the agar gel immunodiffusion test may also contribute to the spread of infection with EIAV, because some infected horses might have escaped detection. The results of the phylogenetic analysis also provide additional knowledge about the highly heterogeneous nature of the EIAV genome. © 2015 EVJ Ltd.

  12. Diversity of Phylogenetic Information According to the Locus and the Taxonomic Level: An Example from a Parasitic Mesostigmatid Mite Genus

    Directory of Open Access Journals (Sweden)

    Lise Roy

    2010-04-01

    Full Text Available Molecular markers for cladistic analyses may perform differently according to the taxonomic group considered and the historical level under investigation. Here we evaluate the phylogenetic potential of five different markers for resolving evolutionary relationships within the ectoparasitic genus Dermanyssus at the species level, and their ability to address questions about the evolution of specialization. COI provided 9–18% divergence between species (up to 9% within species, 16S rRNA 10–16% (up to 4% within species, ITS1 and 2 2–9% (up to 1% within species and Tropomyosin intron n 8–20% (up to 6% within species. EF-1a revealed different non-orthologous copies withinindividuals of Dermanyssus and Ornithonyssus. Tropomyosin intron n was shown containing consistent phylogenetic signal at the specific level within Dermanyssus and represents a promising marker for future prospects in phylogenetics of Acari. Phylogenetic analyses revealed that the generalist condition is apomorphic and D. gallinae mightrepresent a complex of hybridized lineages. The split into hirsutus-group and gallinae-group in Dermanyssus does not seem to be appropriate based upon these results and D. longipes appears to be composed of two different entities.

  13. Evaluating the microbial diversity of an in vitro model of the human large intestine by phylogenetic microarray analysis

    NARCIS (Netherlands)

    Rajilic-Stojanovic, M.; Maathuis, A.; Heilig, G.H.J.; Venema, K.; Vos, de W.M.; Smidt, H.

    2010-01-01

    A high-density phylogenetic microarray targeting small subunit rRNA (SSU rRNA) sequences of over 1000 microbial phylotypes of the human gastrointestinal tract, the HITChip, was used to assess the impact of faecal inoculum preparation and operation conditions on an in vitro model of the human large

  14. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Science.gov (United States)

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  15. Panorama 98. 16 thematic files

    International Nuclear Information System (INIS)

    Anon.

    1998-01-01

    Under the 'Panorama 98' title, the Institut Francais du Petrole (IFP) has organized an international colloquium on the most recent events and the foreseeable perspectives in the domain of hydrocarbons. 16 technical and economical documentation files were given to the participants. This paper presents a synthesis of the content of these files: the oil offer and demand, the worldwide petroleum activity, the recent oil and gas discoveries, the stakes of the oil and gas perspectives in the North Sea, the US renewal in the Gulf of Mexico, the exploitation of heavy and extra-heavy crudes in Venezuela, the Asian oil rise, the limits of oil recovery efficiency, the oil markets, the international overview of the natural gas industry, the perspectives of the LNG market, the recent evolution and the perspectives of the European refining activities, the oil companies in 1997, the future of marketing, the trends of European automotive industry, and the scientific certitudes and uncertainties about urban pollution. (J.S.)

  16. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Taxonomic and phylogenetic diversity of vascular plants at Ma'anling volcano urban park in tropical Haikou, China: Reponses to soil properties.

    Science.gov (United States)

    Cheng, Xia-Lan; Yuan, Lang-Xing; Nizamani, Mir Mohammad; Zhu, Zhi-Xin; Friedman, Cynthia Ross; Wang, Hua-Feng

    2018-01-01

    Anthropogenic processes and socio-economic factors play important roles in shaping plant diversity in urban parks. To investigate how plant diversity of Ma' anling urban volcano park in Hainan Province, China respond to these factors, we carried out a field investigation on the taxonomic and phylogenetic diversity of vascular plants and soil properties in this area. We found 284 species of vascular plants belonging to 88 families and 241 genera, which included 194 native species, 23 invasive species, 31 naturalized species, 40 cultivars, and 4 rare / endangered plant species. Tree composition and richness significantly varied between different vegetation formations (plantation, secondary forest, and abandoned land). Plant species richness and community composition were significantly affected by elevation (El), soil water content (WC), total soil nitrogen (TN) and soil organic matter (SOM). There were significant diversity differences between plantations and abandoned lands, but not between the plantations and secondary forests. The flora in the study site was tropical in nature, characterized by pantropic distributions. Compared to adjacent areas, floristic composition in the study site was most similar to that of Guangdong, followed by that of Vietnam. Our study revealed the diversity patterns of volcanic plants and provided the basis for future planning of plant conservation, such as preserving plant species, maintaining plant habitats, and coordinating plant management in this region.

  18. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Recovery and phylogenetic diversity of culturable fungi associated with marine sponges Clathrina luteoculcitella and Holoxea sp. in the South China Sea.

    Science.gov (United States)

    Ding, Bo; Yin, Ying; Zhang, Fengli; Li, Zhiyong

    2011-08-01

    Sponge-associated fungi represent an important source of marine natural products, but little is known about the fungal diversity and the relationship of sponge-fungal association, especially no research on the fungal diversity in the South China Sea sponge has been reported. In this study, a total of 111 cultivable fungi strains were isolated from two South China Sea sponges Clathrina luteoculcitella and Holoxea sp. using eight different media. Thirty-two independent representatives were selected for analysis of phylogenetic diversity according to ARDRA and morphological characteristics. The culturable fungal communities consisted of at least 17 genera within ten taxonomic orders of two phyla (nine orders of the phylum Ascomycota and one order of the phylum Basidiomycota) including some potential novel marine fungi. Particularly, eight genera of Apiospora, Botryosphaeria, Davidiella, Didymocrea, Lentomitella, Marasmius, Pestalotiopsis, and Rhizomucor were isolated from sponge for the first time. Sponge C. luteoculcitella has greater culturable fungal diversity than sponge Holoxea sp. Five genera of Aspergillus, Davidiella, Fusarium, Paecilomyces, and Penicillium were isolated from both sponges, while 12 genera of Apiospora, Botryosphaeria, Candida, Marasmius, Cladosporium, Didymocrea, Hypocrea, Lentomitella, Nigrospora, Pestalotiopsis, Rhizomucor, and Scopulariopsis were isolated from sponge C. luteoculcitella only. Order Eurotiales especially genera Penicillium, Aspergillus, and order Hypocreales represented the dominant culturable fungi in these two South China Sea sponges. Nigrospora oryzae strain PF18 isolated from sponge C. luteoculcitella showed a strong and broad spectrum antimicrobial activities suggesting the potential for antimicrobial compounds production.

  20. The effects of micro-aeration on the phylogenetic diversity of microorganisms in a thermophilic anaerobic municipal solid-waste digester.

    Science.gov (United States)

    Tang, Yueqin; Shigematsu, Toru; Ikbal; Morimura, Shigeru; Kida, Kenji

    2004-05-01

    We demonstrated previously that micro-aeration allows construction of an effective thermophilic methane-fermentation system for treatment of municipal solid waste (MSW) without production of H(2)S. In the present study, we compared the microbial communities in a thermophilic MSW digester without aeration and with micro-aeration by fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), phylogenetic analysis of libraries of 16S rRNA gene clones and quantitative real-time PCR. Moreover, we studied the activity of sulfate-reducing bacteria (SRB) by analysis of the transcription of the gene for dissimilatory sulfite reductase (dsr). Experiments using FISH revealed that microorganisms belonging to the domain Bacteria dominated in the digester both without aeration and with micro-aeration. Phylogenetic analysis based on 16S rRNA gene and analysis of bacteria by DGGE did not reveal any obvious difference within the microbial communities under the two aeration conditions, and bacteria affiliated with the phylum Firmicutes were dominant. In Archaea, the population of Methanosarcina decreased while the population of Methanoculleus increased as a result of micro-aerations as revealed by the analysis of 16S rRNA gene clones and quantitative real-time PCR. Reverse transcription and PCR (RT-PCR) demonstrated the transcription of dsrA not only in the absence of aeration but also in the presence of micro-aeration, even under conditions where no H(2)S was detected in the biogas. In conclusion, micro-aeration has no obvious effects on the phylogenetic diversity of microorganisms. Furthermore, the activity of SRBs in the digester was not repressed even though the concentration of H(2)S in the biogas was very low under the micro-aeration conditions.

  1. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

  2. Phylogenetic diversity of actinobacteria associated with soft coral Alcyonium gracllimum and stony coral Tubastraea coccinea in the East China Sea.

    Science.gov (United States)

    Yang, Shan; Sun, Wei; Tang, Cen; Jin, Liling; Zhang, Fengli; Li, Zhiyong

    2013-07-01

    Actinobacteria are widely distributed in the marine environment. To date, few studies have been performed to explore the coral-associated Actinobacteria, and little is known about the diversity of coral-associated Actinobacteria. In this study, the actinobacterial diversity associated with one soft coral Alcyonium gracllimum and one stony coral Tubastraea coccinea collected from the East China Sea was investigated using both culture-independent and culture-dependent approaches. A total of 19 actinobacterial genera were detected in these two corals, among which nine genera (Corynebacterium, Dietzia, Gordonia, Kocuria, Microbacterium, Micrococcus, Mycobacterium, Streptomyces, and Candidatus Microthrix) were common, three genera (Cellulomonas, Dermatophilus, and Janibacter) were unique to the soft coral, and seven genera (Brevibacterium, Dermacoccus, Leucobacter, Micromonospora, Nocardioides, Rhodococcus, and Serinicoccus) were unique to the stony coral. This finding suggested that highly diverse Actinobacteria were associated with different types of corals. In particular, five actinobacterial genera (Cellulomonas, Dermacoccus, Gordonia, Serinicoccus, and Candidatus Microthrix) were recovered from corals for the first time, extending the known diversity of coral-associated Actinobacteria. This study shows that soft and stony corals host diverse Actinobacteria and can serve as a new source of marine actinomycetes.

  3. Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals.

    Science.gov (United States)

    Asakura, H; Makino, S; Kobori, H; Watarai, M; Shirahata, T; Ikeda, T; Takeshi, K

    2001-08-01

    Nucleotide sequences of Shiga toxin (Stx) genes in STEC from various origins were determined and characterized by phylogenetic analysis based on Shiga toxin (Stx) with those deposited in GenBank. The phylogenetic trees placed Stx1 and Stx2 into two and five groups respectively, and indicated that Stx1 in sheep-origin STEC were placed into a different group from those in other STEC, and that Stx2 of deer-origin STEC also belonged to the unique group and appeared to be distantly related to human-origin STEC. On the other hand, Stx of STEC isolated from cattle, seagulls and flies were closely related to those of human-origin STEC. Such a diversity of Stx suggested that STEC might be widely disseminated in many animal species, and be dependent on their host species or their habitat. In addition, the active sites in both toxins were compared; the active sites in both subunits of Stx in all the animal-origin STEC were identical to those in human-origin STEC, suggesting that all the toxin of STEC from animals might be also cytotoxic, and therefore, such animal-origin STEC might have potential pathogenicity for humans.

  4. Dynamics of Phylogenetic Diversity and Its Influence on the Production of Extracellular Protease by Moderately Halotolerant Alkaliphilic Bacteria Acinetobacter Baumannii GTCR407 Nov

    Directory of Open Access Journals (Sweden)

    Thiyagarajan Gurunathan

    2010-07-01

    Full Text Available New characters emerge in the population of microorganisms living in the extreme environments due to its adaptation to ecological association. The microorganisms living in saline habitat utilize complex nutrients by adopting different strategies in Deoxyribonucleic Acid (DNA and Ribonucleic Acid (RNA, which are related to their metabolic and ecological diversities. Isolation and characterization of the organisms producing extracellular protease from such environment were the prime focus of this investigation, which can indicate the importance of metabolic diversity in phylogeny. Norberg medium was used to isolate halotolerant microorganisms from salt-cured skin. The isolates were screened for high activity of protease and the strain showing maximum activity of protease was taken for further studies. The biochemical characterization and 16s ribosomal RNA sequencing studies confirm that the isolate is Acinetobacter baumannii. Moreover, hydrolysis positive for starch and casein, negative for gelatin shows that the organism is a variant form of A. baumannii. Cell growth parameters such as pH and temperature were optimized and their values are 8 and 37oC respectively. The extracellular production of protease was optimized in the suitable medium and its enzyme activity was 165μg/ml/min. The results imply that the isolate had acquired operational genes through lateral gene transfer (LGT probably from unrelated species in the environment. This indicates that the isolate identified possesses metabolic and ecological diversities with values of phylogenetic delineation

  5. Large-scale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae).

    Science.gov (United States)

    Chen, Jin-Min; Poyarkov, Nikolay A; Suwannapoom, Chatmongkon; Lathrop, Amy; Wu, Yun-He; Zhou, Wei-Wei; Yuan, Zhi-Yong; Jin, Jie-Qiong; Chen, Hong-Man; Liu, He-Qun; Nguyen, Truong Quang; Nguyen, Sang Ngoc; Duong, Tang Van; Eto, Koshiro; Nishikawa, Kanto; Matsui, Masafumi; Orlov, Nikolai L; Stuart, Bryan L; Brown, Rafe M; Rowley, Jodi J L; Murphy, Robert W; Wang, Ying-Yong; Che, Jing

    2018-07-01

    Southeast Asia and southern China (SEA-SC) harbor a highly diverse and endemic flora and fauna that is under increasing threat. An understanding of the biogeographical history and drivers of this diversity is lacking, especially in some of the most diverse and threatened groups. The Asian leaf-litter frog genus Leptolalax Dubois 1980 is a forest-dependent genus distributed throughout SEA-SC, making it an ideal study group to examine specific biogeographic hypotheses. In addition, the diversity of this genus remains poorly understood, and the phylogenetic relationships among species of Leptolalax and closely related Leptobrachella Smith 1928 remain unclear. Herein, we evaluate species-level diversity based on 48 of the 53 described species from throughout the distribution of Leptolalax. Molecular analyses reveal many undescribed species, mostly in southern China and Indochina. Our well-resolved phylogeny based on multiple nuclear DNA markers shows that Leptolalax is not monophyletic with respect to Leptobrachella and, thus, we assign the former to being a junior synonym of the latter. Similarly, analyses reject monophyly of the two subgenera of Leptolalax. The diversification pattern of the group is complex, involving a high degree of sympatry and prevalence of microendemic species. Northern Sundaland (Borneo) and eastern Indochina (Vietnam) appear to have played pivotal roles as geographical centers of diversification, and paleoclimatic changes and tectonic movements seem to have driven the major divergence of clades. Analyses fail to reject an "upstream" colonization hypothesis, and, thus, the genus appears to have originated in Sundaland and then colonized mainland Asia. Our results reveal that both vicariance and dispersal are responsible for current distribution patterns in the genus. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  7. Some like it high! Phylogenetic diversity of high-elevation cyanobacterial community from biological soil crusts of Western Himalaya.

    Czech Academy of Sciences Publication Activity Database

    Čapková, K.; Hauer, T.; Řeháková, Klára; Doležal, J.

    2016-01-01

    Roč. 71, č. 1 (2016), s. 113-123 ISSN 0095-3628 Institutional support: RVO:60077344 Keywords : soil crusts * cyanobacterial diversity * Western Himalayas * high-elevation * desert * phosphorus Subject RIV: EH - Ecology, Behaviour Impact factor: 3.630, year: 2016

  8. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya

    Czech Academy of Sciences Publication Activity Database

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    Roč. 71, č. 1 (2016), s. 113-123 ISSN 0095-3628 R&D Projects: GA ČR GA13-13368S Institutional support: RVO:67985939 Keywords : Soil crusts * Cyanobacterial diversity * Western Himalayas Subject RIV: EH - Ecology , Behaviour Impact factor: 3.630, year: 2016

  9. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh S.; Cann, Isaac Ko O; Mackie, Roderick Ian

    2014-01-01

    affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a

  10. Microscopic Examination of Distribution and Phenotypic Properties of Phylogenetically Diverse Chloroflexaceae-Related Bacteria in Hot Spring Microbial Mats

    DEFF Research Database (Denmark)

    Nübel, U.; Bateson, Mary M.; Vandieken, V.

    2002-01-01

    We investigated the diversity, distribution, and phenotypes of uncultivated Chloroflexaceae-related bacteria in photosynthetic microbial mats of an alkaline hot spring (Mushroom Spring, Yellowstone National Park). By applying a directed PCR approach, molecular cloning, and sequence analysis of 16S...

  11. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    Czech Academy of Sciences Publication Activity Database

    Machač, A.; Janda, Milan; Dunn, R. R.; Sanders, N. J.

    2011-01-01

    Roč. 34, č. 3 (2011), s. 364-371 ISSN 0906-7590 R&D Projects: GA AV ČR KJB612230701; GA MŠk LC06073; GA ČR GD206/08/H044; GA ČR GA206/09/0115; GA ČR GAP505/10/0673 Institutional research plan: CEZ:AV0Z50070508 Keywords : diversity Subject RIV: EH - Ecology, Behaviour Impact factor: 4.188, year: 2011

  12. The Genetic Diversity and Phylogenetic Characteritics of Rotavirus VP4(P Genotypes in Children With Acute Diarrhea

    Directory of Open Access Journals (Sweden)

    Haghshenas Z

    2011-11-01

    Full Text Available Background: Acute gastroenteritis is a major cause of morbidity and mortality among children in developing countries. Rotaviruses are recognized as the most common etiologic factors of gastroenteritis. In this study, we determined the epidemiologic features, clinical symptoms and molecular structure of rotavirus VP4(P genotypes in children with acute diarrhea in Bahrami Hospital in Tehran Iran, during 2009 for justifying the routine use of rotavirus vaccines in children. Methods: One hundred fifty fecal samples from 150 children with acute diarrhea in Bahrami Pediatric Hospital in Tehran, Iran were collected from January to December 2009. The patients’ mean age was 20.90+18.19 years (ranging from 1 month to 14 years. Fecal samples were transported on ice to the laboratory of virology department of Pasture Institute of Iran. The demographic and clinical data for each case were entered in an author-devised questionnaire. Group A rotavirus was detected by dsRNA-PAGE. Subsequently, rotavirus genotyping (VP4 was performed by semi-nested multiple RT-PCR and the phylogenetic tree of the Rotavirus nucleotides was constructed. The data were analyzed by statistical tests including Wilcoxon signed and Mann-Whitney U. Results: Rotavirus was isolated in 19.3% of the samples, more than 90% of which had long RNA patterns. The predominant genotype (VP4 was P[8] (86% and other genotypes respectively were P[6] (6.9% and P[4] (6.9%. Conclusion: A high prevalence of the P[8] genotype was found to be the cause of acute diarrhea. The analysis of P[8] genotype sequence showed a high level of similarity of the virus in this study with those of other Asian countries.

  13. Diversity and phylogenetic analyses of bacteria from a shallow-water hydrothermal vent in Milos island (Greece).

    Science.gov (United States)

    Giovannelli, Donato; d'Errico, Giuseppe; Manini, Elena; Yakimov, Michail; Vetriani, Costantino

    2013-01-01

    Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34 × 10(8) cells g(-1). The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94%), revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  14. Phenotypic and genetic diversity of Saccharomyces contaminants isolated from lager breweries and their phylogenetic relationship with brewing yeasts

    DEFF Research Database (Denmark)

    Jespersen, Lene; Kühle, Alis Van der Aa; Petersen, Kamilla M.

    2000-01-01

    -amplified intergenic transcribed spacer (ITS) regions. Chromosome length polymorphism (CLP) was evident among the Saccharomyces brewing contaminants with chromosome profiles typical of Saccharomyces sensu stricto. Based upon cluster analysis of their chromosome profiles the majority of the brewing contaminants could...... be grouped as either S. cerevisiae or S. pastorianus/S. bayanus. Further, the technique was able to differentiate between almost all brewing contaminants and to separate them from any specific lager brewing yeast. The diversity of the Saccharomyces brewing contaminants clearly demonstrated by their CLP...... in the SaccharomYces brewing contaminants indicate their adaptation to a maltose-enriched environment....

  15. Phylogenetic Diversity in Core Region of Hepatitis C Virus Genotype 1a as a Factor Associated with Fibrosis Severity in HIV-1-Coinfected Patients

    Directory of Open Access Journals (Sweden)

    Micaela Parra

    2017-01-01

    Full Text Available High hepatitis C virus (HCV genetic diversity impacts infectivity/pathogenicity, influencing chronic liver disease progression associated with fibrosis degrees and hepatocellular carcinoma. HCV core protein is crucial in cell-growth regulation and host-gene expression. Liver fibrosis is accelerated by unknown mechanisms in human immunodeficiency virus-1- (HIV-1- coinfected individuals. We aimed to study whether well-defined HCV-1a core polymorphisms and genetic heterogeneity are related to fibrosis in a highly homogeneous group of interferon-treated HIV-HCV-coinfected patients. Genetic heterogeneity was weighed by Faith’s phylogenetic diversity (PD, which has been little studied in HCV. Eighteen HCV/HIV-coinfected patients presenting different liver fibrosis stages before anti-HCV treatment-initiation were recruited. Sampling at baseline and during and after treatment was performed up to 72 weeks. At inter/intrahost level, HCV-1a populations were studied using molecular cloning and Sanger sequencing. Over 400 complete HCV-1a core sequences encompassing 573 positions of C were obtained. Amino acid substitutions found previously at positions 70 and 91 of HCV-1b core region were not observed. However, HCV genetic heterogeneity was higher in mild than in severe fibrosis cases. These results suggest a potential utility of PD as a virus-related factor associated with chronic hepatitis C progression. These observations should be reassessed in larger cohorts to corroborate our findings and assess other potential covariates.

  16. Phylogenetic and functional diversity of Bacteria and Archaea in a unique stratified lagoon, the Clipperton atoll (N Pacific).

    Science.gov (United States)

    Galand, Pierre E; Bourrain, Muriel; De Maistre, Emmanuel; Catala, Philippe; Desdevises, Yves; Elifantz, Hila; Kirchman, David L; Lebaron, Philippe

    2012-01-01

    The Clipperton lagoon in the North Pacific Ocean has been isolated from the surrounding sea for c. 160 years. It has a stratified water column that comprises an oxic and brackish upper water layer (mixolimnion) and a deep sulfuric anoxic saline layer (monimolimnion), separated by a steep pycnocline. Here, we test whether the Clipperton lagoon with its distinctive physico-chemical features, geographic isolation, recent water column stratification, and large nutrient input harbors original microbial communities. The combination of capillary electrophoresis single-strand polymorphism (CE-SSCP) fingerprinting and sequencing of cloned bacterial and archaeal 16S rRNA genes, and functional genes for methanogenesis (mcrA), methanotrophy (pmoA), and sulfate reduction (dsrAB), revealed that microbial communities and pathways were highly stratified down the water column. The mixolimnion contained ubiquitous freshwater clades of Alpha- and Betaproteobacteria, while the pycnocline contained mostly green sulfur bacteria (phylum Chlorobi). Sequences of the upper layers were closely related to sequences found in other aquatic ecosystems, suggesting that they have a strong potential for dispersal and colonization. In contrast, the monimolimnion contained new deeply branching bacterial divisions within the OP11 cluster and the Bacteroidetes, and was the most diverse of the layers. The unique environmental conditions characterizing the deep layers of the lagoon may explain the novelty of the microbial communities found at the Clipperton atoll.

  17. Panorama Pluton : a composite gabbro-monzodiorite early Ross Orogeny intrusion in southern Victoria Land, Antarctica

    International Nuclear Information System (INIS)

    Mellish, S.D.; Cooper, A.F.; Walker, N.W.

    2002-01-01

    The Koettlitz Glacier Alkaline Province of the Walcott Glacier to Radian Glacier area of the Transantarctic Mountains contains a diverse suite of intrusions ranging from gabbro and diorite to granite, nepheline syenite, and carbonatite. Most of the plutons are alkaline (A-type), although the Panorama Pluton is mafic, comprising both hypersthene normative gabbroic and quartz normative monzodioritic lithologies. The pluton has a composite nature, determined by whole-rock geochemical trends and Nd-Sr isotope data that reflect distinctive source regions for the different components. U-Pb geochronology of zircon and titanite indicates the Panorama Pluton was intruded during the early stages of the Neoproterozoic-early Paleozoic Ross Orogeny at 535 ± 9 Ma, and that it is coeval with the geochemically similar Dromedary Mafic Complex which crops out 10 km to the southeast. The Panorama Pluton is a volumetrically minor mafic component of the Koettlitz Glacier Alkaline Province, which predates, by at least 15 m.y., the dominant calc-alkaline suites that occur along-strike in the Dry Valleys area to the north, and the central Transantarctic Mountains to the south. The Panorama Pluton magmas, and other Koettlitz Glacier Alkaline Province lithologies, are interpreted to have formed in an extensional or transtensional jog that predates the onset of widespread Ross Orogeny subduction. (author). 48 refs., 7 figs., 3 tabs

  18. 'Everest' Panorama; 20-20 Vision

    Science.gov (United States)

    2005-01-01

    [figure removed for brevity, see original site] 'Everest' Panorama 20-20 Vision (QTVR) [figure removed for brevity, see original site] 'Everest' Panorama Animation If a human with perfect vision donned a spacesuit and stepped onto the martian surface, the view would be as clear as this sweeping panorama taken by NASA's Mars Exploration Rover Spirit. That's because the rover's panoramic camera has the equivalent of 20-20 vision. Earthlings can take a virtual tour of the scenery by zooming in on their computer screens many times to get a closer look at, say, a rock outcrop or a sand drift, without losing any detail. This level of clarity is unequaled in the history of Mars exploration. It took Spirit three days, sols 620 to 622 (Oct. 1 to Oct. 3, 2005), to acquire all the images combined into this mosaic, called the 'Everest Panorama,' looking outward in every direction from the true summit of 'Husband Hill.' During that period, the sky changed in color and brightness due to atmospheric dust variations, as shown in contrasting sections of this mosaic. Haze occasionally obscured the view of the hills on the distant rim of Gusev Crater 80 kilometers (50 miles) away. As dust devils swooped across the horizon in the upper right portion of the panorama, the robotic explorer changed the filters on the camera from red to green to blue, making the dust devils appear red, green, and blue. In reality, the dust devils are similar in color to the reddish-brown soils of Mars. No attempt was made to 'smooth' the sky in this mosaic, as has been done in other panoramic-camera mosaics to simulate the view one would get by taking in the landscape all at once. The result is a sweeping vista that allows viewers to observe weather changes on Mars. The summit of Husband Hill is a broad plateau of rock outcrops and windblown drifts about 100 meters (300 feet) higher than the surrounding plains of Gusev Crater. In the distance, near the center of the mosaic, is the 'South Basin,' the

  19. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae

    Directory of Open Access Journals (Sweden)

    Tarcilla C. Borghesan

    2018-02-01

    Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This

  20. Location Distribution Optimization of Photographing Sites for Indoor Panorama Modeling

    Science.gov (United States)

    Zhang, S.; Wu, J.; Zhang, Y.; Zhang, X.; Xin, Z.; Liu, J.

    2017-09-01

    Generally, panoramas image modeling is costly and time-consuming because of photographing continuously to capture enough photos along the routes, especially in complicated indoor environment. Thus, difficulty follows for a wider applications of panoramic image modeling for business. It is indispensable to make a feasible arrangement of panorama sites locations because the locations influence the clarity, coverage and the amount of panoramic images under the condition of certain device. This paper is aim to propose a standard procedure to generate the specific location and total amount of panorama sites in indoor panoramas modeling. Firstly, establish the functional relationship between one panorama site and its objectives. Then, apply the relationship to panorama sites network. We propose the Distance Clarity function (FC and Fe) manifesting the mathematical relationship between panoramas and objectives distance or obstacle distance. The Distance Buffer function (FB) is modified from traditional buffer method to generate the coverage of panorama site. Secondly, transverse every point in possible area to locate possible panorama site, calculate the clarity and coverage synthetically. Finally select as little points as possible to satiate clarity requirement preferentially and then the coverage requirement. In the experiments, detailed parameters of camera lens are given. Still, more experiments parameters need trying out given that relationship between clarity and distance is device dependent. In short, through the function FC, Fe and FB, locations of panorama sites can be generated automatically and accurately.

  1. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  2. Pharmacological Potential of Phylogenetically Diverse Actinobacteria Isolated from Deep-Sea Coral Ecosystems of the Submarine Avilés Canyon in the Cantabrian Sea.

    Science.gov (United States)

    Sarmiento-Vizcaíno, Aida; González, Verónica; Braña, Alfredo F; Palacios, Juan J; Otero, Luis; Fernández, Jonathan; Molina, Axayacatl; Kulik, Andreas; Vázquez, Fernando; Acuña, José L; García, Luis A; Blanco, Gloria

    2017-02-01

    Marine Actinobacteria are emerging as an unexplored source for natural product discovery. Eighty-seven deep-sea coral reef invertebrates were collected during an oceanographic expedition at the submarine Avilés Canyon (Asturias, Spain) in a range of 1500 to 4700 m depth. From these, 18 cultivable bioactive Actinobacteria were isolated, mainly from corals, phylum Cnidaria, and some specimens of phyla Echinodermata, Porifera, Annelida, Arthropoda, Mollusca and Sipuncula. As determined by 16S rRNA sequencing and phylogenetic analyses, all isolates belong to the phylum Actinobacteria, mainly to the Streptomyces genus and also to Micromonospora, Pseudonocardia and Myceligenerans. Production of bioactive compounds of pharmacological interest was investigated by high-performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry (GC-MS) techniques and subsequent database comparison. Results reveal that deep-sea isolated Actinobacteria display a wide repertoire of secondary metabolite production with a high chemical diversity. Most identified products (both diffusible and volatiles) are known by their contrasted antibiotic or antitumor activities. Bioassays with ethyl acetate extracts from isolates displayed strong antibiotic activities against a panel of important resistant clinical pathogens, including Gram-positive and Gram-negative bacteria, as well as fungi, all of them isolated at two main hospitals (HUCA and Cabueñes) from the same geographical region. The identity of the active extracts components of these producing Actinobacteria is currently being investigated, given its potential for the discovery of pharmaceuticals and other products of biotechnological interest.

  3. D.E.R. 86 panorama

    International Nuclear Information System (INIS)

    1987-01-01

    This progress report presents the panorama of the studies carried out by the ''Direction des Etudes et des Recherches'' (E.D.F.): nuclear boilers; classical and nuclear thermal power plants, hydraulic power plants; electrical equipment; network analysis; environmental impacts; uses of electric power; new aspects of energy; applied informatics and mathematics; normalization and patents. A selection of the publications of 1986 is finally presented. 680 refs [fr

  4. D.E.R. 84 panorama

    International Nuclear Information System (INIS)

    1985-01-01

    This progress report presents the panorama of the studies carried out by the ''Direction des Etudes et des Recherches'' (E.D.F): nuclear boilers; classical and nuclear thermal power plants, hydraulic power plants; electrical equipment; network analysis; environmental impacts; uses of electric power; new aspects of energy; applied informatics and mathematics; normalization and patents. A selection of the publications of the year is finally presented [fr

  5. D.E.R. 83 panorama

    International Nuclear Information System (INIS)

    1984-01-01

    This progress report presents the panorama of the studies carried out by the ''Direction des Etudes et des Recherches'' (E.D.F.): nuclear boilers; classical and nuclear thermal power plants, hydraulic power plants; electrical equipment; network analysis; environmental impacts; uses of electric power; new aspects of energy; applied informatics and mathematics; normalization and patents. A selection of the publications of 1982 is finally presented [fr

  6. D.E.R. 85 panorama

    International Nuclear Information System (INIS)

    1986-01-01

    This progress report presents the panorama of the studies carried out by the ''Direction des Etudes et des Recherches'' (E.D.F.): nuclear boilers; classical and nuclear thermal power plants, hydraulic power plants; electrical equipment; network analysis environmental impacts; uses of electric power; new aspects of energy; applied informatics and mathematics; normalization and patents. A selection of the publications of 1985 is finally presented [fr

  7. Legacy Panorama on Spirit's Way to 'Bonneville'

    Science.gov (United States)

    2005-01-01

    [figure removed for brevity, see original site] Click on the image for Legacy Panorama on Spirit's Way to 'Bonneville' (QTVR) This view captured by the panoramic camera on NASA's Mars Exploration Rover Spirit nearly a year ago is called Spirit's 'Legacy' panorama. It combines many frames acquired during Spirit's 59th through 61st martian days, or sols (March 3 to 5, 2004) from a position about halfway between the landing site and the rim of 'Bonneville Crater.' The location is within the transition from the relatively smooth plains to the more rocky and rugged blanket of material ejected from Bonneville by the force of the impact that dug the crater. The panorama spans 360 degrees and consists of images obtained in 78 individual pointings. The camera took images though 5 different filter at each pointing. This mosaic is an approximately true-color rendering generated using the images acquired through filters centered at wavelengths of 750, 530, and 480 nanometers. The Columbia Memorial Station lander can be seen about 200 meters (about 650 feet) in the distance by following the rover tracks back toward right of center in the mosaic and zooming in.

  8. PANORAMA - Explorations in the aesthetics of social awareness

    OpenAIRE

    Eliëns, A.; Eliens, A.P.W.; Vyas, Dhaval; Roccetti, M.

    2007-01-01

    In this paper we reflect on our experiences in developing PANORAMA, a playful application meant to promote and support social awareness in a work environment, through art-inspired visualisations of social processes and personal contributions. With respect to the design of PANORAMA, we found common notions of visual semiotics helpful in determining the overall composition of the screen layout. More in general, however, the development of PANORAMA proved to be an exercise in interaction aesthet...

  9. [Phylogenetic diversity and cold-adaptive hydrolytic enzymes of culturable psychrophilic bacteria associated with sea ice from high latitude ocean, Artic].

    Science.gov (United States)

    Yu, Yong; Li, Hui-Rong; Chen, Bo; Zeng, Yin-Xin; He, Jian-Feng

    2006-04-01

    The phylogenetic diversity of culturable psychrophilic bacteria associated with sea ice from high latitude sea (77 degrees 30'N - 81 degrees 12'N), Canadian Basin and Greenland sea Arctic, was investigated. A total of 37 psychrophilic strains were isolated using three different methods of ( i ) spread plate method: 100 microL of each dilution ice-melt sample was spreaded onto the surface of Marine 2216 agar (DIFCO laboratories, Detroit, MI) and incubated for 2 to 6 weeks at 4 degrees C; ( ii ) bath culture and spread plate method: 1 mL of sample was added to 9mL of NSW (unamended natural seawater, 0.2 microm prefiltered and autoclaved) and incubated for 1 months at - 1 degrees C, then spread plate method was used to isolate bacterial strains from the pre-cultured samples; ( iii ) cold shock, bath culture and spread plate method: samples were exposed to - 20 degrees C for 24h, then bacterial strains isolated by bath culture and spread plate method under aerobic conditions. Nearly half of psychrophilic strains are isolated by using method iii . 16S rDNA nearly full-length sequence analysis reveal that psychrophilic strains fall in two phylogenetic divisions, gamma-proteobacteria (in the genera Colwellia, Marinobacter, Shewanella, Thalassomonas, Glaciecola, Marinomonas and Pseudoalteromonas) and Cytophaga-Flexibacter-Bacteroides (in the genera Flavobacterium and Psychroflexus). Nine of bacterial isolates (BSi20007, BSi20497, BSi20517, BSi20537, BSi20170, BSi20001, BSi20002, BSi20675 and BSi20101) quite likely represent novel species (16S rDNA sequence similarity below 97%). One of strains (BSi20002) from Canadian Basin shows 100% sequence similarity to the Antarctic Weddell sea ice isolate Marinobacter sp. ANT8277, suggesting bacteria may have a bipolar distribution at the species level. AF283859 sequences were submitted to the BLAST search program of the National Center for Biotechnology Information website (NCBI, http://www. ncbi. nlm.nih. gov). Twenty sequences

  10. International nuclear panorama. Developments october 2001 - april 2002; Panorama nucleaire international. Developpements octobre 2001 - avril 2002

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    This panorama presents the today situation of the nuclear parks and the future tendencies, by a political and economic analysis of the governments policy, for the following continents: north America, west Europe, Asia, South America, Africa, Russia and east europe. (A.L.B.)

  11. The renewable energies panorama in Aquitaine; Panorama des energies renouvelables en Aquitaine

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    The Information network on the Economic Development in Aquitaine (IDEA) aims to collect and spread the environmental information concerning the Aquitaine, in order to implement an observatory of the regional environment and of the sustainable development. This panorama takes stock on the renewable energies development in Aquitaine: photovoltaic, geothermal energy, thermal solar, hydroelectricity and cogeneration. (A.L.B.)

  12. Diversity

    Science.gov (United States)

    Portraits In Courage Vol. VIII Portraits In Courage Vol. IX Portraits In Courage Vol. X AF Sites Social -Wide Initiative to Promote Diversity and Inclusion in the Federal Workforce Executive Order 13548 : Virtual Diversity Conference Air Force Diversity & Inclusion Air Force Diversity Graphic There is no

  13. Panorama de la Dendrochronologie en France.

    OpenAIRE

    Astrade, Laurent; Miramont, Cécile

    2010-01-01

    Actes du colloque "Panorama de la dendrochronologie en France", octobre 2009, Digne les Bains. Ce nouveau numéro de la Collection Edytem accueille les contributions du colloque qui s'est déroulé, il y a moins d'un an, à Digne-les-Bains, autour de la dendrochronologie en France. Les différents textes de ce numéro et leur articulation en cinq grands thèmes (dendroécologie, dendroclimatologie, dendrogéomorphologie, dendroarchéologie, méthodes de la dendrochronologie) mettent en avant la diversit...

  14. Panorama of acute diarrhoeal diseases in Mexico.

    Science.gov (United States)

    Cifuentes, E; Hernández, J E; Venczel, L; Hurtado, M

    1999-09-01

    We examined the recent panorama of ADD related deaths in Mexico in an effort to assess the overall impact of control measures that may vary in space and time. We pay particular attention to mortality rates recorded between 1985-1995, that is, before and after the cholera emergency. The aim is to focus on the social groups at risk, using time series data represented in the form of images and produced by a geographic information system (GIS). We show the potential of such methods to define populations at risk and support the decision process.

  15. Spherical Panoramas for Astrophysical Data Visualization

    Science.gov (United States)

    Kent, Brian R.

    2017-05-01

    Data immersion has advantages in astrophysical visualization. Complex multi-dimensional data and phase spaces can be explored in a seamless and interactive viewing environment. Putting the user in the data is a first step toward immersive data analysis. We present a technique for creating 360° spherical panoramas with astrophysical data. The three-dimensional software package Blender and the Google Spatial Media module are used together to immerse users in data exploration. Several examples employing these methods exhibit how the technique works using different types of astronomical data.

  16. PANORAMA - Explorations in the aesthetics of social awareness

    NARCIS (Netherlands)

    Eliëns, A.; Eliens, A.P.W.; Vyas, Dhaval; Roccetti, M.

    2007-01-01

    In this paper we reflect on our experiences in developing PANORAMA, a playful application meant to promote and support social awareness in a work environment, through art-inspired visualisations of social processes and personal contributions. With respect to the design of PANORAMA, we found common

  17. Panorama of explicit carbon pricing instruments around the world

    International Nuclear Information System (INIS)

    2016-09-01

    In September 2016, I4CE updated its database on carbon pricing policies and published a panorama of explicit carbon pricing policies. This panorama presents an implementation timeline, a world map and a table that together, provide information on the jurisdictions that have implemented or plan to implement explicit carbon pricing policies, the type of instrument chosen, the sectors covered and the carbon prices

  18. Depth Perception in Cave and Panorama

    DEFF Research Database (Denmark)

    Mullins, Michael; Strojan, Tadeja Zupancic

    2004-01-01

    This study compares aspects of spatial perception in a physical environment and its virtual representations in a CAVE and Panorama, derived from recent research. To measure accuracy of spatial perception, participants in an experiment were asked to look at identical objects in the three environme......, learning and training in virtual environments; in architectural education; and participatory design processes, in which the dialogue between real and imagined space may take place in virtual . reality environments...... environments and then locate them and identify their shape on scaled drawings.  Results are presented together with statistical analysis. In a discussion of the results, the paper addresses the two hypothetical assertions ? that depth perception in physical reality and its virtual representations in CAVE......This study compares aspects of spatial perception in a physical environment and its virtual representations in a CAVE and Panorama, derived from recent research. To measure accuracy of spatial perception, participants in an experiment were asked to look at identical objects in the three...

  19. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    of Euryarchaeota. Our results indicate that archaeal diversity in tropical estuarine sediments is influenced by the mangrove vegetation bordering the lower stretches of both estuaries. Higher diversity may be related to elevated land drainage during the monsoon...

  20. AUTOMATIC ADJUSTMENT OF WIDE-BASE GOOGLE STREET VIEW PANORAMAS

    Directory of Open Access Journals (Sweden)

    E. Boussias-Alexakis

    2016-06-01

    Full Text Available This paper focuses on the issue of sparse matching in cases of extremely wide-base panoramic images such as those acquired by Google Street View in narrow urban streets. In order to effectively use affine point operators for bundle adjustment, panoramas must be suitably rectified to simulate affinity. To this end, a custom piecewise planar projection (triangular prism projection is applied. On the assumption that the image baselines run parallel to the street façades, the estimated locations of the vanishing lines of the façade plane allow effectively removing projectivity and applying the ASIFT point operator on panorama pairs. Results from comparisons with multi-panorama adjustment, based on manually measured image points, and ground truth indicate that such an approach, if further elaborated, may well provide a realistic answer to the matching problem in the case of demanding panorama configurations.

  1. Por que o panorama religioso no Brasil mudou tanto?

    Directory of Open Access Journals (Sweden)

    Alberto Antoniazzi

    2009-05-01

    Full Text Available Entre 1991 e 2000, a porcentagem de católicos caiu de 83,3% para 73,9%, a dos evangélicos cresceu de 9% para 15,6% e a dos “sem religião” subiu de 4,7% para 7,4%. Como entender essas mudanças? Qual a responsabilidade da Igreja católica? O artigo apresenta, primeiramente, a visão sobre a diversidade religiosa, as mudanças ocorridas nas últimas décadas. Discute a seguir sobre a “Força e fraqueza da presença católica”, construindo um “mapa do catolicismo”. O terceiro enfoque reflete sobre as causas desse “enfraquecimento”, especialmente, os movimentos migratórios da população brasileira e os problemas da resposta da Igreja para acompanhar essa mudança, tanto nas “novas frentes migratórias” quanto nas periferias dos grandes centros. Deixando o campo católico, analisa-se a diversidade das igrejas evangélicas ou os protestantes tradicionais e depois a “expansão pentecostal”, em sua enorme diversidade, com destaque ao neopentecostalismo e seu profissionalismo empresarial. Finalmente, aborda-se o fenômeno das “outras religiões” e o crescimento dos “sem-religião”.Palabras clave: Religião; Diversidade religiosa; Panorama religioso brasileiro; Censo 2000; Igreja católica.ABSTRACTBetween 1991 and 2000, the percentage of catholics dropped from 83,3% to 73,9%, that o the evangelicalsgrew from 9% to 15,6%, and that of people ‘without a religion’ rose from 4,7% to 7,4%. How can we understand those changes? How far is the Catholic church responsible? This article starts with a view of religious diversity and the changes that took place in the last decades. It then goes on to discuss the ‘power and weakness of the Catholic presence’, drawing a ‘map of Catholicism’. O terceiro The third part focuses on the causes of that ‘weakening’, mainly the migratory flows of the Brazilian population and the problems of the church response to those changes, in the ‘new migratory fronts’ as well as in

  2. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  3. Escolas de governo: o panorama brasileiro

    Directory of Open Access Journals (Sweden)

    Renan Felinto de Farias Aires

    2014-08-01

    Full Text Available Escolas de governo têm papel significativo na vida do servidor público, valorizando-o e qualificando-o para a construção de uma nova imagem do serviço público. Apesar disso, esse é um universo de instituições ainda não totalmente conhecido e com poucos estudos. Partindo desse princípio, o objetivo deste artigo é traçar o panorama das escolas de governo do Brasil, descrevendo-as e analisando-as criticamente. Para tanto, foi realizada uma pesquisa exploratório-descritiva, por meio de um levantamento bibliográfico em estudos já publicados e nos websites relacionados às escolas, seguida de uma análise de conteúdo baseada nos critérios utilizados por Aires e colaboradores (2012. Os resultados apontaram que os estados pertencentes às regiões Norte e alguns estados da região Nordeste apresentaram um baixo desempenho nos critérios analisados, se comparados às escolas das outras regiões brasileiras.

  4. Long term panorama of the nuclear technology

    International Nuclear Information System (INIS)

    Velez, C.

    2009-01-01

    The concern for the security of the hydrocarbons supply, essentials for the transport and every time more important in the electricity production, it is one of the rebirth causes of interest for the nuclear energy. On the other hand, it is the increase of the hydrocarbons price. In some countries, included Mexico, the price of gas is subject to strong seasonal fluctuations, aggravating by the congestion of the ducts. It is certain that great part of the prices rise of petroleum that we are experiencing is due to speculation, for what it is necessary to look for objective elements that allow to venture in the difficult topic of the future price of crude. One finishes reason of the resurgence of interest for the nuclear energy, is the growing perception that with the gases emission of greenhouse effect we are exposing our planet to an uncontrollable experiment with consequences potentially catastrophic. This perception is translated in a pressure of the public opinion for to use renewable energy sources that do not contribute to the greenhouse effect. In this work a general panorama is exposed on the advances that exist at the present time, like nuclear reactors with the purpose of solving the current problem that the world is crossing. (Author)

  5. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  6. Acquisition of stereo panoramas for display in VR environments

    KAUST Repository

    Ainsworth, Richard A.

    2011-01-23

    Virtual reality systems are an excellent environment for stereo panorama displays. The acquisition and display methods described here combine high-resolution photography with surround vision and full stereo view in an immersive environment. This combination provides photographic stereo-panoramas for a variety of VR displays, including the StarCAVE, NexCAVE, and CORNEA. The zero parallax point used in conventional panorama photography is also the center of horizontal and vertical rotation when creating photographs for stereo panoramas. The two photographically created images are displayed on a cylinder or a sphere. The radius from the viewer to the image is set at approximately 20 feet, or at the object of major interest. A full stereo view is presented in all directions. The interocular distance, as seen from the viewer\\'s perspective, displaces the two spherical images horizontally. This presents correct stereo separation in whatever direction the viewer is looking, even up and down. Objects at infinity will move with the viewer, contributing to an immersive experience. Stereo panoramas created with this acquisition and display technique can be applied without modification to a large array of VR devices having different screen arrangements and different VR libraries.

  7. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  8. Comparative genomics of phylogenetically diverse unicellular eukaryotes provide new insights into the genetic basis for the evolution of the programmed cell death machinery.

    Science.gov (United States)

    Nedelcu, Aurora M

    2009-03-01

    Programmed cell death (PCD) represents a significant component of normal growth and development in multicellular organisms. Recently, PCD-like processes have been reported in single-celled eukaryotes, implying that some components of the PCD machinery existed early in eukaryotic evolution. This study provides a comparative analysis of PCD-related sequences across more than 50 unicellular genera from four eukaryotic supergroups: Unikonts, Excavata, Chromalveolata, and Plantae. A complex set of PCD-related sequences that correspond to domains or proteins associated with all main functional classes--from ligands and receptors to executors of PCD--was found in many unicellular lineages. Several PCD domains and proteins previously thought to be restricted to animals or land plants are also present in unicellular species. Noteworthy, the yeast, Saccharomyces cerevisiae--used as an experimental model system for PCD research, has a rather reduced set of PCD-related sequences relative to other unicellular species. The phylogenetic distribution of the PCD-related sequences identified in unicellular lineages suggests that the genetic basis for the evolution of the complex PCD machinery present in extant multicellular lineages has been established early in the evolution of eukaryotes. The shaping of the PCD machinery in multicellular lineages involved the duplication, co-option, recruitment, and shuffling of domains already present in their unicellular ancestors.

  9. Panorama 1999: prospects for the future

    International Nuclear Information System (INIS)

    Appert, O.

    1999-01-01

    During the last 'Panorama 1999' international conference organised on 28 January by the EFPISIS group, the ISIS General Manager, Olivier Appert, on the basis of the outstanding elements of the year 1998, made an analysis concerning the perspective of the oil and gas markets for the years to come. The year of 1998 shall remain the second counter- shock oil year with a fall in prices of crude oil of about 45 %. However, despite the current abundant flow of oil, the underlying factors of the oil markets - the recovery in 1999 in the rate of growth for the world oil requirement of 1.1 Mb/day as per the AIE estimations, a level close to that of the years 1985/1995, taken into account by the market of the return of Iraq expected for several years and natural depletion of oil deposits faster than in the past - seem to indicate that, after a purging period of stocks, prices could be favourably adjusted. In the current context, the interest of deep offshore operators does not seem consistent. The year of 1998 has also been marked by major restructuring of the oil, para-petroleum and car industries: BP-Amaco, Exxon-Mobil and Total-Petrofina in the petrol sector, Halliburton/Dresser, Baker Hugues/Western Atlas and Schlumberger/Camco in the para-petroleum sector or even Daimler-Benz/Chrysler in the motor vehicle sector. Despite an overall mediocre economic trend, 1998 has confirmed the signs of improvement of refining activity, already observed in 1996 and 1997, both in Europe and the United States, whereas in Asia the refining margins went down. In the natural gas field, perspectives remain favourable in the long term despite a slowing down in the short term. In the context, technological progress shall continue to play a main role so as to challenge the problems concerning the petroleum activity on the dawn of the 21. century. deep offshore, gas chemical conversion,conversion of heavy products or hybrid vehicles are a few fields amongst which the IFP and its technological

  10. Micro-evolutionary diversification among Indian Ocean parrots: temporal and spatial changes in phylogenetic diversity as a consequence of extinction and invasion

    OpenAIRE

    Jackson, H; Jones, C G; Agapow, P-M; Tatayah, V; Groombridge, Jim J.

    2015-01-01

    Almost 90% of global bird extinctions have occurred on islands. The loss of endemic spe- cies from island systems can dramatically alter evolutionary trajectories of insular species biodiversity, resulting in a loss of evolutionary diversity important for species adaptation to changing environments. The Western Indian Ocean islands have been the scene of evolution for a large number of endemic parrots. Since their discovery in the 16th cen- tury, many of these parrots have become extinct or h...

  11. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum".

    Directory of Open Access Journals (Sweden)

    Sophie R Ullrich

    Full Text Available Members of the genus "Ferrovum" are ubiquitously distributed in acid mine drainage (AMD waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain "Ferrovum myxofaciens" P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus "Ferrovum" is extremely scarce.In order to access the wider genetic pool of the genus "Ferrovum" we sequenced the genome of a "Ferrovum"-containing mixed culture and successfully assembled the almost complete genome sequence of the novel "Ferrovum" strain JA12.The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct "Ferrovum" species. "Ferrovum" strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that "Ferrovum" strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively.The potential utilisation of urea by "Ferrovum" strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs "Ferrovum" strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin and Acidithiobacillus ferrivorans (iron oxidase indicates the existence of a modified pathway in "Ferrovum" strain JA12

  12. Molecular diversity of bacterial endosymbionts associated with dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) reveals a high degree of phylogenetic congruence with their host.

    Science.gov (United States)

    Palomares-Rius, Juan E; Archidona-Yuste, Antonio; Cantalapiedra-Navarrete, Carolina; Prieto, Pilar; Castillo, Pablo

    2016-12-01

    Bacterial endosymbionts have been detected in some groups of plant-parasitic nematodes, but few cases have been reported compared to other groups in the phylum Nematoda, such as animal-parasitic or free-living nematodes. This study was performed on a wide variety of plant-parasitic nematode families and species from different host plants and nematode populations. A total of 124 nematode populations (previously identified morphologically and molecularly) were screened for the presence of potential bacterial endosymbionts using the partial 16S rRNA gene and fluorescence in situ hybridization (FISH) and confocal microscopy. Potential bacterial endosymbionts were only detected in nematode species belonging to the genus Xiphinema and specifically in the X. americanum group. Fifty-seven partial 16S rRNA sequences were obtained from bacterial endosymbionts in this study. One group of sequences was closely related to the genus 'Candidatus Xiphinematobacter' (19 bacterial endosymbiont sequences were associated with seven nematode host species, including two that have already been described and three unknown bacterial endosymbionts). The second bacterial endosymbiont group (38 bacterial endosymbiont sequences associated with six nematode species) was related to the family Burkholderiaceae, which includes fungal and soil-plant bacterial endosymbionts. These endosymbionts were reported for the first time in the phylum Nematoda. Our findings suggest that there is a highly specific symbiotic relationship between nematode host and bacterial endosymbionts. Overall, these results were corroborated by a phylogeny of nematode host and bacterial endosymbionts that suggested that there was a high degree of phylogenetic congruence and long-term evolutionary persistence between hosts and endosymbionts. © 2016 John Wiley & Sons Ltd.

  13. Morphological characterization and phylogenetic distance among ...

    African Journals Online (AJOL)

    The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...

  14. 3D moviemap and a 3D panorama

    Science.gov (United States)

    Naimark, Michael

    1997-05-01

    Two immersive virtual environments produced as art installations investigate 'sense of place' in different but complimentary ways. One is a stereoscopic moviemap, the other a stereoscopic panorama. Moviemaps are interactive systems which allow 'travel' along pre-recorded routes with some control over speed and direction. Panoramas are 360 degree visual representations dating back to the late 18th century but which have recently experienced renewed interest due to 'virtual reality' systems. Moviemaps allow 'moving around' while panoramas allow 'looking around,' but to date there has been little or no attempt to produce either in stereo from camera-based material. 'See Banff stereoscopic moviemap about landscape, tourism, and growth in the Canadian Rocky Mountains. It was filmed with twin 16 mm cameras and displayed as a single-user experience housed in a cabinet resembling a century-old kinetoscope, with a crank on the side for 'moving through' the material. 'Be Now Here (Welcome to the Neighborhood)' (1995-6) is a stereoscopic panorama filmed in public gathering places around the world, based upon the UNESCO World Heritage 'In Danger' list. It was filmed with twin 35 mm motion picture cameras on a rotating tripod and displayed using a synchronized rotating floor.

  15. International nuclear panorama. Developments october 2001 - april 2002

    International Nuclear Information System (INIS)

    2002-01-01

    This panorama presents the today situation of the nuclear parks and the future tendencies, by a political and economic analysis of the governments policy, for the following continents: north America, west Europe, Asia, South America, Africa, Russia and east europe. (A.L.B.)

  16. Acquisition of stereo panoramas for display in VR environments

    KAUST Repository

    Ainsworth, Richard A.; Sandin, Daniel J.; Schulze, Jurgen P.; Prudhomme, Andrew; DeFanti, Thomas A.; Srinivasan, Madhusudhanan

    2011-01-01

    photographs for stereo panoramas. The two photographically created images are displayed on a cylinder or a sphere. The radius from the viewer to the image is set at approximately 20 feet, or at the object of major interest. A full stereo view is presented

  17. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    Science.gov (United States)

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  18. Phylogenetic and Physiological Diversity of Subseafloor Microbial Communities at Axial Seamount, Juan de Fuca Ridge: Summary of Results From the New Millenium Observatory (NeMO), 1998-2004

    Science.gov (United States)

    Baross, J. A.; Huber, J. A.; Mehta, M. P.; Opatkiewicz, A.; Bolton, S. A.; Butterfield, D. A.; Sogin, M. L.; Embley, R. W.

    2005-12-01

    Axial Seamount (45 ° 58' N; 130 ° 00' W) is an active submarine volcano located on the Juan de Fuca Ridge, approximately 300 miles off the coast of Oregon. Lying at the intersection of a seamount chain and a spreading axis, Axial is a unique study site from both the geological and biological perspective. In January of 1998, Axial experienced a week-long series of earthquakes, and subsequent water column and seafloor observations on the southeast portion of the caldera found temperature and chemical anomalies, extensive new seafloor lava flows, large "snow blower" type vents, and other characteristics commonly associated with diking-eruptive events. Due to its high activity and close proximity to shore, Axial was chosen as a site for a multi-year observatory (New Millenium Observatory, NeMO) to document changes and interactions between geology, chemistry, and biology on the mid-ocean ridge system. From 1998 through 2004, we extensively sampled diffuse vents at Axial Seamount to determine the physiological and phylogenetic diversity of subseafloor microbial communities and their relationship to the geochemical environment. Here we present a summary of those studies, including molecular-based phylogenetic surveys of bacteria, archaea, and potential nitrogen-fixing organisms, culturing results of thermophiles and hyperthermophiles from over 20 sites, and the distribution of one particular group of hyperthermophiles at diffuse vents throughout the caldera and how that distribution may be linked to the geochemical habitat. Results indicate that Axial supports a diverse subseafloor microbial community, including hydrogen and sulfur oxidizers, hyperthermophilic methane producers and heterotrophs, and many organisms with the potential to fix nitrogen. In addition, we find that the species composition of the microbial community changes in response to changes in the physical and chemical conditions at each vent site. The extent of seawater mixing with hydrothermal fluids

  19. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  20. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus “Ferrovum”

    Science.gov (United States)

    Ullrich, Sophie R.; Poehlein, Anja; Tischler, Judith S.; González, Carolina; Ossandon, Francisco J.; Daniel, Rolf; Holmes, David S.; Schlömann, Michael; Mühling, Martin

    2016-01-01

    Background Members of the genus “Ferrovum” are ubiquitously distributed in acid mine drainage (AMD) waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain “Ferrovum myxofaciens” P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus “Ferrovum” is extremely scarce. Objective In order to access the wider genetic pool of the genus “Ferrovum” we sequenced the genome of a “Ferrovum”-containing mixed culture and successfully assembled the almost complete genome sequence of the novel “Ferrovum” strain JA12. Phylogeny and Lifestyle The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct “Ferrovum” species. “Ferrovum” strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that “Ferrovum” strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively. Unique Metabolic Features The potential utilisation of urea by “Ferrovum” strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs “Ferrovum” strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin) and Acidithiobacillus

  1. Phylogenetic diversity and spatial distribution of the microbial community associated with the Caribbean deep-water sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA gene analysis.

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2008-08-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species), whereas 26% appeared to be P. cf. corticata specifically associated microorganisms ("specialists"); 21% of the phylotypes were confirmed to represent seawater- and sediment-derived proteobacterial species ("contaminants") acquired by filtration processes from the host environment. Consistently, the aprA and amoA gene-based analyses indicated the presence of environmentally derived sulfur- and ammonia-oxidizers besides putative sponge-specific sulfur-oxidizing Gammaproteobacteria and Alphaproteobacteria and a sulfate-reducing archaeon. A sponge-specific, endosymbiotic sulfur cycle as described for marine oligochaetes is proposed to be also present in P. cf. corticata. Overall, the results of this work support the recent studies that demonstrated the sponge species specificity of the associated microbial community while the biogeography of the host collection site has only a minor influence on the composition. In P. cf. corticata, the specificity of the sponge-microbe associations is even extended to the spatial distribution of the microorganisms within the sponge body; distinct bacterial populations were associated with the different tissue sections, papillae, outer and inner cortex, and choanosome. The local distribution of a phylotype within P. cf. corticata correlated with its (1) phylogenetic affiliation, (2) classification as sponge-specific or nonspecifically associated microorganism, and (3) potential ecological role in the host sponge.

  2. Diversity of Sarcocystis spp shed by opossums in Brazil inferred with phylogenetic analysis of DNA coding ITS1, cytochrome B, and surface antigens.

    Science.gov (United States)

    Valadas, Samantha Y O B; da Silva, Juliana I G; Lopes, Estela Gallucci; Keid, Lara B; Zwarg, Ticiana; de Oliveira, Alice S; Sanches, Thaís C; Joppert, Adriana M; Pena, Hilda F J; Oliveira, Tricia M F S; Ferreira, Helena L; Soares, Rodrigo M

    2016-05-01

    Although few species of Sarcocystis are known to use marsupials of the genus Didelphis as definitive host, an extensive diversity of alleles of surface antigen genes (sag2, sag3, and sag4) has been described in samples of didelphid opossums in Brazil. In this work, we studied 25 samples of Sarcocystis derived from gastrointestinal tract of opossums of the genus Didelphis by accessing the variability of sag2, sag3, sag4, gene encoding cytochrome b (cytB) and first internal transcribed spacer (ITS1). Reference samples of Sarcocystis neurona (SN138) and Sarcocystis falcatula (SF1) maintained in cell culture were also analyzed. We found four allele variants of cytB, seven allele variants of ITS1, 10 allele variants of sag2, 13 allele variants of sag3, and 6 allele variants of sag4. None of the sporocyst-derived sequences obtained from Brazilian opossums revealed 100% identity to SN138 at cytB gene, nor to SN138 or SF1 at ITS1 locus. In addition, none of the sag alleles were found identical to either SF1 or SN138 homologous sequences, and a high number of new sag allele types were found other than those previously described in Brazil. Out of ten sag2 alleles, four are novel, while eight out of 13 sag3 alleles are novel and one out of six sag4 alleles is novel. Further studies are needed to clarify if such a vast repertoire of allele variants of Sarcocystis is the consequence of re-assortments driven by sexual exchange, in order to form individuals with highly diverse characteristics, such as pathogenicity, host spectrum, among others or if it only represents allele variants of different species with different biological traits. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  4. Long term panorama of the nuclear technology; Panorama a largo plazo de la tecnologia nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Velez, C. [Electricite de France, Comite Cientifico Asesor, 22-30 avenue de Wagram, 75382 Paris (France)

    2009-07-01

    The concern for the security of the hydrocarbons supply, essentials for the transport and every time more important in the electricity production, it is one of the rebirth causes of interest for the nuclear energy. On the other hand, it is the increase of the hydrocarbons price. In some countries, included Mexico, the price of gas is subject to strong seasonal fluctuations, aggravating by the congestion of the ducts. It is certain that great part of the prices rise of petroleum that we are experiencing is due to speculation, for what it is necessary to look for objective elements that allow to venture in the difficult topic of the future price of crude. One finishes reason of the resurgence of interest for the nuclear energy, is the growing perception that with the gases emission of greenhouse effect we are exposing our planet to an uncontrollable experiment with consequences potentially catastrophic. This perception is translated in a pressure of the public opinion for to use renewable energy sources that do not contribute to the greenhouse effect. In this work a general panorama is exposed on the advances that exist at the present time, like nuclear reactors with the purpose of solving the current problem that the world is crossing. (Author)

  5. Evolution of Chemical Diversity in a Group of Non-Reduced Polyketide Gene Clusters: Using Phylogenetics to Inform the Search for Novel Fungal Natural Products

    Directory of Open Access Journals (Sweden)

    Kurt Throckmorton

    2015-09-01

    Full Text Available Fungal polyketides are a diverse class of natural products, or secondary metabolites (SMs, with a wide range of bioactivities often associated with toxicity. Here, we focus on a group of non-reducing polyketide synthases (NR-PKSs in the fungal phylum Ascomycota that lack a thioesterase domain for product release, group V. Although widespread in ascomycete taxa, this group of NR-PKSs is notably absent in the mycotoxigenic genus Fusarium and, surprisingly, found in genera not known for their secondary metabolite production (e.g., the mycorrhizal genus Oidiodendron, the powdery mildew genus Blumeria, and the causative agent of white-nose syndrome in bats, Pseudogymnoascus destructans. This group of NR-PKSs, in association with the other enzymes encoded by their gene clusters, produces a variety of different chemical classes including naphthacenediones, anthraquinones, benzophenones, grisandienes, and diphenyl ethers. We discuss the modification of and transitions between these chemical classes, the requisite enzymes, and the evolution of the SM gene clusters that encode them. Integrating this information, we predict the likely products of related but uncharacterized SM clusters, and we speculate upon the utility of these classes of SMs as virulence factors or chemical defenses to various plant, animal, and insect pathogens, as well as mutualistic fungi.

  6. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  7. Animation of Panorama of Phoenix's Solar Panel and Robotic Arm

    Science.gov (United States)

    2008-01-01

    [figure removed for brevity, see original site] Click on image for animation This is an animation of panorama images of NASA's Phoenix Mars Lander's solar panel and the lander's Robotic Arm with a sample in the scoop. The image was taken just before the sample was delivered to the Optical Microscope. The images making up this animation were taken by the lander's Surface Stereo Imager looking west during Phoenix's Sol 16 (June 10, 2008), or the 16th Martian day after landing. This view is a part of the 'mission success' panorama that will show the whole landing site in color. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  8. In Brasile: indagine e considerazioni sul panorama contemporaneo e ultracontemporaneo

    Directory of Open Access Journals (Sweden)

    Adriana Iozzi Klein

    2017-11-01

    Full Text Available Lo scenario della letteratura italiana contemporanea tradotta in Brasile comprende autori e titoli consacrati dall’editoria perché ormai “classici” o in quanto campioni di vendite, ma anche giovani autori e nuove opere, spesso pubblicati da editori minori. L’articolo è dedicato a tracciare a grandi linee il panorama attuale, con particolare attenzione per le opere italiane arrivate più recentemente sul mercato brasiliano.

  9. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow ... used to characterize and identify the cultivars; however, it is often difficult and even .... complete deletion of the missing/gap sites from all the sequences (table 2).

  10. Genetic fingerprinting and phylogenetic diversity of Staphylococcus ...

    African Journals Online (AJOL)

    Genetic fingerprinting of 18 different isolates of Staphylococcus aureus from Nigeria using random amplified polymorphic DNA (RAPD) was carried out. Ten out of 100 Operon primers showed polymorphism among the isolates tested generating 88 bands, 51 of which were polymorphic with sizes ranging between 200 and ...

  11. PHYLOGENETIC DIVERSITY OF CASSAVA GREEN MITE ...

    African Journals Online (AJOL)

    ACSS

    All rights reserved. ©2016, African Crop ... A comparative search from the NCBI Gene bank resulted into identical ... Previous studies have reported success in biological control of ..... Australian Systematic Botany 19: 479-559. Murega, T.N. ...

  12. Phylogenetic diversity of Mesorhizobium in chickpea

    Indian Academy of Sciences (India)

    2014-04-29

    Apr 29, 2014 ... uniform flowering/fruiting and seed maturation, etc., hap- pened several ... partnered with legume plants that were found to be ineffective nitrogen fixers ..... vides a rich resource for development of functional markers. PLoS ONE 7 ... Amarger N 2001 Classification of rhizobia based on nodC and. nifH gene ...

  13. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  14. Increased phylogenetic resolution using target enrichment in Rubus

    Science.gov (United States)

    Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...

  15. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  16. 'McMurdo' Panorama from Spirit's 'Winter Haven'

    Science.gov (United States)

    2006-01-01

    This 360-degree view, called the 'McMurdo' panorama, comes from the panoramic camera (Pancam) on NASA's Mars Exploration Rover Spirit. From April through October 2006, Spirit has stayed on a small hill known as 'Low Ridge.' There, the rover's solar panels are tilted toward the sun to maintain enough solar power for Spirit to keep making scientific observations throughout the winter on southern Mars. This view of the surroundings from Spirit's 'Winter Haven' is presented in approximately true color. Oct. 26, 2006, marks Spirit's 1,000th sol of what was planned as a 90-sol mission. (A sol is a Martian day, which lasts 24 hours, 39 minutes, 35 seconds). The rover has lived through the most challenging part of its second Martian winter. Its solar power levels are rising again. Spring in the southern hemisphere of Mars will begin in early 2007. Before that, the rover team hopes to start driving Spirit again toward scientifically interesting places in the 'Inner Basin' and 'Columbia Hills' inside Gusev crater. The McMurdo panorama is providing team members with key pieces of scientific and topographic information for choosing where to continue Spirit's exploration adventure. The Pancam began shooting component images of this panorama during Spirit's sol 814 (April 18, 2006) and completed the part shown here on sol 932 (Aug. 17, 2006). The panorama was acquired using all 13 of the Pancam's color filters, using lossless compression for the red and blue stereo filters, and only modest levels of compression on the remaining filters. The overall panorama consists of 1,449 Pancam images and represents a raw data volume of nearly 500 megabytes. It is thus the largest, highest-fidelity view of Mars acquired from either rover. Additional photo coverage of the parts of the rover deck not shown here was completed on sol 980 (Oct. 5 , 2006). The team is completing the processing and mosaicking of those final pieces of the panorama, and that image will be released on the Web shortly

  17. 'McMurdo' Panorama from Spirit's 'Winter Haven' (False Color)

    Science.gov (United States)

    2006-01-01

    This 360-degree view, called the 'McMurdo' panorama, comes from the panoramic camera (Pancam) on NASA's Mars Exploration Rover Spirit. From April through October 2006, Spirit has stayed on a small hill known as 'Low Ridge.' There, the rover's solar panels are tilted toward the sun to maintain enough solar power for Spirit to keep making scientific observations throughout the winter on southern Mars. This view of the surroundings from Spirit's 'Winter Haven' is presented in exaggerated color to enhance color differences among rocks, soils and sand. Oct. 26, 2006, marks Spirit's 1,000th sol of what was planned as a 90-sol mission. (A sol is a Martian day, which lasts 24 hours, 39 minutes, 35 seconds). The rover has lived through the most challenging part of its second Martian winter. Its solar power levels are rising again. Spring in the southern hemisphere of Mars will begin in early 2007. Before that, the rover team hopes to start driving Spirit again toward scientifically interesting places in the 'Inner Basin' and 'Columbia Hills' inside Gusev crater. The McMurdo panorama is providing team members with key pieces of scientific and topographic information for choosing where to continue Spirit's exploration adventure. The Pancam began shooting component images of this panorama during Spirit's sol 814 (April 18, 2006) and completed the part shown here on sol 932 (Aug. 17, 2006). The panorama was acquired using all 13 of the Pancam's color filters, using lossless compression for the red and blue stereo filters, and only modest levels of compression on the remaining filters. The overall panorama consists of 1,449 Pancam images and represents a raw data volume of nearly 500 megabytes. It is thus the largest, highest-fidelity view of Mars acquired from either rover. Additional photo coverage of the parts of the rover deck not shown here was completed on sol 980 (Oct. 5 , 2006). The team is completing the processing and mosaicking of those final pieces of the panorama

  18. Phylogenetic analysis of anemone fishes of the Persian Gulf using ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.

  19. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  20. 'McMurdo' Panorama from Spirit's 'Winter Haven' (Color Stereo)

    Science.gov (United States)

    2006-01-01

    [figure removed for brevity, see original site] Left-eye view of a stereo pair for PIA01905 [figure removed for brevity, see original site] Right-eye view of a stereo pair for PIA01905 This 360-degree view, called the 'McMurdo' panorama, comes from the panoramic camera (Pancam) on NASA's Mars Exploration Rover Spirit. From April through October 2006, Spirit has stayed on a small hill known as 'Low Ridge.' There, the rover's solar panels are tilted toward the sun to maintain enough solar power for Spirit to keep making scientific observations throughout the winter on southern Mars. This view of the surroundings from Spirit's 'Winter Haven' is presented as a stereo anaglyph to show the scene three-dimensionally when viewed through red-blue glasses (with the red lens on the left). Oct. 26, 2006, marks Spirit's 1,000th sol of what was planned as a 90-sol mission. (A sol is a Martian day, which lasts 24 hours, 39 minutes, 35 seconds). The rover has lived through the most challenging part of its second Martian winter. Its solar power levels are rising again. Spring in the southern hemisphere of Mars will begin in early 2007. Before that, the rover team hopes to start driving Spirit again toward scientifically interesting places in the 'Inner Basin' and 'Columbia Hills' inside Gusev crater. The McMurdo panorama is providing team members with key pieces of scientific and topographic information for choosing where to continue Spirit's exploration adventure. The Pancam began shooting component images of this panorama during Spirit's sol 814 (April 18, 2006) and completed the part shown here on sol 932 (Aug. 17, 2006). The panorama was acquired using all 13 of the Pancam's color filters, using lossless compression for the red and blue stereo filters, and only modest levels of compression on the remaining filters. The overall panorama consists of 1,449 Pancam images and represents a raw data volume of nearly 500 megabytes. It is thus the largest, highest-fidelity view of Mars

  1. 'McMurdo' Panorama from Spirit's 'Winter Haven' (Stereo)

    Science.gov (United States)

    2006-01-01

    This 360-degree view, called the 'McMurdo' panorama, comes from the panoramic camera (Pancam) on NASA's Mars Exploration Rover Spirit. From April through October 2006, Spirit has stayed on a small hill known as 'Low Ridge.' There, the rover's solar panels are tilted toward the sun to maintain enough solar power for Spirit to keep making scientific observations throughout the winter on southern Mars. This view of the surroundings from Spirit's 'Winter Haven' is presented as a stereo anaglyph to show the scene three-dimensionally when viewed through red-blue glasses (with the red lens on the left). Oct. 26, 2006, marks Spirit's 1,000th sol of what was planned as a 90-sol mission. (A sol is a Martian day, which lasts 24 hours, 39 minutes, 35 seconds). The rover has lived through the most challenging part of its second Martian winter. Its solar power levels are rising again. Spring in the southern hemisphere of Mars will begin in early 2007. Before that, the rover team hopes to start driving Spirit again toward scientifically interesting places in the 'Inner Basin' and 'Columbia Hills' inside Gusev crater. The McMurdo panorama is providing team members with key pieces of scientific and topographic information for choosing where to continue Spirit's exploration adventure. The Pancam began shooting component images of this panorama during Spirit's sol 814 (April 18, 2006) and completed the part shown here on sol 932 (Aug. 17, 2006). The panorama was acquired using all 13 of the Pancam's color filters, using lossless compression for the red and blue stereo filters, and only modest levels of compression on the remaining filters. The overall panorama consists of 1,449 Pancam images and represents a raw data volume of nearly 500 megabytes. It is thus the largest, highest-fidelity view of Mars acquired from either rover. Additional photo coverage of the parts of the rover deck not shown here was completed on sol 980 (Oct. 5 , 2006). The team is completing the processing and

  2. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  3. mPano: cloud-based mobile panorama view from single picture

    Science.gov (United States)

    Li, Hongzhi; Zhu, Wenwu

    2013-09-01

    Panorama view provides people an informative and natural user experience to represent the whole scene. The advances on mobile augmented reality, mobile-cloud computing, and mobile internet can enable panorama view on mobile phone with new functionalities, such as anytime anywhere query where a landmark picture is and what the whole scene looks like. To generate and explore panorama view on mobile devices faces significant challenges due to the limitations of computing capacity, battery life, and memory size of mobile phones, as well as the bandwidth of mobile Internet connection. To address the challenges, this paper presents a novel cloud-based mobile panorama view system that can generate and view panorama-view on mobile devices from a single picture, namely "Pano". In our system, first, we propose a novel iterative multi-modal image retrieval (IMIR) approach to get spatially adjacent images using both tag and content information from the single picture. Second, we propose a cloud-based parallel server synthing approach to generate panorama view in cloud, against today's local-client synthing approach that is almost impossible for mobile phones. Third, we propose predictive-cache solution to reduce latency of image delivery from cloud server to the mobile client. We have built a real mobile panorama view system and perform experiments. The experimental results demonstrated the effectiveness of our system and the proposed key component technologies, especially for landmark images.

  4. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  5. INTEGRAL highlights in the high energy astrophysics panorama

    Energy Technology Data Exchange (ETDEWEB)

    Ubertini, P.; Bazzano, A.

    2013-10-15

    ESAs INTEGRAL Space Observatory has spent his first decade in orbit, and its scientific outcome has completely changed our view of the hard-X/soft γ-ray sky. The scientific result comprises, among other discoveries, the production of the all-sky high energy sources catalogue, confirming the time variability over all time scales of most of the soft γ-ray sources observed, the first detailed map of the Aluminium and 511 keV annihilation line in the Galaxy and the evidence of polarized γ-ray emission from the Crab Nebula and Cyg X-1. This paper will review the latest INTEGRAL discoveries in the framework of the high energy sky panorama.

  6. Label inspection of approximate cylinder based on adverse cylinder panorama

    Science.gov (United States)

    Lin, Jianping; Liao, Qingmin; He, Bei; Shi, Chenbo

    2013-12-01

    This paper presents a machine vision system for automated label inspection, with the goal to reduce labor cost and ensure consistent product quality. Firstly, the images captured from each single-camera are distorted, since the inspection object is approximate cylindrical. Therefore, this paper proposes an algorithm based on adverse cylinder projection, where label images are rectified by distortion compensation. Secondly, to overcome the limited field of viewing for each single-camera, our method novelly combines images of all single-cameras and build a panorama for label inspection. Thirdly, considering the shake of production lines and error of electronic signal, we design the real-time image registration to calculate offsets between the template and inspected images. Experimental results demonstrate that our system is accurate, real-time and can be applied for numerous real- time inspections of approximate cylinders.

  7. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  8. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation

    OpenAIRE

    Guevara Andino, Juan Ernesto; Pitman, Nigel C. A.; ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V. A.

    2017-01-01

    Abstract Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one‐hectare plots in terra firme forests of Ecuadorian Amazon. In these plots...

  9. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  10. El Panorama : una manifestación artística marginal del siglo XIX

    Directory of Open Access Journals (Sweden)

    María Dolores Bastida de la Calle

    2001-01-01

    Full Text Available El Panorama, una forma de arte de la revolución industrial, consistía en gigantescas pinturas circulares con una visión central de 360-, en las que se mezclaba arte y técnica. Estas pinturas circularon por las principales ciudades de Europa y América, París, Londres, Nueva York y atrajeron a un gran número de espectadores, lo que hizo posible el desarrollo del Panorama como una actividad empresarial. Al igual que otro fenómeno artístico marginal del siglo XIX, la revista ilustrada de actualidad, el Panorama debió su gran popularidad a una cultura visual de medio de masas, basada en un afán de saber y conocer, fruto de la filosofía positivista de la época.Panoramas were huge circular paintings with a 360- central view ttiat mixed art and tecfinique into an artistic form characteristic of the industrial revolution. These paintings traveled to the great european and American cities, París, London, New York, and attracted large crowds of spectactors, that allowed the Panorama to develop as a commercial activity. In a way similar to another marginal artistic manifestation of the 19th century, the illustrated magazine, the Panorama owed its popularity to a massmédium visual culture, that was based on a desire for knowledge, result of the positivist philosophy prevalent at the time.

  11. Panorama parking assistant system with improved particle swarm optimization method

    Science.gov (United States)

    Cheng, Ruzhong; Zhao, Yong; Li, Zhichao; Jiang, Weigang; Wang, Xin'an; Xu, Yong

    2013-10-01

    A panorama parking assistant system (PPAS) for the automotive aftermarket together with a practical improved particle swarm optimization method (IPSO) are proposed in this paper. In the PPAS system, four fisheye cameras are installed in the vehicle with different views, and four channels of video frames captured by the cameras are processed as a 360-deg top-view image around the vehicle. Besides the embedded design of PPAS, the key problem for image distortion correction and mosaicking is the efficiency of parameter optimization in the process of camera calibration. In order to address this problem, an IPSO method is proposed. Compared with other parameter optimization methods, the proposed method allows a certain range of dynamic change for the intrinsic and extrinsic parameters, and can exploit only one reference image to complete all of the optimization; therefore, the efficiency of the whole camera calibration is increased. The PPAS is commercially available, and the IPSO method is a highly practical way to increase the efficiency of the installation and the calibration of PPAS in automobile 4S shops.

  12. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation.

    Science.gov (United States)

    Guevara Andino, Juan Ernesto; Pitman, Nigel C A; Ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V A

    2017-11-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one-hectare plots in terra firme forests of Ecuadorian Amazon. In these plots, we tagged, collected, and identified every single adult tree with dbh ≥10 cm. These data were combined with a regional community phylogenetic tree to calculate different phylogenetic diversity (PD) metrics in order to create spatial models. We used Loess regression to estimate the spatial variation of taxonomic and phylogenetic beta diversity as well as phylogenetic endemism and evolutionary distinctiveness. We found evidence for the definition of three floristic districts in the Ecuadorian Amazon, supported by both taxonomic and phylogenetic diversity data. Areas with high levels of phylogenetic endemism and evolutionary distinctiveness in Ecuadorian Amazon forests are unprotected. Furthermore, these areas are severely threatened by proposed plans of oil and mining extraction at large scales and should be prioritized in conservation planning for this region.

  13. METHOD FOR CREATION OF SPHERICAL PANORAMAS FROM IMAGES OBTAINED BY OMNIDIRECTIONAL OPTOELECTRONIC SYSTEMS

    Directory of Open Access Journals (Sweden)

    V. P. Lazarenko

    2016-01-01

    Full Text Available Subject of Study. The key feature of spherical panoramas is the maximum possible angle of view (360 × 180 degrees. Omnidirectional optical-electronic systems are able to produce images that show most of this space, but these images are different from the canonical spherical panoramas. This paper proposes a method of converting the circular images obtained by omnidirectional optical systems, to canonical spherical panoramic images with the use ofcalibration procedure of omnidirectional optical-electronic system. Method. The process of spherical panoramas creation consists of three steps.The first step includesthe forming of virtual surface in the object space corresponding to a field of view of the spherical panorama. The surface is defined by the three-dimensional array of pixels.At the second step the coordinates of images of these points in the plane of the detectorare specified. At the third step pixel-by-pixel forming of the output imageisperformed from the original omnidirectional image with the use of coordinates obtained at the second step. Main Results. We have considered the geometric projectionmodel of spherical panoramas. The algorithm has been proposed calculating the three-dimensional array of pixels, characterizing the field of view of a spherical panorama and convenient for practical usage. The developed method is designed to work with omnidirectional optical-electronic systems both with catadioptric optical systems and with fisheye lens. Experimental results confirming the validity of this method are presented. The reprojection mean-square error was equal to 0.794 px. Practical Relevance. The proposed method can be applied in technologies of creating of virtual tours or panoramas of streets where spherical panoramic images are the standard for storing visual information. The method may also find its application in various fields of robotics, orientation and navigation of space vehicles and UAVs.

  14. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  15. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  16. Panorama of mining activities in France during 1995

    International Nuclear Information System (INIS)

    Michel, J.C.; Bornuat, M.; Mouron, R.

    1996-01-01

    The French mining industry in 1995 continued to follow the overall trend of the past 5 to 10 years characterized mainly by: 1)a decline in the production of most energy materials: oil, coal, uranium. This decline will probably be further accentuated over the next two years with the planned closure of Lodeve (U), Forbach, La Mure and Carmaux (coal). Gas production, however, has remained relatively stable at 4.7 to 5 billion m''3 per year. 2)a scarcity of metal ore mines in Metropolitan France 3)an increase in the production of gold that, in 1995, came close to 6 tonnes in Metropolitan France and reached 8.4 tonnes with French Guiana. 4)the development of metal ore mining in the DOM-TOM 5) divergent developments in the industrial mineral sector: downward trends for sulfur, talc, andalusite, diatomite and silica; upward trends for kaolin, mica, feldspar and salt. Although overall the decline in mine production continued, the panorama does include some positive aspects: 1)France's independence in the energy sector exceeded the half-way mark two years ago and 1995 saw an appreciable decrease in the nation's energy bill compared to 1994. 2)French companies involved in metal mining have adapted themselves to world trends: Cogema has diversified its uranium sources mainly through its mining interests in Canada; Eramet has strengthened its activities by becoming the majority shareholder of Comilog, a manganese producer in Gabon. France also has mining interests in Africa, South America and Europe through LaSource Compagnie Miniere (BRGM and Normandy) created in 1995 3) France's position and production in the industrial mineral sector are significant at European scale, if not at world scale, as regards andalusite, diatomite, kaolin, mica, feldspar, sulfur, potassium, salt and industrial silica. Finally, mention must be made of the increasing environmental awareness by the French authorities and mining companies. This has resulted in a major rehabilitation of mine sites by

  17. Panorama of mining activities in France during 1991

    International Nuclear Information System (INIS)

    Heinry, C.; Michel, J.C.

    1992-01-01

    1991 can be considered as year of transition during which the world economy was adapting to the new political situation arising out of the Gulf War and the collapse of the Soviet Bloc. Although a major conflict normally causes a rise in the price of gold and a high demand for base products, this time the raw materials market did not react in the normal way. The prices of almost all products dropped throughout the year, and the dollar increase (average exchange rate for the year = FF 5.65) did not compensate European industry for this drop in metal prices. The economic slowdown in America, Europe and, which is new, Japan, compounded by the consequences of CIS export, caused serious harm to western firms, including those of the European Community: seriously disrupted markets, price falls, production units in danger. The purpose of this paper is to give a panorama of mining activities in France during 1991. The French mineral sector continued with difficulty to adjust to the economic trend through reductions in staff and production capacities: the Malines Zn-Pb mine closed, uranium mines in the Vendee and Limousin closed, mining activities at the Salsigne gold mine and its refining plants stopped. The field of energy supplies saw a fall off in both coal and petroleum production. Gas production, however, rose to a level close to that of 1987. Uranium production continued to ease; in spite of a relatively stable demand, poor prices coupled with the exhaustion of certain deposits and the public's preoccupation with preserving the environment, led to mines being closed. 15 refs., 2 figs., 11 tabs

  18. Panorama epidemiológico de México, principales causas de morbilidad y mortalidad

    OpenAIRE

    Soto-Estrada, Guadalupe; Moreno-Altamirano, Laura; Pahua Díaz, Daniel

    2016-01-01

    Resumen Introducción: En este trabajo se presenta a grandes rasgos el panorama epidemiológico de México. A través de esta revisión se discute la mortalidad y morbilidad general por grupos específicos, los egresos hospitalarios y recursos humanos disponibles para la atención de la salud. Propósito: Analizar las transformaciones en el panorama epidemiológico actual del país en el marco de algunas variaciones demográficas y acordes al crecimiento económico y la evolución del salario mínimo. ...

  19. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  20. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  1. Climate-driven extinctions shape the phylogenetic structure of temperate tree floras.

    Science.gov (United States)

    Eiserhardt, Wolf L; Borchsenius, Finn; Plum, Christoffer M; Ordonez, Alejandro; Svenning, Jens-Christian

    2015-03-01

    When taxa go extinct, unique evolutionary history is lost. If extinction is selective, and the intrinsic vulnerabilities of taxa show phylogenetic signal, more evolutionary history may be lost than expected under random extinction. Under what conditions this occurs is insufficiently known. We show that late Cenozoic climate change induced phylogenetically selective regional extinction of northern temperate trees because of phylogenetic signal in cold tolerance, leading to significantly and substantially larger than random losses of phylogenetic diversity (PD). The surviving floras in regions that experienced stronger extinction are phylogenetically more clustered, indicating that non-random losses of PD are of increasing concern with increasing extinction severity. Using simulations, we show that a simple threshold model of survival given a physiological trait with phylogenetic signal reproduces our findings. Our results send a strong warning that we may expect future assemblages to be phylogenetically and possibly functionally depauperate if anthropogenic climate change affects taxa similarly. © 2015 John Wiley & Sons Ltd/CNRS.

  2. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  3. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  4. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  5. Phylogenetic impoverishment of Amazonian tree communities in an experimentally fragmented forest landscape.

    Science.gov (United States)

    Santos, Bráulio A; Tabarelli, Marcelo; Melo, Felipe P L; Camargo, José L C; Andrade, Ana; Laurance, Susan G; Laurance, William F

    2014-01-01

    Amazonian rainforests sustain some of the richest tree communities on Earth, but their ecological and evolutionary responses to human threats remain poorly known. We used one of the largest experimental datasets currently available on tree dynamics in fragmented tropical forests and a recent phylogeny of angiosperms to test whether tree communities have lost phylogenetic diversity since their isolation about two decades previously. Our findings revealed an overall trend toward phylogenetic impoverishment across the experimentally fragmented landscape, irrespective of whether tree communities were in 1-ha, 10-ha, or 100-ha forest fragments, near forest edges, or in continuous forest. The magnitude of the phylogenetic diversity loss was low (phylogenetic diversity, we observed a significant decrease of 50% in phylogenetic dispersion since forest isolation, irrespective of plot location. Analyses based on tree genera that have significantly increased (28 genera) or declined (31 genera) in abundance and basal area in the landscape revealed that increasing genera are more phylogenetically related than decreasing ones. Also, the loss of phylogenetic diversity was greater in tree communities where increasing genera proliferated and decreasing genera reduced their importance values, suggesting that this taxonomic replacement is partially underlying the phylogenetic impoverishment at the landscape scale. This finding has clear implications for the current debate about the role human-modified landscapes play in sustaining biodiversity persistence and key ecosystem services, such as carbon storage. Although the generalization of our findings to other fragmented tropical forests is uncertain, it could negatively affect ecosystem productivity and stability and have broader impacts on coevolved organisms.

  6. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  7. A semi-interactive panorama based 3D reconstruction framework for indoor scenes

    NARCIS (Netherlands)

    Dang, T.K.; Worring, M.; Bui, T.D.

    2011-01-01

    We present a semi-interactive method for 3D reconstruction specialized for indoor scenes which combines computer vision techniques with efficient interaction. We use panoramas, popularly used for visualization of indoor scenes, but clearly not able to show depth, for their great field of view, as

  8. Panorama of events in 1999 at the Institut francais du petrole

    International Nuclear Information System (INIS)

    Bureau, C.

    2000-01-01

    At 'Le Panorama de l'IFP', now held at the beginning of each year, the lFP (French petroleum institute) looks back over the oil and gas activities of the previous year, both in France and throughout the world. This important rendezvous also provides an opportunity for invited speakers to examine more specific or more prospective aspects of the year's events. (author)

  9. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  10. Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro Island, México, and their role in the re-introduction of the Socorro dove (Zenaida graysoni).

    Science.gov (United States)

    Carlson, Jenny S; Martínez-Gómez, Juan E; Valkiūnas, Gediminas; Loiseau, Claire; Bell, Douglas A; Sehgal, Ravinder N M

    2013-04-01

    The Socorro dove Zenaida graysoni , endemic to Socorro Island, was last reported in the wild in 1972. Fortunately, the species has been propagated in zoos in Europe and the United States, and plans are under way to re-introduce it to its native habitat. This will be the first known attempt to return a bird species extinct in the wild to its ancestral island. In order to assess the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina passerina socorroensis and mourning doves Zenaida macroura , as well as Socorro doves in captivity, were screened for blood parasites of the genera Plasmodium , Haemoproteus, Leucocytozoon, and Trypanosoma spp. We found Haemoproteus spp. in 17 (74%) of 23 Socorro ground doves, 23 (92%) of 25 mourning doves, and 3 (14%) of 21 northern mockingbirds; none of the other bird species showed infections. Here, we report the phylogenetic analysis of 19 distinct lineages of Haemoproteus spp. detected in birds of Socorro Island and compare their evolutionary relationships to parasites detected in the avifauna of the Galápagos Islands, continental Latin America, and Europe. Microscopic examination revealed 1 mourning dove infected with Plasmodium ( Haemamoeba ), thus underscoring the importance of using both PCR and microscopy when analyzing avian blood samples for hemosporidian parasites. The study confirms that the Socorro dove will most likely be exposed to Haemoproteus spp. that currently infect mourning doves and Socorro ground doves of Socorro Island. A monitoring program for both birds and vectors should be implemented to establish the prevalence of Plasmodium sp. and as a necessary conservation measure for critically endangered birds on the island.

  11. Applications of Panoramic Images: from 720° Panorama to Interior 3d Models of Augmented Reality

    Science.gov (United States)

    Lee, I.-C.; Tsai, F.

    2015-05-01

    A series of panoramic images are usually used to generate a 720° panorama image. Although panoramic images are typically used for establishing tour guiding systems, in this research, we demonstrate the potential of using panoramic images acquired from multiple sites to create not only 720° panorama, but also three-dimensional (3D) point clouds and 3D indoor models. Since 3D modeling is one of the goals of this research, the location of the panoramic sites needed to be carefully planned in order to maintain a robust result for close-range photogrammetry. After the images are acquired, panoramic images are processed into 720° panoramas, and these panoramas which can be used directly as panorama guiding systems or other applications. In addition to these straightforward applications, interior orientation parameters can also be estimated while generating 720° panorama. These parameters are focal length, principle point, and lens radial distortion. The panoramic images can then be processed with closerange photogrammetry procedures to extract the exterior orientation parameters and generate 3D point clouds. In this research, VisaulSFM, a structure from motion software is used to estimate the exterior orientation, and CMVS toolkit is used to generate 3D point clouds. Next, the 3D point clouds are used as references to create building interior models. In this research, Trimble Sketchup was used to build the model, and the 3D point cloud was added to the determining of locations of building objects using plane finding procedure. In the texturing process, the panorama images are used as the data source for creating model textures. This 3D indoor model was used as an Augmented Reality model replacing a guide map or a floor plan commonly used in an on-line touring guide system. The 3D indoor model generating procedure has been utilized in two research projects: a cultural heritage site at Kinmen, and Taipei Main Station pedestrian zone guidance and navigation system. The

  12. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  13. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Glucosinolate diversity within a phylogenetic framework of the tribe Cardamineae (Brassicaceae) unraveled with HPLC-MS/MS and NMR-based analytical distinction of 70 desulfoglucosinolates.

    Science.gov (United States)

    Olsen, Carl Erik; Huang, Xiao-Chen; Hansen, Cecilie I C; Cipollini, Don; Ørgaard, Marian; Matthes, Annemarie; Geu-Flores, Fernando; Koch, Marcus A; Agerbirk, Niels

    2016-12-01

    As a basis for future investigations of evolutionary trajectories and biosynthetic mechanisms underlying variations in glucosinolate structures, we screened members of the crucifer tribe Cardamineae by HPLC-MS/MS, isolated and identified glucosinolates by NMR, searched the literature for previous data for the tribe, and collected HPLC-MS/MS data for nearly all glucosinolates known from the tribe as well as some related structures (70 in total). This is a considerable proportion of the approximately 142 currently documented natural glucosinolates. Calibration with authentic references allowed distinction (or elucidation) of isomers in many cases, such as distinction of β-hydroxyls, methylthios, methylsulfinyls and methylsulfonyls. A mechanism for fragmentation of secondary β-hydroxyls in MS was elucidated, and two novel glucosinolates were discovered: 2-hydroxy-3-methylpentylglucosinolate in roots of Cardamine pratensis and 2-hydroxy-8-(methylsulfinyl)octylglucosinolate in seeds of Rorippa amphibia. A large number of glucosinolates (ca. 54 with high structural certainty and a further 28 or more suggested from tandem MS), representing a wide structural variation, is documented from the tribe. This included glucosinolates apparently derived from Met, Phe, Trp, Val/Leu, Ile and higher homologues. Normal side chain elongation and side chain decoration by oxidation or methylation was observed, as well as rare abnormal side chain decoration (hydroxylation of aliphatics at the δ rather than β-position). Some species had diverse profiles, e.g. R. amphibia and C. pratensis (19 and 16 individual glucosinolates, respectively), comparable to total diversity in literature reports of Armoracia rusticana (17?), Barbarea vulgaris (20-24), and Rorippa indica (>20?). The ancestor or the tribe would appear to have used Trp, Met, and homoPhe as glucosinolate precursor amino acids, and to exhibit oxidation of thio to sulfinyl, formation of alkenyls, β-hydroxylation of aliphatic

  15. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  16. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  17. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  18. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  19. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  1. The Fair Proportion is a Shapley Value on phylogenetic networks too

    OpenAIRE

    Coronado, Tomás M.; Riera, Gabriel; Rosselló, Francesc

    2018-01-01

    The Fair Proportion of a species in a phylogenetic tree is a very simple measure that has been used to assess its value relative to the overall phylogenetic diversity represented by the tree. It has recently been proved by Fuchs and Jin to be equal to the Shapley Value of the coallitional game that sends each subset of species to its rooted Phylogenetic Diversity in the tree. We prove in this paper that this result extends to the natural translations of the Fair Proportion and the rooted Phyl...

  2. Phylogenetic perspectives on reef fish functional traits.

    Science.gov (United States)

    Floeter, Sergio R; Bender, Mariana G; Siqueira, Alexandre C; Cowman, Peter F

    2018-02-01

    Functional traits have been fundamental to the evolution and diversification of entire fish lineages on coral reefs. Yet their relationship with the processes promoting speciation, extinction and the filtering of local species pools remains unclear. We review the current literature exploring the evolution of diet, body size, water column use and geographic range size in reef-associated fishes. Using published and new data, we mapped functional traits on to published phylogenetic trees to uncover evolutionary patterns that have led to the current functional diversity of fishes on coral reefs. When examining reconstructed patterns for diet and feeding mode, we found examples of independent transitions to planktivory across different reef fish families. Such transitions and associated morphological alterations may represent cases in which ecological opportunity for the exploitation of different resources drives speciation and adaptation. In terms of body size, reconstructions showed that both large and small sizes appear multiple times within clades of mid-sized fishes and that extreme body sizes have arisen mostly in the last 10 million years (Myr). The reconstruction of range size revealed many cases of disparate range sizes among sister species. Such range size disparity highlights potential vicariant processes through isolation in peripheral locations. When accounting for peripheral speciation processes in sister pairs, we found a significant relationship between labrid range size and lineage age. The diversity and evolution of traits within lineages is influenced by trait-environment interactions as well as by species and trait-trait interactions, where the presence of a given trait may trigger the development of related traits or behaviours. Our effort to assess the evolution of functional diversity across reef fish clades adds to the burgeoning research focusing on the evolutionary and ecological roles of functional traits. We argue that the combination of a

  3. New Panorama Reveals More Than a Thousand Black Holes

    Science.gov (United States)

    2007-03-01

    By casting a wide net, astronomers have captured an image of more than a thousand supermassive black holes. These results give astronomers a snapshot of a crucial period when these monster black holes are growing, and provide insight into the environments in which they occur. The new black hole panorama was made with data from NASA's Chandra X-ray Observatory, the Spitzer Space Telescope and ground-based optical telescopes. The black holes in the image are hundreds of millions to several billion times more massive than the sun and lie in the centers of galaxies. X-ray, IR & Optical Composites of Obscured & Unobscured AGN in Bootes Field X-ray, IR & Optical Composites of Obscured & Unobscured AGN in Bootes Field Material falling into these black holes at high rates generates huge amounts of light that can be detected in different wavelengths. These systems are known as active galactic nuclei, or AGN. "We're trying to get a complete census across the Universe of black holes and their habits," said Ryan Hickox of the Harvard-Smithsonian Center for Astrophysics (CfA) in Cambridge, Mass. "We used special tactics to hunt down the very biggest black holes." Instead of staring at one relatively small part of the sky for a long time, as with the Chandra Deep Fields -- two of the longest exposures obtained with the observatory -- and other concentrated surveys, this team scanned a much bigger portion with shorter exposures. Since the biggest black holes power the brightest AGN, they can be spotted at vast distances, even with short exposures. Scale Chandra Images to Full Moon Scale Chandra Images to Full Moon "With this approach, we found well over a thousand of these monsters, and have started using them to test our understanding of these powerful objects," said co-investigator Christine Jones, also of the CfA. The new survey raises doubts about a popular current model in which a supermassive black hole is surrounded by a doughnut-shaped region, or torus, of gas. An

  4. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  5. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    Here, we review Charles Darwin’s relation to beetles and developments in coleopteran systematics in the last two centuries. Darwin was an enthusiastic beetle collector. He used beetles to illustrate different evolutionary phenomena in his major works, and astonishingly, an entire sub-chapter is dedicated to beetles in “The Descent of Man”. During his voyage on the Beagle, Darwin was impressed by the high diversity of beetles in the tropics, and he remarked that, to his surprise, the majority of species were small and inconspicuous. However, despite his obvious interest in the group, he did not get involved in beetle taxonomy, and his theoretical work had little immediate impact on beetle classification. The development of taxonomy and classification in the late nineteenth and earlier twentieth century was mainly characterised by the exploration of new character systems (e.g. larval features and wing venation). In the mid-twentieth century, Hennig’s new methodology to group lineages by derived characters revolutionised systematics of Coleoptera and other organisms. As envisioned by Darwin and Ernst Haeckel, the new Hennigian approach enabled systematists to establish classifications truly reflecting evolution. Roy A. Crowson and Howard E. Hinton, who both made tremendous contributions to coleopterology, had an ambivalent attitude towards the Hennigian ideas. The Mickoleit school combined detailed anatomical work with a classical Hennigian character evaluation, with stepwise tree building, comparatively few characters and a priori polarity assessment without explicit use of the outgroup comparison method. The rise of cladistic methods in the 1970s had a strong impact on beetle systematics. Cladistic computer programs facilitated parsimony analyses of large data matrices, mostly morphological characters not requiring detailed anatomical investigations. Molecular studies on beetle phylogeny started in the 1990s with modest taxon sampling and limited DNA data

  6. Charles Darwin, beetles and phylogenetics.

    Science.gov (United States)

    Beutel, Rolf G; Friedrich, Frank; Leschen, Richard A B

    2009-11-01

    Here, we review Charles Darwin's relation to beetles and developments in coleopteran systematics in the last two centuries. Darwin was an enthusiastic beetle collector. He used beetles to illustrate different evolutionary phenomena in his major works, and astonishingly, an entire sub-chapter is dedicated to beetles in "The Descent of Man". During his voyage on the Beagle, Darwin was impressed by the high diversity of beetles in the tropics, and he remarked that, to his surprise, the majority of species were small and inconspicuous. However, despite his obvious interest in the group, he did not get involved in beetle taxonomy, and his theoretical work had little immediate impact on beetle classification. The development of taxonomy and classification in the late nineteenth and earlier twentieth century was mainly characterised by the exploration of new character systems (e.g. larval features and wing venation). In the mid-twentieth century, Hennig's new methodology to group lineages by derived characters revolutionised systematics of Coleoptera and other organisms. As envisioned by Darwin and Ernst Haeckel, the new Hennigian approach enabled systematists to establish classifications truly reflecting evolution. Roy A. Crowson and Howard E. Hinton, who both made tremendous contributions to coleopterology, had an ambivalent attitude towards the Hennigian ideas. The Mickoleit school combined detailed anatomical work with a classical Hennigian character evaluation, with stepwise tree building, comparatively few characters and a priori polarity assessment without explicit use of the outgroup comparison method. The rise of cladistic methods in the 1970s had a strong impact on beetle systematics. Cladistic computer programs facilitated parsimony analyses of large data matrices, mostly morphological characters not requiring detailed anatomical investigations. Molecular studies on beetle phylogeny started in the 1990s with modest taxon sampling and limited DNA data. This has

  7. Phylogenetic signals in the climatic niches of the world's amphibians

    DEFF Research Database (Denmark)

    Hof, Christian; Rahbek, Carsten; Araújo, Miguel B.

    2010-01-01

    amphibian orders and across biogeographical regions. To our knowledge, this is the first study providing a comprehensive analysis of the phylogenetic signal in species climatic niches for an entire clade across the world. Even though our results do not provide a strong test of the niche conservatism......The question of whether closely related species share similar ecological requirements has attracted increasing attention, because of its importance for understanding global diversity gradients and the impacts of climate change on species distributions. In fact, the assumption that related species...... are also ecologically similar has often been made, although the prevalence of such a phylogenetic signal in ecological niches remains heavily debated. Here, we provide a global analysis of phylogenetic niche relatedness for the world's amphibians. In particular, we assess which proportion of the variance...

  8. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  9. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  10. Automatic Registration of Vehicle-borne Mobile Mapping Laser Point Cloud and Sequent Panoramas

    Directory of Open Access Journals (Sweden)

    CHEN Chi

    2018-02-01

    Full Text Available An automatic registration method of mobile mapping system laser point cloud and sequence panoramic image is proposed in this paper.Firstly,hierarchical object extraction method is applied on LiDAR data to extract the building façade and outline polygons are generated to construct the skyline vectors.A virtual imaging method is proposed to solve the distortion on panoramas and corners on skylines are further detected on the virtual images combining segmentation and corner detection results.Secondly,the detected skyline vectors are taken as the registration primitives.Registration graphs are built according to the extracted skyline vector and further matched under graph edit distance minimization criteria.The matched conjugate primitives are utilized to solve the 2D-3D rough registration model to obtain the initial transformation between the sequence panoramic image coordinate system and the LiDAR point cloud coordinate system.Finally,to reduce the impact of registration primitives extraction and matching error on the registration results,the optimal transformation between the multi view stereo matching dens point cloud generated from the virtual imaging of the sequent panoramas and the LiDAR point cloud are solved by a 3D-3D ICP registration algorithm variant,thus,refine the exterior orientation parameters of panoramas indirectly.Experiments are undertaken to validate the proposed method and the results show that 1.5 pixel level registration results are achieved on the experiment dataset.The registration results can be applied to point cloud and panoramas fusion applications such as true color point cloud generation.

  11. Reportaje interactivo acerca del panorama político electoral en Ecuador de 2016 a 2017.

    OpenAIRE

    Rojas Cajamarca, Juan Carlos

    2017-01-01

    This study is an interactive report of the 2016 to 2017 electoral panorama in Ecuador, it focuses in building a multimedia product, which would be used to classify the profiles and campaign plans of the different candidates, synthetizing the huge amount of information in existence. For this purpose we have sustained our research in the analysis done from the perspective of political communication, study of its different narratives, and with this we have elaborated a transmedia product utilizi...

  12. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  13. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  14. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  15. Landmarks or panoramas: what do navigating ants attend to for guidance?

    Directory of Open Access Journals (Sweden)

    Beugnon Guy

    2011-08-01

    Full Text Available Abstract Background Insects are known to rely on terrestrial landmarks for navigation. Landmarks are used to chart a route or pinpoint a goal. The distant panorama, however, is often thought not to guide navigation directly during a familiar journey, but to act as a contextual cue that primes the correct memory of the landmarks. Results We provided Melophorus bagoti ants with a huge artificial landmark located right near the nest entrance to find out whether navigating ants focus on such a prominent visual landmark for homing guidance. When the landmark was displaced by small or large distances, ant routes were affected differently. Certain behaviours appeared inconsistent with the hypothesis that guidance was based on the landmark only. Instead, comparisons of panoramic images recorded on the field, encompassing both landmark and distal panorama, could explain most aspects of the ant behaviours. Conclusion Ants navigating along a familiar route do not focus on obvious landmarks or filter out distal panoramic cues, but appear to be guided by cues covering a large area of their panoramic visual field, including both landmarks and distal panorama. Using panoramic views seems an appropriate strategy to cope with the complexity of natural scenes and the poor resolution of insects' eyes. The ability to isolate landmarks from the rest of a scene may be beyond the capacity of animals that do not possess a dedicated object-perception visual stream like primates.

  16. ALGORITMOS PARA CONSTRUÇÃO DE PANORAMA DE IMAGENS 360 E VISUALIZAÇÃO

    Directory of Open Access Journals (Sweden)

    Alan Kazuo Hiraga

    2013-07-01

    Full Text Available This paper presents a methodology for the construction of mosaic images to form 360 panorama and an application for viewing. We used the SIFT and RANSAC algorithms commonly found in the literature for matching images. The algorithms for projection, adjustment of images and Blend for smoothing the joints were implemented in this paper using the OpenCV Computer Vision library. The methodology of this research techniques were applied to reduce the distortions caused in the joints of successive images, as well as increase the quality of the final panorama and get better performance. The viewer application developed in C# shows the 360 image resulting from images stitching into a cylinder with the point of view inside. The results of the experiments performed using the proposed technique has proved satisfactory, the mosaic formed by the joining of multiple pictures suffers little distortion, however, these distortions do not interfere with the final formation of the panorama 360, which provides good visual quality.

  17. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  18. Conservation Action Based on Threatened Species Capture Taxonomic and Phylogenetic Richness in Breeding and Wintering Populations of Central Asian Birds

    Science.gov (United States)

    Schweizer, Manuel; Ayé, Raffael; Kashkarov, Roman; Roth, Tobias

    2014-01-01

    Although phylogenetic diversity has been suggested to be relevant from a conservation point of view, its role is still limited in applied nature conservation. Recently, the practice of investing conservation resources based on threatened species was identified as a reason for the slow integration of phylogenetic diversity in nature conservation planning. One of the main arguments is based on the observation that threatened species are not evenly distributed over the phylogenetic tree. However this argument seems to dismiss the fact that conservation action is a spatially explicit process, and even if threatened species are not evenly distributed over the phylogenetic tree, the occurrence of threatened species could still indicate areas with above average phylogenetic diversity and consequently could protect phylogenetic diversity. Here we aim to study the selection of important bird areas in Central Asia, which were nominated largely based on the presence of threatened bird species. We show that although threatened species occurring in Central Asia do not capture phylogenetically more distinct species than expected by chance, the current spatially explicit conservation approach of selecting important bird areas covers above average taxonomic and phylogenetic diversity of breeding and wintering birds. We conclude that the spatially explicit processes of conservation actions need to be considered in the current discussion of whether new prioritization methods are needed to complement conservation action based on threatened species. PMID:25337861

  19. Spatial phylogenetics of the vascular flora of Chile.

    Science.gov (United States)

    Scherson, Rosa A; Thornhill, Andrew H; Urbina-Casanova, Rafael; Freyman, William A; Pliscoff, Patricio A; Mishler, Brent D

    2017-07-01

    Current geographic patterns of biodiversity are a consequence of the evolutionary history of the lineages that comprise them. This study was aimed at exploring how evolutionary features of the vascular flora of Chile are distributed across the landscape. Using a phylogeny at the genus level for 87% of the Chilean vascular flora, and a geographic database of sample localities, we calculated phylogenetic diversity (PD), phylogenetic endemism (PE), relative PD (RPD), and relative PE (RPE). Categorical Analyses of Neo- and Paleo-Endemism (CANAPE) were also performed, using a spatial randomization to assess statistical significance. A cluster analysis using range-weighted phylogenetic turnover was used to compare among grid cells, and with known Chilean bioclimates. PD patterns were concordant with known centers of high taxon richness and the Chilean biodiversity hotspot. In addition, several other interesting areas of concentration of evolutionary history were revealed as potential conservation targets. The south of the country shows areas of significantly high RPD and a concentration of paleo-endemism, and the north shows areas of significantly low PD and RPD, and a concentration of neo-endemism. Range-weighted phylogenetic turnover shows high congruence with the main macrobioclimates of Chile. Even though the study was done at the genus level, the outcome provides an accurate outline of phylogenetic patterns that can be filled in as more fine-scaled information becomes available. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Phylogenetic classification of the world's tropical forests

    DEFF Research Database (Denmark)

    Slik, J. W. Ferry; Franklin, Janet; Arroyo-Rodriguez, Victor

    2018-01-01

    -Pacific counterparts. We also find indications for the existence of a global dry forest region, with representatives in America, Africa, Madagascar, and India. Additionally, a northern-hemisphere Subtropical forest region was identified with representatives in Asia and America, providing support for a link between......Knowledge about the biogeographic affinities of the world's tropical forests helps to better understand regional differences in forest structure, diversity, composition, and dynamics. Such understanding will enable anticipation of region-specific responses to global environmental change. Modern...... phylogenies, in combination with broad coverage of species inventory data, now allow for global biogeographic analyses that take species evolutionary distance into account. Here we present a classification of the world's tropical forests based on their phylogenetic similarity. We identify five principal...

  1. Estimating phylogenetic trees from genome-scale data.

    Science.gov (United States)

    Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V

    2015-12-01

    The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.

  2. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  3. Fire modifies the phylogenetic structure of soil bacterial co-occurrence networks.

    Science.gov (United States)

    Pérez-Valera, Eduardo; Goberna, Marta; Faust, Karoline; Raes, Jeroen; García, Carlos; Verdú, Miguel

    2017-01-01

    Fire alters ecosystems by changing the composition and community structure of soil microbes. The phylogenetic structure of a community provides clues about its main assembling mechanisms. While environmental filtering tends to reduce the community phylogenetic diversity by selecting for functionally (and hence phylogenetically) similar species, processes like competitive exclusion by limiting similarity tend to increase it by preventing the coexistence of functionally (and phylogenetically) similar species. We used co-occurrence networks to detect co-presence (bacteria that co-occur) or exclusion (bacteria that do not co-occur) links indicative of the ecological interactions structuring the community. We propose that inspecting the phylogenetic structure of co-presence or exclusion links allows to detect the main processes simultaneously assembling the community. We monitored a soil bacterial community after an experimental fire and found that fire altered its composition, richness and phylogenetic diversity. Both co-presence and exclusion links were more phylogenetically related than expected by chance. We interpret such a phylogenetic clustering in co-presence links as a result of environmental filtering, while that in exclusion links reflects competitive exclusion by limiting similarity. This suggests that environmental filtering and limiting similarity operate simultaneously to assemble soil bacterial communities, widening the traditional view that only environmental filtering structures bacterial communities. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  5. Assembly and phylogenetic structure of Neotropical palm communities

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Balslev, Henrik

    Diversity, composition and dynamics of Neotropical palm communities are receiving an increasing amount of attention due to their economic importance, but also because their high species richness and functional diversity render them valuable model systems for overall forest biodiversity. However......, to better understand these palm communities, it is crucial to gain insight into the mechanisms responsible for their assembly. These can be dispersal limitation, environmental filtering, or biotic interactions. If the degree of niche conservatism is known for a group of organisms, patterns of community...... an unspecific assumption of “general niche conservatism”, phylogenetic signal will be analysed for Neotropical palms. Moreover, as an example for evolutionary mechanisms disrupting phylogenetic signal, speciation modes will be examined in selected genera. With the combined results we aim to show the relative...

  6. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis

    OpenAIRE

    Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.

    2015-01-01

    Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...

  7. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  8. Landscape patterns in rainforest phylogenetic signal: isolated islands of refugia or structured continental distributions?

    Directory of Open Access Journals (Sweden)

    Robert M Kooyman

    Full Text Available OBJECTIVES: Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. METHODS: We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD, phylogenetic endemism (PE and phylogenetic structure (net relatedness index; NRI. Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. RESULTS: Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. CONCLUSIONS/SIGNIFICANCE: Concentrations of rainforest evolutionary history (phylo-diversity were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community

  9. Landscape Patterns in Rainforest Phylogenetic Signal: Isolated Islands of Refugia or Structured Continental Distributions?

    Science.gov (United States)

    Kooyman, Robert M.; Rossetto, Maurizio; Sauquet, Hervé; Laffan, Shawn W.

    2013-01-01

    Objectives Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. Methods We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD), phylogenetic endemism (PE) and phylogenetic structure (net relatedness index; NRI). Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. Results Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance) in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. Conclusions/Significance Concentrations of rainforest evolutionary history (phylo-diversity) were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community distribution, our findings of

  10. Solitary rectal ulcer syndrome: demographic, clinical, endoscopic and histological panorama

    International Nuclear Information System (INIS)

    Abbasi, A.; Bhutto, K. A.R.; Baloch, A.

    2015-01-01

    To assess the demographic, clinical, endoscopic and histological spectrum of Solitary Rectal Ulcer Syndrome (SRUS). Study Design: Cross-sectional observational study. Place and Duration of Study: Medical Unit-III, Civil Hospital Karachi (CHK) and Ward 7, Jinnah Postgraduate Medical Centre (JPMC), Karachi, from January 2009 to June 2012. Methodology: Patients with SRUS, based on characteristic endoscopic and histological findings, were enrolled. Patients were excluded if they had other causes of the rectal lesions (neoplasm, infection, inflammatory bowel disease, and trauma). Endoscopically, lesions were divided on the basis of number (solitary or multiple) and appearance (ulcerative, polypoidal/nodular or erythematous mucosa). Demographic, clinical and endoscopic characteristics of subjects were evaluated. Results: Forty-four patients met the inclusion criteria; 21 (47.7%) were females and 23 (52.3%) were males with overall mean age of 33.73 ±13.28 years. Symptom-wise 41 (93.2%) had bleeding per rectum, 39 (88.6%) had mucous discharge, 34 (77.3%) had straining, 34 (77.3%) had constipation, 32 (72.7%) had tenesmus, 5 (11.4%) had rectal prolapse and 2 (4.5%) had fecal incontinence. Twelve (27.27%) patients presented with hemoglobin less 10 gm/dl, 27 (61.36%) with 10 - 12 gm/dl and 05 (11.36%) subjects had hemoglobin more than 12 gm/dl. Endoscopically, 26 (59.1%) patients had mucosal ulceration, 11 (25.0%) had mucosal ulceration with polypoid characteristics; while only polypoid features were found in 7 (15.9%) subjects. Conclusion: Solitary rectal ulcer syndrome affects adults of both genders with diverse clinical presentation and nonspecific endoscopic features. (author)

  11. Inferring influenza global transmission networks without complete phylogenetic information.

    Science.gov (United States)

    Aris-Brosou, Stéphane

    2014-03-01

    Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.

  12. Malassezia intra-specific diversity and potentially new species in the skin microbiota from Brazilian healthy subjects and seborrheic dermatitis patients.

    Directory of Open Access Journals (Sweden)

    Renan Cardoso Soares

    Full Text Available Malassezia yeasts are part of the resident cutaneous microbiota, and are also associated with skin diseases such as seborrheic dermatitis (SD. The role these fungi play in skin diseases and why they are pathogenic for only some individuals remain unclear. This study aimed to characterize Malassezia microbiota from different body sites in healthy and SD subjects from Brazil. Scalp and forehead samples from healthy, mild SD and severe SD subjects were collected. Non-scalp lesions from severe SD patients were also sampled. 5.8S rDNA/ITS2 amplicons from Malassezia sp. were analyzed by RFLP and sequencing. Results indicate that Malassezia microbiota did not group according to health condition or body area. Phylogenetic analysis revealed that three groups of sequences did not cluster together with any formally described species, suggesting that they might belong to potential new species. One of them was found in high proportions in scalp samples. A large variety of Malassezia subtypes were detected, indicating intra-specific diversity. Higher M. globosa proportions were found in non-scalp lesions from severe SD subjects compared with other areas, suggesting closer association of this species with SD lesions from areas other than scalp. Our results show the first panorama of Malassezia microbiota in Brazilian subjects using molecular techniques and provide new perspectives for further studies to elucidate the association between Malassezia microbiota and skin diseases.

  13. Schnupperkurs Frauenforschung. Ein Blick auf das Panorama feministischer Sozialwissenschaften Women’s Research—A Trial Course. Examining the Panorama of Social Sciences

    Directory of Open Access Journals (Sweden)

    Katja Strobel

    2007-11-01

    Full Text Available In diesem Lehrbuch wird das Panorama von 40 Jahren kontroverser Forschung eröffnet. Anhand der beispielhaften Themenfelder Arbeit, Sozialisation und Sexualität wurden Originaltexte ausgewählt, die die Problemgeschichte und die Auseinandersetzungen sowohl mit Konzepten innerhalb der Frauenforschung in der BRD als auch mit gesellschaftlichen Veränderungen erkennbar machen. Die Zusammenstellung von Texten aus den 1970er Jahren bis in die Gegenwart auf relativ engem Raum und zum gleichen Themenkomplex macht Veränderungen in den Problemstellungen, aber auch in den Forschungsansätzen begreifbar. Abgesehen von wenigen formalen Schwächen ist das Buch ein sehr empfehlenswerter „Schnupperkurs”. Dass internationale Debatten nur marginal behandelt werden, spiegelt die reale Forschungslandschaft in der BRD wider, kann aber als Desideratum für die zukünftige Frauenforschung konstatiert werden.This textbook opens out to the panorama of 40 years of controversial research. The volume is made up of organizational texts in the fields of work, socialization, and sexuality, which clarify the historical problems and conflicts with concepts within women’s research in the Federal Republic as well as with social changes. The relative close proximity and thematic similarities of the selection of texts from the 1970s to the present makes understandable the changes in both the positions of the problem as well as the research approach. Excepting the minimal formal weaknesses, the book is a highly recommended “trial course.” The marginal treatment of international debates reflects the research landscape of the Federal Republic but could also be seen as a desirable area for future women’s research.

  14. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  15. Plant traits determine the phylogenetic structure of arbuscular mycorrhizal fungal communities.

    Science.gov (United States)

    López-García, Álvaro; Varela-Cervero, Sara; Vasar, Martti; Öpik, Maarja; Barea, José M; Azcón-Aguilar, Concepción

    2017-12-01

    Functional diversity in ecosystems has traditionally been studied using aboveground plant traits. Despite the known effect of plant traits on the microbial community composition, their effects on the microbial functional diversity are only starting to be assessed. In this study, the phylogenetic structure of arbuscular mycorrhizal (AM) fungal communities associated with plant species differing in life cycle and growth form, that is, plant life forms, was determined to unravel the effect of plant traits on the functional diversity of this fungal group. The results of the 454 pyrosequencing showed that the AM fungal community composition differed across plant life forms and this effect was dependent on the soil collection date. Plants with ruderal characteristics tended to associate with phylogenetically clustered AM fungal communities. By contrast, plants with resource-conservative traits associated with phylogenetically overdispersed AM fungal communities. Additionally, the soil collected in different seasons yielded AM fungal communities with different phylogenetic dispersion. In summary, we found that the phylogenetic structure, and hence the functional diversity, of AM fungal communities is dependent on plant traits. This finding adds value to the use of plant traits for the evaluation of belowground ecosystem diversity, functions and processes. © 2017 John Wiley & Sons Ltd.

  16. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  17. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  18. Phylogenetic relationships and genetic diversity of Nemesis Risso ...

    African Journals Online (AJOL)

    Nemesi s is one of 12 genera in the family Eudactylinidae and includes about nine species. In this study, we investigated whether there is any population structure among Nemesis lamna individuals infecting the white shark Carcharodon carcharias and the shortfin mako Isurus oxyrinchus according to host species or ...

  19. Genomic diversity and phylogenetic relationships in the genus Parthenium (Asteraceae)

    Science.gov (United States)

    Guayule (Parthenium argentatum A. Gray) is a perennial hardwood shrub native to the North American Chihuahuan Desert that holds promise as a sustainable source of natural rubber and hypoallergenic latex. The improvement of guayule for commercial-scale production could be potentially accelerated thro...

  20. Molecular diversity and phylogenetic relationships of the gastropod ...

    African Journals Online (AJOL)

    The freshwater snails belonging to the genus Melanoides Olivier, 1804 are widespread across tropical regions of the world and endemic species have evolved in the African Lakes Malawi, Mweru and Tanganyika. The endemic Melanoides species of Lake Malawi have been investigated several times during the last century ...

  1. Genetic diversity within the genus Cynotilapia and its phylogenetic ...

    African Journals Online (AJOL)

    Cynotilapia's unicuspid teeth, a unique character used to delineate it from all other mbuna genera, leaves evolutionary biologists wondering which is the closest relative to this genus among mbuna cichlids. This genus has only two described species out of the 10-13 species/taxa, whereby the undescribed taxa are either ...

  2. Diversity and Phylogenetic Structure of Two Complex Marine Microbial Communities

    Science.gov (United States)

    2004-09-01

    q Ja 1,4 1 S., fn.i.to) 47. 145-1 156 (19r . lntiutoide Geologia ’ Mineria, Universidad Nactonalde Jujuy, Avenida Bolwiva . V~a. C 3. j kLmnnnaommntal...grandfather. 27 Pbl O. G. &R am-aw A. ^ NItL -Mhmuhniodsr•ngrop hsoll rYfonm -ine-4tar Phylov Holotype. Museo de Geologia , Mineralogia y Paleontologia

  3. Taxonomic, phylogenetic, and ecological diversity of methanogenic Archaea

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, J.-L.; Ollivier, B. [Universite de Provence, Marseille (France). Laboratoire de Microbiologist; Patel, B.K.C. [Griffith University, Brisbane (Australia). Microbial Discovery Research Unit

    2000-07-01

    Methanogens are strict anaerobes which share a complex biochemistry for methane synthesis as part of their energy metabolism. The discovery of the unique biochemical and genetic properties of these organisms led to the concept of Archaebacteria at the end of the seventies and the proposal in 1990 for the domain Archaea. A number of studies have provided evidence that they are of economic value. The successive petroleum crisis since 1973 has led to great interest in alternative forms of energy, including recovery of methane via anaerobic digestion of wastes. Improvements in the design of digestors have been made possible by advances in understanding the ecology and physiology of methanogens. In the cattle industry, the knowledge of the fermentation processes in the rumen demonstrated a net loss of energy via the methanogenesis, and inhibitors such as Rumensin have been developed to enhance meat yields. Oil companies try to distinguish between natural gas produced by methanogens or by the thermocatalytic reactions associated with petroleum generation. Finally, studies on the global distribution of methane in the earth's atmosphere are increasing due to the sudden awareness of its possible role in the enhancement of the greenhouse effect from CO-2 accumulation, and on the reversal of stratospheric ozone depletion. This paper summarizes the recent knowledge of methanogenic Archaea with emphasis on their taxonomy and ecology. (author)

  4. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  5. Disentangling environmental and spatial effects on phylogenetic structure of angiosperm tree communities in China.

    Science.gov (United States)

    Qian, Hong; Chen, Shengbin; Zhang, Jin-Long

    2017-07-17

    Niche-based and neutrality-based theories are two major classes of theories explaining the assembly mechanisms of local communities. Both theories have been frequently used to explain species diversity and composition in local communities but their relative importance remains unclear. Here, we analyzed 57 assemblages of angiosperm trees in 0.1-ha forest plots across China to examine the effects of environmental heterogeneity (relevant to niche-based processes) and spatial contingency (relevant to neutrality-based processes) on phylogenetic structure of angiosperm tree assemblages distributed across a wide range of environment and space. Phylogenetic structure was quantified with six phylogenetic metrics (i.e., phylogenetic diversity, mean pairwise distance, mean nearest taxon distance, and the standardized effect sizes of these three metrics), which emphasize on different depths of evolutionary histories and account for different degrees of species richness effects. Our results showed that the variation in phylogenetic metrics explained independently by environmental variables was on average much greater than that explained independently by spatial structure, and the vast majority of the variation in phylogenetic metrics was explained by spatially structured environmental variables. We conclude that niche-based processes have played a more important role than neutrality-based processes in driving phylogenetic structure of angiosperm tree species in forest communities in China.

  6. Regional variations in baseline characteristics of cardiac rhythm device recipients: The PANORAMA observational cohort study.

    Science.gov (United States)

    Al Kandari, Fawziah; Erglis, Andrejs; Sweidan, Raed; Dannheimer, Ingrid; Sepsi, Milan; Bénézet, Juan; Padour, Michal; Naik, Ajay; Escudero, Jaime; West, Teena; Holbrook, Reece; Lorgat, Faizel

    2014-09-01

    The PANORAMA study was designed to collect concurrent data on subjects from different worldwide regions implanted with CRM devices. In this prospective, multi-center study, we analyzed baseline data on 8586 subjects implanted with CRM devices with no additional selection criteria (66% pacemaker (IPG), 16% implantable cardiac defibrillators (ICD), 17% cardiac resynchronization therapy (CRT) and CRM devices from a range of geographies that are not typically reported in literature. We found significant variations in clinical characteristics and implant practices. Long term follow-up data will help evaluate if these variations require adjustments to outcome expectations.

  7. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  8. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  9. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Directory of Open Access Journals (Sweden)

    Luis F Aguirre

    Full Text Available Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups. Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for

  10. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Science.gov (United States)

    Aguirre, Luis F; Montaño-Centellas, Flavia A; Gavilanez, M Mercedes; Stevens, Richard D

    2016-01-01

    Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups). Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement) was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia) create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for patterns of functional

  11. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  12. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  13. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure.

    Science.gov (United States)

    Zappi, Daniela C; Moro, Marcelo F; Meagher, Thomas R; Nic Lughadha, Eimear

    2017-01-01

    Old, climate-buffered infertile landscapes (Ocbils) have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil's campos rupestres (rupestrian grasslands) are home to almost 15% of Brazil's native flora in less than 0.8% of Brazil's territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ) and on ironstone substrates, commonly termed canga . Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC), which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be effective

  14. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure

    Directory of Open Access Journals (Sweden)

    Daniela C. Zappi

    2017-12-01

    Full Text Available Old, climate-buffered infertile landscapes (Ocbils have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil’s campos rupestres (rupestrian grasslands are home to almost 15% of Brazil’s native flora in less than 0.8% of Brazil’s territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ and on ironstone substrates, commonly termed canga. Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC, which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be

  15. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  16. On the Shapley Value of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-01-17

    The Shapley value, a solution concept from cooperative game theory, has recently been considered for both unrooted and rooted phylogenetic trees. Here, we focus on the Shapley value of unrooted trees and first revisit the so-called split counts of a phylogenetic tree and the Shapley transformation matrix that allows for the calculation of the Shapley value from the edge lengths of a tree. We show that non-isomorphic trees may have permutation-equivalent Shapley transformation matrices and permutation-equivalent null spaces. This implies that estimating the split counts associated with a tree or the Shapley values of its leaves does not suffice to reconstruct the correct tree topology. We then turn to the use of the Shapley value as a prioritization criterion in biodiversity conservation and compare it to a greedy solution concept. Here, we show that for certain phylogenetic trees, the Shapley value may fail as a prioritization criterion, meaning that the diversity spanned by the top k species (ranked by their Shapley values) cannot approximate the total diversity of all n species.

  17. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  19. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  20. APPLYING CCD CAMERAS IN STEREO PANORAMA SYSTEMS FOR 3D ENVIRONMENT RECONSTRUCTION

    Directory of Open Access Journals (Sweden)

    A. Sh. Amini

    2012-07-01

    Full Text Available Proper recontruction of 3D environments is nowadays needed by many organizations and applications. In addition to conventional methods the use of stereo panoramas is an appropriate technique to use due to simplicity, low cost and the ability to view an environment the way it is in reality. This paper investigates the ability of applying stereo CCD cameras for 3D reconstruction and presentation of the environment and geometric measuring among that. For this purpose, a rotating stereo panorama was established using two CCDs with a base-length of 350 mm and a DVR (digital video recorder box. The stereo system was first calibrated using a 3D test-field and used to perform accurate measurements. The results of investigating the system in a real environment showed that although this kind of cameras produce noisy images and they do not have appropriate geometric stability, but they can be easily synchronized, well controlled and reasonable accuracy (about 40 mm in objects at 12 meters distance from the camera can be achieved.

  1. Novas tecnologias de intervenção na sexualidade: o panorama latino-americano

    Directory of Open Access Journals (Sweden)

    Fabíola Rohden

    Full Text Available Este artigo busca refletir sobre o desinteresse pela área que congrega estudos e intervenções clínicas sobre a sexualidade por parte dos estudiosos críticos da sexualidade como campo político na América Latina. Iniciamos com um panorama sobre as sexualidades e as políticas na América Latina e, em seguida, apresentamos um panorama histórico do campo da sexologia e da medicina sexual na região. Procuramos argumentar que considerar a medicalização da sexualidade apenas como uma forma da sua despolitização deixa de lado aspectos importantes do processo, em especial no que diz respeito à produção de novos sujeitos na esfera do consumo. Em nossas conclusões realizamos uma reflexão crítica acerca do crescente consumo de biotecnologias na esfera da sexualidade e das concepções que lhes são subjacentes, buscando ressaltar seu aspecto eminentemente político.

  2. A guide to phylogenetic metrics for conservation, community ecology and macroecology

    Science.gov (United States)

    Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent

    2016-01-01

    ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932

  3. Lunar archive panoramas: modern image processing and access to the historic data based on spatial context

    Science.gov (United States)

    Kozlova, Natalia; Kokhanov, Alexander; Oberst, Jürgen; Zubarev, Anatoliy; Nadezhdina, Irina; Patraty, Vyacheslav; Karachevtseva, Irina; Garov, Andrey; Matveev, Evgeniy

    The objectives of our work are to fully exploit the historic Soviet Lunokhod data and use the results for scientific and public purposes. Unfortunately, many of the relevant operational parameters of the Lunokhods missions are lost. Modern photogrammetry is a key to solving these issues, providing analysis techniques, not available at the time of the early lunar missions. For this purpose we use special developed software, GIS tools and high-resolution LRO data [1]. Results of new image processing of historic data are part of PRoViDE project (Planetary Robotics Vision Data Exploitation) which aims to assemble a major portion of the imaging data gathered from different vehicles and probes on planetary surfaces into a unique database, bringing them into a spatial context and providing access to a complete set of 3D vision products (http://www.provide-space.eu/). Our technology of archive panorama processing allows us to recover lost information of Soviet lunar missions and study lunar landing site imagery by state-of-the-art photogrammetric techniques. Our main task is to perform lunar panoramas in measurement form based on photogrammetry and geoanalyses methods, and then involve them in more detailed morphometric analyses [2] and 3D-modeling of lunar surface based on LROC NAC image processing [3]. The results of our work are various types of new products: panoramas in different projections, updated metadata with recovering parameters, and ortho-panoramas, which can be used for quantitative geomorphology assessment based on spatial tools [4]. All data products obtained as a result of the study are to be placed into Planetary data storage which is developing as Geodesy and Cartography Node [5]. Access to archive lunar data will be organized via Geo-portal (http://cartsrv.mexlab.ru/geoportal/) using authorization service, which provided data security and user control. Planetary spatial information system can integrate various types of data for planets and their

  4. Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.

    Science.gov (United States)

    Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E

    2017-06-01

    The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  6. Spectacular energy technology: Panorama-Sauna Holzweiler. KfW funds indoor swimming pools as 'process heat'; Energetisch spektakulaer: Panorama-Sauna Holzweiler. KfW foerdert Schwimmbaeder als 'Prozesswaerme'

    Energy Technology Data Exchange (ETDEWEB)

    Meissner, Rolf

    2008-11-15

    The ''Panorama-Sauna'' at Grafschaft is a big indoor swimming pool and Sauna centre in a rural region not far from Cologne and Koblenz. The charm of this spectacular solar project is in its minimalism. Conventional solar thermal power systems, in contrast, tend to be complex and prone to failure. (orig.)

  7. Phylogenetic trees and Euclidean embeddings.

    Science.gov (United States)

    Layer, Mark; Rhodes, John A

    2017-01-01

    It was recently observed by de Vienne et al. (Syst Biol 60(6):826-832, 2011) that a simple square root transformation of distances between taxa on a phylogenetic tree allowed for an embedding of the taxa into Euclidean space. While the justification for this was based on a diffusion model of continuous character evolution along the tree, here we give a direct and elementary explanation for it that provides substantial additional insight. We use this embedding to reinterpret the differences between the NJ and BIONJ tree building algorithms, providing one illustration of how this embedding reflects tree structures in data.

  8. Implementing a cumulative supermatrix approach for a comprehensive phylogenetic study of the Teloschistales (Pezizomycotina, Ascomycota)

    DEFF Research Database (Denmark)

    Gaya, Ester; Högnabba, Filip; Holguin, Ángela

    2012-01-01

    The resolution of the phylogenetic relationships within the order Teloschistales (Ascomycota, lichen-forming-fungi), with nearly 2000 known species and outstanding phenotypic diversity, has been hindered by the limitation in the resolving power that single-locus or two-locus phylogenetic studies...... – the Megalosporaceae – which is sister to the mainly rock-inhabiting, cosmopolitan, and species rich Teloschistaceae, with a diversity of growth habits ranging from crustose to fruticose. Our results confirm the use of a cumulative supermatrix approach as a viable method to generate comprehensive phylogenies...

  9. The ethnobotany of psychoactive plant use: a phylogenetic perspective

    Directory of Open Access Journals (Sweden)

    Nashmiah Aid Alrashedy

    2016-10-01

    Full Text Available Psychoactive plants contain chemicals that presumably evolved as allelochemicals but target certain neuronal receptors when consumed by humans, altering perception, emotion and cognition. These plants have been used since ancient times as medicines and in the context of religious rituals for their various psychoactive effects (e.g., as hallucinogens, stimulants, sedatives. The ubiquity of psychoactive plants in various cultures motivates investigation of the commonalities among these plants, in which a phylogenetic framework may be insightful. A phylogeny of culturally diverse psychoactive plant taxa was constructed with their psychotropic effects and affected neurotransmitter systems mapped on the phylogeny. The phylogenetic distribution shows multiple evolutionary origins of psychoactive families. The plant families Myristicaceae (e.g., nutmeg, Papaveraceae (opium poppy, Cactaceae (peyote, Convolvulaceae (morning glory, Solanaceae (tobacco, Lamiaceae (mints, Apocynaceae (dogbane have a disproportionate number of psychoactive genera with various indigenous groups using geographically disparate members of these plant families for the same psychoactive effect, an example of cultural convergence. Pharmacological traits related to hallucinogenic and sedative potential are phylogenetically conserved within families. Unrelated families that exert similar psychoactive effects also modulate similar neurotransmitter systems (i.e., mechanistic convergence. However, pharmacological mechanisms for stimulant effects were varied even within families suggesting that stimulant chemicals may be more evolutionarily labile than those associated with hallucinogenic and sedative effects. Chemically similar psychoactive chemicals may also exist in phylogenetically unrelated lineages, suggesting convergent evolution or differential gene regulation of a common metabolic pathway. Our study has shown that phylogenetic analysis of traditionally used psychoactive plants

  10. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    develop under conditions of winter snow accumulation were more,even at the both.scale, i.e., contained more diverse and distantly related plant species compared with random samples. (Scheuchzerio-Caricetea fuscae) aquatic communities in cold (Montio-Cardaminetea), sedge meadows (Carici rupestris-Kobresietea bellardii), and communities, in which shrubs and predominated (juniper and rhododendron elfin woods, class Loiseleurio-Vaccinietea), have been studied only at the larger scale and showed significant evenness of species composition, i.e., were phylogenetically more diverse compared with random samples.

  11. Panorama Profissional

    Directory of Open Access Journals (Sweden)

    Suzana Kahn Ribeiro

    2009-10-01

    Full Text Available

    O Painel Intergovernamental de Mudanças Climáticas é um órgão criado em 1988 pelas Nações Unidas e pela Organização Mundial de Meteorologia. Sua sigla – IPCC – foi muito divulgada recentemente por ocasião do Prêmio Nobel da Paz 2007, quando o Painel foi laureado com este prêmio em conjunto com o ex-Vice-Presidente americano Al Gore. O objetivo do IPCC é compilar dados recentes e de relevância científica a respeito das mudanças climáticas, bem como informações técnicas e de natureza sócio-econômica.

    Assim sendo, os relatórios do IPCC não têm conotação política, mas científica. Eles são publicados em intervalos regulares, sumarizando o que há de mais recente em termos de conhecimento e projeções acerca do tema mudanças climáticas. O primeiro relatório data de 1990 e foi decisivo para a criação da Convenção do Clima na Conferência Rio 92. Os relatórios mais recentes ainda são a maior fonte de informação para as negociações da Convenção do Clima.

    O quarto relatório do IPCC, divulgado no ano de 2007, foi dividido em 3 grupos de trabalho (GT. O GT I trata da ciência do clima, ou seja, composição da atmosfera, bioquímica, modelos meteorológicos, entre outras questões. O GT II detalha a vulnerabilidade dos ecossistemas, assim como as medidas de adaptação dos principais setores e regiões. O GT III analisa as opções de mitigação, avaliando estratégias de médio e longo prazo para os diferentes níveis de estabilização de gases de efeito estufa na atmosfera. Para escrever o relatório são selecionados 450 cientistas do mundo todo, envolvendo mais de 130 países. Há ainda a colaboração de 800 autores contribuintes (produzindo textos sobre tópicos específicos e cerca de 2500 revisores científicos.

    No relatório de mitigação (GT III, a divisão dos capítulos se dá em função dos setores com as maiores contribuições para as emissões de gases de efeito estufa (GEE. Os setores tratados são: energia, transportes, indústria, residencial & comercial, agricultura, floresta e resíduos.

    O setor de transportes deve ser destacado, pois é ex-

     

    tremamente dependente do uso de combustíveis fósseis, especialmente gasolina e diesel, sendo um dos setores que mais consomem estes derivados. No ano de 2000, este setor foi responsável por 58% do consumo mundial de petróleo. No Brasil, 50% dos derivados de petróleo (principalmente gasolina e diesel produzidos são consumidos no setor. Isto mostra que se deve buscar alternativas de energia para os transportes,  uma vez que a queima do petróleo gera emissão de GEE que, além de causar as mudanças do clima, apresenta outros impactos ambientais como na qualidade do ar.

    Várias foram as estratégias abordadas, no relatório, no capítulo sobre transportes, desde as tecnológicas, como veículos híbridos, biocombustíveis, eficiência energética, materiais leves, entre outras, até alternativas associadas às boas práticas em transportes, como transporte público, transferência modal, gerenciamento da mobilidade, etc.

    O interessante é notar que, em um cenário previsto para 2030, não se espera nenhuma nova tecnologia no mercado. Bastaria a implementação das tecnologias comercialmente já disponíveis e a adoção das práticas acima mencionadas, para se ter um nível de emissão de GEE aceitável.

    Assim, com o recente reconhecimento do esforço de todos os cientistas envolvidos, através do Prêmio Nobel da Paz, espera-se que haja não apenas um estímulo para a implantação das recomendações citadas no relatório como também maior investimento em pesquisas nas áreas citadas, tanto a partir dos governos como da iniciativa privada.

    Foi de extrema importância associar o trabalho do IPCC à paz, pois sinaliza a relevância das mudanças climáticas para a paz mundial. O aquecimento global vai intensificar as desigualdades sociais, penalizando, com maior intensidade, os países e as regiões mais pobres do planeta, provocando um fluxo de refugiados climáticos, aumentado, portanto, as tensões e conflitos nas áreas mais atingidas pela alteração do clima. A gravidade das mudanças climáticas que já podem ser identificadas atualmente, bem como daquelas que podem vir no futuro, se configura como uma ameaça às condições de vida e aos recursos naturais.

  12. Panorama Bible

    OpenAIRE

    Samuel, Asumadu-Sarkodie

    2015-01-01

    The Bible, as you know, is not merely a collection of books: It is a divine library. It was written during the course of some fifteen centuries, and forty or more authors contributed to it, some of whom we know, some we do not know. It is a book of wonderful variety. There are beautiful love stories which reflect the tenderness and most delicate of human passions; there are stories of political intrigue and maneuvering which rival anything we know in the 20th Century. The whole book is the gl...

  13. Panorama 96

    International Nuclear Information System (INIS)

    Jacquard, P.

    1996-01-01

    This is the proceedings of the colloquium relative to the petroleum industry that took place on the twenty fifth of January 1996. The different analysis are relative to economic and technological events, but without forgetting the impact of political events such the possible consequences of the opening of ex USSR on petroleum and gas areas or the political evolution in the Middle-East. There are presentations on the market evolution, the industrial structures and the advances in technologies. The situation of South East Asia is developed, especially through the future of petroleum and gas demand. The point of view of a Norwegian group, Statoil is developed to understand the life of petroleum industry. Finally, a survey of the world situation in this area is given. (N.C.)

  14. Phylogenetic Conservatism in Plant Phenology

    Science.gov (United States)

    Davies, T. Jonathan; Wolkovich, Elizabeth M.; Kraft, Nathan J. B.; Salamin, Nicolas; Allen, Jenica M.; Ault, Toby R.; Betancourt, Julio L.; Bolmgren, Kjell; Cleland, Elsa E.; Cook, Benjamin I.; hide

    2013-01-01

    Phenological events defined points in the life cycle of a plant or animal have been regarded as highly plastic traits, reflecting flexible responses to various environmental cues. The ability of a species to track, via shifts in phenological events, the abiotic environment through time might dictate its vulnerability to future climate change. Understanding the predictors and drivers of phenological change is therefore critical. Here, we evaluated evidence for phylogenetic conservatism the tendency for closely related species to share similar ecological and biological attributes in phenological traits across flowering plants. We aggregated published and unpublished data on timing of first flower and first leaf, encompassing 4000 species at 23 sites across the Northern Hemisphere. We reconstructed the phylogeny for the set of included species, first, using the software program Phylomatic, and second, from DNA data. We then quantified phylogenetic conservatism in plant phenology within and across sites. We show that more closely related species tend to flower and leaf at similar times. By contrasting mean flowering times within and across sites, however, we illustrate that it is not the time of year that is conserved, but rather the phenological responses to a common set of abiotic cues. Our findings suggest that species cannot be treated as statistically independent when modelling phenological responses.Closely related species tend to resemble each other in the timing of their life-history events, a likely product of evolutionarily conserved responses to environmental cues. The search for the underlying drivers of phenology must therefore account for species' shared evolutionary histories.

  15. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  16. Phylogenetic classification of the world's tropical forests.

    Science.gov (United States)

    Slik, J W Ferry; Franklin, Janet; Arroyo-Rodríguez, Víctor; Field, Richard; Aguilar, Salomon; Aguirre, Nikolay; Ahumada, Jorge; Aiba, Shin-Ichiro; Alves, Luciana F; K, Anitha; Avella, Andres; Mora, Francisco; Aymard C, Gerardo A; Báez, Selene; Balvanera, Patricia; Bastian, Meredith L; Bastin, Jean-François; Bellingham, Peter J; van den Berg, Eduardo; da Conceição Bispo, Polyanna; Boeckx, Pascal; Boehning-Gaese, Katrin; Bongers, Frans; Boyle, Brad; Brambach, Fabian; Brearley, Francis Q; Brown, Sandra; Chai, Shauna-Lee; Chazdon, Robin L; Chen, Shengbin; Chhang, Phourin; Chuyong, George; Ewango, Corneille; Coronado, Indiana M; Cristóbal-Azkarate, Jurgi; Culmsee, Heike; Damas, Kipiro; Dattaraja, H S; Davidar, Priya; DeWalt, Saara J; Din, Hazimah; Drake, Donald R; Duque, Alvaro; Durigan, Giselda; Eichhorn, Karl; Eler, Eduardo Schmidt; Enoki, Tsutomu; Ensslin, Andreas; Fandohan, Adandé Belarmain; Farwig, Nina; Feeley, Kenneth J; Fischer, Markus; Forshed, Olle; Garcia, Queila Souza; Garkoti, Satish Chandra; Gillespie, Thomas W; Gillet, Jean-Francois; Gonmadje, Christelle; Granzow-de la Cerda, Iñigo; Griffith, Daniel M; Grogan, James; Hakeem, Khalid Rehman; Harris, David J; Harrison, Rhett D; Hector, Andy; Hemp, Andreas; Homeier, Jürgen; Hussain, M Shah; Ibarra-Manríquez, Guillermo; Hanum, I Faridah; Imai, Nobuo; Jansen, Patrick A; Joly, Carlos Alfredo; Joseph, Shijo; Kartawinata, Kuswata; Kearsley, Elizabeth; Kelly, Daniel L; Kessler, Michael; Killeen, Timothy J; Kooyman, Robert M; Laumonier, Yves; Laurance, Susan G; Laurance, William F; Lawes, Michael J; Letcher, Susan G; Lindsell, Jeremy; Lovett, Jon; Lozada, Jose; Lu, Xinghui; Lykke, Anne Mette; Mahmud, Khairil Bin; Mahayani, Ni Putu Diana; Mansor, Asyraf; Marshall, Andrew R; Martin, Emanuel H; Calderado Leal Matos, Darley; Meave, Jorge A; Melo, Felipe P L; Mendoza, Zhofre Huberto Aguirre; Metali, Faizah; Medjibe, Vincent P; Metzger, Jean Paul; Metzker, Thiago; Mohandass, D; Munguía-Rosas, Miguel A; Muñoz, Rodrigo; Nurtjahy, Eddy; de Oliveira, Eddie Lenza; Onrizal; Parolin, Pia; Parren, Marc; Parthasarathy, N; Paudel, Ekananda; Perez, Rolando; Pérez-García, Eduardo A; Pommer, Ulf; Poorter, Lourens; Qie, Lan; Piedade, Maria Teresa F; Pinto, José Roberto Rodrigues; Poulsen, Axel Dalberg; Poulsen, John R; Powers, Jennifer S; Prasad, Rama Chandra; Puyravaud, Jean-Philippe; Rangel, Orlando; Reitsma, Jan; Rocha, Diogo S B; Rolim, Samir; Rovero, Francesco; Rozak, Andes; Ruokolainen, Kalle; Rutishauser, Ervan; Rutten, Gemma; Mohd Said, Mohd Nizam; Saiter, Felipe Z; Saner, Philippe; Santos, Braulio; Dos Santos, João Roberto; Sarker, Swapan Kumar; Schmitt, Christine B; Schoengart, Jochen; Schulze, Mark; Sheil, Douglas; Sist, Plinio; Souza, Alexandre F; Spironello, Wilson Roberto; Sposito, Tereza; Steinmetz, Robert; Stevart, Tariq; Suganuma, Marcio Seiji; Sukri, Rahayu; Sultana, Aisha; Sukumar, Raman; Sunderland, Terry; Supriyadi; Suresh, H S; Suzuki, Eizi; Tabarelli, Marcelo; Tang, Jianwei; Tanner, Ed V J; Targhetta, Natalia; Theilade, Ida; Thomas, Duncan; Timberlake, Jonathan; de Morisson Valeriano, Márcio; van Valkenburg, Johan; Van Do, Tran; Van Sam, Hoang; Vandermeer, John H; Verbeeck, Hans; Vetaas, Ole Reidar; Adekunle, Victor; Vieira, Simone A; Webb, Campbell O; Webb, Edward L; Whitfeld, Timothy; Wich, Serge; Williams, John; Wiser, Susan; Wittmann, Florian; Yang, Xiaobo; Adou Yao, C Yves; Yap, Sandra L; Zahawi, Rakan A; Zakaria, Rahmad; Zang, Runguo

    2018-02-20

    Knowledge about the biogeographic affinities of the world's tropical forests helps to better understand regional differences in forest structure, diversity, composition, and dynamics. Such understanding will enable anticipation of region-specific responses to global environmental change. Modern phylogenies, in combination with broad coverage of species inventory data, now allow for global biogeographic analyses that take species evolutionary distance into account. Here we present a classification of the world's tropical forests based on their phylogenetic similarity. We identify five principal floristic regions and their floristic relationships: ( i ) Indo-Pacific, ( ii ) Subtropical, ( iii ) African, ( iv ) American, and ( v ) Dry forests. Our results do not support the traditional neo- versus paleotropical forest division but instead separate the combined American and African forests from their Indo-Pacific counterparts. We also find indications for the existence of a global dry forest region, with representatives in America, Africa, Madagascar, and India. Additionally, a northern-hemisphere Subtropical forest region was identified with representatives in Asia and America, providing support for a link between Asian and American northern-hemisphere forests. Copyright © 2018 the Author(s). Published by PNAS.

  17. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  18. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  19. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. Effects of phylogenetic reconstruction method on the robustness of species delimitation using single-locus data.

    Science.gov (United States)

    Tang, Cuong Q; Humphreys, Aelys M; Fontaneto, Diego; Barraclough, Timothy G; Paradis, Emmanuel

    2014-10-01

    Coalescent-based species delimitation methods combine population genetic and phylogenetic theory to provide an objective means for delineating evolutionarily significant units of diversity. The generalised mixed Yule coalescent (GMYC) and the Poisson tree process (PTP) are methods that use ultrametric (GMYC or PTP) or non-ultrametric (PTP) gene trees as input, intended for use mostly with single-locus data such as DNA barcodes. Here, we assess how robust the GMYC and PTP are to different phylogenetic reconstruction and branch smoothing methods. We reconstruct over 400 ultrametric trees using up to 30 different combinations of phylogenetic and smoothing methods and perform over 2000 separate species delimitation analyses across 16 empirical data sets. We then assess how variable diversity estimates are, in terms of richness and identity, with respect to species delimitation, phylogenetic and smoothing methods. The PTP method generally generates diversity estimates that are more robust to different phylogenetic methods. The GMYC is more sensitive, but provides consistent estimates for BEAST trees. The lower consistency of GMYC estimates is likely a result of differences among gene trees introduced by the smoothing step. Unresolved nodes (real anomalies or methodological artefacts) affect both GMYC and PTP estimates, but have a greater effect on GMYC estimates. Branch smoothing is a difficult step and perhaps an underappreciated source of bias that may be widespread among studies of diversity and diversification. Nevertheless, careful choice of phylogenetic method does produce equivalent PTP and GMYC diversity estimates. We recommend simultaneous use of the PTP model with any model-based gene tree (e.g. RAxML) and GMYC approaches with BEAST trees for obtaining species hypotheses.

  1. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  2. Novel single-cell mega-size chambers for electrochemical etching of panorama position-sensitive polycarbonate ion image detectors

    Science.gov (United States)

    Sohrabi, Mehdi

    2017-11-01

    A novel development is made here by inventing panorama single-cell mega-size electrochemical etching (MS-ECE) chamber systems for processing panorama position-sensitive mega-size polycarbonate ion image detectors (MS-PCIDs) of potential for many neutron and ion detection applications in particular hydrogen ions or proton tracks and images detected for the first time in polycarbonates in this study. The MS-PCID is simply a large polycarbonate sheet of a desired size. The single-cell MS-ECE invented consists of two large equally sized transparent Plexiglas sheets as chamber walls holding a MS-PCID and the ECE chamber components tightly together. One wall has a large flat stainless steel electrode (dry cell) attached to it which is directly in contact with the MS-PCID and the other wall has a rod electrode with two holes to facilitate feeding and draining out the etching solution from the wet cell. A silicon rubber washer plays the role of the wet cell to hold the etchant and the electrical insulator to isolate the dry cell from the wet cell. A simple 50 Hz-HV home-made generator provides an adequate field strength through the two electrodes across the MS-ECE chamber. Two panorama single-cell MS-ECE chamber systems (circular and rectangular shapes) constructed were efficiently applied to processing the MS-PCIDs for 4π ion emission image detection of different gases in particular hydrogen ions or protons in a 3.5 kJ plasma focus device (PFD as uniquely observed by the unaided eyes). The panorama MS-PCID/MS-ECE image detection systems invented are novel with high potential for many applications in particular as applied to 4π panorama ion emission angular distribution image detection studies in PFD space, some results of which are presented and discussed.

  3. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  4. Educomunicación y radios universitarias: panorama internacional y perspectivas futuras

    Directory of Open Access Journals (Sweden)

    Ignacio Aguaded

    2014-01-01

    Full Text Available El presente trabajo sitúa las radios universitarias en el contexto educomunicativo de servicio a la ciudadanía, la participación cívica y la democratización de los pueblos, como servicios públicos de vocación ciudadana, alternativas mediáticas al sistema comercial y privado. Se ofrece un breve panorama de la pujante situación internacional, especialmente en el ámbito latinoamericano y europeo, de estos medios universitarios que son auténticas plataformas de comunicación 2.0, con un uso intensivo de Internet, centrándose en la importancia de la colaboración y la generación de redes internacionales como estrategia futuro.

  5. Panorama Image Processing for Condition Monitoring with Thermography in Power Plant

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Byoung Joon; Kim, Tae Hwan; Kim, Soon Geol; Mo, Yoon Syub [UNETWARE, Seoul (Korea, Republic of); Kim, Won Tae [Kongju National University, Gongju (Korea, Republic of)

    2010-04-15

    In this paper, imaging processing study obtained from CCD image and thermography image was performed in order to treat easily thermographic data without any risks of personnel who conduct the condition monitoring for the abnormal or failure status occurrable in industrial power plants. This imaging processing is also applicable to the predictive maintenance. For confirming the broad monitoring, a methodology producting single image from the panorama technique was developed no matter how many cameras are employed, including fusion method for discrete configuration for the target. As results, image fusion from quick realtime processing was obtained and it was possible to save time to track the location monitoring in matching the images between CCTV and thermography

  6. Panorama Image Processing for Condition Monitoring with Thermography in Power Plant

    International Nuclear Information System (INIS)

    Jeon, Byoung Joon; Kim, Tae Hwan; Kim, Soon Geol; Mo, Yoon Syub; Kim, Won Tae

    2010-01-01

    In this paper, imaging processing study obtained from CCD image and thermography image was performed in order to treat easily thermographic data without any risks of personnel who conduct the condition monitoring for the abnormal or failure status occurrable in industrial power plants. This imaging processing is also applicable to the predictive maintenance. For confirming the broad monitoring, a methodology producting single image from the panorama technique was developed no matter how many cameras are employed, including fusion method for discrete configuration for the target. As results, image fusion from quick realtime processing was obtained and it was possible to save time to track the location monitoring in matching the images between CCTV and thermography

  7. A universidade e a pós-modernidade: o panorama brasileiro

    Directory of Open Access Journals (Sweden)

    Lessa Carlos

    1999-01-01

    Full Text Available The article examines the panorama currently facing the Brazilian university. In the postmodern era, the process that has transformed knowledge and nature into wealth has brought with it the hypertrophy of mass culture and the spread of telecommunications and computer technology. These latter phenomena act as vectors that have shifted the university away from the central position it held in the nineteenth century. The atrophy of the State and hypertrophy of audiovisual language have reduced the institution?s significance and visibility. In Brazil, these vectors have all been reinforced by a choice to enter the globalization process in passive fashion. This explicit relinquishing of an affirmation of the nation has reduced the university?s space. The article ends by examining current issues in institutional definition, where any eventual format will be vital to the future of the Brazilian university.

  8. Keeping All the PIECES: Phylogenetically Informed Ex Situ Conservation of Endangered Species.

    Science.gov (United States)

    Larkin, Daniel J; Jacobi, Sarah K; Hipp, Andrew L; Kramer, Andrea T

    2016-01-01

    Ex situ conservation in germplasm and living collections is a major focus of global plant conservation strategies. Prioritizing species for ex situ collection is a necessary component of this effort for which sound strategies are needed. Phylogenetic considerations can play an important role in prioritization. Collections that are more phylogenetically diverse are likely to encompass more ecological and trait variation, and thus provide stronger conservation insurance and richer resources for future restoration efforts. However, phylogenetic criteria need to be weighed against other, potentially competing objectives. We used ex situ collection and threat rank data for North American angiosperms to investigate gaps in ex situ coverage and phylogenetic diversity of collections and to develop a flexible framework for prioritizing species across multiple objectives. We found that ex situ coverage of 18,766 North American angiosperm taxa was low with respect to the most vulnerable taxa: just 43% of vulnerable to critically imperiled taxa were in ex situ collections, far short of a year-2020 goal of 75%. In addition, species held in ex situ collections were phylogenetically clustered (P species been drawn at random. These patterns support incorporating phylogenetic considerations into ex situ prioritization in a manner balanced with other criteria, such as vulnerability. To meet this need, we present the 'PIECES' index (Phylogenetically Informed Ex situ Conservation of Endangered Species). PIECES integrates phylogenetic considerations into a flexible framework for prioritizing species across competing objectives using multi-criteria decision analysis. Applying PIECES to prioritizing ex situ conservation of North American angiosperms, we show strong return on investment across multiple objectives, some of which are negatively correlated with each other. A spreadsheet-based decision support tool for North American angiosperms is provided; this tool can be customized to

  9. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    DEFF Research Database (Denmark)

    Pellissier, Loïc; Wisz, Mary S.; Strandberg, Beate

    2014-01-01

    on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy...... height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were......Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based...

  10. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  11. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  13. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  14. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...

  15. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  16. Opposing assembly mechanisms in a neotropical dry forest: implications for phylogenetic and functional community ecology.

    Science.gov (United States)

    Swenson, Nathan G; Enquist, Brian J

    2009-08-01

    Species diversity is promoted and maintained by ecological and evolutionary processes operating on species attributes through space and time. The degree to which variability in species function regulates distribution and promotes coexistence of species has been debated. Previous work has attempted to quantify the relative importance of species function by using phylogenetic relatedness as a proxy for functional similarity. The key assumption of this approach is that function is phylogenetically conserved. If this assumption is supported, then the phylogenetic dispersion in a community should mirror the functional dispersion. Here we quantify functional trait dispersion along several key axes of tree life-history variation and on multiple spatial scales in a Neotropical dry-forest community. We next compare these results to previously reported patterns of phylogenetic dispersion in this same forest. We find that, at small spatial scales, coexisting species are typically more functionally clustered than expected, but traits related to adult and regeneration niches are overdispersed. This outcome was repeated when the analyses were stratified by size class. Some of the trait dispersion results stand in contrast to the previously reported phylogenetic dispersion results. In order to address this inconsistency we examined the strength of phylogenetic signal in traits at different depths in the phylogeny. We argue that: (1) while phylogenetic relatedness may be a good general multivariate proxy for ecological similarity, it may have a reduced capacity to depict the functional mechanisms behind species coexistence when coexisting species simultaneously converge and diverge in function; and (2) the previously used metric of phylogenetic signal provided erroneous inferences about trait dispersion when married with patterns of phylogenetic dispersion.

  17. RAPD analysis for genetic diversity of two populations of Mystus ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... and other aquatic ecosystem and the ecological complexes. ... is a property at the population level while the functional diversity concept ... warm water fish species, which are distributed all over the world. ..... Phylogenetic.

  18. Alien plants invade more phylogenetically clustered community types and cause even stronger clustering

    Czech Academy of Sciences Publication Activity Database

    Lososová, Z.; de Bello, Francesco; Chytrý, M.; Kühn, I.; Pyšek, Petr; Sádlo, Jiří; Winter, M.; Zelený, D.

    2015-01-01

    Roč. 24, č. 7 (2015), s. 786-794 ISSN 1466-822X R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 Keywords : biological invasions * phylogenetic diversity * vegetation type Subject RIV: EH - Ecology, Behaviour Impact factor: 5.840, year: 2015

  19. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    ... glycol plus control. All isolates exhibited good drought-tolerant efficiencies at 10% PEG. While most of the isolates could not tolerate up to 20% PEG, isolates of Rlv6, Rlv9, Rlv12 and Rlv13 tolerated up to 20% PEG. Keywords: Rhizobium leguminosarum, 23S rRNA gene, phylogenetic tree, diversity and drought tolerance ...

  20. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  1. On the need for phylogenetic ‘corrections’ in functional trait-based approaches

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Berg, M. P.; Dias, A. T. C.; Diniz-Filho, J. A. F.; Götzenberger, Lars; Hortal, J.; Ladle, L. J.; Lepš, Jan

    2015-01-01

    Roč. 50, č. 4 (2015), 349-357 ISSN 1211-9520 R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 ; RVO:60077344 Keywords : adaptation * functional and phylogenetic diversity * limiting similarity Subject RIV: EH - Ecology, Behaviour Impact factor: 1.433, year: 2015

  2. Phylogenetically poor plant communities receive more alien species, which more easily coexist with natives

    Czech Academy of Sciences Publication Activity Database

    Gerhold, P.; Pärtel, M.; Tackenberg, O.; Hennekens, S.M.; Bartish, Igor; Schaminée, J.H.J.; Fergus, A. J. F.; Ozinga, W.A.; Prinzing, A.

    2011-01-01

    Roč. 177, č. 5 (2011), s. 68-680 ISSN 0003-0147 Institutional research plan: CEZ:AV0Z60050516 Keywords : species richness * phylogenetic diversity * invasions Subject RIV: EF - Botanics Impact factor: 4.725, year: 2011

  3. In Silico Gene-Level Evolution Explains Microbial Population Diversity through Differential Gene Mobility

    NARCIS (Netherlands)

    van Dijk, Bram; Hogeweg, P.

    2016-01-01

    Microbial communities can show astonishing ecological and phylogenetic diversity. What is the role of pervasive horizontal gene transfer (HGT) in shaping this diversity in the presence of clonally expanding "killer strains"? Does HGT of antibiotic production and resistance genes erase phylogenetic

  4. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  5. Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota.

    Science.gov (United States)

    Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

    2016-01-01

    Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota.

  6. Carotenogenesis diversification in phylogenetic lineages of Rhodophyta.

    Science.gov (United States)

    Takaichi, Shinichi; Yokoyama, Akiko; Mochimaru, Mari; Uchida, Hiroko; Murakami, Akio

    2016-06-01

    Carotenoid composition is very diverse in Rhodophyta. In this study, we investigated whether this variation is related to the phylogeny of this group. Rhodophyta consists of seven classes, and they can be divided into two groups on the basis of their morphology. The unicellular group (Cyanidiophyceae, Porphyridiophyceae, Rhodellophyceae, and Stylonematophyceae) contained only β-carotene and zeaxanthin, "ZEA-type carotenoids." In contrast, within the macrophytic group (Bangiophyceae, Compsopogonophyceae, and Florideophyceae), Compsopogonophyceae contained antheraxanthin in addition to ZEA-type carotenoids, "ANT-type carotenoids," whereas Bangiophyceae contained α-carotene and lutein along with ZEA-type carotenoids, "LUT-type carotenoids." Florideophyceae is divided into five subclasses. Ahnfeltiophycidae, Hildenbrandiophycidae, and Nemaliophycidae contained LUT-type carotenoids. In Corallinophycidae, Hapalidiales and Lithophylloideae in Corallinales contained LUT-type carotenoids, whereas Corallinoideae in Corallinales contained ANT-type carotenoids. In Rhodymeniophycidae, most orders contained LUT-type carotenoids; however, only Gracilariales contained ANT-type carotenoids. There is a clear relationship between carotenoid composition and phylogenetics in Rhodophyta. Furthermore, we searched open genome databases of several red algae for references to the synthetic enzymes of the carotenoid types detected in this study. β-Carotene and zeaxanthin might be synthesized from lycopene, as in land plants. Antheraxanthin might require zeaxanthin epoxydase, whereas α-carotene and lutein might require two additional enzymes, as in land plants. Furthermore, Glaucophyta contained ZEA-type carotenoids, and Cryptophyta contained β-carotene, α-carotene, and alloxanthin, whose acetylenic group might be synthesized from zeaxanthin by an unknown enzyme. Therefore, we conclude that the presence or absence of the four enzymes is related to diversification of carotenoid

  7. Phylogenetic reconstruction and shell evolution of the Diplommatinidae (Gastropoda: Caenogastropoda).

    Science.gov (United States)

    Webster, Nicole B; Van Dooren, Tom J M; Schilthuizen, Menno

    2012-06-01

    The fascinating and often unlikely shell shapes in the terrestrial micromollusc family Diplommatinidae (Gastropoda: Caenogastropoda) provide a particularly attractive set of multiple morphological traits to investigate evolutionary patterns of shape variation. Here, a molecular phylogenetic reconstruction, based on five genes and 2700 bp, was undertaken for this family, integrated with ancestral state reconstruction and phylogenetic PCA of discrete and quantitative traits, respectively. We found strong support for the Diplommatininae as a monophyletic group, separating the Cochlostomatidae into a separate family. Five main clades appear within the Diplommatininae, corresponding with both coiling direction and biogeographic patterns. A Belau clade (A) with highly diverse (but always sinistral) morphology comprised Hungerfordia, Palaina, and some Diplommatina. Arinia (dextral) and Opisthostoma (sinistroid) are sister groups in clade B. Clade C and D solely contain sinistral Diplommatina that are robust and little ornamented (clade C) or slender and sculptured (clade D). Clade E is dextral but biogeographically diverse with species from all sampled regions save the Caroline Islands. Adelopoma, Diplommatina, Palaina, and Hungerfordia require revision to allow taxonomy to reflect phylogeny, whereas Opisthostoma is clearly monophyletic. Ancestral state reconstruction suggests a sinistral origin for the Diplommatinidae, with three reversals to dextrality. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Psychological and physiological human responses to simulated and real environments: A comparison between Photographs, 360° Panoramas, and Virtual Reality.

    Science.gov (United States)

    Higuera-Trujillo, Juan Luis; López-Tarruella Maldonado, Juan; Llinares Millán, Carmen

    2017-11-01

    Psychological research into human factors frequently uses simulations to study the relationship between human behaviour and the environment. Their validity depends on their similarity with the physical environments. This paper aims to validate three environmental-simulation display formats: photographs, 360° panoramas, and virtual reality. To do this we compared the psychological and physiological responses evoked by simulated environments set-ups to those from a physical environment setup; we also assessed the users' sense of presence. Analysis show that 360° panoramas offer the closest to reality results according to the participants' psychological responses, and virtual reality according to the physiological responses. Correlations between the feeling of presence and physiological and other psychological responses were also observed. These results may be of interest to researchers using environmental-simulation technologies currently available in order to replicate the experience of physical environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Phylogenetic climatic niche conservatism and evolution of climatic suitability in Neotropical Angraecinae (Vandeae, Orchidaceae) and their closest African relatives

    Czech Academy of Sciences Publication Activity Database

    Kolanowska, Marta; Grochocka, E.; Konowalik, K.

    2017-01-01

    Roč. 5, may (2017), č. článku e3328. ISSN 2167-8359 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : campylocentrum orchidaceae * molecular phylogenetics * environmental niches * costa-rica * diversity * models * speciation * ecology * pollination * divergence * Angraecinae * Ecological niche modeling * Orchidaceae * Phylogenetic niche conservatism * Angraecum * Campylocentrum * Dendrophylax Subject RIV: EH - Ecology, Behaviour OBOR OECD: Biodiversity conservation Impact factor: 2.177, year: 2016

  11. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  12. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    International Nuclear Information System (INIS)

    Pellissier, Loïc; Wisz, Mary S; Strandberg, Beate; Damgaard, Christian

    2014-01-01

    Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were not phylogenetically conserved. Species richness also decreased with increasing levels of nitrogen and glyphosate. Our results suggest that predicting the cumulative effects of agrochemicals is more complex than anticipated due to their distinct selection of traits that may or may not be conserved phylogenetically. Precautionary efforts to mitigate drift of agricultural chemicals into semi-natural habitats are warranted to prevent unforeseeable biodiversity shifts. (paper)

  13. Long-term nitrogen addition affects the phylogenetic turnover of soil microbial community responding to moisture pulse.

    Science.gov (United States)

    Liu, Chi; Yao, Minjie; Stegen, James C; Rui, Junpeng; Li, Jiabao; Li, Xiangzhen

    2017-12-13

    How press disturbance (long-term) influences the phylogenetic turnover of soil microbial communities responding to pulse disturbances (short-term) is not fully known. Understanding the complex connections between the history of environmental conditions, assembly processes and microbial community dynamics is necessary to predict microbial response to perturbation. We started by investigating phylogenetic spatial turnover (based on DNA) of soil prokaryotic communities after long-term nitrogen (N) deposition and temporal turnover (based on RNA) of communities responding to pulse by conducting short-term rewetting experiments. The results showed that moderate N addition increased ecological stochasticity and phylogenetic diversity. In contrast, high N addition slightly increased homogeneous selection and decreased phylogenetic diversity. Examining the system with higher phylogenetic resolution revealed a moderate contribution of variable selection across the whole N gradient. The moisture pulse experiment showed that high N soils had higher rates of phylogenetic turnover across short phylogenetic distances and significant changes in community compositions through time. Long-term N input history influenced spatial turnover of microbial communities, but the dominant community assembly mechanisms differed across different N deposition gradients. We further revealed an interaction between press and pulse disturbances whereby deterministic processes were particularly important following pulse disturbances in high N soils.

  14. Aquatic insect ecophysiological traits reveal phylogenetically based differences in dissolved cadmium susceptibility.

    Science.gov (United States)

    Buchwalter, David B; Cain, Daniel J; Martin, Caitrin A; Xie, Lingtian; Luoma, Samuel N; Garland, Theodore

    2008-06-17

    We used a phylogenetically based comparative approach to evaluate the potential for physiological studies to reveal patterns of diversity in traits related to susceptibility to an environmental stressor, the trace metal cadmium (Cd). Physiological traits related to Cd bioaccumulation, compartmentalization, and ultimately susceptibility were measured in 21 aquatic insect species representing the orders Ephemeroptera, Plecoptera, and Trichoptera. We mapped these experimentally derived physiological traits onto a phylogeny and quantified the tendency for related species to be similar (phylogenetic signal). All traits related to Cd bioaccumulation and susceptibility exhibited statistically significant phylogenetic signal, although the signal strength varied among traits. Conventional and phylogenetically based regression models were compared, revealing great variability within orders but consistent, strong differences among insect families. Uptake and elimination rate constants were positively correlated among species, but only when effects of body size and phylogeny were incorporated in the analysis. Together, uptake and elimination rates predicted dramatic Cd bioaccumulation differences among species that agreed with field-based measurements. We discovered a potential tradeoff between the ability to eliminate Cd and the ability to detoxify it across species, particularly mayflies. The best-fit regression models were driven by phylogenetic parameters (especially differences among families) rather than functional traits, suggesting that it may eventually be possible to predict a taxon's physiological performance based on its phylogenetic position, provided adequate physiological information is available for close relatives. There appears to be great potential for evolutionary physiological approaches to augment our understanding of insect responses to environmental stressors in nature.

  15. Competition and habitat filtering jointly explain phylogenetic structure of soil bacterial communities across elevational gradients.

    Science.gov (United States)

    Zhang, Qian; Goberna, Marta; Liu, Yuguo; Cui, Ming; Yang, Haishui; Sun, Qixiang; Insam, Heribert; Zhou, Jinxing

    2018-04-24

    The importance of assembly processes in shaping biological communities is poorly understood, especially for microbes. Here we report on the forces that structure soil bacterial communities along a 2000 m elevational gradient. We characterized the relative importance of habitat filtering and competition on phylogenetic structure and turnover in bacterial communities. Bacterial communities exhibited a phylogenetically clustered pattern and were more clustered with increasing elevation. Biotic factors (i.e. relative abundance of dominant bacterial lineages) appeared to be most important to the degree of clustering, evidencing the role of the competitive ability of entire clades in shaping the communities. Phylogenetic turnover showed the greatest correlation to elevation. After controlling for elevation, biotic factors showed greater correlation to phylogenetic turnover than all the habitat variables (i.e. climate, soil and vegetation). Structural equation modelling also identified that elevation and soil organic matter exerted indirect effects on phylogenetic diversity and turnover by determining the dominance of microbial competitors. Our results suggest that competition among bacterial taxa induced by soil carbon contributes to the phylogenetic pattern across elevational gradient in the Tibetan Plateau. This highlights the importance of considering not only abiotic filtering but also biotic interactions in soil bacterial communities across stressful elevational gradients. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Phylogenetic patterns of extinction risk in the eastern arc ecosystems, an African biodiversity hotspot.

    Science.gov (United States)

    Yessoufou, Kowiyou; Daru, Barnabas H; Davies, T Jonathan

    2012-01-01

    There is an urgent need to reduce drastically the rate at which biodiversity is declining worldwide. Phylogenetic methods are increasingly being recognised as providing a useful framework for predicting future losses, and guiding efforts for pre-emptive conservation actions. In this study, we used a reconstructed phylogenetic tree of angiosperm species of the Eastern Arc Mountains - an important African biodiversity hotspot - and described the distribution of extinction risk across taxonomic ranks and phylogeny. We provide evidence for both taxonomic and phylogenetic selectivity in extinction risk. However, we found that selectivity varies with IUCN extinction risk category. Vulnerable species are more closely related than expected by chance, whereas endangered and critically endangered species are not significantly clustered on the phylogeny. We suggest that the general observation for taxonomic and phylogenetic selectivity (i.e. phylogenetic signal, the tendency of closely related species to share similar traits) in extinction risks is therefore largely driven by vulnerable species, and not necessarily the most highly threatened. We also used information on altitudinal distribution and climate to generate a predictive model of at-risk species richness, and found that greater threatened species richness is found at higher altitude, allowing for more informed conservation decision making. Our results indicate that evolutionary history can help predict plant susceptibility to extinction threats in the hyper-diverse but woefully-understudied Eastern Arc Mountains, and illustrate the contribution of phylogenetic approaches in conserving African floristic biodiversity where detailed ecological and evolutionary data are often lacking.

  17. Phylogenetic patterns of extinction risk in the eastern arc ecosystems, an African biodiversity hotspot.

    Directory of Open Access Journals (Sweden)

    Kowiyou Yessoufou

    Full Text Available There is an urgent need to reduce drastically the rate at which biodiversity is declining worldwide. Phylogenetic methods are increasingly being recognised as providing a useful framework for predicting future losses, and guiding efforts for pre-emptive conservation actions. In this study, we used a reconstructed phylogenetic tree of angiosperm species of the Eastern Arc Mountains - an important African biodiversity hotspot - and described the distribution of extinction risk across taxonomic ranks and phylogeny. We provide evidence for both taxonomic and phylogenetic selectivity in extinction risk. However, we found that selectivity varies with IUCN extinction risk category. Vulnerable species are more closely related than expected by chance, whereas endangered and critically endangered species are not significantly clustered on the phylogeny. We suggest that the general observation for taxonomic and phylogenetic selectivity (i.e. phylogenetic signal, the tendency of closely related species to share similar traits in extinction risks is therefore largely driven by vulnerable species, and not necessarily the most highly threatened. We also used information on altitudinal distribution and climate to generate a predictive model of at-risk species richness, and found that greater threatened species richness is found at higher altitude, allowing for more informed conservation decision making. Our results indicate that evolutionary history can help predict plant susceptibility to extinction threats in the hyper-diverse but woefully-understudied Eastern Arc Mountains, and illustrate the contribution of phylogenetic approaches in conserving African floristic biodiversity where detailed ecological and evolutionary data are often lacking.

  18. Characterizing the phylogenetic tree community structure of a protected tropical rain forest area in Cameroon.

    Science.gov (United States)

    Manel, Stéphanie; Couvreur, Thomas L P; Munoz, François; Couteron, Pierre; Hardy, Olivier J; Sonké, Bonaventure

    2014-01-01

    Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world.

  19. Characterizing the Phylogenetic Tree Community Structure of a Protected Tropical Rain Forest Area in Cameroon

    Science.gov (United States)

    Munoz, François; Couteron, Pierre; Hardy, Olivier J.; Sonké, Bonaventure

    2014-01-01

    Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world. PMID:24936786

  20. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  1. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  2. Integrating Spherical Panoramas and Maps for Visualization of Cultural Heritage Objects Using Virtual Reality Technology.

    Science.gov (United States)

    Koeva, Mila; Luleva, Mila; Maldjanski, Plamen

    2017-04-11

    Development and virtual representation of 3D models of Cultural Heritage (CH) objects has triggered great interest over the past decade. The main reason for this is the rapid development in the fields of photogrammetry and remote sensing, laser scanning, and computer vision. The advantages of using 3D models for restoration, preservation, and documentation of valuable historical and architectural objects have been numerously demonstrated by scientists in the field. Moreover, 3D model visualization in virtual reality has been recognized as an efficient, fast, and easy way of representing a variety of objects worldwide for present-day users, who have stringent requirements and high expectations. However, the main focus of recent research is the visual, geometric, and textural characteristics of a single concrete object, while integration of large numbers of models with additional information-such as historical overview, detailed description, and location-are missing. Such integrated information can be beneficial, not only for tourism but also for accurate documentation. For that reason, we demonstrate in this paper an integration of high-resolution spherical panoramas, a variety of maps, GNSS, sound, video, and text information for representation of numerous cultural heritage objects. These are then displayed in a web-based portal with an intuitive interface. The users have the opportunity to choose freely from the provided information, and decide for themselves what is interesting to visit. Based on the created web application, we provide suggestions and guidelines for similar studies. We selected objects, which are located in Bulgaria-a country with thousands of years of history and cultural heritage dating back to ancient civilizations. The methods used in this research are applicable for any type of spherical or cylindrical images and can be easily followed and applied in various domains. After a visual and metric assessment of the panoramas and the evaluation of

  3. Anatomical based registration of multi-sector x-ray images for panorama reconstruction

    Science.gov (United States)

    Ben-Zikri, Yehuda Kfir; Mendez, Stacy; Linte, Cristian A.

    2017-03-01

    Accurate measurement of long limb alignment is an essential stage of the pre-operative planning of realignment surgery. This alignment is quantified according to the hip-knee-ankle (HKA) angle of the mechanical axis of the lower extremity and is measured based on a full-length weight-bearing X-ray or standard computed radiography (CR) image of the patient in standing position. Due to the limited field-of-view of the traditionally employed digital X-ray imaging systems, several sector images are required to capture the posture of a standing individual. These sector images need to then be "stitched" together to reconstruct the standing posture. To eliminate user-induced variability and time constraints associated with the traditional manual "stitching" protocol, we have created an image processing application to automate the stitching process, when there are no reliable external markers available in the images, by only relying on the most reliable anatomical content of the image. The application starts with a rough segmentation of the tibia and the sector images are then registered by evaluating the DICE coefficient between the edges of these corresponding bones along the medial edge. The identified translations are then used to register the original sector images into the standing panorama image. To test the robustness of our method, we randomly selected 40 datasets from a variant database consisting of nearly 100 patient X-ray images acquired for patient screening as part of a multi-site clinical trial. The resulting horizontal and vertical translation values from the automated registration were compared to the homologous translations recorded during the manual panorama generation conducted by a knowledgeable X-ray imaging technician. The mean and standard deviation of the differences for the horizontal translation parameters was -0:27+/-1:14 mm and 0:31+/-1:86 mm for the left and right tibia, respectively. The vertical translation differences for the left and

  4. Functional and phylogenetic structure of island bird communities.

    Science.gov (United States)

    Si, Xingfeng; Cadotte, Marc W; Zeng, Di; Baselga, Andrés; Zhao, Yuhao; Li, Jiaqi; Wu, Yiru; Wang, Siyu; Ding, Ping

    2017-05-01

    Biodiversity change in anthropogenically transformed habitats is often nonrandom, yet the nature and importance of the different mechanisms shaping community structure are unclear. Here, we extend the classic Theory of Island Biogeography (TIB) to account for nonrandom processes by incorporating species traits and phylogenetic relationships into a study of faunal relaxation following habitat loss and fragmentation. Two possible mechanisms can create nonrandom community patterns on fragment islands. First, small and isolated islands might consist of similar or closely related species because they are environmentally homogeneous or select for certain shared traits, such as dispersal ability. Alternatively, communities on small islands might contain more dissimilar or distantly related species than on large islands because limited space and resource availability result in greater competitive exclusion among species with high niche overlap. Breeding birds were surveyed on 36 islands and two mainland sites annually from 2010 to 2014 in the Thousand Island Lake region, China. We assessed community structure of breeding birds on these subtropical land-bridge islands by integrating species' trait and evolutionary distances. We additionally analysed habitat heterogeneity and variance in size ratios to distinguish biotic and abiotic processes of community assembly. Results showed that functional-phylogenetic diversity increased with island area, and decreased with isolation. Bird communities on the mainland were more diverse and generally less clustered than island bird communities and not different than randomly assembled communities. Bird communities on islands tend to be functionally similar and phylogenetically clustered, especially on small and isolated islands. The nonrandom decline in species diversity and change in bird community structure with island area and isolation, along with the relatively homogeneous habitats on small islands, support the environmental

  5. Ecosystem productivity is associated with bacterial phylogenetic distance in surface marine waters.

    Science.gov (United States)

    Galand, Pierre E; Salter, Ian; Kalenitchenko, Dimitri

    2015-12-01

    Understanding the link between community diversity and ecosystem function is a fundamental aspect of ecology. Systematic losses in biodiversity are widely acknowledged but the impact this may exert on ecosystem functioning remains ambiguous. There is growing evidence of a positive relationship between species richness and ecosystem productivity for terrestrial macro-organisms, but similar links for marine micro-organisms, which help drive global climate, are unclear. Community manipulation experiments show both positive and negative relationships for microbes. These previous studies rely, however, on artificial communities and any links between the full diversity of active bacterial communities in the environment, their phylogenetic relatedness and ecosystem function remain hitherto unexplored. Here, we test the hypothesis that productivity is associated with diversity in the metabolically active fraction of microbial communities. We show in natural assemblages of active bacteria that communities containing more distantly related members were associated with higher bacterial production. The positive phylogenetic diversity-productivity relationship was independent of community diversity calculated as the Shannon index. From our long-term (7-year) survey of surface marine bacterial communities, we also found that similarly, productive communities had greater phylogenetic similarity to each other, further suggesting that the traits of active bacteria are an important predictor of ecosystem productivity. Our findings demonstrate that the evolutionary history of the active fraction of a microbial community is critical for understanding their role in ecosystem functioning. © 2015 John Wiley & Sons Ltd.

  6. Introductions do not compensate for functional and phylogenetic losses following extinctions in insular bird assemblages.

    Science.gov (United States)

    Sobral, Fernando L; Lees, Alexander C; Cianciaruso, Marcus V

    2016-09-01

    The ratio of species extinctions to introductions has been comparable for many insular assemblages, suggesting that introductions could have 'compensated' for extinctions. However, the capacity for introduced species to replace ecological roles and evolutionary history lost following extinction is unclear. We investigated changes in bird functional and phylogenetic diversity in the wake of extinctions and introductions across a sample of 32 islands worldwide. We found that extinct and introduced species have comparable functional and phylogenetic alpha diversity. However, this was distributed at different positions in functional space and in the phylogeny, indicating a 'false compensation'. Introduced and extinct species did not have equivalent functional roles nor belong to similar lineages. This makes it unlikely that novel island biotas composed of introduced taxa will be able to maintain ecological roles and represent the evolutionary histories of pre-disturbance assemblages and highlights the importance of evaluating changes in alpha and beta diversity concurrently. © 2016 John Wiley & Sons Ltd/CNRS.

  7. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  8. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  9. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  10. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  11. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  12. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... Phylogenetic characteristics play an important role for traceability and knowledge of ... amplification reaction was performed by PCR in a 25 μl reaction ...... Hierarchical grouping to optimize an objective function. J. Am. Statist.

  13. Phylogenetically Acquired Representations and Evolutionary Algorithms.

    OpenAIRE

    Wozniak , Adrianna

    2006-01-01

    First, we explain why Genetic Algorithms (GAs), inspired by the Modern Synthesis, do not accurately model biological evolution, being rather an artificial version of artificial, rather than natural selection. Being focused on optimisation, we propose two improvements of GAs, with the aim to successfully generate adapted, desired behaviour. The first one concerns phylogenetic grounding of meaning, a way to avoid the Symbol Grounding Problem. We give a definition of Phylogenetically Acquired Re...

  14. Constructing spherical panoramas of a bladder phantom from endoscopic video using bundle adjustment

    Science.gov (United States)

    Soper, Timothy D.; Chandler, John E.; Porter, Michael P.; Seibel, Eric J.

    2011-03-01

    The high recurrence rate of bladder cancer requires patients to undergo frequent surveillance screenings over their lifetime following initial diagnosis and resection. Our laboratory is developing panoramic stitching software that would compile several minutes of cystoscopic video into a single panoramic image, covering the entire bladder, for review by an urolgist at a later time or remote location. Global alignment of video frames is achieved by using a bundle adjuster that simultaneously recovers both the 3D structure of the bladder as well as the scope motion using only the video frames as input. The result of the algorithm is a complete 360° spherical panorama of the outer surface. The details of the software algorithms are presented here along with results from both a virtual cystoscopy as well from real endoscopic imaging of a bladder phantom. The software successfully stitched several hundred video frames into a single panoramic with subpixel accuracy and with no knowledge of the intrinsic camera properties, such as focal length and radial distortion. In the discussion, we outline future work in development of the software as well as identifying factors pertinent to clinical translation of this technology.

  15. Panorama normativo da inclusão de estudantes com deficiência no ensino superior

    Directory of Open Access Journals (Sweden)

    Ana Paula Barbosa-Fohrmann

    2012-12-01

    Full Text Available Este artigo irá analisar, tanto no direito interno quanto no direito internacional, a problemática dos portadores de deficiência e sua inclusão na rede de ensino, em particular no ensino superior. Primeiramente, será apresentado breve panorama histórico da evolução dos direitos dos portadores de deficiência. Em seguida, vai-se analisar como os tratados internacionais são incorporados no direito brasileiro, com base tanto na posição da doutrina quanto na jurisprudência. Em um terceiro momento, serão expostos alguns dos principais compromissos internacionais incorporados pelo Brasil, que versam direta ou indiretamente sobre a questão. Por último, vai-se examinar, então, como o sistema constitucional brasileiro aborda a matéria com suporte em algumas das medidas materiais previstas pelo Decreto 7.611 de 17 de novembro de 2011 que visam a assegurar a educação plena aos estudantes portadores de deficiência.

  16. 2002 survey - energy, petroleum, natural gas, automobile, environment; Panorama 2002 - energie, petrole, gaz naturel, automobile, environnement

    Energy Technology Data Exchange (ETDEWEB)

    Giannesini, J F [Institut Francais du Petrole (IFP), 92 - Rueil-Malmaison (France); Schweitzer, L; Fayolle, J P [Renault, 92 - Boulogne Billancourt (France); Nejat Veziroglu, T [Association Hydrogen Energy (Canada); Alleau, Th [Association Francaise de l' Hydogene, 75 - Paris (France); Gueguen, C [Totalfinaelf raffinerie de Feyzin, 69 - Lyon (France)

    2002-07-01

    The French institute of petroleum (IFP) has organized its seventh annual international 'Panorama' colloquium on the theme: fuels of the future. This document brings together the different invited talks given in Paris, Lyon and Brussels on this theme: a summary of 2001 highlights in the oil and gas industry given by J.F. Giannesini (IFP head's adviser), a prospective analysis of future automotive fuels with respect to fossil fuel reserves depletion and environmental policy constraints given by L. Schweitzer (president of Renault car making industry), a presentation of the hydrogen and synthetic fuel energy systems of the 21. century by T. Nejat Veziroglu (president of the international association for hydrogen energy), a presentation of the economical, environmental, technical and political aspects of hydrogen as a future energy vector by T. Alleau (president of the French association of hydrogen AFH2), the formulation of future automotive fuels as seen from the eye of the refinery engineer by C. Geguen (technical director of Feyzin refinery (TotalFinaElf)), and a last paper about the recent and future evolutions of diesel engines for industrial vehicles by J.P. Fayolle (director of engines R and D, Renault industrial vehicles). (J.S.)

  17. Urban Panorama Tourism Planning A View From River Tour Course In Post-Three Gorges Era

    Directory of Open Access Journals (Sweden)

    Wei Jia Tian

    2012-12-01

    Full Text Available The upstream cities of Yangtze River have been witnessing significant transforming since the beginning of the construction of the Three Gorges hydroelectric dam project. Chongqing Port Authority had its opportunity to alternate the river tourism strategy from being the upstream terminal of the golden route into creating a particular cruise course towards perceiving the panorama of continuous elevation of mountainous city, at the same time, promoting the renovation of the urban design so as to revival the typical mountain-river vista. This paper bases on the panoramic research of Chongqing peninsula; discusses the characteristic aspects of the three-dimension sightseeing of the mountainous city on the cruise route, which widely exists in the Three Gorges region as well. And this method is different from the two dimensional approach of skyline analysis which is more suitable for the topographic area. The achieved work can offer the tourism-related sectors a sustainable assistance to deal with “tourbanism” topics in the urban regeneration process in the Three Gorges regions.

  18. Panorama da Sustentabilidade na Fronteira Agrícola de Bioenergia na Amazônia

    Directory of Open Access Journals (Sweden)

    Wanja Janayna de Miranda Lameira

    2015-08-01

    Full Text Available Esta pesquisa apresenta um panorama da sustentabilidade em sete municípios paraenses, que fazem parte do polo de produção do dendê (Elaeis guineensis Jacq. na Amazônia oriental. Trata-se de uma área com aproximadamente 46.000 km² que apresenta diferentes padrões de usos da terra, considerada prioritária para a implementação da política nacional dos biocombustíveis por apresentar grandes extensões de terras em condições edafoclimáticas favoráveis. A pesquisa, utilizando o Barômetro da Sustentabilidade – BS, faz uma avaliação ex ante do nível de desenvolvimento dos municípios, analisando dados quantitativos e qualitativos de diferentes fontes a partir de 2010. Foram empregados dezesseis indicadores para o bem-estar humano (social e nove para o bem-estar ecológico (ambiental, ajustados à escala do Barômetro. Os resultados do BS mostraram que os municípios ocupam posições intermediárias e potencialmente insustentáveis, o que reflete a fragilidade socioeconômica e ambiental da região estudada.

  19. Panorama da fruticultura no Espírito Santo – Brasil

    Directory of Open Access Journals (Sweden)

    Thiago Marques Teixeira Silva

    2014-05-01

    Full Text Available Resumo: A fruticultura é um mercado que vem já há alguns anos com um grande potencial tanto nacional quanto capixaba. Diante da situação, este trabalho tem o objetivo de apresentar um panorama da fruticultura no Espírito Santo, posicionando-a no cenário nacional. A partir do estudo da produção científica e de informações sobre o assunto, foi elaborada uma revisão bibliográfica a respeito do desenvolvimento da fruticultura capixaba. O setor de fruticultura está entre os principais geradores de renda, emprego e de desenvolvimento rural do estado. Na fruticultura agroecológica, tem-se como futuro desejável a expansão e a diversificação da atividade no Espírito Santo, com qualidade e competitividade. Contudo, a plena realização do potencial produtivo e social da fruticultura depende de uma melhor organização do setor, da modernização da comercialização e de incentivos para a inovação tecnológica e agregação de valor.

  20. Bibliotecas universitarias y automatización: un panorama de la Ciudad de México

    Directory of Open Access Journals (Sweden)

    Oscar Arriola Navarrete

    2011-08-01

    Full Text Available Después de contextualizar la educación superior en México, se ofrece un panorama de las condiciones de automatización de las bibliotecas universitarias en su Área Metropolitana, especialmente en lo que tiene que ver con el Sistema Integral de Automatización de Bibliotecas (SIAB. Mediante la aplicación de un cuestionario y la observación directa, se da cuenta de los sistemas utilizados, los procesos de migración, el tiempo de uso, las formas de adquisición, los módulos implementados, el nivel de conocimiento y operación y el grado de satisfacción. Se encontró que la mayoría de las bibliotecas cuentan con un SIAB, y que los más utilizados eran SIABUC, ALEPH y LOGICAT. Sin embargo, se constató que su grado de implementación es bajo, principalmente por la falta de capacitación del personal a cargo. En muchos casos sólo se ha logrado una automatización muy limitada debido al precio del sistema y al alto costo del mantenimiento. Además, sólo una de las bibliotecas tenía instalado un software libre, lo que indica desconocimiento sobre este tipo de alternativas.

  1. 2002 survey - energy, petroleum, natural gas, automobile, environment; Panorama 2002 - energie, petrole, gaz naturel, automobile, environnement

    Energy Technology Data Exchange (ETDEWEB)

    Giannesini, J.F. [Institut Francais du Petrole (IFP), 92 - Rueil-Malmaison (France); Schweitzer, L.; Fayolle, J.P. [Renault, 92 - Boulogne Billancourt (France); Nejat Veziroglu, T. [Association Hydrogen Energy (Canada); Alleau, Th. [Association Francaise de l' Hydogene, 75 - Paris (France); Gueguen, C. [Totalfinaelf raffinerie de Feyzin, 69 - Lyon (France)

    2002-07-01

    The French institute of petroleum (IFP) has organized its seventh annual international 'Panorama' colloquium on the theme: fuels of the future. This document brings together the different invited talks given in Paris, Lyon and Brussels on this theme: a summary of 2001 highlights in the oil and gas industry given by J.F. Giannesini (IFP head's adviser), a prospective analysis of future automotive fuels with respect to fossil fuel reserves depletion and environmental policy constraints given by L. Schweitzer (president of Renault car making industry), a presentation of the hydrogen and synthetic fuel energy systems of the 21. century by T. Nejat Veziroglu (president of the international association for hydrogen energy), a presentation of the economical, environmental, technical and political aspects of hydrogen as a future energy vector by T. Alleau (president of the French association of hydrogen AFH2), the formulation of future automotive fuels as seen from the eye of the refinery engineer by C. Geguen (technical director of Feyzin refinery (TotalFinaElf)), and a last paper about the recent and future evolutions of diesel engines for industrial vehicles by J.P. Fayolle (director of engines R and D, Renault industrial vehicles). (J.S.)

  2. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  3. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  4. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  5. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  6. Diversity management

    OpenAIRE

    Knákalová, Lucie

    2009-01-01

    The key topic of the work is diversity management, i.e. management of em-ployees" diversity within organization. Opening part of the work identifies the position of diversity within society and related phenomena such as stereotypes, biases and various forms of discrimination. Then the work discusses the role of diversity management in organizations, its principles and basic areas of focus. Attention is paid to certain social groups that the diversity management concept should especially deal ...

  7. A phylogenetic perspective on the evolution of Mediterranean teleost fishes.

    Directory of Open Access Journals (Sweden)

    Christine N Meynard

    Full Text Available The Mediterranean Sea is a highly diverse, highly studied, and highly impacted biogeographic region, yet no phylogenetic reconstruction of fish diversity in this area has been published to date. Here, we infer the timing and geographic origins of Mediterranean teleost species diversity using nucleotide sequences collected from GenBank. We assembled a DNA supermatrix composed of four mitochondrial genes (12S ribosomal DNA, 16S ribosomal DNA, cytochrome c oxidase subunit I and cytochrome b and two nuclear genes (rhodopsin and recombination activating gene I, including 62% of Mediterranean teleost species plus 9 outgroups. Maximum likelihood and Bayesian phylogenetic and dating analyses were calibrated using 20 fossil constraints. An additional 124 species were grafted onto the chronogram according to their taxonomic affinity, checking for the effects of taxonomic coverage in subsequent diversification analyses. We then interpreted the time-line of teleost diversification in light of Mediterranean historical biogeography, distinguishing non-endemic natives, endemics and exotic species. Results show that the major Mediterranean orders are of Cretaceous origin, specifically ~100-80 Mya, and most Perciformes families originated 80-50 Mya. Two important clade origin events were detected. The first at 100-80 Mya, affected native and exotic species, and reflects a global diversification period at a time when the Mediterranean Sea did not yet exist. The second occurred during the last 50 Mya, and is noticeable among endemic and native species, but not among exotic species. This period corresponds to isolation of the Mediterranean from Indo-Pacific waters before the Messinian salinity crisis. The Mediterranean fish fauna illustrates well the assembly of regional faunas through origination and immigration, where dispersal and isolation have shaped the emergence of a biodiversity hotspot.

  8. Ecological and phylogenetic variability in the spinalis muscle of snakes.

    Science.gov (United States)

    Tingle, J L; Gartner, G E A; Jayne, B C; Garland, T

    2017-11-01

    Understanding the origin and maintenance of functionally important subordinate traits is a major goal of evolutionary physiologists and ecomorphologists. Within the confines of a limbless body plan, snakes are diverse in terms of body size and ecology, but we know little about the functional traits that underlie this diversity. We used a phylogenetically diverse group of 131 snake species to examine associations between habitat use, sidewinding locomotion and constriction behaviour with the number of body vertebrae spanned by a single segment of the spinalis muscle, with total numbers of body vertebrae used as a covariate in statistical analyses. We compared models with combinations of these predictors to determine which best fit the data among all species and for the advanced snakes only (N = 114). We used both ordinary least-squares models and phylogenetic models in which the residuals were modelled as evolving by the Ornstein-Uhlenbeck process. Snakes with greater numbers of vertebrae tended to have spinalis muscles that spanned more vertebrae. Habitat effects dominated models for analyses of all species and advanced snakes only, with the spinalis length spanning more vertebrae in arboreal species and fewer vertebrae in aquatic and burrowing species. Sidewinding specialists had shorter muscle lengths than nonspecialists. The relationship between prey constriction and spinalis length was less clear. Differences among clades were also strong when considering all species, but not for advanced snakes alone. Overall, these results suggest that muscle morphology may have played a key role in the adaptive radiation of snakes. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  9. Diversity of total and functional microbiome of anammox reactors fed with complex and synthetic nitrogen-rich wastewaters

    DEFF Research Database (Denmark)

    Gülay, Arda; Pellicer i Nàcher, Carles; Mutlu, Ayten Gizem

    diversity than the bioreactors treating synthetic wastewaters inferred from observed OTUs0.03, Chao1, Shannon index and Phylogenetic distance calculations. Differences in total microbial diversity agreed with the ecological theory concerning the positive correlation between substrate complexity...

  10. Determinants of plant community assembly in a mosaic of landscape units in central Amazonia: ecological and phylogenetic perspectives.

    Directory of Open Access Journals (Sweden)

    María Natalia Umaña

    Full Text Available The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace and flooded forests (Igapó. We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties.

  11. Determinants of Plant Community Assembly in a Mosaic of Landscape Units in Central Amazonia: Ecological and Phylogenetic Perspectives

    Science.gov (United States)

    Umaña, María Natalia; Norden, Natalia; Cano, Ángela; Stevenson, Pablo R.

    2012-01-01

    The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace) and flooded forests (Igapó). We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties. PMID:23028844

  12. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  13. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  14. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  15. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  16. Phylogenetic turnover during subtropical forest succession acr