WorldWideScience

Sample records for palindromic genomic duplication

  1. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Science.gov (United States)

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  2. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  3. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    Science.gov (United States)

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  4. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  5. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  6. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  7. [Progress of genome engineering technology via clustered regularly interspaced short palindromic repeats--a review].

    Science.gov (United States)

    Li, Hao; Qiu, Shaofu; Song, Hongbin

    2013-10-04

    In survival competition with phage, bacteria and archaea gradually evolved the acquired immune system--Clustered regularly interspaced short palindromic repeats (CRISPR), presenting the trait of transcribing the crRNA and the CRISPR-associated protein (Cas) to silence or cleaving the foreign double-stranded DNA specifically. In recent years, strong interest arises in prokaryotes primitive immune system and many in-depth researches are going on. Recently, researchers successfully repurposed CRISPR as an RNA-guided platform for sequence-specific gene expression, which provides a simple approach for selectively perturbing gene expression on a genome-wide scale. It will undoubtedly bring genome engineering into a more convenient and accurate new era.

  8. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  9. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  10. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  11. [Comparative analysis of clustered regularly interspaced short palindromic repeats (CRISPRs) loci in the genomes of halophilic archaea].

    Science.gov (United States)

    Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian

    2009-11-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.

  12. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  13. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  14. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  15. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  17. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  18. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  19. Detection and analysis of ancient segmental duplications in mammalian genomes.

    Science.gov (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A

    2018-05-07

    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Optimal packaging of FIV genomic RNA depends upon a conserved long-range interaction and a palindromic sequence within gag.

    Science.gov (United States)

    Rizvi, Tahir A; Kenyon, Julia C; Ali, Jahabar; Aktar, Suriya J; Phillip, Pretty S; Ghazawi, Akela; Mustafa, Farah; Lever, Andrew M L

    2010-10-15

    The feline immunodeficiency virus (FIV) is a lentivirus that is related to human immunodeficiency virus (HIV), causing a similar pathology in cats. It is a potential small animal model for AIDS and the FIV-based vectors are also being pursued for human gene therapy. Previous studies have mapped the FIV packaging signal (ψ) to two or more discontinuous regions within the 5' 511 nt of the genomic RNA and structural analyses have determined its secondary structure. The 5' and 3' sequences within ψ region interact through extensive long-range interactions (LRIs), including a conserved heptanucleotide interaction between R/U5 and gag. Other secondary structural elements identified include a conserved 150 nt stem-loop (SL2) and a small palindromic stem-loop within gag open reading frame that might act as a viral dimerization initiation site. We have performed extensive mutational analysis of these sequences and structures and ascertained their importance in FIV packaging using a trans-complementation assay. Disrupting the conserved heptanucleotide LRI to prevent base pairing between R/U5 and gag reduced packaging by 2.8-5.5 fold. Restoration of pairing using an alternative, non-wild type (wt) LRI sequence restored RNA packaging and propagation to wt levels, suggesting that it is the structure of the LRI, rather than its sequence, that is important for FIV packaging. Disrupting the palindrome within gag reduced packaging by 1.5-3-fold, but substitution with a different palindromic sequence did not restore packaging completely, suggesting that the sequence of this region as well as its palindromic nature is important. Mutation of individual regions of SL2 did not have a pronounced effect on FIV packaging, suggesting that either it is the structure of SL2 as a whole that is necessary for optimal packaging, or that there is redundancy within this structure. The mutational analysis presented here has further validated the previously predicted RNA secondary structure of FIV

  1. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  2. Detection and correction of false segmental duplications caused by genome mis-assembly

    Science.gov (United States)

    2010-01-01

    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  3. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  4. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  5. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  6. Large palindromes in the lambda phage genome are preserved in a rec/sup +/ host by inhibiting lambda DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Shurvinton, C.E.; Stahl, M.M.; Stahl, F.W.

    1987-03-01

    A large palindrome carried by phage lambda has been shown to prevent growth of the phage on a rec/sup +/ strain of Escherichia coli. The phage do form plaques on recBC sbcB strains, but the palindrome is not stable - deletions that either destroy the palindrome or diminish its size overgrow the original engineered palindrome-containing phage. The authors have prepared stocks of lambda carrying a palindrome that is 2 x 4200 base pairs long. lambda phage were density labeled by UV induction of lysogens grown in minimal medium containing (/sup 13/C) glucose and /sup 15/NH/sub 4/Cl. These phage stocks are produced by induction of a lysogen in which the two halves of the palindrome are stored at opposite ends of the prophage and are of sufficient titer (10/sup 9/ phage per ml) to enable one-step growth experiments with replication-blocked phage. They find that the large palindrome as well as a lesser palindrome of 2 x 265 base pairs are recovered intact among particles carrying unreplicated chromosomes following such an infection of a rec/sup +/ host. they propose that DNA replication drives the extrusion of palindromic sequences in vivo, forming secondary structures that are substrates for the recBC and sbcB gene products.

  7. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  8. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.

    Science.gov (United States)

    Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E

    2006-09-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.

  9. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  10. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  11. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  12. Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Fadista, João; Bendixen, Christian

    Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...

  13. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  14. Mre11-Sae2 and RPA Collaborate to Prevent Palindromic Gene Amplification.

    Science.gov (United States)

    Deng, Sarah K; Yin, Yi; Petes, Thomas D; Symington, Lorraine S

    2015-11-05

    Foldback priming at DNA double-stranded breaks is one mechanism proposed to initiate palindromic gene amplification, a common feature of cancer cells. Here, we show that small (5-9 bp) inverted repeats drive the formation of large palindromic duplications, the major class of chromosomal rearrangements recovered from yeast cells lacking Sae2 or the Mre11 nuclease. RPA dysfunction increased the frequency of palindromic duplications in Sae2 or Mre11 nuclease-deficient cells by ∼ 1,000-fold, consistent with intra-strand annealing to create a hairpin-capped chromosome that is subsequently replicated to form a dicentric isochromosome. The palindromic duplications were frequently associated with duplication of a second chromosome region bounded by a repeated sequence and a telomere, suggesting the dicentric chromosome breaks and repairs by recombination between dispersed repeats to acquire a telomere. We propose secondary structures within single-stranded DNA are potent instigators of genome instability, and RPA and Mre11-Sae2 play important roles in preventing their formation and propagation, respectively. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.

    Science.gov (United States)

    McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael

    2014-08-01

    Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.

  16. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  18. Whole genome duplication of intra- and inter-chromosomes in the tomato genome.

    Science.gov (United States)

    Song, Chi; Guo, Juan; Sun, Wei; Wang, Ying

    2012-07-20

    Whole genome duplication (WGD) events have been proven to occur in the evolutionary history of most angiosperms. Tomato is considered a model species of the Solanaceae family. In this study, we describe the details of the evolutionary process of the tomato genome by detecting collinearity blocks and dating the WGD events on the tree of life by combining two different methods: synonymous substitution rates (Ks) and phylogenetic trees. In total, 593 collinearity blocks were discovered out of 12 pseudo-chromosomes constructed. It was evident that chromosome 2 had experienced an intra-chromosomal duplication event. Major inter-chromosomal duplication occurred among all the pseudo-chromosome. We calculated the Ks value of these collinearity blocks. Two peaks of Ks distribution were found, corresponding to two WGD events occurring approximately 36-82 million years ago (MYA) and 148-205 MYA. Additionally, the results of phylogenetic trees suggested that the more recent WGD event may have occurred after the divergence of the rosid-asterid clade, but before the major diversification in Solanaceae. The older WGD event was shown to have occurred before the divergence of the rosid-asterid clade and after the divergence of rice-Arabidopsis (monocot-dicot). Copyright © 2012. Published by Elsevier Ltd.

  19. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  20. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  1. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2011-02-01

    Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.

  2. Two Rounds of Whole Genome Duplication in the AncestralVertebrate

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir; Boore, Jeffrey L.

    2005-04-12

    The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

  3. Decoding Synteny Blocks and Large-Scale Duplications in Mammalian and Plant Genomes

    Science.gov (United States)

    Peng, Qian; Alekseyev, Max A.; Tesler, Glenn; Pevzner, Pavel A.

    The existing synteny block reconstruction algorithms use anchors (e.g., orthologous genes) shared over all genomes to construct the synteny blocks for multiple genomes. This approach, while efficient for a few genomes, cannot be scaled to address the need to construct synteny blocks in many mammalian genomes that are currently being sequenced. The problem is that the number of anchors shared among all genomes quickly decreases with the increase in the number of genomes. Another problem is that many genomes (plant genomes in particular) had extensive duplications, which makes decoding of genomic architecture and rearrangement analysis in plants difficult. The existing synteny block generation algorithms in plants do not address the issue of generating non-overlapping synteny blocks suitable for analyzing rearrangements and evolution history of duplications. We present a new algorithm based on the A-Bruijn graph framework that overcomes these difficulties and provides a unified approach to synteny block reconstruction for multiple genomes, and for genomes with large duplications.

  4. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  5. The sea lamprey meiotic map improves resolution of ancient vertebrate genome duplications.

    Science.gov (United States)

    Smith, Jeramiah J; Keinath, Melissa C

    2015-08-01

    It is generally accepted that many genes present in vertebrate genomes owe their origin to two whole-genome duplications that occurred deep in the ancestry of the vertebrate lineage. However, details regarding the timing and outcome of these duplications are not well resolved. We present high-density meiotic and comparative genomic maps for the sea lamprey (Petromyzon marinus), a representative of an ancient lineage that diverged from all other vertebrates ∼550 million years ago. Linkage analyses yielded a total of 95 linkage groups, similar to the estimated number of germline chromosomes (1n ∼ 99), spanning a total of 5570.25 cM. Comparative mapping data yield strong support for the hypothesis that a single whole-genome duplication occurred in the basal vertebrate lineage, but do not strongly support a hypothetical second event. Rather, these comparative maps reveal several evolutionarily independent segmental duplications occurring over the last 600+ million years of chordate evolution. This refined history of vertebrate genome duplication should permit more precise investigations of vertebrate evolution. © 2015 Smith and Keinath; Published by Cold Spring Harbor Laboratory Press.

  6. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  7. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  8. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  9. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Science.gov (United States)

    Cuypers, Thomas D; Hogeweg, Paulien

    2014-04-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  10. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  11. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  12. Sorting duplicated loci disentangles complexities of polyploid genomes masked by genotyping by sequencing

    DEFF Research Database (Denmark)

    Limborg, Morten; Seeb, Lisa W.; Seeb, J. E.

    2016-01-01

    Many plants and animals of polyploid origin are currently enjoying a genomics explosion enabled by modern sequencing and genotyping technologies. However, routine filtering of duplicated loci in most studies using genotyping by sequencing introduces an unacceptable, but often overlooked, bias when...... particularly stress the sometimes overlooked fact that basing genomic studies on dense maps provides value added in the form of locating and annotating outlier loci or colocating outliers into islands of divergenc...

  13. Development of genome- and transcriptome-derived microsatellites in related species of snapping shrimps with highly duplicated genomes.

    Science.gov (United States)

    Gaynor, Kaitlyn M; Solomon, Joseph W; Siller, Stefanie; Jessell, Linnet; Duffy, J Emmett; Rubenstein, Dustin R

    2017-11-01

    Molecular markers are powerful tools for studying patterns of relatedness and parentage within populations and for making inferences about social evolution. However, the development of molecular markers for simultaneous study of multiple species presents challenges, particularly when species exhibit genome duplication or polyploidy. We developed microsatellite markers for Synalpheus shrimp, a genus in which species exhibit not only great variation in social organization, but also interspecific variation in genome size and partial genome duplication. From the four primary clades within Synalpheus, we identified microsatellites in the genomes of four species and in the consensus transcriptome of two species. Ultimately, we designed and tested primers for 143 microsatellite markers across 25 species. Although the majority of markers were disomic, many markers were polysomic for certain species. Surprisingly, we found no relationship between genome size and the number of polysomic markers. As expected, markers developed for a given species amplified better for closely related species than for more distant relatives. Finally, the markers developed from the transcriptome were more likely to work successfully and to be disomic than those developed from the genome, suggesting that consensus transcriptomes are likely to be conserved across species. Our findings suggest that the transcriptome, particularly consensus sequences from multiple species, can be a valuable source of molecular markers for taxa with complex, duplicated genomes. © 2017 John Wiley & Sons Ltd.

  14. Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

    Science.gov (United States)

    Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

    2014-01-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

  15. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

    2014-08-01

    The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Whole genome duplication affects evolvability of flowering time in an autotetraploid plant.

    Directory of Open Access Journals (Sweden)

    Sara L Martin

    Full Text Available Whole genome duplications have occurred recurrently throughout the evolutionary history of eukaryotes. The resulting genetic and phenotypic changes can influence physiological and ecological responses to the environment; however, the impact of genome copy number on evolvability has rarely been examined experimentally. Here, we evaluate the effect of genome duplication on the ability to respond to selection for early flowering time in lines drawn from naturally occurring diploid and autotetraploid populations of the plant Chamerion angustifolium (fireweed. We contrast this with the result of four generations of selection on synthesized neoautotetraploids, whose genic variability is similar to diploids but genome copy number is similar to autotetraploids. In addition, we examine correlated responses to selection in all three groups. Diploid and both extant tetraploid and neoautotetraploid lines responded to selection with significant reductions in time to flowering. Evolvability, measured as realized heritability, was significantly lower in extant tetraploids (^b(T =  0.31 than diploids (^b(T =  0.40. Neotetraploids exhibited the highest evolutionary response (^b(T  =  0.55. The rapid shift in flowering time in neotetraploids was associated with an increase in phenotypic variability across generations, but not with change in genome size or phenotypic correlations among traits. Our results suggest that whole genome duplications, without hybridization, may initially alter evolutionary rate, and that the dynamic nature of neoautopolyploids may contribute to the prevalence of polyploidy throughout eukaryotes.

  17. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  18. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  19. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Directory of Open Access Journals (Sweden)

    Thomas D Cuypers

    2014-04-01

    Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  20. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  1. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  2. Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio)

    Science.gov (United States)

    2012-01-01

    Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

  3. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  4. Genome specific PPARαB duplicates in salmonids and insights into estrogenic regulation in brown trout.

    Science.gov (United States)

    Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph

    2017-06-01

    Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  6. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere

    2008-09-01

    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  7. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  8. Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Guo

    Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

  9. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  10. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  11. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Directory of Open Access Journals (Sweden)

    Michael J Considine

    Full Text Available Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised

  12. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Science.gov (United States)

    Considine, Michael J; Wan, Yizhen; D'Antuono, Mario F; Zhou, Qian; Han, Mingyu; Gao, Hua; Wang, Man

    2012-01-01

    Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised. Impacts of

  13. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  14. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  15. Inference of the ancestral vertebrate phenotype through vestiges of the whole-genome duplications.

    Science.gov (United States)

    Onimaru, Koh; Kuraku, Shigehiro

    2018-03-16

    Inferring the phenotype of the last common ancestor of living vertebrates is a challenging problem because of several unresolvable factors. They include the lack of reliable out-groups of living vertebrates, poor information about less fossilizable organs and specialized traits of phylogenetically important species, such as lampreys and hagfishes (e.g. secondary loss of vertebrae in adult hagfishes). These factors undermine the reliability of ancestral reconstruction by traditional character mapping approaches based on maximum parsimony. In this article, we formulate an approach to hypothesizing ancestral vertebrate phenotypes using information from the phylogenetic and functional properties of genes duplicated by genome expansions in early vertebrate evolution. We named the conjecture as 'chronological reconstruction of ohnolog functions (CHROF)'. This CHROF conjecture raises the possibility that the last common ancestor of living vertebrates may have had more complex traits than currently thought.

  16. Genetic diversity and population structure inferred from the partially duplicated genome of domesticated carp, Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Feldman Marcus W

    2007-04-01

    Full Text Available Abstract Genetic relationships among eight populations of domesticated carp (Cyprinus carpio L., a species with a partially duplicated genome, were studied using 12 microsatellites and 505 AFLP bands. The populations included three aquacultured carp strains and five ornamental carp (koi variants. Grass carp (Ctenopharyngodon idella was used as an outgroup. AFLP-based gene diversity varied from 5% (grass carp to 32% (koi and reflected the reasonably well understood histories and breeding practices of the populations. A large fraction of the molecular variance was due to differences between aquacultured and ornamental carps. Further analyses based on microsatellite data, including cluster analysis and neighbor-joining trees, supported the genetic distinctiveness of aquacultured and ornamental carps, despite the recent divergence of the two groups. In contrast to what was observed for AFLP-based diversity, the frequency of heterozygotes based on microsatellites was comparable among all populations. This discrepancy can potentially be explained by duplication of some loci in Cyprinus carpio L., and a model that shows how duplication can increase heterozygosity estimates for microsatellites but not for AFLP loci is discussed. Our analyses in carp can help in understanding the consequences of genotyping duplicated loci and in interpreting discrepancies between dominant and co-dominant markers in species with recent genome duplication.

  17. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  18. Nested radiations and the pulse of angiosperm diversification: increased diversification rates often follow whole genome duplications.

    Science.gov (United States)

    Tank, David C; Eastman, Jonathan M; Pennell, Matthew W; Soltis, Pamela S; Soltis, Douglas E; Hinchliff, Cody E; Brown, Joseph W; Sessa, Emily B; Harmon, Luke J

    2015-07-01

    Our growing understanding of the plant tree of life provides a novel opportunity to uncover the major drivers of angiosperm diversity. Using a time-calibrated phylogeny, we characterized hot and cold spots of lineage diversification across the angiosperm tree of life by modeling evolutionary diversification using stepwise AIC (MEDUSA). We also tested the whole-genome duplication (WGD) radiation lag-time model, which postulates that increases in diversification tend to lag behind established WGD events. Diversification rates have been incredibly heterogeneous throughout the evolutionary history of angiosperms and reveal a pattern of 'nested radiations' - increases in net diversification nested within other radiations. This pattern in turn generates a negative relationship between clade age and diversity across both families and orders. We suggest that stochastically changing diversification rates across the phylogeny explain these patterns. Finally, we demonstrate significant statistical support for the WGD radiation lag-time model. Across angiosperms, nested shifts in diversification led to an overall increasing rate of net diversification and declining relative extinction rates through time. These diversification shifts are only rarely perfectly associated with WGD events, but commonly follow them after a lag period. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  19. Impact of whole-genome duplication events on diversification rates in angiosperms.

    Science.gov (United States)

    Landis, Jacob B; Soltis, Douglas E; Li, Zheng; Marx, Hannah E; Barker, Michael S; Tank, David C; Soltis, Pamela S

    2018-03-01

    Polyploidy or whole-genome duplication (WGD) pervades the evolutionary history of angiosperms. Despite extensive progress in our understanding of WGD, the role of these events in promoting diversification is still not well understood. We seek to clarify the possible association between WGD and diversification rates in flowering plants. Using a previously published phylogeny spanning all land plants (31,749 tips) and WGD events inferred from analyses of the 1000 Plants (1KP) transcriptome data, we analyzed the association of WGDs and diversification rates following numerous WGD events across the angiosperms. We used a stepwise AIC approach (MEDUSA), a Bayesian mixture model approach (BAMM), and state-dependent diversification analyses (MuSSE) to investigate patterns of diversification. Sister-clade comparisons were used to investigate species richness after WGDs. Based on the density of 1KP taxon sampling, 106 WGDs were unambiguously placed on the angiosperm phylogeny. We identified 334-530 shifts in diversification rates. We found that 61 WGD events were tightly linked to changes in diversification rates, and state-dependent diversification analyses indicated higher speciation rates for subsequent rounds of WGD. Additionally, 70 of 99 WGD events showed an increase in species richness compared to the sister clade. Forty-six of the 106 WGDs analyzed appear to be closely associated with upshifts in the rate of diversification in angiosperms. Shifts in diversification do not appear more likely than random within a four-node lag phase following a WGD; however, younger WGD events are more likely to be followed by an upshift in diversification than older WGD events. © 2018 Botanical Society of America.

  20. Array comparative genomic hybridization analysis of a familial duplication of chromosome 13q: A recognizable syndrome

    NARCIS (Netherlands)

    Mathijssen, Inge B.; Hoovers, Jan M. N.; Mul, Adri N. P. M.; Man, Hai-Yen; Ket, Jan L.; Hennekam, Raoul C. M.

    2005-01-01

    We report on a family with six persons in three generations who have mild mental retardation, behavioral problems, seizures, hearing loss, strabismus, dental anomalies, hypermobility, juvenile hallux valgus, and mild dysmorphic features. Classical cytogenetic analysis showed a partial duplication of

  1. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  2. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  3. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  4. Array comparative genomic hybridisation analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical region at Xq27 containing SOX3.

    NARCIS (Netherlands)

    Solomon, N.M.; Ross, S.; Morgan, T.; Belsky, J.L.; Hol, F.A.; Karnes, P.; Hopwood, N.J.; Myers, S.E.; Tan, A.; Warne, G.L.; Forrest, S.M.; Thomas, P.Q.

    2004-01-01

    INTRODUCTION: Array comparative genomic hybridisation (array CGH) is a powerful method that detects alteration of gene copy number with greater resolution and efficiency than traditional methods. However, its ability to detect disease causing duplications in constitutional genomic DNA has not been

  5. De novo assembly of the zucchini genome reveals a whole-genome duplication associated with the origin of the Cucurbita genus.

    Science.gov (United States)

    Montero-Pau, Javier; Blanca, José; Bombarely, Aureliano; Ziarsolo, Peio; Esteras, Cristina; Martí-Gómez, Carlos; Ferriol, María; Gómez, Pedro; Jamilena, Manuel; Mueller, Lukas; Picó, Belén; Cañizares, Joaquín

    2017-11-07

    The Cucurbita genus (squashes, pumpkins and gourds) includes important domesticated species such as C. pepo, C. maxima and C. moschata. In this study, we present a high-quality draft of the zucchini (C. pepo) genome. The assembly has a size of 263 Mb, a scaffold N50 of 1.8 Mb and 34 240 gene models. It includes 92% of the conserved BUSCO core gene set, and it is estimated to cover 93.0% of the genome. The genome is organized in 20 pseudomolecules that represent 81.4% of the assembly, and it is integrated with a genetic map of 7718 SNPs. Despite the small genome size, three independent lines of evidence support that the C. pepo genome is the result of a whole-genome duplication: the topology of the gene family phylogenies, the karyotype organization and the distribution of 4DTv distances. Additionally, 40 transcriptomes of 12 species of the genus were assembled and analysed together with all the other published genomes of the Cucurbitaceae family. The duplication was detected in all the Cucurbita species analysed, including C. maxima and C. moschata, but not in the more distant cucurbits belonging to the Cucumis and Citrullus genera, and it is likely to have occurred 30 ± 4 Mya in the ancestral species that gave rise to the genus. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  7. Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius

    International Nuclear Information System (INIS)

    Brykov, V.A.; Kukhlevskii, A.D.

    1986-01-01

    The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10 7 nucleotide pairs, and the number of palindromes per haploid genome ∼ 500,000

  8. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

    Science.gov (United States)

    Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

    2013-11-02

    Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

  9. Genome duplication and mutations in ACE2 cause multicellular, fast-sedimenting phenotypes in evolved Saccharomyces cerevisiae.

    Science.gov (United States)

    Oud, Bart; Guadalupe-Medina, Victor; Nijkamp, Jurgen F; de Ridder, Dick; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc

    2013-11-05

    Laboratory evolution of the yeast Saccharomyces cerevisiae in bioreactor batch cultures yielded variants that grow as multicellular, fast-sedimenting clusters. Knowledge of the molecular basis of this phenomenon may contribute to the understanding of natural evolution of multicellularity and to manipulating cell sedimentation in laboratory and industrial applications of S. cerevisiae. Multicellular, fast-sedimenting lineages obtained from a haploid S. cerevisiae strain in two independent evolution experiments were analyzed by whole genome resequencing. The two evolved cell lines showed different frameshift mutations in a stretch of eight adenosines in ACE2, which encodes a transcriptional regulator involved in cell cycle control and mother-daughter cell separation. Introduction of the two ace2 mutant alleles into the haploid parental strain led to slow-sedimenting cell clusters that consisted of just a few cells, thus representing only a partial reconstruction of the evolved phenotype. In addition to single-nucleotide mutations, a whole-genome duplication event had occurred in both evolved multicellular strains. Construction of a diploid reference strain with two mutant ace2 alleles led to complete reconstruction of the multicellular-fast sedimenting phenotype. This study shows that whole-genome duplication and a frameshift mutation in ACE2 are sufficient to generate a fast-sedimenting, multicellular phenotype in S. cerevisiae. The nature of the ace2 mutations and their occurrence in two independent evolution experiments encompassing fewer than 500 generations of selective growth suggest that switching between unicellular and multicellular phenotypes may be relevant for competitiveness of S. cerevisiae in natural environments.

  10. Comparative genomic analysis of the MHC: the evolution of class I duplication blocks, diversity and complexity from shark to man.

    Science.gov (United States)

    Kulski, Jerzy K; Shiina, Takashi; Anzai, Tatsuya; Kohara, Sakae; Inoko, Hidetoshi

    2002-12-01

    The major histocompatibility complex (MHC) genomic region is composed of a group of linked genes involved functionally with the adaptive and innate immune systems. The class I and class II genes are intrinsic features of the MHC and have been found in all the jawed vertebrates studied so far. The MHC genomic regions of the human and the chicken (B locus) have been fully sequenced and mapped, and the mouse MHC sequence is almost finished. Information on the MHC genomic structures (size, complexity, genic and intergenic composition and organization, gene order and number) of other vertebrates is largely limited or nonexistent. Therefore, we are mapping, sequencing and analyzing the MHC genomic regions of different human haplotypes and at least eight nonhuman species. Here, we review our progress with these sequences and compare the human MHC structure with that of the nonhuman primates (chimpanzee and rhesus macaque), other mammals (pigs, mice and rats) and nonmammalian vertebrates such as birds (chicken and quail), bony fish (medaka, pufferfish and zebrafish) and cartilaginous fish (nurse shark). This comparison reveals a complex MHC structure for mammals and a relatively simpler design for nonmammalian animals with a hypothetical prototypic structure for the shark. In the mammalian MHC, there are two to five different class I duplication blocks embedded within a framework of conserved nonclass I and/or nonclass II genes. With a few exceptions, the class I framework genes are absent from the MHC of birds, bony fish and sharks. Comparative genomics of the MHC reveal a highly plastic region with major structural differences between the mammalian and nonmammalian vertebrates. Additional genomic data are needed on animals of the reptilia, crocodilia and marsupial classes to find the origins of the class I framework genes and examples of structures that may be intermediate between the simple and complex MHC organizations of birds and mammals, respectively.

  11. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  12. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  13. Yeast "make-accumulate-consume" life strategy evolved as a multi-step process that predates the whole genome duplication.

    Science.gov (United States)

    Hagman, Arne; Säll, Torbjörn; Compagno, Concetta; Piskur, Jure

    2013-01-01

    When fruits ripen, microbial communities start a fierce competition for the freely available fruit sugars. Three yeast lineages, including baker's yeast Saccharomyces cerevisiae, have independently developed the metabolic activity to convert simple sugars into ethanol even under fully aerobic conditions. This fermentation capacity, named Crabtree effect, reduces the cell-biomass production but provides in nature a tool to out-compete other microorganisms. Here, we analyzed over forty Saccharomycetaceae yeasts, covering over 200 million years of the evolutionary history, for their carbon metabolism. The experiments were done under strictly controlled and uniform conditions, which has not been done before. We show that the origin of Crabtree effect in Saccharomycetaceae predates the whole genome duplication and became a settled metabolic trait after the split of the S. cerevisiae and Kluyveromyces lineages, and coincided with the origin of modern fruit bearing plants. Our results suggest that ethanol fermentation evolved progressively, involving several successive molecular events that have gradually remodeled the yeast carbon metabolism. While some of the final evolutionary events, like gene duplications of glucose transporters and glycolytic enzymes, have been deduced, the earliest molecular events initiating Crabtree effect are still to be determined.

  14. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  15. Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

    Science.gov (United States)

    Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

    2018-01-15

    Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula)

    Czech Academy of Sciences Publication Activity Database

    Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr

    2017-01-01

    Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016

  17. A SNP Based Linkage Map of the Arctic Charr (Salvelinus alpinus Genome Provides Insights into the Diploidization Process After Whole Genome Duplication

    Directory of Open Access Journals (Sweden)

    Cameron M. Nugent

    2017-02-01

    Full Text Available Diploidization, which follows whole genome duplication events, does not occur evenly across the genome. In salmonid fishes, certain pairs of homeologous chromosomes preserve tetraploid loci in higher frequencies toward the telomeres due to residual tetrasomic inheritance. Research suggests this occurs only in homeologous pairs where one chromosome arm has undergone a fusion event. We present a linkage map for Arctic charr (Salvelinus alpinus, a salmonid species with relatively fewer chromosome fusions. Genotype by sequencing identified 19,418 SNPs, and a linkage map consisting of 4508 markers was constructed from a subset of high quality SNPs and microsatellite markers that were used to anchor the new map to previous versions. Both male- and female-specific linkage maps contained the expected number of 39 linkage groups. The chromosome type associated with each linkage group was determined, and 10 stable metacentric chromosomes were identified, along with a chromosome polymorphism involving the sex chromosome AC04. Two instances of a weak form of pseudolinkage were detected in the telomeric regions of homeologous chromosome arms in both female and male linkage maps. Chromosome arm homologies within the Atlantic salmon (Salmo salar and rainbow trout (Oncorhynchus mykiss genomes were determined. Paralogous sequence variants (PSVs were identified, and their comparative BLASTn hit locations showed that duplicate markers exist in higher numbers on seven pairs of homeologous arms, previously identified as preserving tetrasomy in salmonid species. Homeologous arm pairs where neither arm has been part of a fusion event in Arctic charr had fewer PSVs, suggesting faster diploidization rates in these regions.

  18. Genome-wide analysis of SSR and ILP markers in trees: diversity profiling, alternate distribution, and applications in duplication.

    Science.gov (United States)

    Xia, Xinyao; Luan, Lin Lin; Qin, Guanghua; Yu, Li Fang; Wang, Zhi Wei; Dong, Wan Chen; Song, Yumin; Qiao, Yuling; Zhang, Xian Sheng; Sang, Ya Lin; Yang, Long

    2017-12-20

    Molecular markers are efficient tools for breeding and genetic studies. However, despite their ecological and economic importance, their development and application have long been hampered. In this study, we identified 524,170 simple sequence repeat (SSR), 267,636 intron length polymorphism (ILP), and 11,872 potential intron polymorphism (PIP) markers from 16 tree species based on recently available genome sequences. Larger motifs, including hexamers and heptamers, accounted for most of the seven different types of SSR loci. Within these loci, A/T bases comprised a significantly larger proportion of sequence than G/C. SSR and ILP markers exhibited an alternative distribution pattern. Most SSRs were monomorphic markers, and the proportions of polymorphic markers were positively correlated with genome size. By verifying with all 16 tree species, 54 SSR, 418 ILP, and four PIP universal markers were obtained, and their efficiency was examined by PCR. A combination of five SSR and six ILP markers were used for the phylogenetic analysis of 30 willow samples, revealing a positive correlation between genetic diversity and geographic distance. We also found that SSRs can be used as tools for duplication analysis. Our findings provide important foundations for the development of breeding and genetic studies in tree species.

  19. A Genome-wide CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Screen Identifies NEK7 as an Essential Component of NLRP3 Inflammasome Activation.

    Science.gov (United States)

    Schmid-Burgk, Jonathan L; Chauhan, Dhruv; Schmidt, Tobias; Ebert, Thomas S; Reinhardt, Julia; Endl, Elmar; Hornung, Veit

    2016-01-01

    Inflammasomes are high molecular weight protein complexes that assemble in the cytosol upon pathogen encounter. This results in caspase-1-dependent pro-inflammatory cytokine maturation, as well as a special type of cell death, known as pyroptosis. The Nlrp3 inflammasome plays a pivotal role in pathogen defense, but at the same time, its activity has also been implicated in many common sterile inflammatory conditions. To this effect, several studies have identified Nlrp3 inflammasome engagement in a number of common human diseases such as atherosclerosis, type 2 diabetes, Alzheimer disease, or gout. Although it has been shown that known Nlrp3 stimuli converge on potassium ion efflux upstream of Nlrp3 activation, the exact molecular mechanism of Nlrp3 activation remains elusive. Here, we describe a genome-wide CRISPR/Cas9 screen in immortalized mouse macrophages aiming at the unbiased identification of gene products involved in Nlrp3 inflammasome activation. We employed a FACS-based screen for Nlrp3-dependent cell death, using the ionophoric compound nigericin as a potassium efflux-inducing stimulus. Using a genome-wide guide RNA (gRNA) library, we found that targeting Nek7 rescued macrophages from nigericin-induced lethality. Subsequent studies revealed that murine macrophages deficient in Nek7 displayed a largely blunted Nlrp3 inflammasome response, whereas Aim2-mediated inflammasome activation proved to be fully intact. Although the mechanism of Nek7 functioning upstream of Nlrp3 yet remains elusive, these studies provide a first genetic handle of a component that specifically functions upstream of Nlrp3. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  1. Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch.

    Directory of Open Access Journals (Sweden)

    Raúl A Ortiz-Merino

    2017-05-01

    Full Text Available Many interspecies hybrids have been discovered in yeasts, but most of these hybrids are asexual and can replicate only mitotically. Whole-genome duplication has been proposed as a mechanism by which interspecies hybrids can regain fertility, restoring their ability to perform meiosis and sporulate. Here, we show that this process occurred naturally during the evolution of Zygosaccharomyces parabailii, an interspecies hybrid that was formed by mating between 2 parents that differed by 7% in genome sequence and by many interchromosomal rearrangements. Surprisingly, Z. parabailii has a full sexual cycle and is genetically haploid. It goes through mating-type switching and autodiploidization, followed by immediate sporulation. We identified the key evolutionary event that enabled Z. parabailii to regain fertility, which was breakage of 1 of the 2 homeologous copies of the mating-type (MAT locus in the hybrid, resulting in a chromosomal rearrangement and irreparable damage to 1 MAT locus. This rearrangement was caused by HO endonuclease, which normally functions in mating-type switching. With 1 copy of MAT inactivated, the interspecies hybrid now behaves as a haploid. Our results provide the first demonstration that MAT locus damage is a naturally occurring evolutionary mechanism for whole-genome duplication and restoration of fertility to interspecies hybrids. The events that occurred in Z. parabailii strongly resemble those postulated to have caused ancient whole-genome duplication in an ancestor of Saccharomyces cerevisiae.

  2. Evolution of Rosaceae Fruit Types Based on Nuclear Phylogeny in the Context of Geological Times and Genome Duplication.

    Science.gov (United States)

    Xiang, Yezi; Huang, Chien-Hsun; Hu, Yi; Wen, Jun; Li, Shisheng; Yi, Tingshuang; Chen, Hongyi; Xiang, Jun; Ma, Hong

    2017-02-01

    Fruits are the defining feature of angiosperms, likely have contributed to angiosperm successes by protecting and dispersing seeds, and provide foods to humans and other animals, with many morphological types and important ecological and agricultural implications. Rosaceae is a family with ∼3000 species and an extraordinary spectrum of distinct fruits, including fleshy peach, apple, and strawberry prized by their consumers, as well as dry achenetum and follicetum with features facilitating seed dispersal, excellent for studying fruit evolution. To address Rosaceae fruit evolution and other questions, we generated 125 new transcriptomic and genomic datasets and identified hundreds of nuclear genes to reconstruct a well-resolved Rosaceae phylogeny with highly supported monophyly of all subfamilies and tribes. Molecular clock analysis revealed an estimated age of ∼101.6 Ma for crown Rosaceae and divergence times of tribes and genera, providing a geological and climate context for fruit evolution. Phylogenomic analysis yielded strong evidence for numerous whole genome duplications (WGDs), supporting the hypothesis that the apple tribe had a WGD and revealing another one shared by fleshy fruit-bearing members of this tribe, with moderate support for WGDs in the peach tribe and other groups. Ancestral character reconstruction for fruit types supports independent origins of fleshy fruits from dry-fruit ancestors, including the evolution of drupes (e.g., peach) and pomes (e.g., apple) from follicetum, and drupetum (raspberry and blackberry) from achenetum. We propose that WGDs and environmental factors, including animals, contributed to the evolution of the many fruits in Rosaceae, which provide a foundation for understanding fruit evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. The genomic distribution of intraspecific and interspecific sequence divergence of human segmental duplications relative to human/chimpanzee chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Eichler Evan E

    2008-08-01

    Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.

  4. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Conservation of the abscission signaling peptide IDA during Angiosperm evolution: withstanding genome duplications and gain and loss of the receptors HAE/HSL2

    Directory of Open Access Journals (Sweden)

    Ida M. Stø

    2015-10-01

    Full Text Available The peptide INFLORESCENCE DEFICIENT IN ABSCISSION (IDA, which signals through the leucine-rich repeat receptor-like kinases HAESA (HAE and HAESA-LIKE2 (HSL2, controls different cell separation events in Arabidopsis thaliana. We hypothesize the involvement of this signaling module in abscission processes in other plant species even though they may shed other organs than A. thaliana. As the first step towards testing this hypothesis from an evolutionarily perspective we have identified genes encoding putative orthologues of IDA and its receptors by BLAST searches of publically available protein, nucleotide and genome databases for angiosperms. Genes encoding IDA or IDA-LIKE (IDL peptides and HSL proteins were found in all investigated species, which were selected as to represent each angiosperm order with available genomic sequences. The 12 amino acids representing the bioactive peptide in A. thaliana have virtually been unchanged throughout the evolution of the angiosperms; however, the number of IDL and HSL genes varies between different orders and species. The phylogenetic analyses suggest that IDA, HSL2 and the related HSL1 gene, were present in the species that gave rise to the angiosperms. HAE has arisen from HSL1 after a genome duplication that took place after the monocot - eudicots split. HSL1 has also independently been duplicated in the monocots, while HSL2 has been lost in gingers (Zingiberales and grasses (Poales. IDA has been duplicated in eudicots to give rise to functionally divergent IDL peptides. We postulate that the high number of IDL homologs present in the core eudicots is a result of multiple whole genome duplications. We substantiate the involvement of IDA and HAE/HSL2 homologs in abscission by providing gene expression data of different organ separation events from various species.

  6. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  7. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  8. The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability.

    Science.gov (United States)

    Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo

    2016-01-01

    1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication

  9. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  10. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  11. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  12. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  13. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  14. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  15. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  16. Palindromic widths of nilpotent and wreath products

    Indian Academy of Sciences (India)

    Palindromic width; commutator width; wreath products; nilpotent product. 2000 Mathematics ... An algorithm of the computation of the commutator length in free non-abelian .... It is clear that A(1)B = A × B is the direct sum. Let us list some ...

  17. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  18. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  19. Abundance and distribution of the highly iterated palindrome 1 (HIP1) among prokaryotes

    OpenAIRE

    Delaye, Luis; Moya, Andrés

    2011-01-01

    We have studied the abundance and phylogenetic distribution of the Highly Iterated Palindrome 1 (HIP1) among sequenced prokaryotic genomes. We show that an overrepresentation of HIP1 is exclusive of some lineages of cyanobacteria, and that this abundance was gained only once during evolution and was subsequently lost in the lineage leading to marine pico-cyanobacteria. We show that among cyanobacterial protein sequences with annotated Pfam domains, only OpcA (glucose 6-phosphate dehydrogenase...

  20. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  1. Singular continuous spectrum for palindromic Schroedinger operators

    International Nuclear Information System (INIS)

    Hof, A.; Knill, O.; Simon, B.

    1995-01-01

    We give new examples of discrete Schroedinger operators with potentials taking finitely many values that have purely singular continuous spectrum. If the hull X of the potential is strictly ergodic, then the existence of just one potential x in X for which the operator has no eigenvalues implies that there is a generic set in X for which the operator has purely singular continuous spectrum. A sufficient condition for the existence of such an x is that there is a z element of X that contains arbitrarily long palindromes. Thus we can define a large class of primitive substitutions for which the operators are purely singularly continuous for a generic subset in X. The class includes well-known substitutions like Fibonacci, Thue-Morse, Period Doubling, binary non-Pisot and ternary non-Pisot. We also show that the operator has no absolutely continuous spectrum for all x element of X if X derives from a primitive substitution. For potentials defined by circle maps, x n =l J (θ 0 +nα), we show that the operator has purely singular continuous spectrum for a generic subset in X for all irrational α and every half-open interval J. (orig.)

  2. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  3. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. The complete chloroplast genome sequences of Lychnis wilfordii and Silene capitata and comparative analyses with other Caryophyllaceae genomes.

    Science.gov (United States)

    Kang, Jong-Soo; Lee, Byoung Yoon; Kwak, Myounghai

    2017-01-01

    The complete chloroplast genomes of Lychnis wilfordii and Silene capitata were determined and compared with ten previously reported Caryophyllaceae chloroplast genomes. The chloroplast genome sequences of L. wilfordii and S. capitata contain 152,320 bp and 150,224 bp, respectively. The gene contents and orders among 12 Caryophyllaceae species are consistent, but several microstructural changes have occurred. Expansion of the inverted repeat (IR) regions at the large single copy (LSC)/IRb and small single copy (SSC)/IR boundaries led to partial or entire gene duplications. Additionally, rearrangements of the LSC region were caused by gene inversions and/or transpositions. The 18 kb inversions, which occurred three times in different lineages of tribe Sileneae, were thought to be facilitated by the intermolecular duplicated sequences. Sequence analyses of the L. wilfordii and S. capitata genomes revealed 39 and 43 repeats, respectively, including forward, palindromic, and reverse repeats. In addition, a total of 67 and 56 simple sequence repeats were discovered in the L. wilfordii and S. capitata chloroplast genomes, respectively. Finally, we constructed phylogenetic trees of the 12 Caryophyllaceae species and two Amaranthaceae species based on 73 protein-coding genes using both maximum parsimony and likelihood methods.

  5. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  6. Schroedinger operators with Rudin-Shapiro potentials are not palindromic

    International Nuclear Information System (INIS)

    Allouche, J.

    1997-01-01

    We prove a conjecture of A. Hof, O. Knill and B. Simon [Commun. Math. Phys. 174, 149 endash 159 (1995)] by showing that the Rudin-Shapiro sequence is not palindromic, i.e., does not contain arbitrarily long palindromes. We prove actually this property for all paperfolding sequences and all Rudin-Shapiro sequences deduced from paperfolding sequences. As a consequence and as guessed by the above authors, their method cannot be used for establishing that discrete Schroedinger operators with Rudin-Shapiro potentials have a purely singular continuous spectrum. copyright 1997 American Institute of Physics

  7. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  8. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  9. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  10. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  11. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  12. An algorithm to find all palindromic sequences in proteins

    Indian Academy of Sciences (India)

    2013-01-20

    Jan 20, 2013 ... 1976; Karrer and Gall 1976; Vogt and Braun 1976) and (iii) in the formation of hairpin loops in the newly transcribed RNA. Palindromic sequences are observed in various classes of proteins like histones (Cheng et al. 1989), prion proteins (Sulkowski 1992; Kazim 1993),. DNA-binding proteins (Suzuki 1992; ...

  13. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  14. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  15. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  16. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  17. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Raquel S Linheiro

    Full Text Available Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes.

  18. In vitro evolution of terminal protein-containing genomes

    Science.gov (United States)

    Esteban, José A.; Blanco, Luis; Villar, Laurentino; Salas, Margarita

    1997-01-01

    A new self-sustained terminal protein-primed DNA amplification system has been used to describe in vitro evolutionary changes affecting maintenance of the genome size of bacteriophage φ29. These changes involve generation and efficient amplification of short palindromic molecules containing an inverted duplication of one of the original DNA ends. A template-switching mechanism is proposed to account for the appearance of these molecules. After their formation, they would replicate by means of hairpin intermediates. Relevant kinetic information about this DNA replication system has been obtained from the competition between the input full-length φ29 DNA and its derived truncated versions. The physiological relevance of these molecules and the mechanisms to control their formation are discussed. PMID:9096322

  19. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  20. [Clustered regularly interspaced short palindromic repeats (CRISPR) site in Bacillus anthracis].

    Science.gov (United States)

    Gao, Zhiqi; Wang, Dongshu; Feng, Erling; Wang, Bingxiang; Hui, Yiming; Han, Shaobo; Jiao, Lei; Liu, Xiankai; Wang, Hengliang

    2014-11-04

    To investigate the polymorphism of clustered regularly interspaced short palindromic repeats (CRISPR) in Bacillu santhracis and the application to molecular typing based on the polymorphism of CRISPR in B. anthracis. We downloaded the whole genome sequence of 6 B. anthracis strains and extracted the CRISPR sites. We designed the primers of CRISPR sites and amplified the CRISPR fragments in 193 B. anthracis strains by PCR and sequenced these fragments. In order to reveal the polymorphism of CRISPR in B. anthracis, wealigned all the extracted sequences and sequenced results by local blasting. At the same time, we also analyzed the CRISPR sites in B. cereus and B. thuringiensis. We did not find any polymorphism of CRISPR in B. anthracis. The molecular typing approach based on CRISPR polymorphism is not suitable for B. anthracis, but it is possible for us to distinguish B. anthracis from B. cereus and B. thuringiensis.

  1. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  2. Analyses of the Sequence and Structural Properties Corresponding to Pentapeptide and Large Palindromes in Proteins.

    Directory of Open Access Journals (Sweden)

    Settu Sridhar

    Full Text Available The analyses of 3967 representative proteins selected from the Protein Data Bank revealed the presence of 2803 pentapeptide and large palindrome sequences with known secondary structure conformation. These represent 2014 unique palindrome sequences. 60% palindromes are not associated with any regular secondary structure and 28% are in helix conformation, 11% in strand conformation and 1% in the coil conformation. The average solvent accessibility values are in the range between 0-155.28 Å2 suggesting that the palindromes in proteins can be either buried, exposed to the solvent or share an intermittent property. The number of residue neighborhood contacts defined by interactions ≤ 3.2 Ǻ is in the range between 0-29 residues. Palindromes of the same length in helix, strand and coil conformation are associated with different amino acid residue preferences at the individual positions. Nearly, 20% palindromes interact with catalytic/active site residues, ligand or metal ions in proteins and may therefore be important for function in the corresponding protein. The average hydrophobicity values for the pentapeptide and large palindromes range between -4.3 to +4.32 and the number of palindromes is almost equally distributed between the negative and positive hydrophobicity values. The palindromes represent 107 different protein families and the hydrolases, transferases, oxidoreductases and lyases contain relatively large number of palindromes.

  3. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  4. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  6. Structural and sequence diversity of the transposon Galileo in the Drosophila willistoni genome.

    Science.gov (United States)

    Gonçalves, Juliana W; Valiati, Victor Hugo; Delprat, Alejandra; Valente, Vera L S; Ruiz, Alfredo

    2014-09-13

    Galileo is one of three members of the P superfamily of DNA transposons. It was originally discovered in Drosophila buzzatii, in which three segregating chromosomal inversions were shown to have been generated by ectopic recombination between Galileo copies. Subsequently, Galileo was identified in six of 12 sequenced Drosophila genomes, indicating its widespread distribution within this genus. Galileo is strikingly abundant in Drosophila willistoni, a neotropical species that is highly polymorphic for chromosomal inversions, suggesting a role for this transposon in the evolution of its genome. We carried out a detailed characterization of all Galileo copies present in the D. willistoni genome. A total of 191 copies, including 133 with two terminal inverted repeats (TIRs), were classified according to structure in six groups. The TIRs exhibited remarkable variation in their length and structure compared to the most complete copy. Three copies showed extended TIRs due to internal tandem repeats, the insertion of other transposable elements (TEs), or the incorporation of non-TIR sequences into the TIRs. Phylogenetic analyses of the transposase (TPase)-encoding and TIR segments yielded two divergent clades, which we termed Galileo subfamilies V and W. Target-site duplications (TSDs) in D. willistoni Galileo copies were 7- or 8-bp in length, with the consensus sequence GTATTAC. Analysis of the region around the TSDs revealed a target site motif (TSM) with a 15-bp palindrome that may give rise to a stem-loop secondary structure. There is a remarkable abundance and diversity of Galileo copies in the D. willistoni genome, although no functional copies were found. The TIRs in particular have a dynamic structure and extend in different ways, but their ends (required for transposition) are more conserved than the rest of the element. The D. willistoni genome harbors two Galileo subfamilies (V and W) that diverged ~9 million years ago and may have descended from an ancestral

  7. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  8. Trapping of palindromic ligands within native transthyretin prevents amyloid formation

    OpenAIRE

    Kolstoe, Simon E.; Mangione, Palma P.; Bellotti, Vittorio; Taylor, Graham W.; Tennent, Glenys A.; Deroo, Stéphanie; Morrison, Angus J.; Cobb, Alexander J. A.; Coyne, Anthony; McCammon, Margaret G.; Warner, Timothy D.; Mitchell, Jane; Gill, Raj; Smith, Martin D.; Ley, Steven V.

    2010-01-01

    Transthyretin (TTR) amyloidosis is a fatal disease for which new therapeutic approaches are urgently needed. We have designed two palindromic ligands, 2,2'-(4,4'-(heptane-1,7-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (mds84) and 2,2'-(4,4'-(undecane-1,11-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (4ajm15), that are rapidly bound by native wild-type TTR in whole serum and even more avidly by amyloidogenic TTR variants. One to one...

  9. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  10. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  11. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  12. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  13. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  14. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  15. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  16. [Advances in application of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 system in stem cells research].

    Science.gov (United States)

    Sun, S J; Huo, J H; Geng, Z J; Sun, X Y; Fu, X B

    2018-04-20

    Gene engineering has attracted worldwide attention because of its ability of precise location of disease mutations in genome. As a new gene editing technology, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system is simple, fast, and accurate to operate at a specific gene site. It overcomes the long-standing problem of conventional operation. At the same time, stem cells are a good foundation for establishing disease model in vitro. Therefore, it has great significance to combine stem cells with the rapidly developing gene manipulation techniques. In this review, we mainly focus on the mechanism of CRISPR/Cas9 technology and its application in stem cell genomic editing, so as to pave the way for promoting rapid application and development of CRISPR/Cas9 technology.

  17. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    Science.gov (United States)

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  18. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  19. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    Directory of Open Access Journals (Sweden)

    Glass John I

    2010-07-01

    repeat may be disseminated by HGT and intra-genomic shuffling. Conclusions We describe novel features of PARCELs (Palindromic Amphipathic Repeat Coding ELements, a set of widely distributed repeat protein domains and coding sequences that were likely acquired through HGT by diverse unicellular microbes, further mobilized and diversified within genomes, and co-opted for expression in the membrane proteome of some taxa. Disseminated by multiple gene-centric vehicles, ORFs harboring these elements enhance accessory gene pools as part of the "mobilome" connecting genomes of various clades, in taxa sharing common niches.

  20. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  1. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  2. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  3. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  4. Function and Regulation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR / CRISPR Associated (Cas Systems

    Directory of Open Access Journals (Sweden)

    Peter C. Fineran

    2012-10-01

    Full Text Available Phages are the most abundant biological entities on earth and pose a constant challenge to their bacterial hosts. Thus, bacteria have evolved numerous ‘innate’ mechanisms of defense against phage, such as abortive infection or restriction/modification systems. In contrast, the clustered regularly interspaced short palindromic repeats (CRISPR systems provide acquired, yet heritable, sequence-specific ‘adaptive’ immunity against phage and other horizontally-acquired elements, such as plasmids. Resistance is acquired following viral infection or plasmid uptake when a short sequence of the foreign genome is added to the CRISPR array. CRISPRs are then transcribed and processed, generally by CRISPR associated (Cas proteins, into short interfering RNAs (crRNAs, which form part of a ribonucleoprotein complex. This complex guides the crRNA to the complementary invading nucleic acid and targets this for degradation. Recently, there have been rapid advances in our understanding of CRISPR/Cas systems. In this review, we will present the current model(s of the molecular events involved in both the acquisition of immunity and interference stages and will also address recent progress in our knowledge of the regulation of CRISPR/Cas systems.

  5. Lactobacillus buchneri genotyping on the basis of clustered regularly interspaced short palindromic repeat (CRISPR) locus diversity.

    Science.gov (United States)

    Briner, Alexandra E; Barrangou, Rodolphe

    2014-02-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel "spacers" that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5'-AAAA-3'. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri.

  6. Function and regulation of clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR associated (Cas) systems.

    Science.gov (United States)

    Richter, Corinna; Chang, James T; Fineran, Peter C

    2012-10-19

    Phages are the most abundant biological entities on earth and pose a constant challenge to their bacterial hosts. Thus, bacteria have evolved numerous 'innate' mechanisms of defense against phage, such as abortive infection or restriction/modification systems. In contrast, the clustered regularly interspaced short palindromic repeats (CRISPR) systems provide acquired, yet heritable, sequence-specific 'adaptive' immunity against phage and other horizontally-acquired elements, such as plasmids. Resistance is acquired following viral infection or plasmid uptake when a short sequence of the foreign genome is added to the CRISPR array. CRISPRs are then transcribed and processed, generally by CRISPR associated (Cas) proteins, into short interfering RNAs (crRNAs), which form part of a ribonucleoprotein complex. This complex guides the crRNA to the complementary invading nucleic acid and targets this for degradation. Recently, there have been rapid advances in our understanding of CRISPR/Cas systems. In this review, we will present the current model(s) of the molecular events involved in both the acquisition of immunity and interference stages and will also address recent progress in our knowledge of the regulation of CRISPR/Cas systems.

  7. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  8. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  9. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  10. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  11. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  12. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  13. Trapping of palindromic ligands within native transthyretin prevents amyloid formation

    Science.gov (United States)

    Kolstoe, Simon E.; Mangione, Palma P.; Bellotti, Vittorio; Taylor, Graham W.; Tennent, Glenys A.; Deroo, Stéphanie; Morrison, Angus J.; Cobb, Alexander J. A.; Coyne, Anthony; McCammon, Margaret G.; Warner, Timothy D.; Mitchell, Jane; Gill, Raj; Smith, Martin D.; Ley, Steven V.; Robinson, Carol V.; Wood, Stephen P.; Pepys, Mark B.

    2010-01-01

    Transthyretin (TTR) amyloidosis is a fatal disease for which new therapeutic approaches are urgently needed. We have designed two palindromic ligands, 2,2'-(4,4'-(heptane-1,7-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (mds84) and 2,2'-(4,4'-(undecane-1,11-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (4ajm15), that are rapidly bound by native wild-type TTR in whole serum and even more avidly by amyloidogenic TTR variants. One to one stoichiometry, demonstrable in solution and by MS, was confirmed by X-ray crystallographic analysis showing simultaneous occupation of both T4 binding sites in each tetrameric TTR molecule by the pair of ligand head groups. Ligand binding by native TTR was irreversible under physiological conditions, and it stabilized the tetrameric assembly and inhibited amyloidogenic aggregation more potently than other known ligands. These superstabilizers are orally bioavailable and exhibit low inhibitory activity against cyclooxygenase (COX). They offer a promising platform for development of drugs to treat and prevent TTR amyloidosis. PMID:21059958

  14. Myocardial Infarction in a Young Female with Palindromic Rheumatism: A Consequence of Negative Remodeling

    Directory of Open Access Journals (Sweden)

    Timothy R. Larsen

    2012-01-01

    Full Text Available Palindromic rheumatism is a rare disease associated with systemic inflammation. Negative or constrictive coronary artery remodeling is typically not seen until the 7th or 8th decade of life. We report a case of a young female with palindromic rheumatism who suffered a non-ST segment elevation myocardial infarction secondary to a flow-limiting lesion that demonstrated negative remodeling by intravascular ultrasound (IVUS.

  15. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  16. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  18. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  20. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  1. Genomes

    National Research Council Canada - National Science Library

    Brown, T. A. (Terence A.)

    2002-01-01

    ... of genome expression and replication processes, and transcriptomics and proteomics. This text is richly illustrated with clear, easy-to-follow, full color diagrams, which are downloadable from the book's website...

  2. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    Energy Technology Data Exchange (ETDEWEB)

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  3. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  4. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  5. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  6. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  7. Discovering Complete Quasispecies In Bacterial Genomes

    OpenAIRE

    Bertels, Frederic; Gokhale, Chaitanya; Traulsen, Arne

    2017-01-01

    Mobile genetic elements can be found in almost all genomes. Possibly the most common nonautonomous mobile genetic elements in bacteria are repetitive extragenic palindromic doublets forming hairpins (REPINs) that can occur hundreds of times within a genome. The sum of all REPINs in a genome can be viewed as an evolving population because REPINs replicate and mutate. In contrast to most other biological populations, we know the exact composition of the REPIN population and the sequence of each...

  8. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  9. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  10. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  11. MATLAB Algorithms for Rapid Detection and Embedding of Palindrome and Emordnilap Electronic Watermarks in Simulated Chemical and Biological Image Data

    National Research Council Canada - National Science Library

    Robbins, Ronny C

    2004-01-01

    .... This is similar to words such as STOP which when flipped left right gives the new word POTS. Emordnilap is palindrome spelled backwards. This paper explores the use of MATLAB algorithms in the rapid detection and embedding of palindrome and emordnilap electronic watermarks in simulated chemical and biological Image Data.

  12. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  13. Computing the full spectrum of large sparse palindromic quadratic eigenvalue problems arising from surface Green's function calculations

    Science.gov (United States)

    Huang, Tsung-Ming; Lin, Wen-Wei; Tian, Heng; Chen, Guan-Hua

    2018-03-01

    Full spectrum of a large sparse ⊤-palindromic quadratic eigenvalue problem (⊤-PQEP) is considered arguably for the first time in this article. Such a problem is posed by calculation of surface Green's functions (SGFs) of mesoscopic transistors with a tremendous non-periodic cross-section. For this problem, general purpose eigensolvers are not efficient, nor is advisable to resort to the decimation method etc. to obtain the Wiener-Hopf factorization. After reviewing some rigorous understanding of SGF calculation from the perspective of ⊤-PQEP and nonlinear matrix equation, we present our new approach to this problem. In a nutshell, the unit disk where the spectrum of interest lies is broken down adaptively into pieces small enough that they each can be locally tackled by the generalized ⊤-skew-Hamiltonian implicitly restarted shift-and-invert Arnoldi (G⊤SHIRA) algorithm with suitable shifts and other parameters, and the eigenvalues missed by this divide-and-conquer strategy can be recovered thanks to the accurate estimation provided by our newly developed scheme. Notably the novel non-equivalence deflation is proposed to avoid as much as possible duplication of nearby known eigenvalues when a new shift of G⊤SHIRA is determined. We demonstrate our new approach by calculating the SGF of a realistic nanowire whose unit cell is described by a matrix of size 4000 × 4000 at the density functional tight binding level, corresponding to a 8 × 8nm2 cross-section. We believe that quantum transport simulation of realistic nano-devices in the mesoscopic regime will greatly benefit from this work.

  14. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  15. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  16. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  17. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  18. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  19. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  20. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  2. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  3. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases.

    Science.gov (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E

    2000-03-13

    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  4. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  5. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    Science.gov (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  6. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System.

    Science.gov (United States)

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-07-15

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System*

    Science.gov (United States)

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

  8. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  9. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  11. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  12. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  13. [Clustered regularly interspaced short palindromic repeats: structure, function and application--a review].

    Science.gov (United States)

    Cui, Yujun; Li, Yanjun; Yan, Yanfeng; Yang, Ruifu

    2008-11-01

    CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), the basis of spoligotyping technology, can provide prokaryotes with heritable adaptive immunity against phages' invasion. Studies on CRISPR loci and their associated elements, including various CAS (CRISPR-associated) proteins and leader sequences, are still in its infant period. We introduce the brief history', structure, function, bioinformatics research and application of this amazing immunity system in prokaryotic organism for inspiring more scientists to find their interest in this developing topic.

  14. Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes

    NARCIS (Netherlands)

    Al-Attar, S.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Many prokaryotes contain the recently discovered defense system against mobile genetic elements. This defense system contains a unique type of repetitive DNA stretches, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). CRISPRs consist of identical repeated DNA sequences

  15. Palindromic Molecule Beacon-Based Cascade Amplification for Colorimetric Detection of Cancer Genes.

    Science.gov (United States)

    Shen, Zhi-Fa; Li, Feng; Jiang, Yi-Fan; Chen, Chang; Xu, Huo; Li, Cong-Cong; Yang, Zhe; Wu, Zai-Sheng

    2018-03-06

    A highly sensitive and selective colorimetric assay based on a multifunctional molecular beacon with palindromic tail (PMB) was proposed for the detection of target p53 gene. The PMB probe can serve as recognition element, primer, and polymerization template and contains a nicking site and a C-rich region complementary to a DNAzyme. In the presence of target DNA, the hairpin of PMB is opened, and the released palindromic tails intermolecularly hybridize with each other, triggering the autonomous polymerization/nicking/displacement cycles. Although only one type of probe is involved, the system can execute triple and continuous polymerization strand displacement amplifications, generating large amounts of G-quadruplex fragments. These G-rich fragments can bind to hemin and form the DNAzymes that possess the catalytic activity similar to horseradish peroxidase, catalyzing the oxidation of ABTS by H 2 O 2 and producing the colorimetric signal. Utilizing the newly proposed sensing system, target DNA can be detected down to 10 pM with a linear response range from 10 pM to 200 nM, and mutant target DNAs are able to be distinguished even by the naked eye. The desirable detection sensitivity, high specificity, and operation convenience without any separation step and chemical modification demonstrate that the palindromic molecular beacon holds the potential for detecting and monitoring a variety of nucleic acid-related biomarkers.

  16. Transgenic Clustered Regularly Interspaced Short Palindromic Repeat/Cas9-Mediated Viral Gene Targeting for Antiviral Therapy of Bombyx mori Nucleopolyhedrovirus.

    Science.gov (United States)

    Chen, Shuqing; Hou, Chengxiang; Bi, Honglun; Wang, Yueqiang; Xu, Jun; Li, Muwang; James, Anthony A; Huang, Yongping; Tan, Anjiang

    2017-04-15

    We developed a novel antiviral strategy by combining transposon-based transgenesis and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system for the direct cleavage of Bombyx mori nucleopolyhedrovirus (BmNPV) genome DNA to promote virus clearance in silkworms. We demonstrate that transgenic silkworms constitutively expressing Cas9 and guide RNAs targeting the BmNPV immediate early-1 ( ie-1 ) and me53 genes effectively induce target-specific cleavage and subsequent mutagenesis, especially large (∼7-kbp) segment deletions in BmNPV genomes, and thus exhibit robust suppression of BmNPV proliferation. Transgenic animals exhibited higher and inheritable resistance to BmNPV infection than wild-type animals. Our approach will not only contribute to modern sericulture but also shed light on future antiviral therapy. IMPORTANCE Pathogen genome targeting has shown its potential in antiviral research. However, transgenic CRISPR/Cas9 system-mediated viral genome targeting has not been reported as an antiviral strategy in a natural animal host of a virus. Our data provide an effective approach against BmNPV infection in a real-world biological system and demonstrate the potential of transgenic CRISPR/Cas9 systems in antiviral research in other species. Copyright © 2017 Chen et al.

  17. Ultrafast comparison of personal genomes

    OpenAIRE

    Mauldin, Denise; Hood, Leroy; Robinson, Max; Glusman, Gustavo

    2017-01-01

    We present an ultra-fast method for comparing personal genomes. We transform the standard genome representation (lists of variants relative to a reference) into 'genome fingerprints' that can be readily compared across sequencing technologies and reference versions. Because of their reduced size, computation on the genome fingerprints is fast and requires little memory. This enables scaling up a variety of important genome analyses, including quantifying relatedness, recognizing duplicative s...

  18. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  19. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  20. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair.

    Science.gov (United States)

    Kato-Inui, Tomoko; Takahashi, Gou; Hsu, Szuyin; Miyaoka, Yuichiro

    2018-05-18

    Genome editing using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) predominantly induces non-homologous end joining (NHEJ), which generates random insertions or deletions, whereas homology-directed repair (HDR), which generates precise recombination products, is useful for wider applications. However, the factors that determine the ratio of HDR to NHEJ products after CRISPR/Cas9 editing remain unclear, and methods by which the proportion of HDR products can be increased have not yet been fully established. We systematically analyzed the HDR and NHEJ products after genome editing using various modified guide RNAs (gRNAs) and Cas9 variants with an enhanced conformational checkpoint to improve the fidelity at endogenous gene loci in HEK293T cells and HeLa cells. We found that these modified gRNAs and Cas9 variants were able to enhance HDR in both single-nucleotide substitutions and a multi-kb DNA fragment insertion. Our results suggest that the original CRISPR/Cas9 system from the bacterial immune system is not necessarily the best option for the induction of HDR in genome editing and indicate that the modulation of the kinetics of conformational checkpoints of Cas9 can optimize the HDR/NHEJ ratio.

  1. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  2. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  3. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    OpenAIRE

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-01-01

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lac...

  4. Heterogeneous Diversity of Spacers within CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)

    Science.gov (United States)

    He, Jiankui; Deem, Michael W.

    2010-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  5. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    International Nuclear Information System (INIS)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    Crystals of palindromic SBE DNA-bound Smad1 MH1 domain diffracting to 2.7 Å resolution have been obtained. The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit

  6. Genetic variation of classical swine fever virus based on palindromic nucleotide substitutions, a genetic marker in the 5' untranslated region of RNA

    Directory of Open Access Journals (Sweden)

    Massimo Giangaspero

    2008-06-01

    Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.

  7. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  8. Fine mapping of a de novo interstitial 10q22-q23 duplication in a patient with congenital heart disease and microcephaly

    DEFF Research Database (Denmark)

    Erdogan, F; Belloso, J M; Gabau, E

    2008-01-01

    deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22...

  9. Duplicate Record Elimination in Large Data Files.

    Science.gov (United States)

    1981-08-01

    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  10. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  11. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  12. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  13. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  14. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  15. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  16. Rectal duplication cyst in a cat.

    Science.gov (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio

    2010-12-01

    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  17. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  18. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  19. [Rectal duplication cyst--case report].

    Science.gov (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J

    2009-06-01

    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  20. [Knocking-out extra domain A alternative splice fragment of fibronectin using a clustered regularly interspaced short palindromic repeats/associated proteins 9 system].

    Science.gov (United States)

    Yang, Yue; Wang, Haicheng; Xu, Shuyu; Peng, Jing; Jiang, Jiuhui; Li, Cuiying

    2015-08-01

    To investigate the effect of the fibronectin extra domain A on the aggressiveness of salivary adenoid cystic carcinoma (SACC) cells, via the clustered regularly interspaced short palindromic repeats (CRISPR)/ associated proteins (Cas) system. One sgRNA was designed to target the upstream of the genome sequences of extra domain A(EDA) exon and the downstream. Then the sgRNA was linked into plasmid PX-330 and transfected into SACC-83 cells. PCR and DNA sequence were used to testify the knockout cells, and the monoclones of EDA absent SACC cells were selected (A+C-2, A+C-6, B+C-10). CCK-8 cell proliferation and invasion was then tested in control group and the experimental group. The sgRNA was successfully linked into PX-330 plasmid. Part of adenoid cystic carcinoma cells' SACC-83 genomic EDA exon was knocked out, and the knockdown efficiency was above 70%, but the total amount of fibronectin did not change significantly. Three monoclones of EDA absent SACC- 83 cells were successfully selected with diminished migration and proliferation. The CRISPR/Cas9 system was a simplified system with relatively high knockout efficiency and EDA knockout could inhibiting SACC cell's mobility and invasiveness.

  1. A 1.37-Mb 12p11.22-p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation.

    Science.gov (United States)

    Chen, Chih-Ping; Lin, Shuan-Pei; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Lee, Chen-Chi; Wang, Wayseen

    2014-03-01

    To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22-p11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retardation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal translocation of t(8;12)(q24.3;p11.2). A 13-year-old girl was referred to the hospital because of autism, mental retardation, and difficulty in the self-care of her menstruation. Cytogenetic analysis revealed an apparently balanced reciprocal translocation and a karyotype of 46,XX,t(8;12) (q24.3;p11.2)dn. The girl manifested microcephaly, hypertelorism, flat facial profile, prominent forehead, thick scalp hair, upslanting palpebral fissures, broad nasal bridge, bulbous nose, right simian crease, bilateral clinodactyly of the fifth fingers, bilateral pes cavus, learning difficulties, mental retardation, emotional instability, cognitive impairment, behavior problems, jumping-like gaits, and autistic spectrum disorder. aCGH was performed to evaluate genomic imbalance in this patient. aCGH analysis revealed a 1.37-Mb 12p11.22-p11.21 microdeletion or arr [hg 19] 12p11.22-p11.21 (30,645,008-32,014,774)×1 and a 367-kb 22q11.21 microduplication or arr [hg 19] 22q11.21 (18,657,470-19,024,306)×3. The 1.37-Mb 12p11.22-p11.21 microdeletion encompassed 26 genes including IPO8, CAPRIN2, and DDX11, and the 367-kb 22q11.21 microduplication encompassed 20 genes including USP18, DGCR6, PRODH, and DGCR2. An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22-p11.21 microdeletion and 22q11.2 microduplication. Copyright © 2014. Published by Elsevier B.V.

  2. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  3. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  4. Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2018-05-03

    Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.

  5. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  6. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  7. Somatic mosaicism of an intragenic FANCB duplication in both fibroblast and peripheral blood cells observed in a Fanconi anemia patient leads to milder phenotype.

    Science.gov (United States)

    Asur, Rajalakshmi S; Kimble, Danielle C; Lach, Francis P; Jung, Moonjung; Donovan, Frank X; Kamat, Aparna; Noonan, Raymond J; Thomas, James W; Park, Morgan; Chines, Peter; Vlachos, Adrianna; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C

    2018-01-01

    Fanconi anemia (FA) is a rare disorder characterized by congenital malformations, progressive bone marrow failure, and predisposition to cancer. Patients harboring X-linked FANCB pathogenic variants usually present with severe congenital malformations resembling VACTERL syndrome with hydrocephalus. We employed the diepoxybutane (DEB) test for FA diagnosis, arrayCGH for detection of duplication, targeted capture and next-gen sequencing for defining the duplication breakpoint, PacBio sequencing of full-length FANCB aberrant transcript, FANCD2 ubiquitination and foci formation assays for the evaluation of FANCB protein function by viral transduction of FANCB-null cells with lentiviral FANCB WT and mutant expression constructs, and droplet digital PCR for quantitation of the duplication in the genomic DNA and cDNA. We describe here an FA-B patient with a mild phenotype. The DEB diagnostic test for FA revealed somatic mosaicism. We identified a 9154 bp intragenic duplication in FANCB, covering the first coding exon 3 and the flanking regions. A four bp homology (GTAG) present at both ends of the breakpoint is consistent with microhomology-mediated duplication mechanism. The duplicated allele gives rise to an aberrant transcript containing exon 3 duplication, predicted to introduce a stop codon in FANCB protein (p.A319*). Duplication levels in the peripheral blood DNA declined from 93% to 7.9% in the span of eleven years. Moreover, the patient fibroblasts have shown 8% of wild-type (WT) allele and his carrier mother showed higher than expected levels of WT allele (79% vs. 50%) in peripheral blood, suggesting that the duplication was highly unstable. Unlike sequence point variants, intragenic duplications are difficult to precisely define, accurately quantify, and may be very unstable, challenging the proper diagnosis. The reversion of genomic duplication to the WT allele results in somatic mosaicism and may explain the relatively milder phenotype displayed by the FA

  8. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  9. Assembling the Streptococcus thermophilus clustered regularly interspaced short palindromic repeats (CRISPR) array for multiplex DNA targeting.

    Science.gov (United States)

    Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying

    2015-06-01

    In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Survey of clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) systems in multiple sequenced strains of Klebsiella pneumoniae.

    Science.gov (United States)

    Ostria-Hernández, Martha Lorena; Sánchez-Vallejo, Carlos Javier; Ibarra, J Antonio; Castro-Escarpulli, Graciela

    2015-08-04

    In recent years the emergence of multidrug resistant Klebsiella pneumoniae strains has been an increasingly common event. This opportunistic species is one of the five main bacterial pathogens that cause hospital infections worldwide and multidrug resistance has been associated with the presence of high molecular weight plasmids. Plasmids are generally acquired through horizontal transfer and therefore is possible that systems that prevent the entry of foreign genetic material are inactive or absent. One of these systems is CRISPR/Cas. However, little is known regarding the clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) system in K. pneumoniae. The adaptive immune system CRISPR/Cas has been shown to limit the entry of foreign genetic elements into bacterial organisms and in some bacteria it has been shown to be involved in regulation of virulence genes. Thus in this work we used bioinformatics tools to determine the presence or absence of CRISPR/Cas systems in available K. pneumoniae genomes. The complete CRISPR/Cas system was identified in two out of the eight complete K. pneumoniae genomes sequences and in four out of the 44 available draft genomes sequences. The cas genes in these strains comprises eight cas genes similar to those found in Escherichia coli, suggesting they belong to the type I-E group, although their arrangement is slightly different. As for the CRISPR sequences, the average lengths of the direct repeats and spacers were 29 and 33 bp, respectively. BLAST searches demonstrated that 38 of the 116 spacer sequences (33%) are significantly similar to either plasmid, phage or genome sequences, while the remaining 78 sequences (67%) showed no significant similarity to other sequences. The region where the CRISPR/Cas systems were located is the same in all the Klebsiella genomes containing it, it has a syntenic architecture, and is located among genes encoding for proteins likely involved in

  11. Duplication of Key Frames of Video Streams in Wireless Networks

    OpenAIRE

    Sagatov, Evgeny S.; Sukhov, Andrei M.

    2011-01-01

    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  12. Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.

    Science.gov (United States)

    Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario

    2008-01-01

    Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.

  13. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1971-10-15

    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  14. [Intestinal volvulus due to yeyunal duplication].

    Science.gov (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L

    2014-10-01

    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  15. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William

    2010-01-01

    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  16. A case of de novo duplication of 15q24-q26.3

    Directory of Open Access Journals (Sweden)

    Hye Ran Kim

    2011-06-01

    Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.

  17. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  18. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph

    2010-09-01

    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  19. Abundant and diverse clustered regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and prophages target multiple phage types within this pathogen.

    Science.gov (United States)

    Hargreaves, Katherine R; Flores, Cesar O; Lawley, Trevor D; Clokie, Martha R J

    2014-08-26

    Clostridium difficile is an important human-pathogenic bacterium causing antibiotic-associated nosocomial infections worldwide. Mobile genetic elements and bacteriophages have helped shape C. difficile genome evolution. In many bacteria, phage infection may be controlled by a form of bacterial immunity called the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system. This uses acquired short nucleotide sequences (spacers) to target homologous sequences (protospacers) in phage genomes. C. difficile carries multiple CRISPR arrays, and in this paper we examine the relationships between the host- and phage-carried elements of the system. We detected multiple matches between spacers and regions in 31 C. difficile phage and prophage genomes. A subset of the spacers was located in prophage-carried CRISPR arrays. The CRISPR spacer profiles generated suggest that related phages would have similar host ranges. Furthermore, we show that C. difficile strains of the same ribotype could either have similar or divergent CRISPR contents. Both synonymous and nonsynonymous mutations in the protospacer sequences were identified, as well as differences in the protospacer adjacent motif (PAM), which could explain how phages escape this system. This paper illustrates how the distribution and diversity of CRISPR spacers in C. difficile, and its prophages, could modulate phage predation for this pathogen and impact upon its evolution and pathogenicity. Clostridium difficile is a significant bacterial human pathogen which undergoes continual genome evolution, resulting in the emergence of new virulent strains. Phages are major facilitators of genome evolution in other bacterial species, and we use sequence analysis-based approaches in order to examine whether the CRISPR/Cas system could control these interactions across divergent C. difficile strains. The presence of spacer sequences in prophages that are homologous to phage genomes raises an

  20. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  1. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  2. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    Science.gov (United States)

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

    Science.gov (United States)

    Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

    2012-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

  4. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  5. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  6. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  7. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  8. DB2: a probabilistic approach for accurate detection of tandem duplication breakpoints using paired-end reads.

    Science.gov (United States)

    Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas

    2014-03-05

    With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available

  9. Reciprocal duplication of the Williams-Beuren syndrome deletion on chromosome 7q11.23 is associated with schizophrenia.

    Science.gov (United States)

    Mulle, Jennifer Gladys; Pulver, Ann E; McGrath, John A; Wolyniec, Paula S; Dodd, Anne F; Cutler, David J; Sebat, Jonathan; Malhotra, Dheeraj; Nestadt, Gerald; Conrad, Donald F; Hurles, Matthew; Barnes, Chris P; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F; Gejman, Pablo V; Sanders, Alan R; Duan, Jubao; Mitchell, Adele A; Peter, Inga; Sklar, Pamela; O'Dushlaine, Colm T; Grozeva, Detelina; O'Donovan, Michael C; Owen, Michael J; Hultman, Christina M; Kähler, Anna K; Sullivan, Patrick F; Kirov, George; Warren, Stephen T

    2014-03-01

    Several copy number variants (CNVs) have been implicated as susceptibility factors for schizophrenia (SZ). Some of these same CNVs also increase risk for autism spectrum disorders, suggesting an etiologic overlap between these conditions. Recently, de novo duplications of a region on chromosome 7q11.23 were associated with autism spectrum disorders. The reciprocal deletion of this region causes Williams-Beuren syndrome. We assayed an Ashkenazi Jewish cohort of 554 SZ cases and 1014 controls for genome-wide CNV. An excess of large rare and de novo CNVs were observed, including a 1.4 Mb duplication on chromosome 7q11.23 identified in two unrelated patients. To test whether this 7q11.23 duplication is also associated with SZ, we obtained data for 14,387 SZ cases and 28,139 controls from seven additional studies with high-resolution genome-wide CNV detection. We performed a meta-analysis, correcting for study population of origin, to assess whether the duplication is associated with SZ. We found duplications at 7q11.23 in 11 of 14,387 SZ cases with only 1 in 28,139 control subjects (unadjusted odds ratio 21.52, 95% confidence interval: 3.13-922.6, p value 5.5 × 10(-5); adjusted odds ratio 10.8, 95% confidence interval: 1.46-79.62, p value .007). Of three SZ duplication carriers with detailed retrospective data, all showed social anxiety and language delay premorbid to SZ onset, consistent with both human studies and animal models of the 7q11.23 duplication. We have identified a new CNV associated with SZ. Reciprocal duplication of the Williams-Beuren syndrome deletion at chromosome 7q11.23 confers an approximately tenfold increase in risk for SZ. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  10. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem

    2018-05-01

    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  11. Increments and duplication events of enzymes and transcription factors influence metabolic and regulatory diversity in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Mario Alberto Martínez-Núñez

    Full Text Available In this work, the content of enzymes and DNA-binding transcription factors (TFs in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM and structural domains (Superfamily. For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22% than in the bacterial ones (27% was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected.

  12. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  13. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  14. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  15. Application of CRISPR/Cas9 Genome Editing to Improve Recombinant Protein Production in CHO Cells

    DEFF Research Database (Denmark)

    Grav, Lise Marie; Julie la Cour Karottki, Karen; Lee, Jae Seong

    2017-01-01

    and yields. In this chapter, we present our protocol on how to use the genome editing tool Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) to knockout engineering target genes in CHO cells. As an example, we refer to the glutamine synthetase (GS...

  16. CRISPR/Cas system for yeast genome engineering: advances and applications

    DEFF Research Database (Denmark)

    Stovicek, Vratislav; Holkenbrink, Carina; Borodina, Irina

    2017-01-01

    The methods based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) system have quickly gained popularity for genome editing and transcriptional regulation in many organisms, including yeast. This review aims to provide a comprehensive overview...... of CRISPR application for different yeast species: from basic principles and genetic design to applications....

  17. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  18. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  19. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  20. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  1. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice

    2011-01-01

    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  2. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  3. Neutral Evolution of Duplicated DNA: An Evolutionary Stick-Breaking Process Causes Scale-Invariant Behavior

    Science.gov (United States)

    Massip, Florian; Arndt, Peter F.

    2013-04-01

    Recently, an enrichment of identical matching sequences has been found in many eukaryotic genomes. Their length distribution exhibits a power law tail raising the question of what evolutionary mechanism or functional constraints would be able to shape this distribution. Here we introduce a simple and evolutionarily neutral model, which involves only point mutations and segmental duplications, and produces the same statistical features as observed for genomic data. Further, we extend a mathematical model for random stick breaking to analytically show that the exponent of the power law tail is -3 and universal as it does not depend on the microscopic details of the model.

  4. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    Science.gov (United States)

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-10-11

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

  5. [Molecular characteristics of Clustered Regularly Interspaced Short Palindromic Repeat in Shigella].

    Science.gov (United States)

    Xue, Zerun; Wang, Yingfang; Duan, Guangcai; Yang, Haiyan; Xi, Yuanlin; Wang, Pengfei; Wang, Linlin; Guo, Xiangjiao

    2015-08-01

    To detect the molecular characteristics of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) in Shigella and to analyze the distribution of CRISPR related to the time of isolation. Of the 52 Shigella strains, 41 were isolated from Henan, 6 from Jiangxi and 5 isolated from Beijing. Both CRISPR locus of S1, S2, S3 and S4 in Shigella were detected by polymerase chain reaction (PCR). The PCR products were sequenced and compared. The positive rates of CRISPR locus in Shigella were 33.69% (S1), 50.00% (S2), 82.69% (S3) and 73.08% (S4), respectively. Two subtypes were discovered in S1 and S3 locus. Three subtypes were discovered in S2 locus. Four different subtypes were discovered in S4 locus. The isolates from Henan strains were divided into two groups by the time of isolation. Distributions of S1 were different, before or after 2004, on Shigella. S1 could not be detected after 2004. There were no statistical differences of S2, S3 and S4 in two groups. Different CRISPR subtypes or Shigella were discovered. A significant correlation was noticed between the CRISPR S1 related to the time of isolation but not between S2, S3 or S4 on the time of isolation.

  6. Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

    Science.gov (United States)

    Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

    2015-12-01

    Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism. © 2015 American Heart Association, Inc.

  7. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  8. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  9. A 1.37-Mb 12p11.22–p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2014-03-01

    Conclusion: An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22–p11.21 microdeletion and 22q11.2 microduplication.

  10. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)

    2013-01-15

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  12. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun

    2013-01-01

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  13. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko

    2009-01-01

    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  15. Draft Genome Sequence of Ezakiella peruensis Strain M6.X2, a Human Gut Gram-Positive Anaerobic Coccus.

    Science.gov (United States)

    Diop, Awa; Diop, Khoudia; Tomei, Enora; Raoult, Didier; Fenollar, Florence; Fournier, Pierre-Edouard

    2018-03-01

    We report here the draft genome sequence of Ezakiella peruensis strain M6.X2 T The draft genome is 1,672,788 bp long and harbors 1,589 predicted protein-encoding genes, including 26 antibiotic resistance genes with 1 gene encoding vancomycin resistance. The genome also exhibits 1 clustered regularly interspaced short palindromic repeat region and 333 genes acquired by horizontal gene transfer. Copyright © 2018 Diop et al.

  16. Cosmic abundances: The impact of stellar duplicity

    OpenAIRE

    Jorissen, A.; Van Eck, S.

    2004-01-01

    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  17. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  18. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  19. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung

    2004-01-01

    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  20. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder

    2016-01-01

    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  1. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  2. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  3. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  4. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  5. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  6. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  7. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  8. Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.

    Science.gov (United States)

    Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan

    2013-01-01

    Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.

  9. Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

    Science.gov (United States)

    Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

    2009-01-01

    Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

  10. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

    2010-07-22

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  11. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

    2010-12-01

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  12. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  13. Clustered, regularly interspaced short palindromic repeat (CRISPR) diversity and virulence factor distribution in avian Escherichia coli.

    Science.gov (United States)

    Fu, Qiang; Su, Zhixin; Cheng, Yuqiang; Wang, Zhaofei; Li, Shiyu; Wang, Heng'an; Sun, Jianhe; Yan, Yaxian

    In order to investigate the diverse characteristics of clustered, regularly interspaced short palindromic repeat (CRISPR) arrays and the distribution of virulence factor genes in avian Escherichia coli, 80 E. coli isolates obtained from chickens with avian pathogenic E. coli (APEC) or avian fecal commensal E. coli (AFEC) were identified. Using the multiplex polymerase chain reaction (PCR), five genes were subjected to phylogenetic typing and examined for CRISPR arrays to study genetic relatedness among the strains. The strains were further analyzed for CRISPR loci and virulence factor genes to determine a possible association between their CRISPR elements and their potential virulence. The strains were divided into five phylogenetic groups: A, B1, B2, D and E. It was confirmed that two types of CRISPR arrays, CRISPR1 and CRISPR2, which contain up to 246 distinct spacers, were amplified in most of the strains. Further classification of the isolates was achieved by sorting them into nine CRISPR clusters based on their spacer profiles, which indicates a candidate typing method for E. coli. Several significant differences in invasion-associated gene distribution were found between the APEC isolates and the AFEC isolates. Our results identified the distribution of 11 virulence genes and CRISPR diversity in 80 strains. It was demonstrated that, with the exception of iucD and aslA, there was no sharp demarcation in the gene distribution between the pathogenic (APEC) and commensal (AFEC) strains, while the total number of indicated CRISPR spacers may have a positive correlation with the potential pathogenicity of the E. coli isolates. Copyright © 2016. Published by Elsevier Masson SAS.

  14. Insight into microevolution of Yersinia pestis by clustered regularly interspaced short palindromic repeats.

    Directory of Open Access Journals (Sweden)

    Yujun Cui

    Full Text Available BACKGROUND: Yersinia pestis, the pathogen of plague, has greatly influenced human history on a global scale. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR, an element participating in immunity against phages' invasion, is composed of short repeated sequences separated by unique spacers and provides the basis of the spoligotyping technology. In the present research, three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis. METHODOLOGY/PRINCIPAL FINDINGS: Using PCR amplification, sequencing and online data processing, a high degree of genetic diversity was revealed in all three CRISPR elements. The distribution of spacers and their arrays in Y. pestis strains is strongly region and focus-specific, allowing the construction of a hypothetic evolutionary model of Y. pestis. This model suggests transmission route of microtus strains that encircled Takla Makan Desert and ZhunGer Basin. Starting from Tadjikistan, one branch passed through the Kunlun Mountains, and moved to the Qinghai-Tibet Plateau. Another branch went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Other Y. pestis lineages might be originated from certain areas along those routes. CONCLUSIONS/SIGNIFICANCE: CRISPR can provide important information for genotyping and evolutionary research of bacteria, which will help to trace the source of outbreaks. The resulting data will make possible the development of very low cost and high-resolution assays for the systematic typing of any new isolate.

  15. Laparoscopic excision of a newborn rectal duplication cyst.

    Science.gov (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L

    2008-08-01

    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  16. Surgical management of complete penile duplication accompanied by multiple anomalies.

    Science.gov (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya

    2014-09-01

    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  17. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook

    2003-01-01

    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  18. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  19. Gene conversion in the rice genome

    DEFF Research Database (Denmark)

    Xu, Shuqing; Clark, Terry; Zheng, Hongkun

    2008-01-01

    -chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....

  20. Effects of chemical and physical mutagens on the frequency of a large genetic duplication in Salmonella typhimurium. II

    International Nuclear Information System (INIS)

    Hoffman, G.R.; Morgan, R.W.; Kirven, R.

    1978-01-01

    Strains of Salmonella typhimurium which contain a duplication of approximately 30% of the genome may be obtained by a simple selective procedure. These strains are highly unstable, losing the duplication when grown on non-selective medium. In this paper the authors report that treatment of merodiploid bacteria with mutagenic agents stimulates the rate at which haploid segregants are obtained from merodiploid strains. The mutagens which have been tested for this effect are X-rays, ultraviolet light (UV), ethyl methanesulfonate (EMS), and the azaacridine half-mustard ICR-372. (Auth.)

  1. CRISPR-Cpf1: A New Tool for Plant Genome Editing

    KAUST Repository

    Zaidi, Syed Shan-e-Ali

    2017-05-19

    Clustered regularly interspaced palindromic repeats (CRISPR)-CRISPR-associated proteins (CRISPR-Cas), a groundbreaking genome-engineering tool, has facilitated targeted trait improvement in plants. Recently, CRISPR-CRISPR from Prevotella and Francisella 1 (Cpf1) has emerged as a new tool for efficient genome editing, including DNA-free editing in plants, with higher efficiency, specificity, and potentially wider applications than CRISPR-Cas9.

  2. CRISPR-Cpf1: A New Tool for Plant Genome Editing

    KAUST Repository

    Zaidi, Syed Shan-e-Ali; Mahfouz, Magdy M.; Mansoor, Shahid

    2017-01-01

    Clustered regularly interspaced palindromic repeats (CRISPR)-CRISPR-associated proteins (CRISPR-Cas), a groundbreaking genome-engineering tool, has facilitated targeted trait improvement in plants. Recently, CRISPR-CRISPR from Prevotella and Francisella 1 (Cpf1) has emerged as a new tool for efficient genome editing, including DNA-free editing in plants, with higher efficiency, specificity, and potentially wider applications than CRISPR-Cas9.

  3. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  4. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  5. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2016-01-01

    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  6. Somatic cell nuclear transfer followed by CRIPSR/CAS9 microinjection results in highly efficient genome editing in cloned pigs

    Science.gov (United States)

    The domestic pig is an ideal “dual purpose” animal model for agricultural and biomedical research. With the availability of genome editing tools [e.g. clustered regularly interspersed short palindromic repeat (CRISPR) and associated nuclease Cas9 (CRISPR/Cas9)] it is now possible to perform site-sp...

  7. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    Science.gov (United States)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-­propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727

  8. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  9. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira

    2014-11-01

    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  10. Concomitant urethral triplication, bladder, and colon duplication.

    Science.gov (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi

    2012-02-01

    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  11. Distribution of segmental duplications in the context of higher order chromatin organisation of human chromosome 7

    DEFF Research Database (Denmark)

    Ebert, Grit; Steininger, Anne; Weißmann, Robert

    2014-01-01

    of the Williams-Beuren syndrome locus we demonstrate by cross-species comparison that these SDs have inserted at the borders of a topological domain and that they flank regions with distinct DNA conformation. CONCLUSIONS: Our study suggests a link of nuclear architecture and the propagation of SDs across......BACKGROUND: Segmental duplications (SDs) are not evenly distributed along chromosomes. The reasons for this biased susceptibility to SD insertion are poorly understood. Accumulation of SDs is associated with increased genomic instability, which can lead to structural variants and genomic disorders...... chromosome 7, either by promoting regional SD insertion or by contributing to the establishment of higher order chromatin organisation themselves. The latter could compensate for the high risk of structural rearrangements and thus may have contributed to their evolutionary fixation in the human genome....

  12. The evolution of the tape measure protein: units, duplications and losses

    Directory of Open Access Journals (Sweden)

    Poisson Guylaine

    2011-10-01

    Full Text Available Abstract Background A large family of viruses that infect bacteria, called phages, is characterized by long tails used to inject DNA into their victims' cells. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species. A natural question is whether there exist units for these tape measures, and if different tape measures have different units and lengths. Such units would allow us to retrace the evolution of tape measure proteins using their duplication/loss history. The vast number of sequenced phages genomes allows us to attack this problem with a comparative genomics approach. Results Here we describe a subset of phages whose tape measure proteins contain variable numbers of an 11 amino acids sequence repeat, aligned with sequence similarity, structural properties, and simple arithmetics. This subset provides a unique opportunity for the combinatorial study of phage evolution, without the added uncertainties of multiple alignments, which are trivial in this case, or of protein functions, that are well established. We give a heuristic that reconstructs the duplication history of these sequences, using divergent strains to discriminate between mutations that occurred before and after speciation, or lineage divergence. The heuristic is based on an efficient algorithm that gives an exhaustive enumeration of all possible parsimonious reconstructions of the duplication/speciation history of a single nucleotide. Finally, we present a method that allows, when possible, to discriminate between duplication and loss events. Conclusions Establishing the evolutionary history of viruses is difficult, in part due to extensive recombinations and gene transfers, and high mutation rates that often erase detectable similarity between homologous genes. In this paper, we introduce new tools to address this

  13. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  14. Tandemly Arrayed Genes in Vertebrate Genomes

    Directory of Open Access Journals (Sweden)

    Deng Pan

    2008-01-01

    Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.

  15. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  16. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  17. Spinal Accessory Nerve Duplication: A Case Report and Literature Review

    OpenAIRE

    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios

    2018-01-01

    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  18. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)

    2009-12-15

    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  19. Harnessing CRISPR-Cas systems for bacterial genome editing.

    Science.gov (United States)

    Selle, Kurt; Barrangou, Rodolphe

    2015-04-01

    Manipulation of genomic sequences facilitates the identification and characterization of key genetic determinants in the investigation of biological processes. Genome editing via clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) constitutes a next-generation method for programmable and high-throughput functional genomics. CRISPR-Cas systems are readily reprogrammed to induce sequence-specific DNA breaks at target loci, resulting in fixed mutations via host-dependent DNA repair mechanisms. Although bacterial genome editing is a relatively unexplored and underrepresented application of CRISPR-Cas systems, recent studies provide valuable insights for the widespread future implementation of this technology. This review summarizes recent progress in bacterial genome editing and identifies fundamental genetic and phenotypic outcomes of CRISPR targeting in bacteria, in the context of tool development, genome homeostasis, and DNA repair. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha

    2009-07-01

    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  1. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  2. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  3. CRISPR/Cas9 for Human Genome Engineering and Disease Research.

    Science.gov (United States)

    Xiong, Xin; Chen, Meng; Lim, Wendell A; Zhao, Dehua; Qi, Lei S

    2016-08-31

    The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system, a versatile RNA-guided DNA targeting platform, has been revolutionizing our ability to modify, manipulate, and visualize the human genome, which greatly advances both biological research and therapeutics development. Here, we review the current development of CRISPR/Cas9 technologies for gene editing, transcription regulation, genome imaging, and epigenetic modification. We discuss the broad application of this system to the study of functional genomics, especially genome-wide genetic screening, and to therapeutics development, including establishing disease models, correcting defective genetic mutations, and treating diseases.

  4. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  5. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  6. The Centrosome and Its Duplication Cycle

    Science.gov (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.

    2015-01-01

    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  7. X-linked congenital ptosis and associated intellectual disability, short stature, microcephaly, cleft palate, digital and genital abnormalities define novel Xq25q26 duplication syndrome

    DEFF Research Database (Denmark)

    Møller, R S; Jensen, L R; Maas, S M

    2014-01-01

    , hypogonadism and feeding difficulties. Female carriers are often phenotypically normal or show a similar but milder phenotype, as in most cases the X-chromosome harbouring the duplication is subject to inactivation. Xq28, which includes MECP2 is the major locus for submicroscopic X-chromosome duplications......, whereas duplications in Xq25 and Xq26 have been reported in only a few cases. Using genome-wide array platforms we identified overlapping interstitial Xq25q26 duplications ranging from 0.2 to 4.76 Mb in eight unrelated families with in total five affected males and seven affected females. All affected...... males shared a common phenotype with intrauterine- and postnatal growth retardation and feeding difficulties in childhood. Three had microcephaly and two out of five suffered from epilepsy. In addition, three males had a distinct facial appearance with congenital bilateral ptosis and large protruding...

  8. The ecoresponsive genome of Daphnia pulex

    Energy Technology Data Exchange (ETDEWEB)

    Colbourne, John K.; Pfrender, Michael E.; Gilbert, Donald; Thomas, W. Kelley; Tucker, Abraham; Oakley, Todd H.; Tokishita, Shinichi; Aerts, Andrea; Arnold, Georg J.; Basu, Malay Kumar; Bauer, Darren J.; Caceres, Carla E.; Carmel, Liran; Casola, Claudio; Choi, Jeong-Hyeon; Detter, John C.; Dong, Qunfeng; Dusheyko, Serge; Eads, Brian D.; Frohlich, Thomas; Geiler-Samerotte, Kerry A.; Gerlach, Daniel; Hatcher, Phil; Jogdeo, Sanjuro; Krijgsveld, Jeroen; Kriventseva, Evgenia V; Kültz, Dietmar; Laforsch, Christian; Lindquist, Erika; Lopez, Jacqueline; Manak, Robert; Muller, Jean; Pangilinan, Jasmyn; Patwardhan, Rupali P.; Pitluck, Samuel; Pritham, Ellen J.; Rechtsteiner, Andreas; Rho, Mina; Rogozin, Igor B.; Sakarya, Onur; Salamov, Asaf; Schaack, Sarah; Shapiro, Harris; Shiga, Yasuhiro; Skalitzky, Courtney; Smith, Zachary; Souvorov, Alexander; Sung, Way; Tang, Zuojian; Tsuchiya, Dai; Tu, Hank; Vos, Harmjan; Wang, Mei; Wolf, Yuri I.; Yamagata, Hideo; Yamada, Takuji; Ye, Yuzhen; Shaw, Joseph R.; Andrews, Justen; Crease, Teresa J.; Tang, Haixu; Lucas, Susan M.; Robertson, Hugh M.; Bork, Peer; Koonin, Eugene V.; Zdobnov, Evgeny M.; Grigoriev, Igor V.; Lynch, Michael; Boore, Jeffrey L.

    2011-02-04

    This document provides supporting material related to the sequencing of the ecoresponsive genome of Daphnia pulex. This material includes information on materials and methods and supporting text, as well as supplemental figures, tables, and references. The coverage of materials and methods addresses genome sequence, assembly, and mapping to chromosomes, gene inventory, attributes of a compact genome, the origin and preservation of Daphnia pulex genes, implications of Daphnia's genome structure, evolutionary diversification of duplicated genes, functional significance of expanded gene families, and ecoresponsive genes. Supporting text covers chromosome studies, gene homology among Daphnia genomes, micro-RNA and transposable elements and the 46 Daphnia pulex opsins. 36 figures, 50 tables, 183 references.

  9. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  10. Targeted Porcine Genome Engineering with TALENs

    DEFF Research Database (Denmark)

    Luo, Yonglun; Lin, Lin; Golas, Mariola Monika

    2015-01-01

    Genetically modified pigs are becoming an invaluable animal model for agricultural, pharmaceutical, and biomedical applications. Unlike traditional transgenesis, which is accomplished by randomly inserting an exogenous transgene cassette into the natural chromosomal context, targeted genome editing...... confers precisely editing (e.g., mutations or indels) or insertion of a functional transgenic cassette to user-designed loci. Techniques for targeted genome engineering are growing dramatically and include, e.g., zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs......), and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems. These systems provide enormous potential applications. In this chapter, we review the use of TALENs for targeted genome editing with focus on their application in pigs. In addition, a brief protocol...

  11. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  12. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho

    2002-01-01

    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  13. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  14. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  15. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  16. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki

    2015-01-01

    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  17. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜

    1983-01-01

    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  18. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate.

    Science.gov (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun

    2010-03-01

    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  19. Rectal duplication cyst: a combined abdominal and endoanal operative approach.

    Science.gov (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri

    2007-04-01

    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  20. Ruptured rectal duplication with urogenital abnormality: Unusual presentation.

    Science.gov (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh

    2015-01-01

    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  1. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  2. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly.

    Science.gov (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag

    2017-02-01

    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  3. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  4. Neurodevelopmental and neurobehavioral characteristics in males and females with CDKL5 duplications.

    Science.gov (United States)

    Szafranski, Przemyslaw; Golla, Sailaja; Jin, Weihong; Fang, Ping; Hixson, Patricia; Matalon, Reuben; Kinney, Daniel; Bock, Hans-Georg; Craigen, William; Smith, Janice L; Bi, Weimin; Patel, Ankita; Wai Cheung, Sau; Bacino, Carlos A; Stankiewicz, Paweł

    2015-07-01

    Point mutations and genomic deletions of the CDKL5 (STK9) gene on chromosome Xp22 have been reported in patients with severe neurodevelopmental abnormalities, including Rett-like disorders. To date, only larger-sized (8-21 Mb) duplications harboring CDKL5 have been described. We report seven females and four males from seven unrelated families with CDKL5 duplications 540-935 kb in size. Three families of different ethnicities had identical 667kb duplications containing only the shorter CDKL5 isoform. Four affected boys, 8-14 years of age, and three affected girls, 6-8 years of age, manifested autistic behavior, developmental delay, language impairment, and hyperactivity. Of note, two boys and one girl had macrocephaly. Two carrier mothers of the affected boys reported a history of problems with learning and mathematics while at school. None of the patients had epilepsy. Similarly to CDKL5 mutations and deletions, the X-inactivation pattern in all six studied females was random. We hypothesize that the increased dosage of CDKL5 might have affected interactions of this kinase with its substrates, leading to perturbation of synaptic plasticity and learning, and resulting in autistic behavior, developmental and speech delay, hyperactivity, and macrocephaly.

  5. Williams syndrome deletions and duplications: Genetic windows to understanding anxiety, sociality, autism, and schizophrenia.

    Science.gov (United States)

    Crespi, Bernard J; Procyshyn, Tanya L

    2017-08-01

    We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Complete cloacal duplication imaged before and during pregnancy.

    Science.gov (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi

    2009-01-01

    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  7. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.

    Science.gov (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon

    2011-12-01

    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  8. Endoscopic ultrasonography and rectal duplication cyst in an adult.

    Science.gov (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S

    2017-01-01

    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  9. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  10. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  11. Genome plasticity and systems evolution in Streptomyces

    Science.gov (United States)

    2012-01-01

    Background Streptomycetes are filamentous soil-dwelling bacteria. They are best known as the producers of a great variety of natural products such as antibiotics, antifungals, antiparasitics, and anticancer agents and the decomposers of organic substances for carbon recycling. They are also model organisms for the studies of gene regulatory networks, morphological differentiation, and stress response. The availability of sets of genomes from closely related Streptomyces strains makes it possible to assess the mechanisms underlying genome plasticity and systems adaptation. Results We present the results of a comprehensive analysis of the genomes of five Streptomyces species with distinct phenotypes. These streptomycetes have a pan-genome comprised of 17,362 orthologous families which includes 3,096 components in the core genome, 5,066 components in the dispensable genome, and 9,200 components that are uniquely present in only one species. The core genome makes up about 33%-45% of each genome repertoire. It contains important genes for Streptomyces biology including those involved in gene regulation, secretion, secondary metabolism and morphological differentiation. Abundant duplicate genes have been identified, with 4%-11% of the whole genomes composed of lineage-specific expansions (LSEs), suggesting that frequent gene duplication or lateral gene transfer events play a role in shaping the genome diversification within this genus. Two patterns of expansion, single gene expansion and chromosome block expansion are observed, representing different scales of duplication. Conclusions Our results provide a catalog of genome components and their potential functional roles in gene regulatory networks and metabolic networks. The core genome components reveal the minimum requirement for streptomycetes to sustain a successful lifecycle in the soil environment, reflecting the effects of both genome evolution and environmental stress acting upon the expressed phenotypes. A

  12. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    Science.gov (United States)

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. A Genome-Wide Landscape of Retrocopies in Primate Genomes.

    Science.gov (United States)

    Navarro, Fábio C P; Galante, Pedro A F

    2015-07-29

    Gene duplication is a key factor contributing to phenotype diversity across and within species. Although the availability of complete genomes has led to the extensive study of genomic duplications, the dynamics and variability of gene duplications mediated by retrotransposition are not well understood. Here, we predict mRNA retrotransposition and use comparative genomics to investigate their origin and variability across primates. Analyzing seven anthropoid primate genomes, we found a similar number of mRNA retrotranspositions (∼7,500 retrocopies) in Catarrhini (Old Word Monkeys, including humans), but a surprising large number of retrocopies (∼10,000) in Platyrrhini (New World Monkeys), which may be a by-product of higher long interspersed nuclear element 1 activity in these genomes. By inferring retrocopy orthology, we dated most of the primate retrocopy origins, and estimated a decrease in the fixation rate in recent primate history, implying a smaller number of species-specific retrocopies. Moreover, using RNA-Seq data, we identified approximately 3,600 expressed retrocopies. As expected, most of these retrocopies are located near or within known genes, present tissue-specific and even species-specific expression patterns, and no expression correlation to their parental genes. Taken together, our results provide further evidence that mRNA retrotransposition is an active mechanism in primate evolution and suggest that retrocopies may not only introduce great genetic variability between lineages but also create a large reservoir of potentially functional new genomic loci in primate genomes. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Recent Duplication and Functional Divergence in Parasitic Nematode Levamisole-Sensitive Acetylcholine Receptors.

    Directory of Open Access Journals (Sweden)

    Thomas B Duguet

    2016-07-01

    Full Text Available Helminth parasites rely on fast-synaptic transmission in their neuromusculature to experience the outside world and respond to it. Acetylcholine plays a pivotal role in this and its receptors are targeted by a wide variety of both natural and synthetic compounds used in human health and for the control of parasitic disease. The model, Caenorhabditis elegans is characterized by a large number of acetylcholine receptor subunit genes, a feature shared across the nematodes. This dynamic family is characterized by both gene duplication and loss between species. The pentameric levamisole-sensitive acetylcholine receptor has been characterized from C. elegans, comprised of five different subunits. More recently, cognate receptors have been reconstituted from multiple parasitic nematodes that are found to vary in subunit composition. In order to understand the implications of receptor composition change and the origins of potentially novel drug targets, we investigated a specific example of subunit duplication based on analysis of genome data for 25 species from the 50 helminth genome initiative. We found multiple independent duplications of the unc-29, acetylcholine receptor subunit, where codon substitution rate analysis identified positive, directional selection acting on amino acid positions associated with subunit assembly. Characterization of four gene copies from a model parasitic nematode, Haemonchus contortus, demonstrated that each copy has acquired unique functional characteristics based on phenotype rescue of transgenic C. elegans and electrophysiology of receptors reconstituted in Xenopus oocytes. We found evidence that a specific incompatibility has evolved for two subunits co-expressed in muscle. We demonstrated that functional divergence of acetylcholine receptors, driven by directional selection, can occur more rapidly than previously thought and may be mediated by alteration of receptor assembly. This phenomenon is common among the

  15. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  16. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  17. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  18. Clustered Regularly Interspaced Short Palindromic Repeat-Dependent, Biofilm-Specific Death of Pseudomonas aeruginosa Mediated by Increased Expression of Phage-Related Genes.

    Science.gov (United States)

    Heussler, Gary E; Cady, Kyle C; Koeppen, Katja; Bhuju, Sabin; Stanton, Bruce A; O'Toole, George A

    2015-05-12

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (CRISPR/Cas) system is an adaptive immune system present in many archaea and bacteria. CRISPR/Cas systems are incredibly diverse, and there is increasing evidence of CRISPR/Cas systems playing a role in cellular functions distinct from phage immunity. Previously, our laboratory reported one such alternate function in which the type 1-F CRISPR/Cas system of the opportunistic pathogen Pseudomonas aeruginosa strain UCBPP-PA14 (abbreviated as P. aeruginosa PA14) inhibits both biofilm formation and swarming motility when the bacterium is lysogenized by the bacteriophage DMS3. In this study, we demonstrated that the presence of just the DMS3 protospacer and the protospacer-adjacent motif (PAM) on the P. aeruginosa genome is necessary and sufficient for this CRISPR-dependent loss of these group behaviors, with no requirement of additional DMS3 sequences. We also demonstrated that the interaction of the CRISPR system with the DMS3 protospacer induces expression of SOS-regulated phage-related genes, including the well-characterized pyocin operon, through the activity of the nuclease Cas3 and subsequent RecA activation. Furthermore, our data suggest that expression of the phage-related genes results in bacterial cell death on a surface due to the inability of the CRISPR-engaged strain to downregulate phage-related gene expression, while these phage-related genes have minimal impact on growth and viability under planktonic conditions. Deletion of the phage-related genes restores biofilm formation and swarming motility while still maintaining a functional CRISPR/Cas system, demonstrating that the loss of these group behaviors is an indirect effect of CRISPR self-targeting. The various CRISPR/Cas systems found in both archaea and bacteria are incredibly diverse, and advances in understanding the complex mechanisms of these varied systems has not only increased our knowledge of host

  19. Gastric duplication cyst: A cause of rectal bleeding in a young child.

    Science.gov (United States)

    Surridge, Clare A; Goodier, Matthew D

    2014-01-01

    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  20. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge

    2014-01-01

    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  1. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  2. Partial duplication of head--a rare congenital anomaly.

    Science.gov (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass

    2004-10-01

    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  3. [Overview of patents on targeted genome editing technologies and their implications for innovation and entrepreneurship education in universities].

    Science.gov (United States)

    Fan, Xiang-yu; Lin, Yan-ping; Liao, Guo-jian; Xie, Jian-ping

    2015-12-01

    Zinc finger nuclease, transcription activator-like effector nuclease, and clustered regularly interspaced short palindromic repeats/Cas9 nuclease are important targeted genome editing technologies. They have great significance in scientific research and applications on aspects of functional genomics research, species improvement, disease prevention and gene therapy. There are past or ongoing disputes over ownership of the intellectual property behind every technology. In this review, we summarize the patents on these three targeted genome editing technologies in order to provide some reference for developing genome editing technologies with self-owned intellectual property rights and some implications for current innovation and entrepreneurship education in universities.

  4. Genome Sequence of the Palaeopolyploid soybean

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.

    2009-08-03

    Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.

  5. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  6. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes

    Science.gov (United States)

    Liu, Shengyi; Liu, Yumei; Yang, Xinhua; Tong, Chaobo; Edwards, David; Parkin, Isobel A. P.; Zhao, Meixia; Ma, Jianxin; Yu, Jingyin; Huang, Shunmou; Wang, Xiyin; Wang, Junyi; Lu, Kun; Fang, Zhiyuan; Bancroft, Ian; Yang, Tae-Jin; Hu, Qiong; Wang, Xinfa; Yue, Zhen; Li, Haojie; Yang, Linfeng; Wu, Jian; Zhou, Qing; Wang, Wanxin; King, Graham J; Pires, J. Chris; Lu, Changxin; Wu, Zhangyan; Sampath, Perumal; Wang, Zhuo; Guo, Hui; Pan, Shengkai; Yang, Limei; Min, Jiumeng; Zhang, Dong; Jin, Dianchuan; Li, Wanshun; Belcram, Harry; Tu, Jinxing; Guan, Mei; Qi, Cunkou; Du, Dezhi; Li, Jiana; Jiang, Liangcai; Batley, Jacqueline; Sharpe, Andrew G; Park, Beom-Seok; Ruperao, Pradeep; Cheng, Feng; Waminal, Nomar Espinosa; Huang, Yin; Dong, Caihua; Wang, Li; Li, Jingping; Hu, Zhiyong; Zhuang, Mu; Huang, Yi; Huang, Junyan; Shi, Jiaqin; Mei, Desheng; Liu, Jing; Lee, Tae-Ho; Wang, Jinpeng; Jin, Huizhe; Li, Zaiyun; Li, Xun; Zhang, Jiefu; Xiao, Lu; Zhou, Yongming; Liu, Zhongsong; Liu, Xuequn; Qin, Rui; Tang, Xu; Liu, Wenbin; Wang, Yupeng; Zhang, Yangyong; Lee, Jonghoon; Kim, Hyun Hee; Denoeud, France; Xu, Xun; Liang, Xinming; Hua, Wei; Wang, Xiaowu; Wang, Jun; Chalhoub, Boulos; Paterson, Andrew H

    2014-01-01

    Polyploidization has provided much genetic variation for plant adaptive evolution, but the mechanisms by which the molecular evolution of polyploid genomes establishes genetic architecture underlying species differentiation are unclear. Brassica is an ideal model to increase knowledge of polyploid evolution. Here we describe a draft genome sequence of Brassica oleracea, comparing it with that of its sister species B. rapa to reveal numerous chromosome rearrangements and asymmetrical gene loss in duplicated genomic blocks, asymmetrical amplification of transposable elements, differential gene co-retention for specific pathways and variation in gene expression, including alternative splicing, among a large number of paralogous and orthologous genes. Genes related to the production of anticancer phytochemicals and morphological variations illustrate consequences of genome duplication and gene divergence, imparting biochemical and morphological variation to B. oleracea. This study provides insights into Brassica genome evolution and will underpin research into the many important crops in this genus. PMID:24852848

  7. Genome sequence and genetic diversity of European ash trees

    DEFF Research Database (Denmark)

    Sollars, Elizabeth S A; Harper, Andrea L; Kelly, Laura J

    2017-01-01

    -heterozygosity Fraxinus excelsior tree from Gloucestershire, UK, annotating 38,852 protein-coding genes of which 25% appear ash specific when compared with the genomes of ten other plant species. Analyses of paralogous genes suggest a whole-genome duplication shared with olive (Olea europaea, Oleaceae). We also re...

  8. Unleashing the genome of Brassica rapa

    Directory of Open Access Journals (Sweden)

    Haibao eTang

    2012-07-01

    Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

  9. The infinite sites model of genome evolution.

    Science.gov (United States)

    Ma, Jian; Ratan, Aakrosh; Raney, Brian J; Suh, Bernard B; Miller, Webb; Haussler, David

    2008-09-23

    We formalize the problem of recovering the evolutionary history of a set of genomes that are related to an unseen common ancestor genome by operations of speciation, deletion, insertion, duplication, and rearrangement of segments of bases. The problem is examined in the limit as the number of bases in each genome goes to infinity. In this limit, the chromosomes are represented by continuous circles or line segments. For such an infinite-sites model, we present a polynomial-time algorithm to find the most parsimonious evolutionary history of any set of related present-day genomes.

  10. Polyploidy: adaptation to the genomic environment.

    Science.gov (United States)

    Hollister, Jesse D

    2015-02-01

    Genomic evidence of ancestral whole genome duplication (WGD) and polyploidy is widespread among eukaryotic species, and especially among plants. WGD is thought to provide the raw material for adaptation in the form of duplicated genes, and polyploids are thought to benefit from both physiological and genetic buffering. Comparatively little attention has focused on the genomic challenge of polyploidy, however, although much evidence exists that polyploidy severely perturbs important cellular functions. Here, I review recent progress in the study of the re-establishment of stable meiosis in recently evolved polyploids, focusing on four plant species. This work has yielded an insight into the mechanisms underlying stabilization of genome transmission in polyploids, and is revealing remarkable parallels among diverse taxa. Importantly, these studies also provide a road map for investigating how polyploids respond to the challenge of WGD.

  11. Obstetric significance of fetal craniofacial duplication. A case report.

    Science.gov (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H

    1985-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  12. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  13. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  14. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  15. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  16. Duplicate laboratory test reduction using a clinical decision support tool.

    Science.gov (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice

    2014-05-01

    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  17. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  18. Duplicate Health Insurance Coverage: Determinants of Variation Across States

    OpenAIRE

    Luft, Harold S.; Maerki, Susan C.

    1982-01-01

    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  19. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)

    1995-11-20

    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  20. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey

    2013-01-01

    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  1. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  2. An unusual presentation of a rectal duplication cyst.

    Science.gov (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D

    2012-01-01

    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  3. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin

    2018-06-01

    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  4. Identification of approximately duplicate material records in ERP systems

    Science.gov (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic

    2017-03-01

    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  5. Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice

    Directory of Open Access Journals (Sweden)

    Katerina Kraft

    2015-02-01

    Full Text Available Structural variations (SVs contribute to the variability of our genome and are often associated with disease. Their study in model systems was hampered until now by labor-intensive genetic targeting procedures and multiple mouse crossing steps. Here we present the use of CRISPR/Cas for the fast (10 weeks and efficient generation of SVs in mice. We specifically produced deletions, inversions, and also duplications at six different genomic loci ranging from 1.1 kb to 1.6 Mb with efficiencies up to 42%. After PCR-based selection, clones were successfully used to create mice via aggregation. To test the practicability of the method, we reproduced a human 500 kb disease-associated deletion and were able to recapitulate the human phenotype in mice. Furthermore, we evaluated the regulatory potential of a large genomic interval by deleting a 1.5 Mb fragment. The method presented permits rapid in vivo modeling of genomic rearrangements.

  6. The Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9 (CRISPR/Cas9)-created MDM2 T309G Mutation Enhances Vitreous-induced Expression of MDM2 and Proliferation and Survival of Cells.

    Science.gov (United States)

    Duan, Yajian; Ma, Gaoen; Huang, Xionggao; D'Amore, Patricia A; Zhang, Feng; Lei, Hetian

    2016-07-29

    The G309 allele of SNPs in the mouse double minute (MDM2) promoter locus is associated with a higher risk of cancer and proliferative vitreoretinopathy (PVR), but whether SNP G309 contributes to the pathogenesis of PVR is to date unknown. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease (Cas) 9 from Streptococcus pyogenes (SpCas9) can be harnessed to manipulate a single or multiple nucleotides in mammalian cells. Here we delivered SpCas9 and guide RNAs using dual adeno-associated virus-derived vectors to target the MDM2 genomic locus together with a homologous repair template for creating the mutation of MDM2 T309G in human primary retinal pigment epithelial (hPRPE) cells whose genotype is MDM2 T309T. The next-generation sequencing results indicated that there was 42.51% MDM2 G309 in the edited hPRPE cells using adeno-associated viral CRISPR/Cas9. Our data showed that vitreous induced an increase in MDM2 and subsequent attenuation of p53 expression in MDM2 T309G hPRPE cells. Furthermore, our experimental results demonstrated that MDM2 T309G in hPRPE cells enhanced vitreous-induced cell proliferation and survival, suggesting that this SNP contributes to the pathogenesis of PVR. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Genome editing: a robust technology for human stem cells.

    Science.gov (United States)

    Chandrasekaran, Arun Pandian; Song, Minjung; Ramakrishna, Suresh

    2017-09-01

    Human pluripotent stem cells comprise induced pluripotent and embryonic stem cells, which have tremendous potential for biological and therapeutic applications. The development of efficient technologies for the targeted genome alteration of stem cells in disease models is a prerequisite for utilizing stem cells to their full potential. Genome editing of stem cells is possible with the help of synthetic nucleases that facilitate site-specific modification of a gene of interest. Recent advances in genome editing techniques have improved the efficiency and speed of the development of stem cells for human disease models. Zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated system are powerful tools for editing DNA at specific loci. Here, we discuss recent technological advances in genome editing with site-specific nucleases in human stem cells.

  8. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)

    1995-12-31

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  9. Recurrent reciprocal genomic rearrangements of 17q12 are associated with renal disease, diabetes, and epilepsy

    DEFF Research Database (Denmark)

    Mefford, Heather C; Clauin, Severine; Sharp, Andrew J

    2007-01-01

    predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One...

  10. Evolution of the Largest Mammalian Genome.

    Science.gov (United States)

    Evans, Ben J; Upham, Nathan S; Golding, Goeffrey B; Ojeda, Ricardo A; Ojeda, Agustina A

    2017-06-01

    The genome of the red vizcacha rat (Rodentia, Octodontidae, Tympanoctomys barrerae) is the largest of all mammals, and about double the size of their close relative, the mountain vizcacha rat Octomys mimax, even though the lineages that gave rise to these species diverged from each other only about 5 Ma. The mechanism for this rapid genome expansion is controversial, and hypothesized to be a consequence of whole genome duplication or accumulation of repetitive elements. To test these alternative but nonexclusive hypotheses, we gathered and evaluated evidence from whole transcriptome and whole genome sequences of T. barrerae and O. mimax. We recovered support for genome expansion due to accumulation of a diverse assemblage of repetitive elements, which represent about one half and one fifth of the genomes of T. barrerae and O. mimax, respectively, but we found no strong signal of whole genome duplication. In both species, repetitive sequences were rare in transcribed regions as compared with the rest of the genome, and mostly had no close match to annotated repetitive sequences from other rodents. These findings raise new questions about the genomic dynamics of these repetitive elements, their connection to widespread chromosomal fissions that occurred in the T. barrerae ancestor, and their fitness effects-including during the evolution of hypersaline dietary tolerance in T. barrerae. ©The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Alignment of whole genomes.

    Science.gov (United States)

    Delcher, A L; Kasif, S; Fleischmann, R D; Peterson, J; White, O; Salzberg, S L

    1999-01-01

    A new system for aligning whole genome sequences is described. Using an efficient data structure called a suffix tree, the system is able to rapidly align sequences containing millions of nucleotides. Its use is demonstrated on two strains of Mycoplasma tuberculosis, on two less similar species of Mycoplasma bacteria and on two syntenic sequences from human chromosome 12 and mouse chromosome 6. In each case it found an alignment of the input sequences, using between 30 s and 2 min of computation time. From the system output, information on single nucleotide changes, translocations and homologous genes can easily be extracted. Use of the algorithm should facilitate analysis of syntenic chromosomal regions, strain-to-strain comparisons, evolutionary comparisons and genomic duplications. PMID:10325427

  12. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report.

    Science.gov (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S

    2007-01-01

    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  13. A novel family of sequence-specific endoribonucleases associated with the clustered regularly interspaced short palindromic repeats.

    Science.gov (United States)

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D; Proudfoot, Michael; Makarova, Kira S; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V; Edwards, Aled M; Savchenko, Alexei; Yakunin, Alexander F

    2008-07-18

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6A resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  14. Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora.

    Science.gov (United States)

    Rezzonico, Fabio; Smits, Theo H M; Duffy, Brion

    2011-06-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system.

  15. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci.

    Science.gov (United States)

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson's index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type.

  16. Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses.

    Science.gov (United States)

    Pride, David T; Salzman, Julia; Relman, David A

    2012-09-01

    Explorations of human microbiota have provided substantial insight into microbial community composition; however, little is known about interactions between various microbial components in human ecosystems. In response to the powerful impact of viral predation, bacteria have acquired potent defences, including an adaptive immune response based on the clustered regularly interspaced short palindromic repeats (CRISPRs)/Cas system. To improve our understanding of the interactions between bacteria and their viruses in humans, we analysed 13 977 streptococcal CRISPR sequences and compared them with 2 588 172 virome reads in the saliva of four human subjects over 17 months. We found a diverse array of viruses and CRISPR spacers, many of which were specific to each subject and time point. There were numerous viral sequences matching CRISPR spacers; these matches were highly specific for salivary viruses. We determined that spacers and viruses coexist at the same time, which suggests that streptococcal CRISPR/Cas systems are under constant pressure from salivary viruses. CRISPRs in some subjects were just as likely to match viral sequences from other subjects as they were to match viruses from the same subject. Because interactions between bacteria and viruses help to determine the structure of bacterial communities, CRISPR-virus analyses are likely to provide insight into the forces shaping the human microbiome. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  17. Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes.

    Science.gov (United States)

    Al-Attar, Sinan; Westra, Edze R; van der Oost, John; Brouns, Stan J J

    2011-04-01

    Many prokaryotes contain the recently discovered defense system against mobile genetic elements. This defense system contains a unique type of repetitive DNA stretches, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). CRISPRs consist of identical repeated DNA sequences (repeats), interspaced by highly variable sequences referred to as spacers. The spacers originate from either phages or plasmids and comprise the prokaryotes' 'immunological memory'. CRISPR-associated (cas) genes encode conserved proteins that together with CRISPRs make-up the CRISPR/Cas system, responsible for defending the prokaryotic cell against invaders. CRISPR-mediated resistance has been proposed to involve three stages: (i) CRISPR-Adaptation, the invader DNA is encountered by the CRISPR/Cas machinery and an invader-derived short DNA fragment is incorporated in the CRISPR array. (ii) CRISPR-Expression, the CRISPR array is transcribed and the transcript is processed by Cas proteins. (iii) CRISPR-Interference, the invaders' nucleic acid is recognized by complementarity to the crRNA and neutralized. An application of the CRISPR/Cas system is the immunization of industry-relevant prokaryotes (or eukaryotes) against mobile-genetic invasion. In addition, the high variability of the CRISPR spacer content can be exploited for phylogenetic and evolutionary studies. Despite impressive progress during the last couple of years, the elucidation of several fundamental details will be a major challenge in future research.

  18. Molecular identification and characterization of clustered regularly interspaced short palindromic repeat (CRISPR) gene cluster in Taylorella equigenitalis.

    Science.gov (United States)

    Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo

    2013-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.

  19. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNAs in the Porphyromonas gingivalis CRISPR-Cas I-C System.

    Science.gov (United States)

    Burmistrz, Michal; Rodriguez Martinez, Jose Ignacio; Krochmal, Daniel; Staniec, Dominika; Pyrc, Krzysztof

    2017-12-01

    The CRISPR-Cas (clustered regularly interspaced short palindromic repeat-CRISPR-associated protein) system is unique to prokaryotes and provides the majority of bacteria and archaea with immunity against nucleic acids of foreign origin. CRISPR RNAs (crRNAs) are the key element of this system, since they are responsible for its selectivity and effectiveness. Typical crRNAs consist of a spacer sequence flanked with 5' and 3' handles originating from repeat sequences that are important for recognition of these small RNAs by the Cas machinery. In this investigation, we studied the type I-C CRISPR-Cas system in Porphyromonas gingivalis , a human pathogen associated with periodontitis, rheumatoid arthritis, cardiovascular disease, and aspiration pneumonia. We demonstrated the importance of the 5' handle for crRNA recognition by the effector complex and consequently activity, as well as secondary trimming of the 3' handle, which was not affected by modifications of the repeat sequence. IMPORTANCE Porphyromonas gingivalis , a clinically relevant Gram-negative, anaerobic bacterium, is one of the major etiologic agents of periodontitis and has been linked with the development of other clinical conditions, including rheumatoid arthritis, cardiovascular disease, and aspiration pneumonia. The presented results on the biogenesis and functions of crRNAs expand our understanding of CRISPR-Cas cellular defenses in P. gingivalis and of horizontal gene transfer in bacteria. Copyright © 2017 American Society for Microbiology.

  20. Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas2 protein.

    Science.gov (United States)

    Nam, Ki Hyun; Ding, Fran; Haitjema, Charles; Huang, Qingqiu; DeLisa, Matthew P; Ke, Ailong

    2012-10-19

    The CRISPR (clustered regularly interspaced short palindromic repeats) system is a prokaryotic RNA-based adaptive immune system against extrachromosomal genetic elements. Cas2 is a universally conserved core CRISPR-associated protein required for the acquisition of new spacers for CRISPR adaptation. It was previously characterized as an endoribonuclease with preference for single-stranded (ss)RNA. Here, we show using crystallography, mutagenesis, and isothermal titration calorimetry that the Bacillus halodurans Cas2 (Bha_Cas2) from the subtype I-C/Dvulg CRISPR instead possesses metal-dependent endonuclease activity against double-stranded (ds)DNA. This activity is consistent with its putative function in producing new spacers for insertion into the 5'-end of the CRISPR locus. Mutagenesis and isothermal titration calorimetry studies revealed that a single divalent metal ion (Mg(2+) or Mn(2+)), coordinated by a symmetric Asp pair in the Bha_Cas2 dimer, is involved in the catalysis. We envision that a pH-dependent conformational change switches Cas2 into a metal-binding competent conformation for catalysis. We further propose that the distinct substrate preferences among Cas2 proteins may be determined by the sequence and structure in the β1-α1 loop.

  1. Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families.

    Science.gov (United States)

    Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele

    2017-05-04

    Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  2. Six subgroups and extensive recent duplications characterize the evolution of the eukaryotic tubulin protein family.

    Science.gov (United States)

    Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin

    2014-08-27

    Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Population Genomics of Infectious and Integrated Wolbachia pipientis Genomes in Drosophila ananassae

    Science.gov (United States)

    Choi, Jae Young; Bubnell, Jaclyn E.; Aquadro, Charles F.

    2015-01-01

    Coevolution between Drosophila and its endosymbiont Wolbachia pipientis has many intriguing aspects. For example, Drosophila ananassae hosts two forms of W. pipientis genomes: One being the infectious bacterial genome and the other integrated into the host nuclear genome. Here, we characterize the infectious and integrated genomes of W. pipientis infecting D. ananassae (wAna), by genome sequencing 15 strains of D. ananassae that have either the infectious or integrated wAna genomes. Results indicate evolutionarily stable maternal transmission for the infectious wAna genome suggesting a relatively long-term coevolution with its host. In contrast, the integrated wAna genome showed pseudogene-like characteristics accumulating many variants that are predicted to have deleterious effects if present in an infectious bacterial genome. Phylogenomic analysis of sequence variation together with genotyping by polymerase chain reaction of large structural variations indicated several wAna variants among the eight infectious wAna genomes. In contrast, only a single wAna variant was found among the seven integrated wAna genomes examined in lines from Africa, south Asia, and south Pacific islands suggesting that the integration occurred once from a single infectious wAna genome and then spread geographically. Further analysis revealed that for all D. ananassae we examined with the integrated wAna genomes, the majority of the integrated wAna genomic regions is represented in at least two copies suggesting a double integration or single integration followed by an integrated genome duplication. The possible evolutionary mechanism underlying the widespread geographical presence of the duplicate integration of the wAna genome is an intriguing question remaining to be answered. PMID:26254486

  4. Diprosopus (partially duplicated head) associated with anencephaly: a case report.

    Science.gov (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M

    1999-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  5. [Anterior rectal duplication in adult patient: a case report].

    Science.gov (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E

    2009-01-01

    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  6. [Efficient genome editing in human pluripotent stem cells through CRISPR/Cas9].

    Science.gov (United States)

    Liu, Gai-gai; Li, Shuang; Wei, Yu-da; Zhang, Yong-xian; Ding, Qiu-rong

    2015-11-01

    The RNA-guided CRISPR (clustered regularly interspaced short palindromic repeat)-associated Cas9 nuclease has offered a new platform for genome editing with high efficiency. Here, we report the use of CRISPR/Cas9 technology to target a specific genomic region in human pluripotent stem cells. We show that CRISPR/Cas9 can be used to disrupt a gene by introducing frameshift mutations to gene coding region; to knock in specific sequences (e.g. FLAG tag DNA sequence) to targeted genomic locus via homology directed repair; to induce large genomic deletion through dual-guide multiplex. Our results demonstrate the versatile application of CRISPR/Cas9 in stem cell genome editing, which can be widely utilized for functional studies of genes or genome loci in human pluripotent stem cells.

  7. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  8. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  9. Penile Duplication and Two Anal Openings; Report of a Very Rare Case

    OpenAIRE

    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad

    2012-01-01

    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  10. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  11. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  12. Multiple Whole Genome Alignments Without a Reference Organism

    Energy Technology Data Exchange (ETDEWEB)

    Dubchak, Inna; Poliakov, Alexander; Kislyuk, Andrey; Brudno, Michael

    2009-01-16

    Multiple sequence alignments have become one of the most commonly used resources in genomics research. Most algorithms for multiple alignment of whole genomes rely either on a reference genome, against which all of the other sequences are laid out, or require a one-to-one mapping between the nucleotides of the genomes, preventing the alignment of recently duplicated regions. Both approaches have drawbacks for whole-genome comparisons. In this paper we present a novel symmetric alignment algorithm. The resulting alignments not only represent all of the genomes equally well, but also include all relevant duplications that occurred since the divergence from the last common ancestor. Our algorithm, implemented as a part of the VISTA Genome Pipeline (VGP), was used to align seven vertebrate and sixDrosophila genomes. The resulting whole-genome alignments demonstrate a higher sensitivity and specificity than the pairwise alignments previously available through the VGP and have higher exon alignment accuracy than comparable public whole-genome alignments. Of the multiple alignment methods tested, ours performed the best at aligning genes from multigene families?perhaps the most challenging test for whole-genome alignments. Our whole-genome multiple alignments are available through the VISTA Browser at http://genome.lbl.gov/vista/index.shtml.

  13. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  14. Rectal duplication cyst in an adult: the laparoscopic approach.

    Science.gov (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles

    2002-12-01

    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  15. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  16. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  17. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.

    Science.gov (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat

    2015-08-01

    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  18. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  19. Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens

    Directory of Open Access Journals (Sweden)

    Ming TIAN,Suyun FANG,Yanqiang WANG,Xiaorong GU,Chungang FENG,Rui HAO,Xiaoxiang HU,Ning LI

    2014-06-01

    Full Text Available The dermal hyperpigmentation phenotype in chickens is controlled by the dominant fibromelanosis allele. One of the ten unique characteristics of Silkie chickens is the fibromelanosis phenotype, which is pigmentation in the dermal layer of the skin and connective tissue. In this study, we found a mutation of fibromelanosis, a genomic rearrangement that included an inverted duplication of endothelin3 (EDN3, is responsible. We show that, as a stimulator of melanoblast proliferation, EDN3 expression was increased in silkie embryos and in both skin and muscle throughout adulthood. EDN3 expression led to an increase in expression of the downstream genes EDNRB2 and TYRP2, and was closely relate with the hyperpigmentation phenotype. We examined eight different Chinese chicken breeds showing hyperpigmentation and conclude that this structural genetic variant exists in all fibromelanosis chicken breeds.

  20. Phenotypic variation in a large Swedish pedigree due to SNCA duplication and triplication

    DEFF Research Database (Denmark)

    Fuchs, J; Nilsson, C; Kachergus, J

    2007-01-01

    complex. The genetic basis for familial parkinsonism is an SNCA-MMRN11 multiplication, but whereas SNCA-MMRN1 duplication in the Swedish proband (Branch J) leads to late-onset autonomic dysfunction and parkinsonism, SNCA-MMRN1 triplication in the Swedish American family (Branch I) leads to early......BACKGROUND: The "Lister family complex," an extensive Swedish family with autosomal dominant Parkinson disease, was first described by Henry Mjönes in 1949. On the basis of clinical, molecular, and genealogic findings on a Swedish and an American family branch, we provide genetic evidence...... that explains the parkinsonism in this extended pedigree. METHODS: Clinical methods included a detailed neurologic exam of the proband of the Swedish family branch, MRI, and ([123]I)-beta-CIT SPECT imaging. Genomic analysis included alpha-synuclein sequencing, SNCA real-time PCR dosage, chromosome 4q21...

  1. Telomere maintenance through recruitment of internal genomic regions.

    Science.gov (United States)

    Seo, Beomseok; Kim, Chuna; Hills, Mark; Sung, Sanghyun; Kim, Hyesook; Kim, Eunkyeong; Lim, Daisy S; Oh, Hyun-Seok; Choi, Rachael Mi Jung; Chun, Jongsik; Shim, Jaegal; Lee, Junho

    2015-09-18

    Cells surviving crisis are often tumorigenic and their telomeres are commonly maintained through the reactivation of telomerase. However, surviving cells occasionally activate a recombination-based mechanism called alternative lengthening of telomeres (ALT). Here we establish stably maintained survivors in telomerase-deleted Caenorhabditis elegans that escape from sterility by activating ALT. ALT survivors trans-duplicate an internal genomic region, which is already cis-duplicated to chromosome ends, across the telomeres of all chromosomes. These 'Template for ALT' (TALT) regions consist of a block of genomic DNA flanked by telomere-like sequences, and are different between two genetic background. We establish a model that an ancestral duplication of a donor TALT region to a proximal telomere region forms a genomic reservoir ready to be incorporated into telomeres on ALT activation.

  2. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook

    2006-01-01

    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  3. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani

    2016-01-01

    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  4. Ruptured rectal duplication cyst with classical bladder exstrophy.

    Science.gov (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh

    2010-07-01

    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  5. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco

    2010-01-01

    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  6. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.

    1998-01-01

    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  7. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  8. 19q12q13.2 duplication syndrome: neuropsychiatric long-term follow-up of a new case and literature update

    Directory of Open Access Journals (Sweden)

    Nacinovich R

    2017-10-01

    Full Text Available Renata Nacinovich,1,2 Nicoletta Villa,3 Fiorenza Broggi,1,2 Cristina Tavaniello,1 Monica Bomba,1 Donatella Conconi,2 Serena Redaelli,2 Elena Sala,3 Marialuisa Lavitrano,2 Francesca Neri1,2 1Childhood and Adolescence Neuropsychiatric Unit, San Gerardo Hospital, 2School of Medicine and Surgery, University of Milano Bicocca, 3Medical Genetics Laboratory, Clinical Pathology Department, San Gerardo Hospital, Monza, Italy Abstract: Genetic syndromes are well characterized by the phenotypic point of view, but little is known about their progression and patients’ quality of life. We report a 10-year neuropsychiatric follow-up of a boy with duplication of chromosome 19. Cytogenetic investigation was requested at the age of 5 years for psychomotor and speech delay. The genomic study identified an 8.17 Mb duplication on chromosome 19q12q13.2. We propose that the long-term follow-up of our patient would help to delineate the neuropsychiatric phenotype associated with 19q duplication. This study could be a model for further long-term research in the neuropsychiatric follow-up of patients with 19q duplication syndrome. Keywords: 19q duplication, neuropsychiatric follow-up, array-CGH

  9. Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

    Science.gov (United States)

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

    2011-07-01

    A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. The genome editing revolution: A CRISPR-Cas TALE off-target story.

    Science.gov (United States)

    Stella, Stefano; Montoya, Guillermo

    2016-07-01

    In the last 10 years, we have witnessed a blooming of targeted genome editing systems and applications. The area was revolutionized by the discovery and characterization of the transcription activator-like effector proteins, which are easier to engineer to target new DNA sequences than the previously available DNA binding templates, zinc fingers and meganucleases. Recently, the area experimented a quantum leap because of the introduction of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) system (clustered regularly interspaced short palindromic sequence). This ribonucleoprotein complex protects bacteria from invading DNAs, and it was adapted to be used in genome editing. The CRISPR ribonucleic acid (RNA) molecule guides to the specific DNA site the Cas9 nuclease to cleave the DNA target. Two years and more than 1000 publications later, the CRISPR-Cas system has become the main tool for genome editing in many laboratories. Currently the targeted genome editing technology has been used in many fields and may be a possible approach for human gene therapy. Furthermore, it can also be used to modifying the genomes of model organisms for studying human pathways or to improve key organisms for biotechnological applications, such as plants, livestock genome as well as yeasts and bacterial strains. © 2016 The Authors. BioEssays published by WILEY Periodicals, Inc.

  11. Genome Editing in Sugarcane: Challenges ahead

    Directory of Open Access Journals (Sweden)

    Chakravarthi Mohan

    2016-10-01

    Full Text Available Genome editing opens new and unique opportunities for researchers to enhance crop production. Until 2013, the zinc finger nucleases (ZFNs and transcription activator-like effector nucleases (TALENs were the key tools used for genome editing applications. The advent of RNA-guided engineered nucleases - the type II clustered regularly interspaced short palindromic repeat (CRISPR/Cas9 (CRISPR-associated system from Streptococcus pyogenes holds great potential since it is simple, effective and more versatile than ZFNs and TALENs. CRISPR/Cas9 system has already been successfully employed in several crop plants. Use of these techniques is in its infant stage in sugarcane. Jung and Altpeter (2016 have reported TALEN mediated approach for the first time to reduce lignin content in sugarcane to make it amenable for biofuel production. This is so far the only report describing genome editing in sugarcane. Large genome size, polyploidy, low transformation efficiency, transgene silencing and lack of high throughput screening techniques are certainly great challenges for genome editing in sugarcane which would be discussed in detail in this review.

  12. Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

    Science.gov (United States)

    Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

    2008-03-01

    Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

  13. On Sorting Genomes with DCJ and Indels

    Science.gov (United States)

    Braga, Marília D. V.

    A previous work of Braga, Willing and Stoye compared two genomes with unequal content, but without duplications, and presented a new linear time algorithm to compute the genomic distance, considering double cut and join (DCJ) operations, insertions and deletions. Here we derive from this approach an algorithm to sort one genome into another one also using DCJ, insertions and deletions. The optimal sorting scenarios can have different compositions and we compare two types of sorting scenarios: one that maximizes and one that minimizes the number of DCJ operations with respect to the number of insertions and deletions.

  14. A universal genomic coordinate translator for comparative genomics.

    Science.gov (United States)

    Zamani, Neda; Sundström, Görel; Meadows, Jennifer R S; Höppner, Marc P; Dainat, Jacques; Lantz, Henrik; Haas, Brian J; Grabherr, Manfred G

    2014-06-30

    Genomic duplications constitute major events in the evolution of species, allowing paralogous copies of genes to take on fine-tuned biological roles. Unambiguously identifying the orthology relationship between copies across multiple genomes can be resolved by synteny, i.e. the conserved order of genomic sequences. However, a comprehensive analysis of duplication events and their contributions to evolution would require all-to-all genome alignments, which increases at N2 with the number of available genomes, N. Here, we introduce Kraken, software that omits the all-to-all requirement by recursively traversing a graph of pairwise alignments and dynamically re-computing orthology. Kraken scales linearly with the number of targeted genomes, N, which allows for including large numbers of genomes in analyses. We first evaluated the method on the set of 12 Drosophila genomes, finding that orthologous correspondence computed indirectly through a graph of multiple synteny maps comes at minimal cost in terms of sensitivity, but reduces overall computational runtime by an order of magnitude. We then used the method on three well-annotated mammalian genomes, human, mouse, and rat, and show that up to 93% of protein coding transcripts have unambiguous pairwise orthologous relationships across the genomes. On a nucleotide level, 70 to 83% of exons match exactly at both splice junctions, and up to 97% on at least one junction. We last applied Kraken to an RNA-sequencing dataset from multiple vertebrates and diverse tissues, where we confirmed that brain-specific gene family members, i.e. one-to-many or many-to-many homologs, are more highly correlated across species than single-copy (i.e. one-to-one homologous) genes. Not limited to protein coding genes, Kraken also identifies thousands of newly identified transcribed loci, likely non-coding RNAs that are consistently transcribed in human, chimpanzee and gorilla, and maintain significant correlation of expression levels across

  15. From hacking the human genome to editing organs.

    Science.gov (United States)

    Tobita, Takamasa; Guzman-Lepe, Jorge; Collin de l'Hortet, Alexandra

    2015-01-01

    In the recent decades, human genome engineering has been one of the major interesting research subjects, essentially because it raises new possibilities for personalized medicine and biotechnologies. With the development of engineered nucleases such as the Zinc Finger Nucleases (ZFNs), the Transcription activator-like effector nucleases (TALENs) and more recently the Clustered Regularly Interspaced short Palindromic Repeats (CRISPR), the field of human genome edition has evolved very rapidly. Every new genetic tool is broadening the scope of applications on human tissues, even before we can completely master each of these tools. In this review, we will present the recent advances regarding human genome edition tools, we will discuss the numerous implications they have in research and medicine, and we will mention the limits and concerns about such technologies.

  16. Genome Engineering with TALE and CRISPR Systems in Neuroscience.

    Science.gov (United States)

    Lee, Han B; Sundberg, Brynn N; Sigafoos, Ashley N; Clark, Karl J

    2016-01-01

    Recent advancement in genome engineering technology is changing the landscape of biological research and providing neuroscientists with an opportunity to develop new methodologies to ask critical research questions. This advancement is highlighted by the increased use of programmable DNA-binding agents (PDBAs) such as transcription activator-like effector (TALE) and RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated (Cas) systems. These PDBAs fused or co-expressed with various effector domains allow precise modification of genomic sequences and gene expression levels. These technologies mirror and extend beyond classic gene targeting methods contributing to the development of novel tools for basic and clinical neuroscience. In this Review, we discuss the recent development in genome engineering and potential applications of this technology in the field of neuroscience.

  17. Genome Engineering with TALE and CRISPR Systems in Neuroscience

    Science.gov (United States)

    Lee, Han B.; Sundberg, Brynn N.; Sigafoos, Ashley N.; Clark, Karl J.

    2016-01-01

    Recent advancement in genome engineering technology is changing the landscape of biological research and providing neuroscientists with an opportunity to develop new methodologies to ask critical research questions. This advancement is highlighted by the increased use of programmable DNA-binding agents (PDBAs) such as transcription activator-like effector (TALE) and RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated (Cas) systems. These PDBAs fused or co-expressed with various effector domains allow precise modification of genomic sequences and gene expression levels. These technologies mirror and extend beyond classic gene targeting methods contributing to the development of novel tools for basic and clinical neuroscience. In this Review, we discuss the recent development in genome engineering and potential applications of this technology in the field of neuroscience. PMID:27092173

  18. Production of genome-edited pluripotent stem cells and mice by CRISPR/Cas.

    Science.gov (United States)

    Horii, Takuro; Hatada, Izuho

    2016-01-01

    Clustered regularly at interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) nucleases, so-called CRISPR/Cas, was recently developed as an epoch-making genome engineering technology. This system only requires Cas9 nuclease and single-guide RNA complementary to a target locus. CRISPR/Cas enables the generation of knockout cells and animals in a single step. This system can also be used to generate multiple mutations and knockin in a single step, which is not possible using other methods. In this review, we provide an overview of genome editing by CRISPR/Cas in pluripotent stem cells and mice.

  19. Short communication: Determination of Salmonella clustered regularly interspaced short palindromic repeats (CRISPR) diversity on dairy farms in Wisconsin and Minnesota.

    Science.gov (United States)

    Wehnes, C A; Rehberger, T G; Barrangou, R; Smith, A H

    2014-10-01

    Salmonella enterica ssp. enterica is a foodborne pathogen able to cause disease in both humans and animals. Diverse serovars of this pathogen exist, some of which are host specific, causing a range of clinical symptoms from asymptomatic infection through morbidity and mortality. According to a 2007 survey by the USDA National Animal Health Monitoring System, fecal shedding of Salmonella from healthy cows occurs on 39.7% of dairy farms in the United States. Certain serovars are frequently isolated from dairy farms and the majority of isolates from the National Animal Health Monitoring System study were represented by 5 serovars; however, genotypic diversity was not examined. The objective of this study was to determine the diversity of clustered regularly interspaced short palindromic repeats (CRISPR) loci in Salmonella collected from 8 dairy farms with a previous history of salmonellosis. None of the cows or calves sampled on 2 of the 8 dairy farms were shedding Salmonella, although Salmonella was detected in a cow bedding sample on 1 of these farms. Salmonella populations were discrete on each farm, according to CRISPR typing, with the exception of an Anatum var. 15+ type on farms 5 and 6 and the Montevideo type on farms 1 and 2. One to 4 distinct CRISPR genotypes were identified per farm. The CRISPR typing differed within serovars, as Montevideo, Anatum var. 15+, and Muenster serovars had no overlap of spacer content, even on the same farm, reflecting between- and within-serovar genetic diversity. The dynamic nature of Salmonella populations was shown in a farm that was sampled longitudinally over 13.5 mo. Changes in serovar from 3,19:-:z27 to Montevideo was observed between the first sampling time and 8 mo later, with concomitant change in CRISPR alleles. The results indicate that Salmonella strains present in smaller dairy herds (<500 head) are specific to that farm and new Salmonella strains may emerge over time. Copyright © 2014 American Dairy Science

  20. Characterization of the clustered regularly interspaced short palindromic repeats sites in Streptococcus mutans isolated from early childhood caries patients.

    Science.gov (United States)

    Chen, Jing; Li, Tiancheng; Zhou, Xuedong; Cheng, Lei; Huo, Yuanyuan; Zou, Jing; Li, Yuqing

    2017-11-01

    The aim of this study was to analyze the characteristics of the clustered regularly interspaced short palindromic repeats (CRISPR) sites in 45 clinical Streptococcus mutans strains and their relationship to the clinical manifestations of early childhood caries (ECC). Forty-five S. mutans strains were isolated from the plaque samples taken from sixty-three children. CRISPR sites were sequenced and BLAST was used to compare these sites to those in the CRISPRTarget database. The association between the distribution of CRISPR sites and the manifestation of caries was analyzed by Chi-Square test. Further, biofilm formation (by crystal violet staining) and the synthesis of polysaccharide (by anthrone-sulfuric method) of all clinical isolated S. mutans strains with both CRISPR sites and no CRISPR site were comapared. Finally, acidogenicity and acidurity of two typical strains were determined using pH drop and acid tolerance assays. Biofilm formation and EPS synthesis by two typical strains were compared by 3D CLSM (Confocal Laser Scanning Microscope) assays and the expression of gtf genes were evaluated using qPCR. We found that most of the spacers in the clinical S. mutans strains were derived from Streptococcus phages APCM01 and M102. The number of CRISPR sites in these strains was associated with the clinical manifestations of ECC. Moreover, we found that the biofilm formation and EPS synthesis ability of the S. mutans strains with both CRISPR sites was significant improved. An association was found between the distribution of CRISPR sites and the clinical manifestations of caries. The CRISPR sites might contribute to the cariogenic potential of S. mutans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Duplication of lower lip and mandible--a rare diprosopus.

    Science.gov (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R

    2011-01-01

    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Exposing region duplication through local geometrical color invariant features

    Science.gov (United States)

    Gong, Jiachang; Guo, Jichang

    2015-05-01

    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  3. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  4. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.

    1983-01-01

    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  5. Cryptorchidism due to chromosome 5q inversion duplication.

    Science.gov (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  6. Verification and characterization of chromosome duplication in haploid maize.

    Science.gov (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

    2015-06-26

    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  7. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso

    2014-08-01

    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  8. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy.

    Science.gov (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis

    2013-09-21

    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  9. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.

    1986-01-01

    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  10. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction.

    Science.gov (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D

    1997-07-01

    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  11. Different clinical presentations, diagnostic difficulties, and management of cecal duplication.

    Science.gov (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün

    2013-03-01

    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  13. 48 CFR 1352.231-71 - Duplication of effort.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  14. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.

    1949-01-01

    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  15. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari

    2014-01-01

    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  16. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  17. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. 11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.

    Science.gov (United States)

    Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata

    2015-06-01

    Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.

  19. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  20. A large duplication involving the IHH locus mimics acrocallosal syndrome.

    Science.gov (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd

    2012-06-01

    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  1. The genome of Eucalyptus grandis

    Energy Technology Data Exchange (ETDEWEB)

    Myburg, Alexander A.; Grattapaglia, Dario; Tuskan, Gerald A.; Hellsten, Uffe; Hayes, Richard D.; Grimwood, Jane; Jenkins, Jerry; Lindquist, Erika; Tice, Hope; Bauer, Diane; Goodstein, David M.; Dubchak, Inna; Poliakov, Alexandre; Mizrachi, Eshchar; Kullan, Anand R. K.; Hussey, Steven G.; Pinard, Desre; van der Merwe, Karen; Singh, Pooja; van Jaarsveld, Ida; Silva-Junior, Orzenil B.; Togawa, Roberto C.; Pappas, Marilia R.; Faria, Danielle A.; Sansaloni, Carolina P.; Petroli, Cesar D.; Yang, Xiaohan; Ranjan, Priya; Tschaplinski, Timothy J.; Ye, Chu-Yu; Li, Ting; Sterck, Lieven; Vanneste, Kevin; Murat, Florent; Soler, Marçal; Clemente, Hélène San; Saidi, Naijib; Cassan-Wang, Hua; Dunand, Christophe; Hefer, Charles A.; Bornberg-Bauer, Erich; Kersting, Anna R.; Vining, Kelly; Amarasinghe, Vindhya; Ranik, Martin; Naithani, Sushma; Elser, Justin; Boyd, Alexander E.; Liston, Aaron; Spatafora, Joseph W.; Dharmwardhana, Palitha; Raja, Rajani; Sullivan, Christopher; Romanel, Elisson; Alves-Ferreira, Marcio; Külheim, Carsten; Foley, William; Carocha, Victor; Paiva, Jorge; Kudrna, David; Brommonschenkel, Sergio H.; Pasquali, Giancarlo; Byrne, Margaret; Rigault, Philippe; Tibbits, Josquin; Spokevicius, Antanas; Jones, Rebecca C.; Steane, Dorothy A.; Vaillancourt, René E.; Potts, Brad M.; Joubert, Fourie; Barry, Kerrie; Pappas, Georgios J.; Strauss, Steven H.; Jaiswal, Pankaj; Grima-Pettenati, Jacqueline; Salse, Jérôme; Van de Peer, Yves; Rokhsar, Daniel S.; Schmutz, Jeremy

    2014-06-11

    Eucalypts are the world s most widely planted hardwood trees. Their broad adaptability, rich species diversity, fast growth and superior multipurpose wood, have made them a global renewable resource of fiber and energy that mitigates human pressures on natural forests. We sequenced and assembled >94% of the 640 Mbp genome of Eucalyptus grandis into its 11 chromosomes. A set of 36,376 protein coding genes were predicted revealing that 34% occur in tandem duplications, the largest proportion found thus far in any plant genome. Eucalypts also show the highest diversity of genes for plant specialized metabolism that act as chemical defence against biotic agents and provide unique pharmaceutical oils. Resequencing of a set of inbred tree genomes revealed regions of strongly conserved heterozygosity, likely hotspots of inbreeding depression. The resequenced genome of the sister species E. globulus underscored the high inter-specific genome colinearity despite substantial genome size variation in the genus. The genome of E. grandis is the first reference for the early diverging Rosid order Myrtales and is placed here basal to the Eurosids. This resource expands knowledge on the unique biology of large woody perennials and provides a powerful tool to accelerate comparative biology, breeding and biotechnology.

  2. [CRISPR/Cas system for genome editing in pluripotent stem cells].

    Science.gov (United States)

    Vasil'eva, E A; Melino, D; Barlev, N A

    2015-01-01

    Genome editing systems based on site-specific nucleases became very popular for genome editing in modern bioengineering. Human pluripotent stem cells provide a unique platform for genes function study, disease modeling, and drugs testing. Consequently, technology for fast, accurate and well controlled genome manipulation is required. CRISPR/Cas (clustered regularly interspaced short palindromic repeat/CRISPR-associated) system could be employed for these purposes. This system is based on site-specific programmable nuclease Cas9. Numerous advantages of the CRISPR/Cas system and its successful application to human stem cells provide wide opportunities for genome therapy and regeneration medicine. In this publication, we describe and compare the main genome editing systems based on site-specific programmable nucleases and discuss opportunities and perspectives of the CRISPR/Cas system for application to pluripotent stem cells.

  3. International regulatory landscape and integration of corrective genome editing into in vitro fertilization.

    Science.gov (United States)

    Araki, Motoko; Ishii, Tetsuya

    2014-11-24

    Genome editing technology, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeat (CRISPR)/Cas, has enabled far more efficient genetic engineering even in non-human primates. This biotechnology is more likely to develop into medicine for preventing a genetic disease if corrective genome editing is integrated into assisted reproductive technology, represented by in vitro fertilization. Although rapid advances in genome editing are expected to make germline gene correction feasible in a clinical setting, there are many issues that still need to be addressed before this could occur. We herein examine current status of genome editing in mammalian embryonic stem cells and zygotes and discuss potential issues in the international regulatory landscape regarding human germline gene modification. Moreover, we address some ethical and social issues that would be raised when each country considers whether genome editing-mediated germline gene correction for preventive medicine should be permitted.

  4. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  5. The impact of genome triplication on tandem gene evolution in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Lu eFang

    2012-11-01

    Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.

  6. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  7. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  8. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  9. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  10. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  11. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  12. Engineered Viruses as Genome Editing Devices

    Science.gov (United States)

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-01-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR−Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole. PMID:26336974

  13. Genome editing technologies to fight infectious diseases.

    Science.gov (United States)

    Trevisan, Marta; Palù, Giorgio; Barzon, Luisa

    2017-11-01

    Genome editing by programmable nucleases represents a promising tool that could be exploited to develop new therapeutic strategies to fight infectious diseases. These nucleases, such as zinc-finger nucleases, transcription activator-like effector nucleases, clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated protein 9 (Cas9) and homing endonucleases, are molecular scissors that can be targeted at predetermined loci in order to modify the genome sequence of an organism. Areas covered: By perturbing genomic DNA at predetermined loci, programmable nucleases can be used as antiviral and antimicrobial treatment. This approach includes targeting of essential viral genes or viral sequences able, once mutated, to inhibit viral replication; repurposing of CRISPR-Cas9 system for lethal self-targeting of bacteria; targeting antibiotic-resistance and virulence genes in bacteria, fungi, and parasites; engineering arthropod vectors to prevent vector-borne infections. Expert commentary: While progress has been done in demonstrating the feasibility of using genome editing as antimicrobial strategy, there are still many hurdles to overcome, such as the risk of off-target mutations, the raising of escape mutants, and the inefficiency of delivery methods, before translating results from preclinical studies into clinical applications.

  14. The Whole Genome Assembly and Comparative Genomic Research of Thellungiella parvula (Extremophile Crucifer Mitochondrion

    Directory of Open Access Journals (Sweden)

    Xuelin Wang

    2016-01-01

    Full Text Available The complete nucleotide sequences of the mitochondrial (mt genome of an extremophile species Thellungiella parvula (T. parvula have been determined with the lengths of 255,773 bp. T. parvula mt genome is a circular sequence and contains 32 protein-coding genes, 19 tRNA genes, and three ribosomal RNA genes with a 11.5% coding sequence. The base composition of 27.5% A, 27.5% T, 22.7% C, and 22.3% G in descending order shows a slight bias of 55% AT. Fifty-three repeats were identified in the mitochondrial genome of T. parvula, including 24 direct repeats, 28 tandem repeats (TRs, and one palindromic repeat. Furthermore, a total of 199 perfect microsatellites have been mined with a high A/T content (83.1% through simple sequence repeat (SSR analysis and they were distributed unevenly within this mitochondrial genome. We also analyzed other plant mitochondrial genomes’ evolution in general, providing clues for the understanding of the evolution of organelles genomes in plants. Comparing with other Brassicaceae species, T. parvula is related to Arabidopsis thaliana whose characters of low temperature resistance have been well documented. This study will provide important genetic tools for other Brassicaceae species research and improve yields of economically important plants.

  15. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  16. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  17. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  18. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  19. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan

    2016-01-01

    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  20. Rectal duplications accompanying rectovestibular fistula: report of two cases.

    Science.gov (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur

    2013-08-01

    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.