Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

International Nuclear Information System (INIS)

Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

2017-01-01

Objective: To determine the frequency of organic acidurais (OA) and amino acidopathies (AA) in selected high-risk patients screened in two years. Study Design: Retrospective Observational study. Place and Duration of Study: The Aga Khan University Hospital (AKUH), Karachi, from January 2013 to December 2014. Methodology: Patients with OA and AA were included in the study and patients with IMDs other than OA and AA were excluded. Amino acids and organic acids were analyzed on high performance liquid chromatography and gas chromatography-mass spectrometry respectively. Clinical data and chromatograms of patients screened for IMDs were reviewed by chemical pathologist and metabolic physician. Results: Eighty-eight cases (4.7 percent) were diagnosed including 41 OA (46.5 percent), 28 AA (31.8 percent) and 19 others (21.5 percent) from 1,866 specimens analyzed. Median age of the patients was 1.1 years, with high consanguinity rate (64.8 percent). Among OA, methyl CoA mutase deficiency was diagnosed in 9 (10.2 percent) and was suspected in 2 (2.3 percent) cases. Five (5.7 percent) cases of MHBD (2-methyl-3-hydroxybutyryl-CoA), 4 (4.5 percent) each of PPA (propionic aciduria) and HMG-CoA lyase deficiency, 3 (3.4 percent) cases each of IVA (isovaleric aciduria), multiple carboxylase deficiency, fructose-1, 6-biphosphatase deficiency, fumarase deficiency, GA-1 (glutaric aciduria type 1) and 2 (2.3 percent) cases of EMA (ethyl-malonic aciduria). AA included 8 (9.1 percent) cases of MSUD (maple syrup urine disease), 6 (6.8 percent) cases of CBS (cystathionine beta-synthetase) and UCDs (urea cycle disorders) each, 5 (5.7 percent) cases of hyperphenylalaninemia and 3 (3.4 percent) cases of hyperprolinemia were reported. Other inherited metabolic disorders included: 9 (10.2 percent) cases of intracellular cobalamin defects, 2 (2.3 percent) cases each of alkaptonuria, Canavan's disease, SUCL (succinate CoA ligase) deficiency, and 1 (1.1 percent) case each of DPD

Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

Index Scriptorium Estoniae

Kopli, Kaivo

2007-01-01

Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

Science.gov (United States)

Ali, Zarqa S.

2014-01-01

The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

Index Scriptorium Estoniae

Raidma, Mati, 1965-

2006-01-01

Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

Directory of Open Access Journals (Sweden)

Muhammad Usman

2014-12-01

Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

Directory of Open Access Journals (Sweden)

Summaira Naz

2015-03-01

Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

Perceptions of Disease State Management Among Pakistani ...

African Journals Online (AJOL)

Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

Science.gov (United States)

Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

2015-05-01

In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

Science.gov (United States)

Bittles, A H; Small, N A

2016-11-01

Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

Science.gov (United States)

Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

2018-02-02

Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

Directory of Open Access Journals (Sweden)

Dr. Farhat Jabeen

2013-06-01

Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

Directory of Open Access Journals (Sweden)

Claussen Bjorgulf

2006-06-01

Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

British-Pakistani women's perspectives of diabetes self-management: the role of identity.

Science.gov (United States)

Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

2015-09-01

To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

Suicidal ideation in Pakistani college students.

Science.gov (United States)

Khokher, Sehar; Khan, Murad M

2005-01-01

Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

Science.gov (United States)

Mac an Ghaill, Mairtin; Haywood, Chris

2014-01-01

This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

OpenAIRE

Shakari, Yasmine

2013-01-01

Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

Factors causing stress among Pakistani working women

Directory of Open Access Journals (Sweden)

Ahmed Arif

2017-09-01

Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

Genetic analysis of a consanguineous Pakistani family with Leber ...

Indian Academy of Sciences (India)

2014-08-01

Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

OpenAIRE

Saghir, Sheeba; Hyland, Lynda

2017-01-01

This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

Cerebral Palsy in Pakistani Children: A Hospital Based Survey

Directory of Open Access Journals (Sweden)

Atif Ahmed Khan

2014-08-01

Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

International Nuclear Information System (INIS)

Naqi, N.; Ahmed, T.A.; Bashir, M.M.

2011-01-01

Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

Genetic diversity of Pakistani maize genotypes using chromosome ...

African Journals Online (AJOL)

For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

Directory of Open Access Journals (Sweden)

Abdul Haque

2011-01-01

Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

Science.gov (United States)

Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

2010-01-01

This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

Different sex ratios of children born to Indian and Pakistani immigrants in Norway

Directory of Open Access Journals (Sweden)

Brekke Torkel

2010-08-01

Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

Science.gov (United States)

Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

2017-07-01

Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

Science.gov (United States)

Chaudhry, N; Husain, N; Tomenson, B; Creed, F

2012-06-01

The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

OpenAIRE

Syeda Bushra Zaidi

2016-01-01

This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

Survival outcome of malignant minor salivary tumors in Pakistani population

Directory of Open Access Journals (Sweden)

Hassan Iqbal

2014-01-01

Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

Index Scriptorium Estoniae

Volmer, Karin

2007-01-01

Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

Science.gov (United States)

Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

2007-01-01

Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

African Journals Online (AJOL)

Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

Science.gov (United States)

Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

2017-10-01

To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

Genetic heterogeneity in Pakistani microcephaly families

DEFF Research Database (Denmark)

Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

2013-01-01

Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

Brand equity in the Pakistani hotel industry

OpenAIRE

Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

2014-01-01

Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

Science.gov (United States)

Mythen, Gabe

2012-09-01

Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

Science.gov (United States)

Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

2017-04-11

Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

International Nuclear Information System (INIS)

Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

2010-01-01

Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

Science.gov (United States)

Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

2006-07-10

In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

OpenAIRE

Marwah, Ane Frislid Sveinhaug

2008-01-01

This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

Evolution of Systemic Hypertension in Pakistani Population

International Nuclear Information System (INIS)

Aziz, K. U.

2015-01-01

The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

Social and cultural construction of obesity among Pakistani Muslim women in North West England.

Science.gov (United States)

Ludwig, Alison F; Cox, Peter; Ellahi, Basma

2011-10-01

The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

Directory of Open Access Journals (Sweden)

Rebecca Garcia

2017-04-01

Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

Science.gov (United States)

Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

2011-01-01

This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

Science.gov (United States)

Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

2017-12-01

South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

Science.gov (United States)

Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

2014-01-01

The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

Directory of Open Access Journals (Sweden)

Mushtaq Muhammad Umair

2012-03-01

Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

Science.gov (United States)

Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

2011-01-01

There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

Molecular and clinical studies of X-linked deafness among Pakistani families.

Science.gov (United States)

Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

2011-07-01

There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

Science.gov (United States)

Uphoff, Eleonora P; Pickett, Kate E; Wright, John

2016-10-01

This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

OpenAIRE

Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

2016-01-01

AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

Directory of Open Access Journals (Sweden)

Shahid Ubeera

2011-09-01

Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

Science.gov (United States)

Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

2013-01-01

Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

Directory of Open Access Journals (Sweden)

Hussain Akthar

2006-07-01

Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

Science.gov (United States)

Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

2016-01-01

The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

Understanding the Influence of the Pakistani Government in South Asia

Science.gov (United States)

2010-11-01

boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

Factors Affecting job satisfaction of employees in Pakistani banking sector

OpenAIRE

Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

2010-01-01

The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

Directory of Open Access Journals (Sweden)

Dr. Farhat Jabeen

2013-06-01

Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

Science.gov (United States)

Saghir, Sheeba; Hyland, Lynda

2017-07-01

This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

Science.gov (United States)

Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

2011-08-01

The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

Directory of Open Access Journals (Sweden)

Maryam Mukhtar

2017-01-01

Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

Directory of Open Access Journals (Sweden)

Jaworek Thomas J

2012-06-01

Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

Wall thickness of major coronary arteries in Pakistani population

International Nuclear Information System (INIS)

Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

2012-01-01

To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

Directory of Open Access Journals (Sweden)

Syed Muhammad Aamir Shah

2012-09-01

Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

Between Preferences: Marriage and Mobility among Danish Pakistani Youth

DEFF Research Database (Denmark)

Rytter, Mikkel

2012-01-01

and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

Science.gov (United States)

Qureshi, Mustafa; Abbas, Zaigham

2015-01-01

The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

International Nuclear Information System (INIS)

Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

2016-01-01

Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

Spectrum of K ras mutations in Pakistani colorectal cancer patients

International Nuclear Information System (INIS)

Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

2013-01-01

The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

Spectrum of K ras mutations in Pakistani colorectal cancer patients

Energy Technology Data Exchange (ETDEWEB)

Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

2013-11-29

The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

Directory of Open Access Journals (Sweden)

Barton Pelham M

2011-06-01

Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

Science.gov (United States)

Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

2015-01-01

The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

Science.gov (United States)

Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

2016-12-09

There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

OpenAIRE

Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

2014-01-01

In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

BRCA1 status in Pakistani breast cancer patients with moderate family history

International Nuclear Information System (INIS)

Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

2011-01-01

Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

Directory of Open Access Journals (Sweden)

Barton Pelham

2011-08-01

Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

Directory of Open Access Journals (Sweden)

Atta Abbas Naqvi

2016-12-01

Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

Mineralization and volatilization of 14C-ring labelled 2,4-dichlorophenoxy acetic acid in Pakistani soils

International Nuclear Information System (INIS)

Hussain, Altaf; Iqbal, Zafar; Asi, Muhammad Rafique; Chaudhry, Jamil Anwar

2001-01-01

The mineralization and volatilization of [U-ring 14 C] 2,4-D in three Pakistani soils was investigated under laboratory conditions using 50 g of soil and uniform distribution of 1.345 μg/g of 2,4-D. Maximum losses of 14 CO 2 and volatile organic compounds occurred at day 7 and losses gradually slowed down after 21 days of incubation. The relative distribution of 14 C losses differed with soil type. Volatilization was higher in control soil as compared to test and treated soil in both the study seasons. The contribution of volatile material to the total loss in 1997 was highest in test soil (24.4%), and lowest in farm soil (19.8%) but in 1998 was highest in control soil (26%) and lowest in test and farm soils (7%) during 1998. (author)

Pakistani childrens’ views of TV advertising

Directory of Open Access Journals (Sweden)

Muhammad Kashif

2012-12-01

Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

Science.gov (United States)

Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

2015-01-01

Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

Directory of Open Access Journals (Sweden)

Usman Ahmad

2014-06-01

Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

Science.gov (United States)

Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

2015-01-01

Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

Sorption-desorption characteristics of benzimidazole based fungicide 2-(4-fluorophenyl)-1h-benzimidazole on physicochemical properties of selected pakistani soils

International Nuclear Information System (INIS)

Ahmad, K.S.

2014-01-01

A batch equilibrium method has been utilized to investigate the sorption-desorption behavior of a versatile cost-effective fungicide2-(4-fluorophenyl)-1H-benzimidazole) FBNZ on four Pakistani soils geographically distant, from hilly to desert areas. FBNZ is a newly synthesized fungicide prepared in the laboratory and is cost effective than the commercially available fungicides. The adsorption and desorption data were fitted to the Freundlich equation, with values of na = 1, which points to a C-type isotherm. Sorption increases with soil organic carbon content, with greater degree of adsorption for hilly soil and least adsorption on sandy soil of Multan, Punjab. Desorption studies reveal that the adsorbed fungicide are firmly retained by soil particles and present a certain degree of irreversibility. The results indicate that the soil organic matters followed by clay content are the most important soil properties governing the fungicide sorption capacity. (author)

A Controversial Role Model for Pakistani Women

Directory of Open Access Journals (Sweden)

Faiza Mushtaq

2012-03-01

Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

OpenAIRE

Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

2011-01-01

There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

Science.gov (United States)

Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

2011-01-01

Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

Directory of Open Access Journals (Sweden)

Shamim Saleha

2016-05-01

Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

Science.gov (United States)

Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

2016-01-01

To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

Analysis of toxic metals in branded Pakistani herbal products

International Nuclear Information System (INIS)

Saeed, M.; Muhammad, N.; Khan, H.

2010-01-01

The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

2012-01-01

PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

NARCIS (Netherlands)

Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

Science.gov (United States)

Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

2010-06-01

Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

Directory of Open Access Journals (Sweden)

Syeda Bushra Zaidi

2016-05-01

Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

Acceptability of GM foods among Pakistani consumers

Science.gov (United States)

Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

2016-01-01

ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

Acceptability of GM foods among Pakistani consumers.

Science.gov (United States)

Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

2016-04-02

In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

Science.gov (United States)

Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

2013-01-01

To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

Directory of Open Access Journals (Sweden)

Gele AA

2017-07-01

Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

Science.gov (United States)

Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

2011-06-01

To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

International Nuclear Information System (INIS)

Moazzam, A.; Amer, J.

2015-01-01

The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

Science.gov (United States)

Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

2011-02-01

Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

NARCIS (Netherlands)

Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

2014-01-01

With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

OpenAIRE

Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

2013-01-01

Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

"Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

Science.gov (United States)

Ghaffar-Kucher, Ameena

2015-01-01

Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

Science.gov (United States)

Khurshid, Ayesha

2012-01-01

Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

Differences in the pregnancy gestation period and mean birth weights in infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK: a retrospective analysis of routinely collected data.

Science.gov (United States)

Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

2017-08-11

To compare mean birth weights and gestational age at delivery of infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK. Retrospective analysis using routinely recorded secondary data in Ciconia Maternity information System, between 2008 and 2013. Luton, UK. Mothers whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian and living in Luton, aged over 16, who had a live singleton birth over 24 weeks of gestation were included in the analysis (n=14 871). Primary outcome measures were mean birth weight and gestational age at delivery. After controlling for maternal age, smoking, diabetes, gestation age, parity and maternal height and body mass index at booking, a significant difference in infants' mean birth weight was found between white British and Indian, Pakistani and Bangladeshi infants, F(3, 12 287)=300.32, pmothers, compared with Indian mothers (Wald=8.192, df 1, pmothers and preterm delivery, when compared with Pakistani, Bangladeshi and white British women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

NARCIS (Netherlands)

Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

2009-01-01

PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

International Nuclear Information System (INIS)

RIZK, M.A.

2010-01-01

This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

Directory of Open Access Journals (Sweden)

IRFAN UL HASAN

Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

International Nuclear Information System (INIS)

Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

2017-01-01

To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

Science.gov (United States)

Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

2011-10-01

To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

Important TQM Implementation Contributors in Pakistani Petrochemical Sector

Directory of Open Access Journals (Sweden)

Yasir Latif

2014-10-01

Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

Science.gov (United States)

Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

2010-11-01

To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

Directory of Open Access Journals (Sweden)

Dr. Abdul Muhaimin

2017-02-01

Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

Science.gov (United States)

Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

2017-09-01

Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

Science.gov (United States)

Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

2012-02-27

A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

Science.gov (United States)

Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

2017-01-01

Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

Directory of Open Access Journals (Sweden)

Mir Mohammed

2012-02-01

Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

Science.gov (United States)

Goodwin, Laura; Hunter, Billie; Jones, Aled

2018-02-01

In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

Energy Technology Data Exchange (ETDEWEB)

Kamal, N.

1999-01-01

The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

Energy Technology Data Exchange (ETDEWEB)

Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

2011-06-15

Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

International Nuclear Information System (INIS)

Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

2011-01-01

Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

Impact of leadership styles on employees’ attitude towards their leader and performance: Empirical evidence from Pakistani banks

Directory of Open Access Journals (Sweden)

Muhammad Asrar-ul-Haq

2016-06-01

Full Text Available This paper reports the findings of a study examining the impact of managers’ leadership styles on subordinates’ performance. The impact of leadership styles on employee performance outcomes is explored theoretically and tested empirically in the Pakistani banking sector. The sample of the study consisted of 224 full-time employees in the banking sector of Pakistan. Findings of this study reveal that there exists a significant relationship between transformational leadership and employee performance outcomes. However, laissez-faire leadership style showed negative relationship with employee performance outcomes in terms of effectiveness, and employee satisfaction. Banking industry in Pakistan is prone to numerous challenges including employee turnover. Model presented in the study will be helpful for the human resource managers and top management to design effective leadership development programs. HRD department can be established and HRD professionals can be hired to assist the managers in organizing training and development programs. Further, it may help to design strategies to satisfy, retain and motivate the employees. Also, it will help the managers decide, which leadership style they should choose in terms of outcomes.

Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

Science.gov (United States)

Nauman, Sarwat; Hussain, Nasreen

2017-01-01

Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

NARCIS (Netherlands)

Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

2010-01-01

PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

Genetic characterization of different pakistani date palm varieties

International Nuclear Information System (INIS)

Akhtar, W.; Rashid, A.; Mahmood, T.

2014-01-01

Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

Statistical Analysis of Pakistani Currency Regime before and after Floatation

Directory of Open Access Journals (Sweden)

Shahid ALI

2011-05-01

Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

Science.gov (United States)

Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

2014-01-01

The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

Science.gov (United States)

Tahir, Khazima

2017-01-01

This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

Directory of Open Access Journals (Sweden)

Eivind Andersen

2011-08-01

Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

International Nuclear Information System (INIS)

Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

2017-01-01

Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

Rigid Basement and the Evolution of the Pakistani Convergent Margin

Science.gov (United States)

Haq, S. S.; Davis, D. M.

2007-12-01

In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

Science.gov (United States)

Islam, Kazi Md Mukitul; Asadullah, M Niaz

2018-01-01

Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

Science.gov (United States)

Islam, Kazi Md. Mukitul

2018-01-01

Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

Directory of Open Access Journals (Sweden)

Hempler NF

2015-02-01

Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

DEFF Research Database (Denmark)

Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

2017-01-01

2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

Science.gov (United States)

Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

1995-04-01

Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

Science.gov (United States)

Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

2013-06-01

breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

Directory of Open Access Journals (Sweden)

Khan Shoaib

2016-07-01

Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

Lenses on metacognition: Teachers’ perceptions toward strategies in reading in a Pakistani context

Directory of Open Access Journals (Sweden)

Channa, Mansoor A.

2017-03-01

Full Text Available The research in the field of metacognition for developing reading is not new; metacognition has been used for many years to identify ways to develop students’ reading comprehension. Most previous research has addressed either primary or secondary level students. However, notably few studies have been conducted at the undergraduate level. This study has attempted to initiate strategies to assist first-year engineering students in developing their reading abilities within a Pakistani context. The primary objective of this research was to identify what strategies first-year engineering students use in developing their reading at Quaid-e-Awam University of engineering science and technology in Pakistan. This study used qualitative instruments that included semi-structured interviews with teachers and classroom observations during read-aloud sessions. The data were organized through NVivo version 8 for obtaining nodes, codes, and main themes for interpreting the results. The results of this study demonstrated that teachers should use metacognitive strategies for developing students’ reading abilities. Findings also revealed that reading strategies, such as text scanning, guesses from contextual clues, drawing on prior knowledge, and using a dictionary, are the most important strategies to use for developing the reading skills and comprehension of engineering students. This study has suggested metacognitive strategies be used for promoting students’ reading abilities and that teachers should design and develop more courses using these strategies to enhance the reading and listening skills of engineering students.

Perspectives of UK Pakistani women on their behaviour change to prevent type 2 diabetes: qualitative study using the theory domain framework.

Science.gov (United States)

Penn, Linda; Dombrowski, Stephan U; Sniehotta, Falko F; White, Martin

2014-07-08

Type 2 diabetes (T2D) is a debilitating disease, highly prevalent in UK South Asians, and preventable by lifestyle intervention. The 'New life, New you' (NLNY) physical activity (PA) and dietary intervention for T2D prevention was culturally adapted to better engage minority ethnic populations and tested for feasibility. To investigate Pakistani female participants' perspectives of their behaviour change and of salient intervention features. A community-based 8-week programme of group delivered PA sessions with behavioural counselling and dietary advice, culturally adapted for ethnic minority populations, in an area of socioeconomic deprivation. Participants to NLNY were recruited through screening events in community venues across the town. Interviews were conducted with 20 Pakistani female NLNY participants, aged 26-45 (mean 33.5) years, from different parts of town. Within the a priori Theoretical Domains Framework (intentions and goals, reinforcement, knowledge, nature of the activity, social role and identity, social influences, capabilities and skills, regulation and decision, emotion and environment), we identified the importance of social factors relating to participants' own PA and dietary behaviour change. We also identified cross-cutting themes as collateral benefits of the intervention including participants' 'psychological health'; 'responsibility' (for others' health, especially family members included in the new PA and diet regimes) and 'inclusion' (an ethos of accommodating differences). Our findings suggest that culturally adapted interventions for Pakistani women at risk of T2D, delivered via group PA sessions with counselling and dietary advice, may encourage their PA and dietary behaviour change, and have collateral health and social benefits. The NLNY intervention appeared to be acceptable. We plan to evaluate recruitment, retention and likely effect of the intervention on participant behaviour prior to definitive evaluation. Published by the

HVDC Transmission an Outlook and Significance for Pakistani Power Sector

Science.gov (United States)

Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

2018-04-01

Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

NARCIS (Netherlands)

Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

2014-01-01

We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

Peripartum cardiomeyopathy in a pakistani cohort

International Nuclear Information System (INIS)

Munir, R.; Hussain, S.; Kayani, A.M.

2016-01-01

Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

Directory of Open Access Journals (Sweden)

Abdul RAZIQ

2014-10-01

Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

Promoting smoking cessation in Bangladeshi and Pakistani male adults: design of a pilot cluster randomised controlled trial of trained community smoking cessation workers

Directory of Open Access Journals (Sweden)

Gill Paramjit

2009-08-01

Full Text Available Abstract Background The prevalence of smoking is higher among Pakistani and Bangladeshi males than among the general population. Smokers who receive behavioural support and medication quadruple their chances of stopping smoking, but evidence suggests that these populations do not use National Health Service run stop smoking clinics as frequently as would be expected given their high prevalence of smoking. This study aims to tackle some of the main barriers to use of stop smoking services and adherence to treatment programmes by redesigning service delivery to be more acceptable to these adult male populations. The study compares the effectiveness of trained Pakistani and Bangladeshi smoking cessation workers operating in an outreach capacity ('clinic + outreach' with standard care ('clinic only' to improve access to and success of National Health Service smoking cessation services. Methods/design This is a pilot cluster randomised controlled trial based in Birmingham, UK. Super output areas of Birmingham will be identified in which more than 10% of the population are of Pakistani and/or Bangladeshi origin. From these areas, 'natural geographical communities' will be identified. Sixteen aggregated agglomerations of super output areas will be identified, separating areas from each other using buffer regions in order to reduce potential contamination. These natural communities will be randomised to 'clinic + outreach' (intervention or 'clinic only' (control arms. The use of stop smoking services and the numbers of people quitting smoking (defined as prolonged self-reported abstinence at four weeks, three months and six months will be assessed in each area. In addition, we will assess the impact of the intervention on adherence to smoking cessation treatments and patient satisfaction. Trial registration Current Controlled Trials ISRCTN 82127540.

Chest radiological findings in pakistani cement mill workers

International Nuclear Information System (INIS)

Meo, Sultan A.

2003-01-01

Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

Science.gov (United States)

Rafique, Rafia; Anjum, Afifa

2015-01-01

Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

International Nuclear Information System (INIS)

Rafiq, R.; Anjum, A.

2015-01-01

Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

Directory of Open Access Journals (Sweden)

Ahmed Waqas

2014-12-01

Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

OpenAIRE

Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

2012-01-01

Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

Challenges of implementing e-learning in a Pakistani university

Directory of Open Access Journals (Sweden)

Ijaz A. Qureshi

2012-09-01

Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

Directory of Open Access Journals (Sweden)

Habib Hussain Khan

2017-06-01

Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

Science.gov (United States)

Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

2013-01-01

Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

Visual representation of gender in flood coverage of Pakistani print media

Directory of Open Access Journals (Sweden)

Zarqa S. Ali

2014-08-01

Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

Students and Libraries: The Perspectives of Faculty in a Pakistani University

Directory of Open Access Journals (Sweden)

Muhammad Kashif

2011-06-01

Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

Directory of Open Access Journals (Sweden)

Naeem Muhammad

2011-07-01

Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

Science.gov (United States)

Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

2012-01-01

The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

Directory of Open Access Journals (Sweden)

Md. Kamal Uddin

2012-04-01

Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

Science.gov (United States)

Williams, Lisa; Ralphs, Rob; Gray, Paul

2017-03-21

The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

Dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children.

Science.gov (United States)

Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

2011-11-25

There is no data on diet- and activity-related behaviors associated with overweight and obesity among Pakistani school-aged children. The study aimed to explore dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children. A population-based cross-sectional study was conducted with a representative multistage random cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Overweight (>+1 SD) and obesity (>+2 SD) were defined using the World Health Organization reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to body mass index (BMI). Logistic regression was used to quantify the independent predictors and adjusted odds ratios (aOR) with 95% confidence intervals (CI) were obtained. Statistical significance was considered at Psedentary lifestyle>one hour a day (49%) were significantly more likely to be overweight and obese while those participating in physical activity>twice a week (53%) were significantly less likely to be overweight and obese (all Psedentary lifestyle (Ptwice a week (aOR 0.49, 95% CI 0.34-0.70) and sedentary lifestyle>one hour a day (aOR 1.56, 95% CI 1.19-2.03) were independent predictors of being overweight. Skipping breakfast had independent inverse association with physical activity (aOR 0.63, 95% CI 0.45-0.89) and eating fast food and snacks had independent positive association with sedentary lifestyle (aOR 1.79, 95% CI 1.49-2.16). Female gender was independently associated with skipping breakfast (aOR 1.50, 95% CI 1.04-2.16). Male gender (aOR 1.64, 95% CI 1.33-2.02), urban area with high SES (aOR 5.09, 95% CI 3.02-8.60) and higher parental education (aOR 1.74, 95% CI 1.12-2.68) were significant independent predictors of eating fast food and snacks≥once a week. Living in the rural area was

Coronary anomalies in Pakistani children with tetralogy of fallot

International Nuclear Information System (INIS)

Hussain, I.; Patel, N.

2010-01-01

To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

Science.gov (United States)

Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

2017-04-05

Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

DEFF Research Database (Denmark)

Andersen, Rikke; Brot, Christine; Mejborn, Heddie

2009-01-01

Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

Science.gov (United States)

Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

2014-04-23

In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

Screening for mutations in two exons of FANCG gene in Pakistani population.

Science.gov (United States)

Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

2017-06-01

Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

Assessment of dietary intake of trace elements through Pakistani integrated diets

International Nuclear Information System (INIS)

Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

1994-01-01

A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

Prevalence and risk factors of helicobacter pylori infection among Pakistani population

International Nuclear Information System (INIS)

Rasheed, F.; Ahmad, T.; Bilal, B.

2012-01-01

Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

Meaning of 9/11 for two Pakistani communities: from external intruders to the internalisation of a negative self-image.

Science.gov (United States)

Rousseau, Cécile; Jamil, Uzma

2008-12-01

Since September 11, the increase in international tensions and the subsequent wars in Afghanistan and Iraq have created turmoil and fears in immigrant communities, fanned by the media in the context of the war against terrorism. This paper aims to compare the meaning systems evoked around 9/11 within two Pakistani groups-an immigrant community in Montreal and a group in Karachi. It also intends to examine the representation of themselves and of the 'Other' within these two groups. Results suggest that both Karachi and Montreal Pakistani respondents favour a conspiracy scenario which protects the Muslim community from the responsibility of 9/11 events. They refer to an argumentation process based on 'proofs', thus mirroring the political rhetoric used by the US government and its allies to justify the military intervention in Iraq. In the Montreal group, the pervasive feeling of fear and the bleak image that the community has of itself support the hypothesis of an immigrant internalisation of the negative representations of Muslim and South Asian identities in the North American context. The negative self-image observed in these minority groups indicates that more effort than ever should be dedicated to understanding the impact of the present international context on minority-majority relations in multi-ethnic societies. It is as if America is sitting right here in the living room with us … We have to ask them permission to breathe. (Parveen, Karachi).

DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

International Nuclear Information System (INIS)

Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

2010-01-01

DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

Energy Technology Data Exchange (ETDEWEB)

Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

2010-04-15

DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

Effective heart disease prevention: lessons from a qualitative study of user perspectives in Bangladeshi, Indian and Pakistani communities.

Science.gov (United States)

Netto, G; McCloughan, L; Bhatnagar, A

2007-03-01

Coronary heart disease (CHD) has a high mortality, incidence and prevalence among Indian, Pakistani and Bangladeshi communities in the UK, indicating the need for effective heart disease prevention initiatives for these communities. This paper considers how service user perspectives can be used to develop effective, culturally focused CHD prevention interventions for these target groups by addressing identified barriers, including deeply held cultural beliefs. A qualitative research study, using a longitudinal action research approach. This was a community-based study in Edinburgh. Six focus group discussions--two for each community--were organized with participants from these communities at the beginning of the project. A further six focus group discussions for the same communities were organized six months later. Over the period examined, participants reported varying changes in levels of knowledge relating to the nature, causes and symptoms of CHD. Some participants reported taking slight to significant steps to reduce or prevent heart disease, while others did not. The project was viewed as helpful in increasing knowledge about CHD and preventive measures and encouraging healthier lifestyles. However, persistent barriers to change were also identified, requiring changes to the project that involved not only matching intervention materials and messages to observable, superficial characteristics of the target population, but more fundamental changes that address the cultural, social, historical, environmental and psychological forces that influence health behaviour. CHD prevention initiatives need to identify and respond to deep-rooted influences on health-behaviour in 'at-risk' groups, in addition to superficial characteristics of the target populations. It is important for specific prevention initiatives to be linked into wider CHD frameworks to ensure transferability of learning and integration within wider service provision.

Assessment of potential toxicity of a smokeless tobacco product (naswar) available on the Pakistani market.

Science.gov (United States)

Zakiullah; Saeed, Muhammad; Muhammad, Naveed; Khan, Saeed Ahmad; Gul, Farah; Khuda, Fazli; Humayun, Muhammad; Khan, Hamayun

2012-07-01

'Naswar' is a smokeless tobacco product (STP) widely used in Pakistan. It has been correlated with oral and oesophageal cancer in recent clinical studies. The toxic effects associated with STPs have been associated with trace level contaminants present in these products. The toxin levels of Pakistani naswar are reported for the first time in this study. A total of 30 Pakistani brands of naswar were tested for a variety of toxic constituents and carcinogens such as cadmium, arsenic, lead and other carcinogenic metals, nitrite and nitrate, and nicotine and pH. The average values of all the toxins studied were well above their allowable limits, making the product a health risk for consumers. Calculated lifetime cancer risk from cadmium and lead was 1 lac (100,000) to 10 lac (1,000,000) times higher than the minimum 10E-4 (0.00001) to 10E-6 (0.000001), which is the 'target range' for potentially hazardous substances, according to the US Environmental Protection Agency. Similarly, the level of arsenic was in the range of 0.15 to 14.04 μg/g, the average being 1.25 μg/g. The estimated average bioavailable concentration of arsenic is 0.125-0.25 μg/g, which is higher than the allowable standard of 0.01 μg/g. Similarly, the average minimum daily intake of chromium and nickel was 126.97 μg and 122.01 μg, as compared to allowable 30-35 μg and 35 μg, respectively; a 4-5 times higher exposure. However, beryllium was not detected in any of the brands studied. The pH was highly basic, averaging 8.56, which favours the formation of tobacco specific amines thus making the product potentially toxic. This study validates clinical studies correlating incidence of cancer with naswar use in Pakistan. This study shows that the production, packaging, sale and consumption of naswar should be regulated so as to protect the public from the health hazards associated with its consumption.

The prevalence of Y chromosome microdeletions in Pakistani infertile men

Directory of Open Access Journals (Sweden)

Rubina Tabassum Siddiqui

2013-01-01

Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.

Patient perspectives on type 2 diabetes and medicine use during Ramadan among Pakistanis in Denmark

DEFF Research Database (Denmark)

Mygind, Anna; Kristiansen, Maria; Wittrup, Inge

2013-01-01

of Ramadan without adequate counselling on how to adjust their medicines. Objective To explore patient perspectives on medicine use during Ramadan, reasons for fasting and experiences with counselling on medicine use during Ramadan among people of Pakistani background with type 2 diabetes and at least one...... (six interviewers). Results All interviewees pointed out that Islam allows ill people to refrain from fasting during Ramadan. However, all had fasted during Ramadan despite being diagnosed with type 2 diabetes. While fasting, they adapted their use of medicines in different ways, e.g. by changing...... the time of intake or by skipping morning medicines. Fasting during Ramadan meant a feeling of improvement in well-being for all interviewees. Reasons for this improvement included physiological, social and religious aspects. Healthcare professionals were rarely included in the decision-making process...

Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

Science.gov (United States)

Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

2015-06-01

Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

Pakistani Immigrant Children and Adults in Denmark Have Severely Low Vitamin D Status

DEFF Research Database (Denmark)

Andersen, Rikke; Mølgaard, C.; Skovgaard, L. T.

2008-01-01

association with S-25OHD for men (P = 0.04) and women (P = 0.0008). Twenty-one per cent of the women and 34% of the men had osteopenia. Neither S-25OHD nor S-iPTH was associated with lumbar spine or whole body bone mineral content. Conclusions: Severely low vitamin D status and elevated S-iPTH is common among......, Copenhagen (55 degrees N), January- November. Serum 25-hydroxyvitamin D (S-25OHD), serum intact parathyroid hormone (S-iPTH), bone turnover markers and whole body and lumbar spine bone mineral density were measured. Sun, smoking and clothing habits, age, body mass index (BMI), and vitamin D and calcium from......Objective: To determine vitamin D and bone status in adolescent girls, pre-menopausal women and men of Pakistani origin, to single out determinants of vitamin D status and to determine the association between vitamin D status, bone metabolism and bone status. Subjects/Methods: Cross-sectional study...

Religion, male violence, and the control of women: Pakistani Muslim men in Bradford, UK.

Science.gov (United States)

Macey, M

1999-03-01

This paper examines Pakistani Muslim male violence in the public and private spheres in Bradford, UK. The article also explores the relationship between male violence and ideas of culture and religion. The material used was collected over a 4-year period from students and staff in further and higher education institutions; working women (prostitutes); survivors of domestic violence; police personnel who work with Asian women fleeing domestic violence or forced marriages; and staff of a children's society working with teenage prostitutes. Methodologies included lectures, seminars, focus groups, and interviews. Findings reveal that there is a difference between male and female attitudes towards Islam. Some men are using it to justify violence against women, while women of all ages and backgrounds are using it as a source of strength and to negotiate (with ingenuity and humor) the cultural and religious requirements which men try to impose upon them.

DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

International Nuclear Information System (INIS)

Mirbahar, A.; Khan, S.; Markhand, G.S.

2016-01-01

Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

Association of food security status with overweight and dietary intake: exploration of White British and Pakistani-origin families in the Born in Bradford cohort.

Science.gov (United States)

Yang, T C; Sahota, P; Pickett, K E; Bryant, M

2018-04-24

Food insecurity has been associated with dietary intake and weight status in UK adults and children although results have been mixed and ethnicity has not been explored. We aimed to compare prevalence and trajectories of weight and dietary intakes among food secure and insecure White British and Pakistani-origin families. At 12 months postpartum, mothers in the Born in Bradford cohort completed a questionnaire on food security status and a food frequency questionnaire (FFQ) assessing their child's intake in the previous month; at 18 months postpartum, mothers completed a short-form FFQ assessing dietary intake in the previous 12 months. Weights and heights of mothers and infants were assessed at 12-, 24-, and 36-months postpartum, with an additional measurement of children taken at 4-5 years. Associations between food security status and dietary intakes were assessed using Wilcoxon-Mann-Whitney for continuous variables and χ 2 or Fisher's exact tests for categorical variables. Quantile and logistic regression were used to determine dietary intakes adjusting for mother's age. Linear mixed effects models were used to assess longitudinal changes in body mass index (BMI) in mothers and BMI z-scores in children. At 12 months postpartum, White British mothers reported more food insecurity than Pakistani-origin mothers (11% vs 7%; p secure (β = 0.44 units, 95% CI: 0.33, 0.55). This was also found in Pakistani-origin children (BMI z-score: food insecure β = 0.40 units, 95% CI: 0.22, 0.59; food secure β = 0.25 units, 95% CI: 0.20, 0.29). No significant increases in BMI were observed for food secure or insecure White British mothers while BMI z-score increased by 0.17 (95% CI: 0.13, 0.21) for food secure White British children. Food insecure mothers and children had dietary intakes of poorer quality, with fewer vegetables and higher consumption of sugar-sweetened drinks. Food security status is associated with body weight and dietary intakes

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

Science.gov (United States)

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

Pakistani medical students' specialty preference and the influencing factors.

Science.gov (United States)

Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

2011-07-01

To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

Bacteriological (fecal and total coliform) quality of Pakistani coastal water

International Nuclear Information System (INIS)

Mashiatullah, A.; Qureshi, R.M.; Javed, T.; Khan, M.S.; Chaudhary, M.Z.; Khalid, F.

2010-01-01

The coliform bacteria group consists of several genera of bacteria belonging to the family enterobacteriaceae. These are harmless bacteria, mostly live in soil, water, and digestive system of animals. Fecal coliform bacteria, which belongs to this group, are present in large numbers in feces and intestinal tract of human beings and other warm-blooded animals which can enter into water bodies from human and animal waste. Swimming in water having high levels of Fecal coliform bacteria increases the chance of developing illness (fever, nausea or stomach cramps) from pathogens entering the body through mouth, nose, ears or cuts in the skin. The objective of the present study was to characterize the bathing quality of Pakistani coastal water with respect to coliform bacteria. Total and Fecal coliform bacteria were determined at seven different locations along Pakistan coast using membrane filtration (MF) technique. 100 ml of water was passed through 0.45 micron (mu) filter paper. These filter papers were put on pads, soaked in Lauryle sulphate broth in petri-dishes and incubated at 44 deg. C for Fecal and 37 deg. for Total coliform for 24 hours. Significantly high population of Fecal and Total coliform bacteria was recorded at Karachi harbour area and Indus delta region. Results indicate that a large amount of domestically originated waste is being discharged into these locations without any pre-treatment (e.g., screening, activated sludge, by using filtration beds etc.) resulting in a poor seawater quality making it unfit for bathing. (author)

Isolation, identification, screening of toxicity and oligopeptides of some marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the search for bioactive natural compounds

OpenAIRE

Hameed, Shaista

2009-01-01

Cyanobacteria produce a number of bioactive compounds, most of them are oligopeptides. Almost all are known from freshwater species. The aim of this study was to search for marine and brackish water species producing bioactive compounds. To reach this goal, new strains were isolated from Norwegian and Pakistani coastal waters. These and additional strains from NIVA, UiO and UiB culture collections (24 in total), belonging to Chroococcales and Oscillatoriales, were identified based on morpholo...

Autozygosity mapping of a large consanguineous Pakistani family reveals a novel non-syndromic autosomal recessive mental retardation locus on 11p15-tel

DEFF Research Database (Denmark)

Rehman, Shoaib ur; Baig, Shahid Mahmood; Eiberg, Hans

2011-01-01

done in all sampled individuals in the family. The nuclear central loop in the five generation family showed homozygosity for a 6-Mb telomeric region on 11p15, whereas all other linkage regions were excluded by calculation of logarithm of odds (LOD) for the SNP microarray data. A maximum LOD score of Z......Autosomal recessive inherited mental retardation is an extremely heterogeneous disease and accounts for approximately 25% of all non-syndromic mental retardation cases. Autozygosity mapping of a large consanguineous Pakistani family revealed a novel locus for non-syndromic autosomal recessive...

Chemical composition of particles from traditional burning of Pakistani wood species

Science.gov (United States)

Shahid, Imran; Kistler, Magdalena; Mukhtar, Azam; Ramirez-Santa Cruz, Carlos; Bauer, Heidi; Puxbaum, Hans

2015-11-01

Total particulate matter (TPM) emitted during burning of three types of Pakistani wood (eucalyptus camaldulensis, local name Safeeda; acacia nilotica, local name Kikar, Babul; dalbergia sissoo, Shisham, Tali) in a traditional brick stove were collected and analyzed for anhydrosugars, sugar alcohols, trace metals, soluble ions and carbonaceous species. This is a first study reporting anhydrosugars in wood smoke particles emitted during traditional burning of common wood types in Pakistan. Carbonaceous species showed the highest contribution to the particulate matter. Although the total carbon (TC) contribution was similar for all burnings (64.8-70.2%), the EC/OC ratio varied significantly, from 0.2 to 0.3 for Accacia and Dalbergia to 0.7-0.8 for Eucalyptus and Wood-mix. Among inorganic constituents potassium chloride and silicon were found at levels higher than 1%. The levoglucosan concentrations ranged from 3.0 to 6.6% (average 5.6%) with the highest value for Accacia and lowest value for the wood-mix. The high levoglucosan/mannosan ratios of 20-28 were typical for hardwood. The ratio between levoglucosan and galactosan varied stronger and was found to be around 13-20 for Accacia, Eucalyptus and Wood mix, and 43 for Dalbergia. The determined levoglucosan concentrations allowed assessing the conversion factor for calculation of biomass smoke contribution to ambient particulate matter levels in Pakistan.

Impact on indoor air quality during burning of Pakistani coal briquettes

International Nuclear Information System (INIS)

Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.

1993-01-01

A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside

Attitudes towards euthanasia and physician-assisted suicide among Pakistani and Indian doctors: A survey

Directory of Open Access Journals (Sweden)

Syed Qamar Abbas

2008-01-01

Full Text Available Aim: This study attempts to assess the attitude of Pakistani and Indian doctors to euthanasia and physician-assisted suicide. Methods: We used a questionnaire survey that included one case history of a patient with cancer and another of one suffering from motor neurone disease (MND. Results: Fifty-two of 100 doctors from Pakistan returned the completed questionnaires. Eight of the 52 (15.3% doctors agreed with the concept of euthanasia being an acceptable option for the patient with MND. Six of the 52 (11.5% supported a similar approach for the cancer patient. From India, 60/100 doctors returned the completed questionnaires. Sixteen of the 60 (26.6% doctors supported euthanasia as an option for the patient with MND whereas 15 (25% supported a similar option for the cancer patient. Conclusion: We conclude that only a minority of the doctors support euthanasia. This group belongs to a younger age group. In Pakistan, they were more likely to be males. The religion of the doctors did not appear to be a determining factor.

Characterizing bread wheat genotypes of Pakistani origin for grain zinc biofortification potential.

Science.gov (United States)

Rehman, Abdul; Farooq, Muhammad; Nawaz, Ahmad; Al-Sadi, Abdullah M; Al-Hashmi, Khalid S; Nadeem, Faisal; Ullah, Aman

2018-03-15

Zinc (Zn) is essential for all life forms and its deficiency is a major issue of malnutrition in humans. This study was carried out to characterize 28 wheat genotypes of Pakistani origin for grain zinc biofortification potential, genetic diversity and relatedness. There was low genetic differentiation among the tested genotypes. However, they differed greatly in yield-related traits, grain mineral (Zn, calcium (Ca) and protein) concentrations and Zn bioavailability. Zinc application increased the concentration of Zn in wheat grain (32.1%), embryo (19.8%), aleurone (47%) and endosperm (23.7%), with an increase in bioavailable Zn (22.2%) and a reduction in phytate concentration (6.8%). Application of Zn also enhanced grain protein and Ca concentrations. Among wheat genotypes, Blue Silver had the highest concentration of Zn in grain, embryo, aleurone and endosperm, with high bioavailable Zn, while Kohinoor-83 had low phytate concentration. Wheat genotypes of Pakistan are genetically less diverse owing to continuous focus on the development of high-yielding varieties only. Therefore genetically diverse wheat genotypes with high endospermic Zn concentration and better grain yield should be used in breeding programs approaches, aiming at improving Zn bioavailability. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Construct validation of emotional labor scale for a sample of Pakistani corporate employees.

Science.gov (United States)

Akhter, Noreen

2017-02-01

To translate, adapt and validate emotional labour scale for Pakistani corporate employees. This study was conducted in locale of Rawalpindi and Islamabad from October 2014 to December 2015, and comprised customer service employees of commercial banks and telecommunication companies. It comprised of two independent parts. Part one had two steps. Step one involved translation and adaptation of the instrument. In the second step psychometric properties of the translated scale were established by administering it to customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of emotional labour. Part two comprised the main study. Commercial bank employees were included in the sample by using convenient sampling technique. SPSS 20 was used for data analysis. There were 145 participants in the first study and 495 in the second study . Exploratory factor analysis initially generated three-factor model of emotional labour which was further confirmed by confirmatory factor analysis suggesting that emotional labour had three distinct dimensions, i.e. surface acting, deep acting and genuine expressions of emotions. The emotional labour scale was found to be a valid and reliable measure.

A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

International Nuclear Information System (INIS)

Sohail, Y.

2015-01-01

Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

Addressing key issues in the consanguinity-related risk of autosomal recessive disorders in consanguineous communities: lessons from a qualitative study of British Pakistanis.

Science.gov (United States)

Darr, A; Small, N; Ahmad, W I U; Atkin, K; Corry, P; Modell, B

2016-01-01

Currently, there is no consensus regarding services required to help families with consanguineous marriages manage their increased genetic reproductive risk. Genetic services for communities with a preference for consanguineous marriage in the UK remain patchy, often poor. Receiving two disparate explanations of the cause of recessive disorders (cousin marriage and recessive inheritance) leads to confusion among families. Further, the realisation that couples in non-consanguineous relationships have affected children leads to mistrust of professional advice. British Pakistani families at-risk for recessive disorders lack an understanding of recessive disorders and their inheritance. Such an understanding is empowering and can be shared within the extended family to enable informed choice. In a three-site qualitative study of British Pakistanis, we explored family and health professional perspectives on recessively inherited conditions. Our findings suggest, firstly, that family networks hold strong potential for cascading genetic information, making the adoption of a family-centred approach an efficient strategy for this community. However, this is dependent on provision of high-quality and timely information from health care providers. Secondly, families' experience was of ill-coordinated and time-starved services, with few having access to specialist provision from Regional Genetics Services; these perspectives were consistent with health professionals' views of services. Thirdly, we confirm previous findings that genetic information is difficult to communicate and comprehend, further complicated by the need to communicate the relationship between cousin marriage and recessive disorders. A communication tool we developed and piloted is described and offered as a useful resource for communicating complex genetic information.

Experience of dietary advice among Pakistani-born persons with type 2 diabetes in Oslo.

Science.gov (United States)

Fagerli, Rønnaug Aa; Lien, Marianne E; Wandel, Margareta

2005-12-01

Experience and implementation of dietary advice are influenced by various factors including ethnic, cultural and religious background. The aim is to explore how ethnic minority persons with diabetes experience dietary advice given by Norwegian health-workers, which strategies they have in response to the advice and how they explain their actions. In-depth interviews were performed with 15 Pakistani-born persons with type 2 diabetes living in Oslo. The analyses are based on the principles of Giorgi's interpretation of phenomenology. The participants expressed great concern to follow the advice. However, narratives about constraints were numerous. These concerned different life-situational factors, but more importantly they were related to communication problems arising from discontinuities between universalising medical knowledge and lay knowledge, as well as between different types of culturally defined lay knowledge. As a consequence, advice was generally experienced as inadequately based on the participant's food-cultural background, leaving the person with diabetes to do the translation between different levels of knowledge. In general health-workers would benefit from expanding their knowledge of the many positive aspects of their patients' cultural background, and apply their knowledge thereafter, whether it concerns (food)-culture or the impact of religion in everyday life.

Viral Etiologies of Acute Dehydrating Gastroenteritis in Pakistani Children: Confounding Role of Parechoviruses

Directory of Open Access Journals (Sweden)

Muhammad Masroor Alam

2015-01-01

Full Text Available Despite substantial interventions in the understanding and case management of acute gastroenteritis, diarrheal diseases are still responsible for a notable amount of childhood deaths. Although the rotavirus is known to cause a considerable burden of pediatric diarrheal cases, the roles of other viruses remain undefined for the Pakistani population. This study was based on tertiary care hospital surveillance, from January 2009 to December 2010, including the detection of rotavirus, norovirus, astrovirus, and human parechovirus in children under the age of five using serological or molecular assays. Rotavirus, human parechovirus, norovirus, and astrovirus were detected in 66%, 21%, 19.5%, and 8.5% subjects, respectively. Human parechovirus genotypes, determined through analysis of VP1 gene sequences, showed a great diversity among co-circulating strains. Eighty percent of hospitalized children had dual or multiple viral infections, while 98% parechovirus positive cases were co-infected with rotavirus. The remarkable diversity of viruses associated with the childhood diarrhea in Pakistan calls for large-scale epidemiological surveys, coupled with case control studies, to ascertain their role in clinical manifestations. In addition, these findings also highlight the need for the implementation of up-to-date health interventions, such as the inclusion of a rotavirus vaccine in routine immunization programs for the improvement of quality in child health care.

Minority ethnic community participation in needs assessment and service development in primary care: perceptions of Pakistani and Bangladeshi people about psychological distress.

Science.gov (United States)

Kai, Joe; Hedges, Clive

1999-03-01

OBJECTIVES: To promote community participation in exploring perceptions of psychological distress amongst Pakistani and Bangladeshi people, in order to develop appropriate services. DESIGN: Training and facilitation of resident community members (as community project workers), to define and conduct qualitative research involving semistructured interviews in their own communities, informing primary care led commissioning and service decision making. Setting A socio-economically disadvantaged inner-city locality in the UK. Participants One-hundred and four South Asian people (49 of Pakistani and 55 of Bangladeshi origin), interviewed by 13 resident community members. RESULTS: All community project workers completed training leading to a National Vocational Qualification, and successfully executed the research. Most study respondents located their main sources of stress within pervasive experience of racism and socio-economic disadvantage. They were positive about 'talking' and neutral listening as helpful, but sought strategies beyond non-directive counselling services that embraced practical welfare advice and social support. The roles of primary health care professionals were believed to be restricted to physical ill health rather than personal distress. The importance of professionals' sex, age, ethnicity and social status were emphasized as affecting open communication. Practical recommendations for the re-orientation and provision of services were generated and implemented in response to the findings, through dialogue with a primary care commissioning group, Health and Local Authority, and voluntary agencies. CONCLUSIONS: The work illustrates the feasibility and value of a community participation approach to research and service development in addressing a challenging and neglected area of minority ethnic health need. It offers one model for generating responsive service change in the context of current health policy in the UK, whilst also imparting skills and

Computer users' ergonomics and quality of life - evidence from a developing country.

Science.gov (United States)

Ahmed, Ishfaq; Shaukat, Muhammad Zeeshan

2018-06-01

This study is aimed at investigating the quality of workplace ergonomics at various Pakistani organizations and quality of life of computer users working in these organizations. Two hundred and thirty-five computer users (only those employees who have to do most of their job tasks on computer or laptop, and at their office) responded by filling the questionnaire covering questions on workplace ergonomics and quality of life. Findings of the study revealed the ergonomics at those organizations was poor and unfavourable. The quality of life (both physical and mental health of the employees) of respondents was poor for employees who had unfavourable ergonomic environment. The findings thus highlight an important issue prevalent at Pakistani work settings.

Frequency of different disorders requiring warfarin therapy and its outcome in terms of dosage and inr value in pakistani population

International Nuclear Information System (INIS)

Qayyum, A.; Najmi, M.H.

2014-01-01

To determine the frequency of different disorders requiring warfarin therapy and to see the target INR and warfarin dose requirement in Pakistani population. Study Design:Descriptive study. Setting and Duration of Study: The study was carried out at Armed Forces Institut e of Cardiology (AFIC) Rawalpindi, Military Hospital Rawalpindi and National Institute of Cardiovascular Diseases (NICVD), Karachi, Pakistan from October 2010 to March 2012. Patients and Methods: Stable patients taking warfarin therapy were recruited after detailed medical history, physical examination and laboratory tests. The demographic and clinical data of individuals were entered in a pre-structured proforma. Patients suffering from hepatic and renal disease, any co-morbid disease or taking any concurrent medication or diet which would have affected warfarin therapy, were excluded. Data was analyzed using PSS version 20.0. Results: A total of 607 stable patients fulfilling the eligibility criteria, participated in the study. There were 297 (48.9%) male and 310 (51.1%) female patients. The mean age was 37.93 +- 12.23 years (range 18-65 years). The most common indication for warfarin therapy was valvular heart diseases (93.4%) followed by atrial fibrillation (2.3%) whereas other indications for warfarin use are less commonly seen in our study population. Patients had mean international normalized ratio (INR) value of 2.3 +9- 0.8 (range 1.5-3.5). Mean daily dose of warfarin calculated in 607 patients was 5.62 and 1.98 mg with the range of 0.36-15 g whereas mean weekly dose was 39.36 +- 13.8 mg with the range of 2.5-105 mg. Conclusion: In Pakistani population the most common indications for warfarin use are valvular heart diseases followed by atrial fibrillation. The mean INR values were within recommended range of 2-3. The mean daily dose observed in long-term therapy is comparable to the empirical dose of 5 mg routinely started in clinical practice. (author)

Antimicrobial activity of the bioactive components of essential oils from Pakistani spices against Salmonella and other multi-drug resistant bacteria

Science.gov (United States)

2013-01-01

Background The main objective of this study was the phytochemical characterization of four indigenous essential oils obtained from spices and their antibacterial activities against the multidrug resistant clinical and soil isolates prevalent in Pakistan, and ATCC reference strains. Methods Chemical composition of essential oils from four Pakistani spices cumin (Cuminum cyminum), cinnamon (Cinnamomum verum), cardamom (Amomum subulatum) and clove (Syzygium aromaticum) were analyzed on GC/MS. Their antibacterial activities were investigated by minimum inhibitory concentration (MIC) and Thin-Layer Chromatography-Bioautographic (TLC-Bioautographic) assays against pathogenic strains Salmonella typhi (D1 Vi-positive), Salmonella typhi (G7 Vi-negative), Salmonella paratyphi A, Escherichia coli (SS1), Staphylococcus aureus, Pseudomonas fluorescens and Bacillus licheniformis (ATCC 14580). The data were statistically analyzed by using Analysis of Variance (ANOVA) and Least Significant Difference (LSD) method to find out significant relationship of essential oils biological activities at p essential oils, oil from the bark of C. verum showed best antibacterial activities against all selected bacterial strains in the MIC assay, especially with 2.9 mg/ml concentration against S. typhi G7 Vi-negative and P. fluorescens strains. TLC-bioautography confirmed the presence of biologically active anti-microbial components in all tested essential oils. P. fluorescens was found susceptible to C. verum essential oil while E. coli SS1 and S. aureus were resistant to C. verum and A. subulatum essential oils, respectively, as determined in bioautography assay. The GC/MS analysis revealed that essential oils of C. cyminum, C. verum, A. subulatum, and S. aromaticum contain 17.2% cuminaldehyde, 4.3% t-cinnamaldehyde, 5.2% eucalyptol and 0.73% eugenol, respectively. Conclusions Most of the essential oils included in this study possessed good antibacterial activities against selected multi

Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

Directory of Open Access Journals (Sweden)

Muhammad Arif Soomro

2016-08-01

Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

Evaluation of genetic diversity in different Pakistani wheat land races

International Nuclear Information System (INIS)

Mahmood, T.; Siddiqua, A.; Rasheed, A.; Nazar, N.

2011-01-01

Wheat is one of the main sources of nutrition worldwide. Genetic improvement of the seed makes wheat a source of high quality flour for human consumption and for other industrial uses. With the help of molecular markers, the available germplasm of wheat can be assessed for future breeding programs. Therefore, the aim of the present work was to analyze the genetic diversity among 15 Pakistani wheat land races based on Random Amplified Polymorphism DNA (RAPD) markers. A total of 284 DNA fragments were amplified, ranging in size from 200bp to 1100bp by using six primers. The number of DNA fragments for each primer varied from 2 (OPC-6) to 9 (OPC-8) with an average of 6 fragments per primer. Out of 284 amplified products, 120 were monomorphic and 137 were polymorphic showing an average of 7.8% polymorphism per primer. One specific marker was detected both for OPC-1 and OPC-8, two for OPC-5, while no RAPD specific marker was detected for the remaining primers. The genetic similarity index values ranged from 0.36 to 0.93, with an average of 0.64. Maximum genetic similarity (91%) was observed between Sur bej and Khushkawa. On the contrary, minimum genetic similarity (32%) was observed in Khushkaba-1 and Khushkawa. The dendrogram resulting from the NTSYS cluster analysis showed that the studied genotypes are divided into two main clusters from the same node. The first cluster contained 13 land races, while the second cluster contained only 2 land races. The dendrogram clustered the genotypes into 5 groups and showed efficiency in identifying genetic variability. These results indicated the usefulness of RAPD technique in estimating the genetic diversity among wheat genetic resources. (author)

Bilateral Moyamoya Disease in a 2-Year-Old Pakistani Male Treated with Bilateral Encephaloduroarteriosynangiosis: A Positive Outcome

Directory of Open Access Journals (Sweden)

Shahvaiz Magsi

2016-01-01

Full Text Available Background. We present a rare case of bilateral moyamoya disease presenting as multiple strokes and neurological deficits, treated with the neurosurgical procedure, encephaloduroarteriosynangiosis (EDAS, in a 2-year-old male Pakistani minor. A positive outcome was achieved and the patient recovered fully. Case Summary. Our patient presented with a history of seizures and multiple episodes of hemiparesis (on and off weakness at the age of 2 years. He had a delayed speech development and could not speak more than a few words. He had a slight slurring of speech too. He was diagnosed with bilateral moyamoya disease on Computed Tomography Angiography (CTA. Bilateral EDAS was done in the same year, after which his symptoms improved and patient had moderate functional recovery. Conclusion. A rare disease, moyamoya has been left unexplored in Pakistan; physicians and surgeons when dealing with cases in the pediatric population presenting with symptoms of stroke, signs of generalized weakness, and seizures should consider moyamoya disease as a possibility. Furthermore, this case demonstrates the effectiveness of EDAS procedure for the treatment of moyamoya disease.

Toxic metals distribution in different components of Pakistani and imported cigarettes by electrothermal atomic absorption spectrometer

International Nuclear Information System (INIS)

Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.

2009-01-01

It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy

Clinical Utility of a Coronary Heart Disease Risk Prediction Gene Score in UK Healthy Middle Aged Men and in the Pakistani Population.

Directory of Open Access Journals (Sweden)

Katherine E Beaney

Full Text Available Numerous risk prediction algorithms based on conventional risk factors for Coronary Heart Disease (CHD are available but provide only modest discrimination. The inclusion of genetic information may improve clinical utility.We tested the use of two gene scores (GS in the prospective second Northwick Park Heart Study (NPHSII of 2775 healthy UK men (284 cases, and Pakistani case-control studies from Islamabad/Rawalpindi (321 cases/228 controls and Lahore (414 cases/219 controls. The 19-SNP GS included SNPs in loci identified by GWAS and candidate gene studies, while the 13-SNP GS only included SNPs in loci identified by the CARDIoGRAMplusC4D consortium.In NPHSII, the mean of both gene scores was higher in those who went on to develop CHD over 13.5 years of follow-up (19-SNP p=0.01, 13-SNP p=7x10-3. In combination with the Framingham algorithm the GSs appeared to show improvement in discrimination (increase in area under the ROC curve, 19-SNP p=0.48, 13-SNP p=0.82 and risk classification (net reclassification improvement (NRI, 19-SNP p=0.28, 13-SNP p=0.42 compared to the Framingham algorithm alone, but these were not statistically significant. When considering only individuals who moved up a risk category with inclusion of the GS, the improvement in risk classification was statistically significant (19-SNP p=0.01, 13-SNP p=0.04. In the Pakistani samples, risk allele frequencies were significantly lower compared to NPHSII for 13/19 SNPs. In the Islamabad study, the mean gene score was higher in cases than controls only for the 13-SNP GS (2.24 v 2.34, p=0.04. There was no association with CHD and either score in the Lahore study.The performance of both GSs showed potential clinical utility in European men but much less utility in subjects from Pakistan, suggesting that a different set of risk loci or SNPs may be required for risk prediction in the South Asian population.

Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

Science.gov (United States)

Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

2016-01-01

We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Preservation of Cultural Heritage Embodied in Traditional Crafts in the Developing Countries. A Case Study of Pakistani Handicraft Industry

Directory of Open Access Journals (Sweden)

Yongzhong Yang

2018-04-01

Full Text Available Cultural heritage embodied in traditional crafts is an integral part of any nation which reflects the culture and tradition of a particular region. Although the importance of handicraft has been widely recognized, the literature regarding preservation of traditional craft is scarce. The present paper aimed to explore and identify issues faced by traditional craftsmanship in developing countries and to address those issues in order to contribute to the sustainability of traditional craft heritage and ensure continuous transmission of craft skills and knowledge from generation to generation. Our study identified several key issues which poses substantial challenges to the preservation of traditional craft heritage in developing countries. In order to add empirical evidence, we examined the case of Pakistani handicraft industry that provided further understanding of highlighted issues which traditional craft heritage face. We have suggested some policies to promote, develop and preserve the traditional craft heritage. The significance of these policy suggestions is underlined with the case study of Pakistan.

Correlation of bone mineral density with biochemical markers in different menopausal statuses of Pakistani women

International Nuclear Information System (INIS)

Maqsood, A.; Nadia, N.; Farzana, A.; Bashir, A.

2005-01-01

Aim: The present study is aimed to use bone mineral density (BMD) and various biochemical markers to predict the fracture risk at different menopausal statuses in Pakistani women. Method: Seventy women aged between 28-80 years at various menopausal statuses participated in this study. BMD (T score) of right calcaneus was determined using SAHARA ultrasound bone densitometer that measures the transmission of high frequency from heel. Various biochemical markers such as alkaline phosphates, calcium and inorganic phosphorus were measured from the serum of venous blood using standard kits of Randox. Results: Alkaline phosphates was raised in per menopausal, postmenopausal and postmenopausal with hysterectomy and ligation groups of women as compared to premenopausal women but did not achieve significance (P>0.05). Serum calcium level was significantly lower in postmenopausal women than premenopausal women and inorganic phosphorus decrease significantly when compared with premenopausal and postmenopausal with ligation and hysterectomy. BMD (T score) values of postmenopausal osteopenic and postmenopausal osteoprotic women were significantly lower than those of premenopausal women. BMD values of women under study have negative correlation with age, alkaline phosphates and calcium. Conclusion: Our study conclude that in addition to BMD, serum levels of alkaline phosphate, calcium and inorganic phosphorus can be valuable biochemical markers in predicting bone fracture risk at different menopausal states. (author)

Estimating risk of atherosclerotic cardiovascular diseases in non-atherosclerotic Pakistani patients: Study conducted at National Institute of Cardiovascular Diseases, Karachi, Pakistan

International Nuclear Information System (INIS)

Ashraf, T.; Achakzai, A.S.; Farooq, F.; Memon, M.A.

2017-01-01

This cross-sectional study was carried out at the National Institute of Cardiovascular Disease, Karachi, from July 2014 to March 2015, and comprised male and female subjects with multi-ethnic background, aged 20-79 years and having non-atherosclerotic disease. SPSS 22 was used for data analysis. Results: Of the 437 participants, 174(39.8%) were men and 263(60.2%) were women. The overall mean age was 42.65+-11.45 years. The mean age of men was 43.3+-12.1 years and that of women was 42.2+-10.8 years. Moreover, ten-year and lifetime risk assessment rates were higher in men (50[28.2%] and 86[49.4%] respectively) compared to women (28[10.6%] and 84[31.9%], respectively). Conclusion: Urdu-speaking Pakistanis were found to be at higher risk from atherosclerotic cardiovascular disease.

Estimated percentage of typhoid fever in adult pakistani population (TAP) study

International Nuclear Information System (INIS)

Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S.

2013-01-01

Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

Estimated percentage of typhoid fever in adult pakistani population (TAP) study

Energy Technology Data Exchange (ETDEWEB)

Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S. [Mayo Hospital, Lahore (Pakistan). Dept. of Medicine

2013-01-15

Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

Cultural perceptions and the productive roles of rural Pakistani women.

Science.gov (United States)

Ibraz, T S

1992-01-01

The roles of rural Pakistani women in agricultural production are described with numerous examples from a village study by Anwar and Bilquees, and the author's research in a Punjabi village (Rajpur) to show cultural perceptions of women and their work, and the nature of productive activities inside the house and outside on the farm. The cultural perceptions are related to the image of women as dependent/private wives and mothers. A broad definition of production is used to include activities, such as churning milk which generates income and saves expenditures and making butter which fulfills household needs and is sold in the market for cash. Rajpur is a village engaged in social change. Men seek work outside the villages, and women take on work previously assumed by men. Women contribute considerably to the year-round production and processing of major crops. The productive labor of women by major crop type and activity type are described and charted. Tending livestock is performed exclusively by men. Handicraft activity at home reduces expenditure for buying these items in the local markets. Most women were unaware of the savings and "indirect" income their work contributed to the household. Work for wages is viewed as men's work. Women's mobility beyond the fields and home is still limited; market activity must be conducted with a male present and women do not earn cash. The division of labor is conceived by men for women because of women's cultural identity. Women are perceived as "chase daughters/sisters, fertile wives, and nurturing mothers." There are punishments or social rewards for proper behavior. Women in their private domain are expected to "look good within the house," which is viewed as a feminine world. The outside world is masculine. Women are also seen as lacking reasoning ability and their motherhood roles limit their capability to cope with external affairs. There is great value attached to the invisibility of women physically, socially, and

Investigating Social Commerce as an Alternate Model for Online Commerce in Developing Countries: a case of Pakistani Economy

Directory of Open Access Journals (Sweden)

Amina Talat

2013-05-01

Full Text Available The study is an empirical quantitative research. In light of intense literature review it proposes a new model for effectiveness of social commerce in Pakistan. It has three objectives. It firstly investigates the relationship between perceived risk, social networking focus, and perceived value effect trust. It secondly investigates the relationship between affective influence, word of mouth, affective influence, advertising influence, purchasing experience and viral reach on social commerce. Lastly it investigates how consumer value (adoption and purchase intention is affected by social commerce focus and trust. The software used is SPSS 15.0. Multiple regression equation has been employed to verify the hypotheses. Results show and validate the literature that positive or favorable views of users trigger positive attitude. However, there are two variables and dimensions that do not affect the attitude of users on social networks from the perspective of shopping i.e. social commerce; these are viral reach and previous purchasing experience on different websites. The results show that Pakistani users will welcome social commerce even if they have no previous experience for purchasing goods and services online.

Angiotensin Converting Enzyme Gene I/D Polymorphism in Pakistani Rheumatic Heart Disease Patients and Healthy Controls

Directory of Open Access Journals (Sweden)

Sadia Rehman

2015-09-01

Full Text Available Background: Valve scarring and collagen deposition are crucial in pathogenesis of Rheumatic Heart Disease (RHD, an autoimmune disorder of the heart. Angiotensin I-Converting Enzyme (ACE plays a major role in fibrous tissue formation. Objectives: The present research work aimed to assess the role of ACE Insertion/Deletion (I/D polymorphism in progress of RHD. Patients and Methods: DNA was pre pared from blood samples from 156 RHD patients (156 and 204 healthy ethnically-matched controls. Then, it was screened using sequence-specific Primers. Polymerase chain reaction and Agarose gel electrophoresis. The data were analyzed using Vassar stats (http://faculty.vassar.edu/lowry/VassarStats.html. Results: I allele (P = 0.024, OR = 1.42 and II genotype (P = 0.001, OR = 3.07 were significantly higher in Pakistani RHD patients compared to the healthy controls. Also, a significant difference was found between the female, but not male, patients and the controls regarding I allele and II genotype. Conclusions: The study results provided information about involvement of ACE I/D polymorphism in molecular mechanism of RHD. Thus, it can become one of the useful tools in risk assessment and help with designing strategies to combat the disease.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

Science.gov (United States)

Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

2017-10-26

Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

Evidence based workplace interventions to promote breastfeeding practices among Pakistani working mothers.

Science.gov (United States)

Hirani, Shela Akbar Ali; Karmaliani, Rozina

2013-03-01

Breastfeeding is an essential source of nutrition for young babies; however, it is challenging for employed mothers to continue breastfeeding with employment, especially if workplace support is minimal or missing. In Pakistan, from 1983 to 2008, the prevalence of breastfeeding at 6 months has decreased from 96% to 31%. In this region, workplace barriers have been reported as one of the reasons that result in early cessation of breastfeeding among working mothers. This paper aims at reviewing global literature to explore workplace interventions that can promote the breastfeeding practices among working mothers in Pakistan. A literature search of peer reviewed databases, including CINHAL (1980-2009), MEDLINE (1980-2009), Pub Med (1980-2009), Springer Link (1980-2008), and Cochrane Database of Systematic Reviews (3rd quarter, 2008), was undertaken. Considering the pre-set inclusion and exclusion criteria, out of more than 500 literature sources, 50 were shortlisted and reviewed. A review of global literature revealed that in order to promote breastfeeding practices among employed mothers, the most powerful workplace interventions include: educating working mothers about management of breastfeeding with employment; enhancing employers' awareness about benefits of breastfeeding accommodation at workplace; arranging physical facilities for lactating mothers (including privacy, childcare facilities, breast pumps, and breast milk storage facilities); providing job-flexibility to working mothers; and initiating mother friendly policies at workplace that support breastfeeding. In Pakistani workplace settings, where little attention is paid to sustain breastfeeding practices among working mothers, there is a need to initiate lactation support programmes. These programmes can be made effective by implementing composite interventions at the level of breastfeeding working mothers, employers, and workplace. Copyright © 2012 Australian College of Midwives. Published by Elsevier

She stands alone: Pakistani woman film director, Shireen Pasha.

Science.gov (United States)

Mustafa, A

1995-01-01

This article describes the activities of film director Shireen Pasha in promoting truth in the mass media in Pakistan. Pasha is described as one who finds it inexcusable in a state-subsidized system that national problems of poverty are not aired openly. Pasha has pursued the goal of exposing the real lives of Pakistanis on film in contrast to the publicly aired segments of "pretty girls in nice drawing rooms." Foreign channels available through satellite communications technology are viewed by Pasha as inappropriate with regard to people's needs and uncreative. Pakistan began with one channel, PTV, which recently refused to air her documentary on living conditions in Pakistan's rural areas "The Travelogue Pakistan." "The Walled City of Lahore" was her film about life in the old city. Both films poetically depicted the honor of humans and their struggle to stay alive. Some of her documentaries are made to show the value of indigenous skills, centuries old know-how, and traditions, regardless of the poverty. Pasha is described as fighting with PTV management over use of resources. Pasha desires to invest in training people to do documentaries or be more field-oriented rather than investing in equipment. Pasha joined PTV in 1975 and left in 1990. Pasha is recognized for her isolation as a woman in the business world, her commitment to exposing remote cultures and truth, and the odds she must confront in attaining her goals. Pasha is committed to doing extensive research, usually conducted during the summer months, in order to construct a credible story line that is produced usually during the winter months. One model of film story line is defined as one where women are portrayed as starting from an indigenous skill or knowledge and shifting to a greater position of power and control over their lives. Pasha believes that people who make films have the responsibility to evoke a reaction in people and to offer solutions. Two acclaimed films, which were supported by

Association of body fat and vitamin D status and the effect of body fat on the response to vitamin D supplementation in Pakistani immigrants in Denmark

DEFF Research Database (Denmark)

Grønborg, Ida Marie; Lundby, M.; Mølgaard, C.

2015-01-01

Vitamin D deficiency and obesity are both prevalent conditions in the northern countries, especially among immigrants. The aims were to assess the possible relationship between body fat and vitamin D status, and to investigate the effect of body fat on the response to oral vitamin D supplementation...... in Pakistani immigrants in Denmark. Data were obtained from a 1-year double-blind randomised controlled trial with oral vitamin D supplementation. A total of 122 women and men received either vitamin D3 supplementation (10 or 20 μg/day) or placebo. No association was found between body fat percentage...... and vitamin D status in a multiple linear regression model (Passociation between body fat percentage and vitamin D status, and body fat percentage had...

Study of Biochemical Changes and Elevated Levels of Enzymes in Salmonella typhi Infected Patients in Pakistani Population

Directory of Open Access Journals (Sweden)

Ayesha Shamim

2012-04-01

Full Text Available Typhoid fever causes significant biochemical changes and hepatic complications. As many studies have indicated several biochemical parameters that are involved in developing the risk of typhoid fever. The current study was designed to evaluate these risk factors in general Pakistani population. Serum biochemistry and liver enzymes were studied to investigate the relationship of these risk factors to Typhoid fever. Total 100 subjects were studied, 50 healthy individuals and 50 typhoid patients. Blood samples were collected from Allied and National Hospital, Faisalabad, Pakistan. In this study, Nested PCR was used to test the samples. Elevated level of ALT (P<0.0001 and AST (P<0.0001 were observed in typhoid patients. Typhoid patients had significantly higher concentrations of Triglyceride (P=0.0044, Globulin (P=0.0004 and Total protein (P=0.0978 while LDL (P=0.0197, Albumin (P<0.0001, Glucose (P=0.0006, HDL-cholesterol (P<0.0001 and Cholesterol (P=0.04 were significantly lower than those of healthy individuals. This study appears to be ample evidence based on the physiological and biochemical parameters in typhoid patients to explain influence of typhoid morbidity. Extensive research in this field would enable us to make modern drugs to treat typhoid fever patients.

Depressive disorder and social stress in Pakistan compared to people of Pakistani origin in the UK.

Science.gov (United States)

Husain, Nusrat; Chaudhry, Nasim; Tomenson, Barbara; Jackson, Judy; Gater, Richard; Creed, Francis

2011-11-01

Depressive disorder is more common in low to middle than high-income countries, but the reasons for this have not been explicitly defined. We compared the results of two population-based studies of people of Pakistani origin: one living in rural Pakistan and one in UK. Both samples were screened with the self-reporting questionnaire followed by research interview to determine depressive disorders and social stress. Logistic regression was used to compare the prevalence of depressive disorder in the two countries after adjustment for socio-demographic characteristics and social stress. The estimated prevalence of depression for men was 35.8% (95% CI 16.1-55.5) in Pakistan and 9% (5.0-13.0) in Manchester (pstress (both sexes). 35% of women in Pakistan and 71% of those in UK had received 8 years or more of education. Extremely poor housing and marked poverty were experienced by 36.1% of women in Pakistan and 0.6% of those in Manchester. In Pakistan, housing and poverty predominated as correlates of depression, whereas in Manchester it was marked difficulties in physical health and close relationships. The results suggest that the higher rate of depressive disorder amongst women in Pakistan compared to UK can be attributed to less education and frequent severe social difficulties. These differences have implications for treatment.

Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

International Nuclear Information System (INIS)

Bhatti, S.M.; Dhakam, S.; Khan, M.A.

2009-01-01

Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

Pakistan ei peaks ootama demokraatia hinnaalandust / Marianne Mikko

Index Scriptorium Estoniae

Mikko, Marianne, 1961-

2008-01-01

Euroopa Parlamendi Pakistani valimiste vaatlusmissiooni liige kirjeldab olukorda Pakistanis, tema hinnangul takistavad Pakistani majandust põhiliselt klannimajandus ning sellega kaasnev korruptsioon. Euroopa peab aitama seda olukorda muuta. Kaart: Pakistani üldvalimised

Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

Directory of Open Access Journals (Sweden)

Vaqar Talha

2008-04-01

Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

Postoperative pain assessment using four behavioral scales in Pakistani children undergoing elective surgery

Directory of Open Access Journals (Sweden)

Faisal Shamim

2015-01-01

Full Text Available Background: Several measurement tools have been used for assessment of postoperative pain in pediatric patients. Self-report methods have limitations in younger children and parent, nurse or physician assessment can be used as a surrogate measure. These tools should be tested in different cultures as pain can be influenced by sociocultural factors. The objective was to assess the inter-rater agreement on four different behavioral pain assessment scales in our local population. Materials and Methods: This prospective, descriptive, observational study was conducted in Pakistan. American Society of Anesthesiologists I and II children, 3-7 years of age, undergoing elective surgery were enrolled. Four pain assessment scales were used, Children′s Hospital of Eastern Ontario Pain Scale (CHEOPS, Toddler Preschool Postoperative Pain Scale (TPPPS, objective pain scale (OPS, and Face, Legs, Activity, Cry, Consolability (FLACC. After 15 and 60 min of arrival in the postanesthesia care unit (PACU, each child evaluated his/her postoperative pain by self-reporting and was also independently assessed by the PACU nurse, PACU anesthetist and the parent. The sensitivity and specificity of the responses of the four pain assessment scales were compared to the response of the child. Results: At 15 min, sensitivity and specificity were >60% for doctors and nurses on FLACC, OPS, and CHEOPS scales and for FLACC and CHEOPS scale for the parents. Parents showed poor agreement on OPS and TPPS. At 60 min, sensitivity was poor on the OPS scale by all three observers. Nurses showed a lower specificity on FLACC tool. Parents had poor specificity on CHEOPS and rate of false negatives was high with TPPS. Conclusions: We recommend the use of FLACC scale for assessment by parents, nurses, and doctors in Pakistani children aged between 3 and 7.

Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya.

Science.gov (United States)

Adnan, Muhammad; Hölscher, Dirk

2012-12-01

Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya Medicinal plants collected in Himalayan forests play a vital role in the livelihoods of regional rural societies and are also increasingly recognized at the international level. However, these forests are being heavily transformed by logging. Here we ask how forest transformation influences the diversity and composition of medicinal plants in northwestern Pakistan, where we studied old-growth forests, forests degraded by logging, and regrowth forests. First, an approximate map indicating these forest types was established and then 15 study plots per forest type were randomly selected. We found a total of 59 medicinal plant species consisting of herbs and ferns, most of which occurred in the old-growth forest. Species number was lowest in forest degraded by logging and intermediate in regrowth forest. The most valuable economic species, including six Himalayan endemics, occurred almost exclusively in old-growth forest. Species composition and abundance of forest degraded by logging differed markedly from that of old-growth forest, while regrowth forest was more similar to old-growth forest. The density of medicinal plants positively correlated with tree canopy cover in old-growth forest and negatively in degraded forest, which indicates that species adapted to open conditions dominate in logged forest. Thus, old-growth forests are important as refuge for vulnerable endemics. Forest degraded by logging has the lowest diversity of relatively common medicinal plants. Forest regrowth may foster the reappearance of certain medicinal species valuable to local livelihoods and as such promote acceptance of forest expansion and medicinal plants conservation in the region. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s12231-012-9213-4) contains supplementary material, which is available to authorized users.

Maternity services in multi-cultural Britain: using Q methodology to explore the views of first- and second-generation women of Pakistani origin.

Science.gov (United States)

Cross-Sudworth, Fiona; Williams, Amanda; Herron-Marx, Sandy

2011-08-01

to explore first- and second-generation Pakistani women's experiences of maternity services and the inter generational differences/comparisons. a retrospective Q methodology study of Pakistani women following childbirth. two Children's Centres in an inner city in the West Midlands. women self-identified following distribution of information leaflets at Children's Centres. Fifteen women took part in interviews (Stage one) using a semi-structured design and 16 women participated in the completion of the Q grid sorting (Stage four). a standard five-stage Q methodology process took place: (1) initial data were gathered using a combination of individual face-to-face and focus group semi-structured community-based interviews (developing the concourse); (2) transcribed interviews were analysed for 'themes'; (3) the themes were reduced to 'statements' that reflected the overall content of the concourse using an unstructured evolving approach (giving the Q set); (4) participants were asked to sort the statements (Q sorting) according to a pre-designed distribution grid providing individual participant response grids; and (5) the response grids were factor analysed using PQ Method (V2.11), which generates clusters of participants rather than clusters of variables. Factor loadings were calculated using factor analysis by principal components with varimax rotation. This produced a list of factors, each of which represents a 'story' of women's experiences of maternity services. Throughout the process, an Urdu interpreter was involved. six factors were identified: (1) confidence and empowerment of women who had attended higher education and had family support; (2) isolation of some women from both family and maternity services; (3) women who had poor experiences of maternity services but good family support, and wanted opportunities to be involved in service development; (4) women with positive experiences of maternity care and influenced by traditional cultural practices; (5

Investigation of total seed storage proteins of pakistani and japanese maize (zea mays l.) through sds-page markers

International Nuclear Information System (INIS)

Shinwari, Z.K.

2014-01-01

The assessment of genetic diversity among the members of a species is of vital importance for successful breeding and adaptability. In the present study 83 genotypes of maize of Pakistani and Japanese origin were evaluated for the total seed storage proteins using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) through vertical slab unit. The total protein subunits were separated on 12% polyacrylamide gel using standard protocols. A total of 18 protein subunits were noted out of which 7 (39%) were monomorphic and 11 (61%) were polymorphic, with molecular weight ranging from 10 to 122 kDa. Coefficients of similarity among the accessions ranged between 0.89 and 1.00. The dendrogram obtained through UPGMA clustering method showed two main clusters: 1 and 2. First cluster comprised of 9 genotypes including Sahiwal-2002, while second cluster contained 74 genotypes including Aaiti-2002 and Sadaf. Over all a low level of polymorphism was observed in total seed storage protein patterns of maize genotypes from Pakistan as well as Japan. It is inferred from the present study that more genotypes of maize could be brought under study and more advanced biochemical techniques with more reliable results could be followed to bring assessment of genetic diversity of maize for planning breeding programs. (author)

Genotype and phenotype relationships in 10 Pakistani unrelated patients with inherited factor VII deficiency.

Science.gov (United States)

Borhany, M; Boijout, H; Pellequer, J-L; Shamsi, T; Moulis, G; Aguilar-Martinez, P; Schved, J-F; Giansily-Blaizot, M

2013-11-01

Inherited factor VII (FVII) deficiency is one of the commonest rare bleeding disorders. It is characterized by a wide molecular and clinical heterogeneity and an autosomal recessive pattern of inheritance. Factor VII-deficient patients are still scarcely explored in Pakistan although rare bleeding disorders became quite common as a result of traditional consanguineous marriages. The aim of the study was to give a first insight of F7 gene mutations in Pakistani population. Ten unrelated FVII-deficient patients living in Pakistan were investigated (median FVII:C = 2%; range = 2-37%). A clinical questionnaire was filled out for each patient and direct sequencing was performed on the coding regions, intron/exon boundaries and 5' and 3' untranslated regions of the F7 gene. Nine different mutations (eight missense mutations and one located within the F7 promoter) were identified on the F7 gene. Five of them were novel (p.Cys82Tyr, p.Cys322Ser, p.Leu357Phe, p.Thr410Ala, c-57C>T, the last being predicted to alter the binding site of transcription factor HNF-4). Half of the patients had single mutations in Cys residues involved in disulfide bridges. The p.Cys82Arg mutation was the most frequent in our series. Six of seven patients with FVII:C levels below 10% were homozygous in connection with the high percentage of consanguinity in our series. In addition, we graded the 10 patients according to three previously published classifications for rare bleeding disorders. The use of the bleeding score proposed by Tosetto and co-workers in 2006 appears to well qualify the bleeding tendency in our series. © 2013 John Wiley & Sons Ltd.

Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

Science.gov (United States)

Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad

2014-01-01

Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

Air Land Sea Bulletin. Issue Number 2011-1, January 2011

Science.gov (United States)

2011-01-01

Authority ( NDMA ), Pakistan‘s equiv- alent to the United States Federal Emergency Management Agency (FEMA). Understanding the Environment...Pakistani Army General with the NDMA , chiefs, and representatives from all other nongovernmental organizations, and airlift contributors to the relief

Evaluation of a cross-cultural training program for Pakistani educators: Lessons learned and implications for program planning.

Science.gov (United States)

Mazur, Rebecca; Woodland, Rebecca H

2017-06-01

In this paper, we share the results of a summative evaluation of PEILI, a US-based adult professional development/training program for secondary school Pakistani teachers. The evaluation was guided by the theories of cultural competence (American Psychological Association, 2003; Bamberger, 1999; Wadsworth, 2001) and established frameworks for the evaluation of professional development/training and instructional design (Bennett, 1975; Guskey, 2002; King, 2014; Kirkpatrick, 1967). The explicit and implicit stakeholder assumptions about the connections between program resources, activities, outputs, and outcomes are described. Participant knowledge and skills were measured via scores on a pre/posttest of professional knowledge, and a standards-based performance assessment rubric. In addition to measuring short-term program outcomes, we also sought to incorporate theory-driven thinking into the evaluation design. Hence, we examined participant self-efficacy and access to social capital, two evidenced-based determinants or "levers" that theoretically explain the transformative space between an intervention and its outcomes (Chen, 2012). Data about program determinants were collected and analyzed through a pre/posttest of self-efficacy and social network analysis. Key evaluation findings include participant acquisition of new instructional skills, increased self-efficacy, and the formation of a nascent professional support network. Lessons learned and implications for the design and evaluation of cross-cultural teacher professional development programs are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nucleic acid amplification test for detection of west nile virus infection in pakistani blood donors

International Nuclear Information System (INIS)

Niazi, S.K.; Alam, M.

2017-01-01

Background: The study was planned to determine the presence of West Nile Virus (WNV) infection in Pakistani blood donors, using Nucleic Acid Amplification Test (NAT). Methods: The blood donors for study were selected on the basis of the standard questionnaire and routine screening results. Six donors were pooled using an automated pipettor and NAT for WNV was performed on Roche Cobas s 201 NAT system. The reactive pools were resolved in Individual Donation-NAT (ID-NAT) format and a sample from FFP bags of reactive donations was retrieved. NAT was again performed on retrieved plasma bag (RPB) sample to confirm the reactive donations. The donors were also recalled and interviewed about history of illness related to recent WNV infection. Results: After serological screening of 1929 donors during the study period, 1860 donors were selected for NAT test for WNV detection. The mean age of the donors was 28±8.77 (range: 18–57 years). 1847 (99.3%) donors were male and 13 (0.7%) were female. NAT for WNV identified six initially reactive pools (0.32%). On follow-up testing with RPB samples, 4 donors (0.21%) were found confirmed reactive for WNV RNA (NAT yield of 1 in 465 blood donors). Conclusion: WNV is a threat to safety of blood products in Pakistan. A screening strategy can be implemented after a large-scale study and financial considerations. One of the reduced cost screening strategies is seasonal screening of blood donors for WNV, with pooling of samples. (author)

Relationship of thyroid-stimulating hormone with metabolic syndrome in a sample of euthyroid Pakistani population

International Nuclear Information System (INIS)

Saleem, M.S.; Khan, K.A.

2011-01-01

Metabolic Syndrome is a group of factors that predispose to cardiovascular diseases. The prevalence of metabolic syndrome is rising rapidly. Recently, a few studies have suggested that lower thyroid function in the reference range may be associated with metabolic syndrome, but the issue remains unsettled. We aimed to elucidate the relationship between thyroid function and components of metabolic syndrome in a sample of euthyroid Pakistani population. Methods: This analytical, cross-sectional study was conducted at the Department of Physiology, University of Health Sciences, Lahore, Pakistan, and extended over a period of 12 months. It included 100 subjects with metabolic syndrome in the study group and thirty subjects without metabolic syndrome in the control group with age ranging 45-55 years. Both groups had normal thyroid function. After a detailed history and clinical examination, fasting blood was analysed for glucose, triglycerides, high density lipoprotein-cholesterol along with thyroid-stimulating hormone (TSH) and free thyroxine. Results: Serum TSH was significantly higher in study group than in control group (p=0.040). Serum free thyroxine values of study group were slightly but not significantly lower than those of control group. Serum TSH correlated significantly and positively with serum triglycerides in all subjects and with waist circumference and diastolic blood pressure in men. Serum TSH showed a positive and linear relationship with the number of components of metabolic syndrome (p=0.016) in all subjects. Conclusion: High-normal TSH is associated with metabolic syndrome and its components. There may be increased risk of cardiovascular diseases with high-normal TSH levels. (author)

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

Science.gov (United States)

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-11-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

Research Output of the Pakistani Library and Information Science Authors: A Bibliometric Evaluation of Their Impact

Directory of Open Access Journals (Sweden)

Anwar, Mumtaz Ali

2017-06-01

Full Text Available This paper uses 601 cited papers of Pakistani LIS researchers with the purpose to examine the individual performance of these Library and Information Science (LIS researchers in terms of their research output and its impact on the LIS (national/international literature by using various bibliometric indicators. A list of 139 authors was compiled with the help of the Library, Information Science, and Technology Abstracts (LISTA and some other sources. Data were collected from Google Scholar and SPSS version 20 was utilized in order to identify the relationship between self-citations and various performance indices of the authors. The average citations received per paper vary from 1.80 to 10.08. About half of the papers were single-authored whereas less than one-fifth were by three or more authors. The authors who worked in collaboration produced more papers and received more citations. The h-index, g-index, hI-index, hI-norm, and e-index were used to determine the rank for each author. The intra-group citations grid revealed the volume of self-citations and a small group who cite each other more due to close academic and social relationships. The correlations between self-citations and the impact indices used revealed significant differences. Findings are useful for concerned institutions regarding award, promotions, etc. Further, future research should seriously consider the self-citations and social networking of authors while examining their citations-based research performance.

TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

Science.gov (United States)

Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

2015-01-01

A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

Directory of Open Access Journals (Sweden)

Saleha S

2016-06-01

Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

Science.gov (United States)

Ajmal, M; Zafar, S; Hameed, A

2016-01-01

ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

International Nuclear Information System (INIS)

Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

2014-01-01

Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

Urdu translation and validation of shorter version of Positive Affect and Negative Affect Schedule (PANAS) on Pakistani bank employees.

Science.gov (United States)

Akhter, Noreen

2017-10-01

To translate, adapt and validate shorter version of positive affect and negative affect scale on Pakistani corporate employees. This cross-sectional study was conducted in the twin cities of Islamabad and Rawalpindi from October 2014 to December 2015. The study was completed into two independent parts. In part one, the scale was translated by forward translation. Then it was pilot-tested and administered on customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of positive affect and negative affect scale. Part two comprised the main study. Commercial bank employees were included in the sample using convenient sampling technique. Data of the main study was analysed using confirmatory factor analysis in order to establish construct validity of positive affect and negative affect scale. There were145 participants in the first part of the study and 495 in the second. Results of confirmatory factor analysis confirmed the two-factor structure of positive affect and negative affect scale suggesting that the scale has two distinct domains, i.e. positive affect and negative affect. The shorter version of positive affect and negative affect scale was found to be a valid and reliable measure.

"What is this genetics, anyway?" Understandings of genetics, illness causality and inheritance among British Pakistani users of genetic services.

Science.gov (United States)

Shaw, Alison; Hurst, Jane A

2008-08-01

Misconceptions about basic genetic concepts and inheritance patterns may be widespread in the general population. This paper investigates understandings of genetics, illness causality and inheritance among British Pakistanis referred to a UK genetics clinic. During participant observation of genetics clinic consultations and semi-structured interviews in Urdu or English in respondents' homes, we identified an array of environmental, behavioral and spiritual understandings of the causes of medical and intellectual problems. Misconceptions about the location of genetic information in the body and of genetic mechanisms of inheritance were common, reflected the range of everyday theories observed for White British patients and included the belief that a child receives more genetic material from the father than the mother. Despite some participants' conversational use of genetic terminology, some patients had assimilated genetic information in ways that conflict with genetic theory with potentially serious clinical consequences. Additionally, skepticism of genetic theories of illness reflected a rejection of a dominant discourse of genetic risk that stigmatizes cousin marriages. Patients referred to genetics clinics may not easily surrender their lay or personal theories about the causes of their own or their child's condition and their understandings of genetic risk. Genetic counselors may need to identify, work with and at times challenge patients' understandings of illness causality and inheritance.

A case - control study of risk factors for coronary artery disease in Pakistani females

International Nuclear Information System (INIS)

Nazeer, M.; Naveed, T.; Ullah, A.

2010-01-01

Objectives: To establish the strength of association of conventional risk factors for coronary artery disease in native Pakistani females. Methods: We conducted a case - control hospital based study on 198 females (age 30 - 80 years) scheduled for their first coronary angiography at Punjab Institute of Cardiology, Lahore. Patients were divided into pre-menopausal group (age: 45.1 +- 6.3) and post-menopausal group (62.1 +- 9.1). For each risk factor, patients with significant CAD (= 50% luminal diameter stenosis) were regarded as cases an those without significant CAD were taken as controls. Odds Ratios (OR) and their 95% confidence intervals (CI) were calculated by univariate analysis. Results: In total study cohort, Diabetes mellitus (OR 3.65 95% CI 2.0 - 6.5), Family history of premature coronary artery disease (OR 2.3, 95% CI 1.2 - 4.4), and increased waist circumference (OR 2.11, 95% CI 1.2 - 3.8) were strongly associated with significant CAD. In post menopausal age group, diabetes mellitus (OR 2.66 CI 1.3 - 5.1), hyperlipidaemia (OR 2.25 CI 1.2 - 2.3) and increased waist circumference (OR 2.16 CI 1.1 - 4.2) reached statistical significance. In pre-menopausal females only diabetes was strongly associated with significant coronary artery disease (OR 10 CI 2.6 - 37.4). Association of hypertension was not significant in any of subgroups studied. Very few cases of smoking (6 / 198) were found in our study to merit any further statistical analysis. Conclusions: Diabetes mellitus was the only risk factor in pre-menopausal females associated with coronary artery disease While diabetes, hyperlipidaemia and increased waist circumference were significantly associated with CAD in post menopausal females. (author)

Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

Directory of Open Access Journals (Sweden)

Malik Samina

2010-01-01

Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

Science.gov (United States)

Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

2016-03-01

Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

Influences of religion and culture on continuing bonds in a sample of British Muslims of Pakistani origin.

Science.gov (United States)

Hussein, Hanan; Oyebode, Jan R

2009-11-01

This study considered the nature of continuing bonds with deceased relatives in a sample of Pakistani Muslims living in the United Kingdom. Ten participants were interviewed following a cultural psychology approach and transcripts were analyzed using grounded theory methodology. Dreaming, talking with others about the deceased, following the deceased's example, keeping memories and mementos, and doing actions thought to help the deceased were forms of continued relationship found. These were intertwined with the process of grieving and were influenced by the family, culture, and religion. Religion was a strong influence on the prominence given by participants to finishing well and on the notion of doing actions thought to help the deceased. Cultural mores, such as the community, and collectivist ethos and the expectation that emotion would be expressed around the time of death, were found to be supportive for some but sources of tension for other participants. Expressing a continuing bond through following the deceased's example so as to make them proud or happy seemed to be reinforced by cultural roots in respect for elders. Participants gave instances of tensions in areas such as expression of emotion and communality versus individualism that arose as a result of their position between two cultural frameworks, some illustrating how assimilation into the host culture set up conflict with the expected norms of their family/ancestral culture. The study highlights how understanding different cultural and religious influences may enrich the concept of continuing bonds.

Pharmacokinetic study of atorvastain after single dose administration among pakistani population

International Nuclear Information System (INIS)

Maqsood, I.; Najmi, M. H.; Mazhar, W.; Janjua, A.; Tayyaba, B.; Sabah, S.; Bader, Z.

2017-01-01

Objective: To obtain pharmacokinetic data of Orvastin, a newly launched formulation of atorvastatin, in healthy males of Pakistan. Study Design: It was quasi-experimental design. Place and Duration of Study: Study was conducted at Centre for Research in Experimental and Applied Medicine (CREAM) Army Medical College, Rawalpindi and duration of study was about ten months. Material and Methods: Twenty-four healthy male subjects were taken conveniently from Pakistani population. Two tablets of Orvastin, each containing atorvastatin 40mg, were administered orally as a single dose. Multiple blood samples were taken with small gaps in between up to the period of 48hrs. High Performance Liquid Chromatography (HPLC) with UV-detector was used for quantification of atorvastatin in plasma; wavelength of UV-detector was adjusted at 247nm. Mobile phase was made up of 60 percent acetonitrile and 40 percent 0.05M sodium phosphate buffer. Flow rate of mobile phase was maintained at 1.5ml/min with 5.5 pH. Progesterone was used as an internal standard. Stock solutions of atorvastatin were made by dissolving it into methanol and acetonitrile was used for making stock solution of progesterone. Calibration curves were made for atorvastatin and internal standard from oncentration time data, values for time to achieve maximum plasma concentration. (Tmax) and maximum plasma concentration (Cmax) were directly calculated. Computer program (APO, MW PHARM, and Ver. 3.60) was used for calculation of pharmacokinetic profile of atorvastatin. Results: Atorvastatin was detected in plasma samples of all volunteers. The absorption rate constant (Ka) was 0.41 l/hr. Cmax was 26.69 ± 6.67 µg/l and Tmax was 3.33 ± 0.41 hrs. Apparent volume of distribution (Vd), of atorvastatin, was 3244.84 ± 1237.36 liters. The elimination rate constant was 0.15 l/hr. Elimination half-life of atorvastatin was 6.14 hours. Trapezoidal rule was used for calculation of AUC /sub 0-48/ and AUC /sub 0-∞/ and it was found

Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families.

Directory of Open Access Journals (Sweden)

Sobia Shafique

Full Text Available The frequency of inherited bilateral autosomal recessive non-syndromic hearing loss (ARNSHL in Pakistan is 1.6/1000 individuals. More than 50% of the families carry mutations in GJB2 while mutations in MYO15A account for about 5% of recessive deafness. In the present study a cohort of 30 ARNSHL families was initially screened for mutations in GJB2 and MYO15A. Homozygosity mapping was performed by employing whole genome single nucleotide polymorphism (SNP genotyping in the families that did not carry mutations in GJB2 or MYO15A. Mutation analysis was performed for the known ARNSHL genes present in the homozygous regions to determine the causative mutations. This allowed the identification of a causative mutation in all the 30 families including 9 novel mutations, which were identified in 9 different families (GJB2 (c.598G>A, p.Gly200Arg; MYO15A (c.9948G>A, p.Gln3316Gln; c.3866+1G>A; c.8767C>T, p.Arg2923* and c.8222T>C, p.Phe2741Ser, TMC1 (c.362+18A>G, BSND (c.97G>C, p.Val33Leu, TMPRSS3 (c.726C>G, p.Cys242Trp and MSRB3 (c.20T>G, p.Leu7Arg. Furthermore, 12 recurrent mutations were detected in 21 other families. The 21 identified mutations included 10 (48% missense changes, 4 (19% nonsense mutations, 3 (14% intronic mutations, 2 (9% splice site mutations and 2 (9% frameshift mutations. GJB2 accounted for 53% of the families, while mutations in MYO15A were the second most frequent (13% cause of ARNSHL in these 30 families. The identification of novel as well as recurrent mutations in the present study increases the spectrum of mutations in known deafness genes which could lead to the identification of novel founder mutations and population specific mutated deafness genes causative of ARNSHL. These results provide detailed genetic information that has potential diagnostic implication in the establishment of cost-efficient allele-specific analysis of frequently occurring variants in combination with other reported mutations in Pakistani populations.

Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

Directory of Open Access Journals (Sweden)

Muhammad Tahir Khalily

2011-10-01

Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector. Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy. Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

Directory of Open Access Journals (Sweden)

Muhammad Tahir Khalily

2011-10-01

Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector.Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy.Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

The Effect of Perceiving a Calling on Pakistani Nurses' Organizational Commitment, Organizational Citizenship Behavior, and Job Stress.

Science.gov (United States)

Afsar, Bilal; Shahjehan, Asad; Cheema, Sadia; Javed, Farheen

2018-03-01

People differ considerably in the way in which they express and experience their nursing careers. The positive effects associated with having a calling may differ substantially based on individuals' abilities to live out their callings. In a working world where many individuals have little to no choice in their type of employment and thus are unable to live out a calling even if they have one, the current study examined how perceiving a calling and living a calling interacted to predict organizational commitment, organizational citizenship behavior, and job stress with career commitment mediating the effect of the interactions on the three outcome variables. The purpose of the study is to investigate the mediating effect of career commitment between the relationships of calling and (a) nurses' attitudes (organizational commitment), (b) behaviors (organizational citizenship behavior), and (c) subjective experiences regarding work (job stress). Using a descriptive exploratory design, data were collected from 332 registered nurses working in Pakistani hospitals. Descriptive analysis and hierarchical regression analysis were used for data analysis. Living a calling moderated the effect of calling on career commitment, organizational citizenship behavior, and job stress, and career commitment fully mediated the effect of calling on organizational commitment, organizational citizenship behavior, and job stress. Increasing the understanding of calling, living a calling, and career commitment may increase nurses' organizational commitment and organizational citizenship behavior and decrease job stress. The study provided evidence to help nursing managers and health policy makers integrate knowledge and skills related to calling into career interventions and help nurses discover their calling.

Pakistan tõestas taas nõrkust terroristide ohjeldamisel / Oliver Tiks

Index Scriptorium Estoniae

Tiks, Oliver

2009-01-01

Pakistanis toimus sisside verine terrorirünnak politseiakadeemia vastu, mis analüütikute hinnagul oli sõnumiks USA presidendile Barack Obamale, kes on seadnud Pakistani kesksele kohale võitluseks AL-Qaeda terroristidega. Kaart: Pakistani rünnak

IMPACT OF SERVICE QUALITY ON CUSTOMER SATISFACTION: EVIDENCES FROM THE RESTAURANT INDUSTRY IN PAKISTAN

Directory of Open Access Journals (Sweden)

Ubedullah Amjad Ali SHAIKH

2011-01-01

Full Text Available The purpose of this study is to contribute to the literature of service qualityimportance in restaurant industry. The study has been based upon theServqual technique and Dineserv tool of improving the quality by the serviceproviding organizations. The study is undertaken from the perspective ofPakistani Restaurant Industry and the customers' perceptions vis-à-visrestaurant dining. Two variables of Servqual, i.e. Tangibles andResponsiveness, have been examined to demonstrate the significance ofservice quality on customer satisfaction. The results endorse the importanceof enhanced complementary service standards in restaurant industry. Finally,the findings provide an insight for the Pakistani restaurant service providingestablishments and suggestion have been made for the caretakers of theindustry on ways to improve service quality.

'They say Islam has a solution for everything, so why are there no guidelines for this?' Ethical dilemmas associated with the births and deaths of infants with fatal abnormalities from a small sample of Pakistani Muslim couples in Britain.

Science.gov (United States)

Shaw, Alison

2012-11-01

This paper presents ethical dilemmas concerning the termination of pregnancy, the management of childbirth, and the withdrawal of life-support from infants in special care, for a small sample of British Pakistani Muslim parents of babies diagnosed with fatal abnormalities. Case studies illustrating these dilemmas are taken from a qualitative study of 66 families of Pakistani origin referred to a genetics clinic in Southern England. The paper shows how parents negotiated between the authoritative knowledge of their doctors, religious experts, and senior family members in response to the ethical dilemmas they faced. There was little knowledge or open discussion of the view that Islam permits the termination of pregnancy for serious or fatal abnormality within 120 days and there was considerable disquiet over the idea of ending a pregnancy. For some parents, whether their newborn baby would draw breath was a main worry, with implications for the baby's Muslim identity and for the recognition of loss the parents would receive from family and community. This concern sometimes conflicted with doctors' concerns to minimize risk to future pregnancies by not performing a Caesarean delivery if a baby is sure to die. The paper also identifies parents' concerns and feelings of wrong-doing regarding the withdrawal of artificial life-support from infants with multiple abnormalities. The conclusion considers some of the implications of these observations for the counselling and support of Muslim parents following the pre- or neo-natal diagnosis of fatal abnormalities in their children. © 2011 Blackwell Publishing Ltd.

Representation of Oriental Travelees and Locus in Jurgen Wasim Frembgen’s Travelogue: The Closed Valley: With Fierce Friends in Pakistani Himalays

Directory of Open Access Journals (Sweden)

Ahmad Gholi

2016-11-01

Full Text Available The oft despised and ignored genre of travel writing was recognized as worthy of scholarly investigation in 1970s thanks to Edward Said’s Orientalism, the wave of deconstructionism, and postcolonialism (Calzati, 2015. For these scholars, travel writers do not present a transparent window to an alien space and its residents even though they normally claim it. For them the representation of the traveled terrain and travelees is an ideological construction which is tainted with the travel writer’s ‘habitus’ and ‘field’ and crafted through fictional devices. In this regard, by drawing on postcolonial methodology, the current study seeks to evince how Frembgen in his travelogue, The Closed Valley: With Fierce Friends in Pakistani Himalayas which narrates his voyage to Harban, a far-flung mountainous region in Pakistan Himalaya, reproduces the pitfalls of previous Western travel writers when he depicts his destination and travelees in negative terms. From his perspective, his timeless traveled locus is rife with violence, yet a space to escape from dehumanizing ambience of the West. Additionally, for him the women in this tribal region are tyrannized by husbands and victimized by Muslim extremists. Last but not least, he portrays this remote oriental space as an object of curiosity which needs to be salvaged textually.

Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

Energy Technology Data Exchange (ETDEWEB)

Bhatti, S M; Dhakam, S; Khan, M.A., E-mail: drsehran@yahoo.co

2009-10-15

Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P< 0.0001). Regarding triglyceride concentrations, 16% had high-risk triglyceride levels, 34% were in the borderline-risk category, whereas 50% had a low-risk triglyceride levels (P< 0.0001). Patient proportion with None, One, Two, or Three Values outside clinical targets on percentage basis were 2, 16, 48, and 34%, respectively (P< 0.0001). Women were found to have greater odds of having LDL cholesterol above the target level i.e. >100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

Experience in the manufacture and performance of CANDU fuel for KANUPP

International Nuclear Information System (INIS)

Salim, M.; Ahmed, I.; Butt, P.

1995-01-01

Karachi Nuclear Power Plant (KANUPP) a 137 MWe CANDU unit is In operation since 1971. Initially, it was fueled with Canadian fuel bundles. In July 1980 Pakistani manufactured fuel was introduced in the reactor core, irradiated to a burnup of about 7500 MWd-teU -1 and successfully discharged in May 1984. The core was progressively fuelled with Pakistani fuel and in August 1990 the reactor core contained all Pakistani made fuel. As of the present, 3 core equivalent Pakistani fuel bundles have been successfully discharged at an average bumup of 6500 MWd-teU -1 . with a maximum burnup of ∼ 10,200 MWd-teU -1 . No fuel failure of Pakistani bundles has been observed so far. This paper presents the indigenous efforts towards manufacture and operational aspects of KANUPP fuel and compares its behaviour with that of Canadian supplied fuel. The Pakistani fuel has performed well and is as good as the Canadian fuel. (author)

Seeds of Destruction, Seeds of Success: The Survival or Failure of Violent Extremist Organizations

Science.gov (United States)

2010-06-01

Square in New York City was a “jaw-breaking blow to Satan USA.” Quoted in Bill Roggio, “Pakistani Taliban claim credit for failed NYC Times Square...interpretation of the Bible as fundamental to Christian life and teaching. Although technically correct, it fails to encompass the global usage of the...report on case study evaluations, found at http://www.gao.gov/special.pubs/pe1019. pdf , provides an in-depth discussion of the case study types listed

Novel VPS13B Mutations in Three Large Pakistani Cohen Syndrome Families Suggests a Baloch Variant with Autistic-Like Features.

Science.gov (United States)

Rafiq, Muhammad Arshad; Leblond, Claire S; Saqib, Muhammad Arif Nadeem; Vincent, Akshita K; Ambalavanan, Amirthagowri; Khan, Falak Sher; Ayaz, Muhammad; Shaheen, Naseema; Spiegelman, Dan; Ali, Ghazanfar; Amin-ud-Din, Muhammad; Laurent, Sandra; Mahmood, Huda; Christian, Mehtab; Ali, Nadir; Fennell, Alanna; Nanjiani, Zohair; Egger, Gerald; Caron, Chantal; Waqas, Ahmed; Ayub, Muhammad; Rasheed, Saima; Forgeot d'Arc, Baudouin; Johnson, Amelie; So, Joyce; Brohi, Muhammad Qasim; Mottron, Laurent; Ansar, Muhammad; Vincent, John B; Xiong, Lan

2015-06-25

Cohen Syndrome (COH1) is a rare autosomal recessive disorder, principally identified by ocular, neural and muscular deficits. We identified three large consanguineous Pakistani families with intellectual disability and in some cases with autistic traits. Clinical assessments were performed in order to allow comparison of clinical features with other VPS13B mutations. Homozygosity mapping followed by whole exome sequencing and Sanger sequencing strategies were used to identify disease-related mutations. We identified two novel homozygous deletion mutations in VPS13B, firstly a 1 bp deletion, NM_017890.4:c.6879delT; p.Phe2293Leufs*24, and secondly a deletion of exons 37-40, which co-segregate with affected status. In addition to COH1-related traits, autistic features were reported in a number of family members, contrasting with the "friendly" demeanour often associated with COH1. The c.6879delT mutation is present in two families from different regions of the country, but both from the Baloch sub-ethnic group, and with a shared haplotype, indicating a founder effect among the Baloch population. We suspect that the c.6879delT mutation may be a common cause of COH1 and similar phenotypes among the Baloch population. Additionally, most of the individuals with the c.6879delT mutation in these two families also present with autistic like traits, and suggests that this variant may lead to a distinct autistic-like COH1 subgroup.

Comparative efficiency of high (trip super phosphate) and low (rock phosphate) grade p nutrition source enriched with organic amendment in maize crop

International Nuclear Information System (INIS)

Sabah, N.U.; Sarwar, G.; Tahir, M.A.

2016-01-01

Pakistan falls under arid to semi-arid climate and therefore, Pakistani soils are sufferer of phosphorus deficiency. Costly phosphatic commercial fertilizers and their unavailability at the time of crop demand is the burning issue in Pakistan. Under such circumstances, use of locally available rock phosphate (RP) grasps the interest of researchers now a day. Pakistan has blessed with considerable quantity of cheaper low grade RP in Abbottabad and Hazara districts of KPK province. Due to this scenario, a pot experiment was carried out to evaluate growth efficiency of maize crop by adding organic manure fortified with RP in comparison with TSP in normal soil (pHs= 8.15, ECe= 1.28 dSm-1, SAR = 4.77 mmol L-1, saturation percentage = 29% and sandy clay loam texture). The study was comprised of 7 treatments replicated three times including: T1 = Control (0 P); T2 = Recommended NK + organic material; T3 = Recommended NK + RRP; T4 = Recommended NK + RRP + OM; T5 = Recommended NK + TSP; T6 = Recommended NK + TSP + OM and T7 = N + K + TSP + 0.5 Organic manure. It was concluded that integrated use of organic amendment with RP (Local Hazara Red Rock Phosphate) and TSP proved superior as compared to their sole use on maize crop growth. A significant increase in available P concentration of the growth medium was observed due to addition of organic material along with TSP as a source of P. Addition of organic material also enhanced the soil carbon level as compared to control. It can be concluded that rock phosphate (RP) could be an effective and economic substitution for TSP when it is integrated with suitable organic amendment with specific size. (author)

Genetic analysis of basmati and non-basmati Pakistani rice (oryza sativa l.) cultivars using microsatellite markers

International Nuclear Information System (INIS)

Rabbani, M.A.; Masood, M.A.; Shinwari, Z.K.

2010-01-01

Information of genetic variability and relatedness among rice genotypes is essential for future breeding programmes and derivation of superior cultivars. The objective of the present study was to evaluate the genetic relationship among traditional and improved cultivars of Pakistani rice and to determine differences in the patterns of variation between two indica rice groups: basmati and nonbasmati. Forty-one cultivars were evaluated by means of 30 microsatellite markers distributed over the whole rice genome. A total of 104 alleles were detected by 30 markers, all of them (100%) were polymorphic. The number of alleles generated by each marker ranged from 2 to 6 with an average of 3.5 alleles marker-1. Polymorphism information content (PIC) varied from 0.259 to 0.782 with an average of 0.571. A significant positive correlation (r = 0.71) was found between the number of alleles at SSR locus and the PIC values. Pair-wise Nei and Li's similarity coefficients ranged from 0.10 to 0.99. A dendrogram based on cluster analysis by microsatellite polymorphism grouped 41 rice cultivars into 2 major groups effectively differentiating the late maturing, tall and slender-grain basmati and other aromatic rice cultivars from the early, short statured, short bold and long bold grain non-aromatic cultivars. Higher level of genetic diversity between basmati and non-basmati support the concept that former had a long history of independent evolution and diverged from nonbasmati rice a long time ago through human selection and patronage. Present investigation further indicated that genetically basmati rice is different from that of coarse indica and japonica type. The results suggested that microsatellite markers could efficiently be utilized for diversity analysis, and differentiation of basmati and non-basmati rice cultivars. In addition, marker-based identification of traditional basmati rice may help in maintaining the integrity of this high quality product to the benefit of both

Zinc deficiency in pakistani children with decompensated chronic liver disease; a cross-sectional survey at a hospital in lahore, pakistan

International Nuclear Information System (INIS)

Shoaib, M.; Ayaz, S.B.; Ashraf, M.N.

2015-01-01

This study aimed to objectively assess mean serum zinc levels and influence of age, gender and primary etiology of chronic liver disease (CLD) on these levels in a sample of Pakistani pediatric patients with decompensated CLD (DCLD). Methodology: It was a cross-sectional survey carried out at Combined Military Hospital, Lahore, from August 2013 to February 2014. Through non-probability consecutive sampling we included 100 cases belonging to both genders, fitting in the age-range of 1 - 12 years and having DCLD based on Child-Pugh classification score = 6. Patients with diarrhea, respiratory or urinary tract infection, liver tumors or receiving treatments with immune suppressants, antifungals, antivirals and zinc supplementation were excluded. Results After exclusion, off 74 cases, 58.1% were male. Majority belonged to the age group of 6 - 12 years (54.1%). Idiopathic DCLD was the most prevalent primary etiology (40.5%). Mean serum zinc levels (44.5 ± 4.7 mu g/dL) were significantly lower (p< 0.001) than the minimum normal serum zinc levels (65 micro g/dL). The mean serum zinc levels were lower significantly in children with idiopathic CLD as the primary etiology (p=0.012) and insignificantly in females and children belonging to the age group of 1- < 6 years (p= 0.08 and p= 0.59 respectively) Conclusion Mean serum zinc levels in our sample of pediatric patients with DCLD were significantly lower than the reference values for normal children, were lowest in children suffering from idiopathic CLD and were not dependent on gender and age. (author)

Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

Directory of Open Access Journals (Sweden)

Ilyas Mahwish

2007-09-01

Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

Child labour: a public health issue.

Science.gov (United States)

Gulzar, Saleema Aziz; Vertejee, Samina; Pirani, Laila

2009-11-01

Child labour is a global practice and has many negative outcomes. According to International Labour Organization, child labour is the important source of child exploitation and child abuse in the world today. The Human Rights Commission of Pakistan has estimated the number of Pakistani working children to be around 11-12 millions, out of which, at least, half the children are under the age of ten years. It portrays the society's attitude towards child care. It is therefore, essential to break this vicious cycle and hence, enable the society to produce healthy citizens. This article analyzes the determinants of child labour in the Pakistani context and its implications for child's life, in specific, and for the nation, in general, utilizing the model developed by Clemen-stone & McGuire (1991). Since this practice has complex web of causation, a multidisciplinary approach is required to combat this issue through proposed recommendations.

The Race Against Nuclear Terror

Science.gov (United States)

2005-09-01

franchised version of the nuclear “Wal-Mart” cannot be discounted. Yet, if we are 49 Christopher Clary. “Dr...much emphasis on the Pakistani scientist, other potential “ franchised ” proliferators may be operating and continuing where A.Q. Khan left off...behavior. In brief, Aum Shinrikyo’s decision to attack civilians on a Japanese subway reflects an organization in a desperate fight for survival

Effect of a regimen of optimal medical therapy on brain natriuretic peptide (BNP) levels in heart failure in the Pakistani population

International Nuclear Information System (INIS)

Hussain, S.; Kayani, M.; Munir, R

2012-01-01

Objective: To document the effect of optimal medical therapy (OMT) on BNP levels in heart failure in Pakistani population. Methodology: In this Quasi experimental study, 75 consecutive stage C heart failure patients that had not been on OMT were included. These patients had been referred to AFIC-NIHD Heart Transplantation Department for assessment regarding heart transplantation. Initial assessments were carried out in hospital. Patients who were on OMT already were excluded. The prescription (carvedilol, lisinopril, spironolactone) was introduced as in patient as per pre defined protocol after clinical, imaging and lab evaluation. The patients were followed up in clinic and the dose escalation was done at regular intervals in out patients department. Clinical and lab variables were collected included BNP levels before starting treatment and 4 weeks after treatment. Results : Males were 75% and females were 25%. Mean age was 38.69 +- 12.98 years (range 18-70 years). Mean Ejection fraction was 23.9% (range 15 - 34%). At one month clinical status of all patients improved except one. The patients had improved from NYHA class-III to NYHA class-II of dyspnoea. The mean baseline BNP level was 1331 pg/ mL, and the BNP level 4 weeks after the OMT trial was 951.9 pg/mL. This reduction was statistically significant (p=0.016). Conclusion: OMT improves the BNP levels within a span of one month in patients with advanced systolic heart failure. This also correlated with the clinical improvement in the patients, and it was observed that BNP levels helped to monitor patients objectively and adjust OMT. (author)

In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

Science.gov (United States)

Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

2013-09-24

Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

Clinical safety and parameters of maximum oxygen uptake (Vo/sub 2/ max) testing in pakistani patients with heart failure

International Nuclear Information System (INIS)

Hussain, S.; Kayani, A.M.

2015-01-01

To determine the parameters of maximum oxygen uptake (VO2 max) in a Pakistani systolic heart failure cohort and its safety in a clinical setting. Study Design: Descriptive study. Place and Duration of Study: Armed Forces Institute of Cardiology, National Institute of Heart Diseases, Rawalpindi, from June 2011 to January 2013. Methodology: Maximum oxygen uptake test was performed in patients with severe heart failure, who could perform the VO2 max treadmill test. Age, Body Mass Index (BMI) ejection fraction, VO2 max and respiratory exchange ratios and their correlations were determined. Results: Out of 135 patients, 77% (n=104) were males, with a mean age of 45.9 ± 15.7 years. Weight of patients ranged from 30 kg to 107 kg (mean 63.29 ± 13.6 kg); mean BMI was 23.16 ± 4.56 kg/m2. All patients presented with either NYHA class of III (50.3%; n=68) or IV (49.7%; n=67); mean ejection fraction was 22.54 ± 5.7% (10 - 35%, IQ:20 - 25). The VO2 max of the patients ranged from 3 to 32 ml/kg/minute (mean 12.85 ± 4.49 ml/kg/minute). Respiratory exchange ratio was over 1 for all patients (1.12 - 1.96, mean = 1.36 ± 0.187). There was a negative correlation with age (r = -0.204; p = 0.028) whereas a positive correlation was found with exercise time (r = 0.684; p = 0.000), hemoglobin (r = 0.190; p = 0.047) and ejection fraction (r = 0.187 ; p = 0.044). Conclusion: Cardiopulmonary exercise testing in a high-risk heart failure cohort is safe and provides information beyond the routine clinical evaluation of heart failure patients. (author)

Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

Directory of Open Access Journals (Sweden)

Mubashir Zafar

2013-01-01

Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

Cultural influences on children's understanding of the human body and the concept of life.

Science.gov (United States)

Panagiotaki, Georgia; Nobes, Gavin

2014-09-01

This study aimed to identify the age by which children begin to demonstrate a biological understanding of the human body and the idea that the purpose of body functioning is to maintain life. The study also explored the influence of education, culturally specific experiences and religion on knowledge acquisition in this domain. Children aged between 4 and 7 years from three different cultural backgrounds (White British, British Muslim, and Pakistani Muslim) were interviewed about the human body and its functioning. At least half of the 4- to 5-year-olds in each cultural group, and almost all 6- to 7-year-olds, referred to the maintenance of life when explaining organs' functions and so were classified as 'life theorizers'. Pakistani Muslim children gave fewer biological responses to questions about organs' functions and the purpose of eating and breathing, but referred to life more than their British counterparts. Irrespective of cultural group, older children understood organ location and function better than younger children. These findings support Jaakkola and Slaughter's (2002, Br. J. Dev. Psychol., 20, 325) view that children's understanding of the body as a 'life machine' emerges around the ages of 4-5 years. They also suggest that, despite many similarities in children's ideas cross-culturally, different educational input and culturally specific experiences influence aspects of their biological understanding. © 2014 The British Psychological Society.

Lagunenud valitsusega Pakistan vaevleb kriisis / Sandra Maasalu

Index Scriptorium Estoniae

Maasalu, Sandra

2008-01-01

Ilmunud ka: Postimees : na russkom jazõke 27. aug. 2008, lk. 7. Pakistani valitsuse lagunemisest, kui endine peaminister Navaz Sharif oma parteiga koalitsioonist lahkus. Vt. samas: Pakistani ahistavad separatistid ja majanduse allakäik. Kaart: Pakistan

Exploring Asian Indian and Pakistani views about cancer and participation in cancer genetics research: toward the development of a community genetics intervention.

Science.gov (United States)

Leader, Amy E; Mohanty, Salini; Selvan, Preethi; Lum, Ray; Giri, Veda N

2018-01-01

Cancer is a leading cause of mortality among the three million Asian Indian/Pakistanis (AIPs) in the USA. AIPs have traditionally been underrepresented in cancer-related research, although reasons remain largely unexplored. We sought to understand AIP's awareness and perceptions of cancer to improve their participation in risk assessment and cancer genetics research. Four focus groups, stratified by gender and birthplace (US-born vs. foreign-born), were held at an AIP cultural center. Discussions focused on knowledge and awareness of cancer risk; how AIP culture influences cancer perceptions; access to health care services for cancer screening, diagnosis, or treatment; and willingness to or experiences with participating in cancer genetics research. Sessions were audio-recorded, transcribed verbatim, and content analyzed using NVivo ® 11 for dominant themes. Thirty-two AIP adults participated in a focus group. Information on family cancer history is challenging to obtain due to the desire for privacy, cancer stigma, and loss of medical records. Interest in genetic testing for cancer risk was mixed: some were in favor of knowing their personal risk, yet many noted that future generations in their family would benefit more by knowing their risk. Participants felt that the AIP community has largely been overlooked in recruitment efforts for research studies. Recommendations for improving recruitment efforts included partnering with community events and festivities, posting culturally and linguistically relevant recruitment materials, and focusing on population-wide health improvement. Understanding the culture and perceptions of AIPs, separate from Asian Americans at large, will allow for more tailored approaches for including this population in cancer genetics research.

A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

Science.gov (United States)

Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

2017-04-12

Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

A systematic review of treatment response rates in Pakistani hepatitis C virus patients; current prospects and future challenges

Science.gov (United States)

Ali, Muhammad; Afzal, Samia; Zia, Asad; Hassan, Ahmed; Khalil, Ali Talha; Ovais, Muhammad; Shinwari, Zabta Khan; Idrees, Muhammad

2016-01-01

Abstract Background: The estimated hepatitis C virus (HCV) carriers are approximately 10 million in Pakistan which usually progresses to chronic hepatitis, with rare cases of spontaneous viral eradication. The present article reviews the treatment status of HCV infection in Pakistani population and various factors associated with the treatment response rates. Methods: Literature on anti-HCV therapy was searched in PubMed, Google Scholar and PakMediNet. Thirty three different studies representing different geographic regions of Pakistan published from 2002 to 2016 were included in the present review. Weighted mean, standard error estimates (SE) and standard deviation (SD) were determined for each population group. Results: Mean value for sustained virological response (SVR) for standard IFN plus ribavirin (RBV) combination therapy was 68.38% ± 14.13% (range 33.8%–87.10%; SE 3.08) and pegylated-IFN plus RBV combination therapy 64.38% ± 8.68% (range 55.0%–76.00%; SE 3.88). The lowest value for SVR has been reported to be 24.3% (for genotype 1; administering INF-α 2b 3MU 3 times/week and RBV 1000–1200 mg/day for 48 weeks) while highest of 87.5% (genotype 3a; INF-α 2a 3MU 3 times/week and RBV 1000–1200 mg/day for 24 weeks). The mean value for rapid virological response (RVR) was found to be 48.18% ± 29.20% (SE 9.73). As PEG-interferon and direct acting antivirals (DAAs) are relatively expensive, interferon-alfa (IFN-α) and RBV combination therapy have been used widely to treat HCV infected patients in Pakistan for the last one and half decade. On average, 2.45% of the patients discontinued treatment due to severe side effects. Conclusion: We encourage further studies on understanding host and viral factors associated with specific focus on harder to treat viral variants (relapsers and nonresponders). These variants are currently rising in the country. PMID:27977575

Conflict management of mothers and daughters belonging to individualistic and collectivistic cultural backgrounds: a comparative study.

Science.gov (United States)

Gilani, N P

1999-12-01

Research on the mother-daughter relationship during adolescence is mostly conducted in Western and European cultures where individualism is stressed. To examine ethnic/cultural differences and similarities in this relationship, 80 dyads of British (white) and Pakistani mothers and their adolescent daughters were studied. On the basis of the theories of cultural variability dimension and conflict face negotiation, it was hypothesized that mothers and daughters from the two cultures would use different styles of handling disagreements/conflicts. That is, Pakistani mothers and daughters would use an avoiding style, whereas British mothers and daughters would use either a dominating or compromising style, to a greater degree. It was also argued that Pakistani daughters and mothers will express more intimacy and relational harmony, will exhibit greater connectedness and mutuality and demonstrate lesser individuality and self-assertion compared to their British counterparts. However, it appeared that both the groups used an avoiding style equally, although the British group used a dominating style more than Pakistani group. As hypothesized, Pakistani mothers and daughters expressed more intimacy, relational harmony, connectedness and mutuality and lesser individuality than British mothers and daughters. Copyright 1999 The Association for Professionals in Services for Adolescents.

India ja Pakistan seisavad uute alguste lävepakul / Liisi Poll

Index Scriptorium Estoniae

Poll, Liisi, 1980-

2007-01-01

Indias ja Pakistanis tähistati iseseisvuse 60. aastapäeva. Demokraatliku arengutee valinud India ja islamistliku Pakistani suhted on pingelised, sõdade ja piirikonfliktide põhjuseks on olnud Kashmiri alad. Kaart: India ja Pakistan. Lisa: India ja Pakistan

CLRN1 mutations cause nonsyndromic retinitis pigmentosa

NARCIS (Netherlands)

Khan, M.I.; Kersten, F.F.J.; Azam, M.; Collin, R.W.J.; Hussain, A.; Shah, S.T.; Keunen, J.E.E.; Kremer, J.M.J.; Cremers, F.P.M.; Qamar, R.; Hollander, A.I. den

2011-01-01

OBJECTIVE: To describe the mutations in the CLRN1 gene in patients from 2 consanguineous Pakistani families diagnosed with autosomal recessive retinitis pigmentosa (arRP). DESIGN: Case-series study. PARTICIPANTS: Affected and unaffected individuals of 2 consanguineous Pakistani families and 90

Pakistan vajab abi - kas maailma tõesti ei huvita? / Urmas Jaagant

Index Scriptorium Estoniae

Suurkask, Heiki, 1972-

2010-01-01

Pakistan saab igal aastal suurt rahvusvahelist abi. Mitmed riigid on üleujutustes Pakistani toetanud nüüdki kümnete miljonite dollaritega, kuid riikide tahe annetada on erinev, sest mitte iga abidollarit ei suunata Pakistanis sinna, kus seda tegelikult vajatakse

Experimental investigations on a diesel engine operated with fuel blends derived from a mixture of Pakistani waste tyre oil and waste soybean oil biodiesel.

Science.gov (United States)

Qasim, Muhammad; Ansari, Tariq Mahmood; Hussain, Mazhar

2017-10-18

The waste tyre and waste cooking oils have a great potential to be used as alternative fuels for diesel engines. The aim of this study was to convert light fractions of pyrolysis oil derived from Pakistani waste vehicle tyres and waste soybean oil methyl esters into valuable fuel and to reduce waste disposal-associated environmental problems. In this study, the waste tyre pyrolysis liquid (light fraction) was collected from commercial tyre pyrolysis plant and biodiesel was prepared from waste soybean oil. The fuel blends (FMWO10, FMWO20, FMWO30, FMWO40 and FMWO50) were prepared from a 30:70 mixture of waste tyre pyrolysis liquid and waste soybean oil methyl esters with different proportions of mineral diesel. The mixture was named as the fuel mixture of waste oils (FMWO). FT-IR analysis of the fuel mixture was carried out using ALPHA FT-IR spectrometer. Experimental investigations on a diesel engine were carried out with various FMWO blends. It was observed that the engine fuel consumption was marginally increased and brake thermal efficiency was marginally decreased with FMWO fuel blends. FMWO10 has shown lowest NOx emissions among all the fuel blends tested. In addition, HC, CO and smoke emissions were noticeably decreased by 3.1-15.6%, 16.5-33.2%, and 1.8-4.5%, respectively, in comparison to diesel fuel, thereby qualifying the blends to be used as alternative fuel for diesel engines.

IMPACT OF SERVICE QUALITY ON CUSTOMER SATISFACTION: EVIDENCES FROM THE RESTAURANT INDUSTRY IN PAKISTAN

OpenAIRE

Ubedullah Amjad Ali SHAIKH; Naveed Ur Rehman KHAN

2011-01-01

The purpose of this study is to contribute to the literature of service quality importance in restaurant industry. The study has been based upon the Servqual technique and Dineserv tool of improving the quality by the service providing organizations. The study is undertaken from the perspective of Pakistani Restaurant Industry and the customers' perceptions vis-à-vis restaurant dining. Two variables of Servqual, i.e. Tangibles and Responsiveness, have been examined to demonstrate the signific...

NCBI nr-aa BLAST: CBRC-TTRU-01-0303 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TTRU-01-0303 ref|ZP_04119696.1| O-acetyl transferase [Bacillus thuringiensis serovar pakistan...i str. T13001] gb|EEM48546.1| O-acetyl transferase [Bacillus thuringiensis serovar pakistani str. T13001] ZP_04119696.1 0.008 23% ...

NCBI nr-aa BLAST: CBRC-TTRU-01-0284 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TTRU-01-0284 ref|ZP_04119696.1| O-acetyl transferase [Bacillus thuringiensis serovar pakistan...i str. T13001] gb|EEM48546.1| O-acetyl transferase [Bacillus thuringiensis serovar pakistani str. T13001] ZP_04119696.1 0.009 26% ...

NCBI nr-aa BLAST: CBRC-VPAC-01-0194 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-VPAC-01-0194 ref|ZP_04121235.1| Transporter, MFS superfamily [Bacillus thuringiensis serovar pakistan...i str. T13001] gb|EEM47055.1| Transporter, MFS superfamily [Bacillus thuringiensis serovar pakistani str. T13001] ZP_04121235.1 0.99 23% ...

Ethnic disparity in stillbirth and infant mortality in Denmark 1981-2003

DEFF Research Database (Denmark)

Villadsen, Sarah Fredsted; Mortensen, Laust Hvas; Andersen, Anne-Marie Nybo

2009-01-01

.60-2.77) for Somali women. The relative risks of infant mortality were 1.41 (1.22-1.63), 1.88 (1.53-2.30), 1.39 (1.03-1.89) for children born of Turkish, Pakistani, and Somali mothers, respectively. The fetal and infant mortality in offspring of Lebanese and Former Yugoslavian women was not different from...... the mortality in the Danish group. The differences found were, in general, not attributable to ethnic differences in socioeconomic position. Turkish, Pakistani, and Somali children had an excess relative risk of infant death due to congenital malformations and the risk of death of perinatal causes was increased...... among the Pakistani offspring. CONCLUSION: Among the five largest ethnic minorities, the Turkish. Pakistani, and Somali population had substantially higher fetal and infant mortality compared to the Danish majority population, while the Lebanese and Former Yugoslavian minorities were at the same level...

NCBI nr-aa BLAST: CBRC-TTRU-01-1232 [SEVENS

Lifescience Database Archive (English)

Full Text Available thuringiensis serovar pakistani str. T13001] gb|EEM48940.1| hypothetical protein bthur0005_11430 [Bacillus thuringiensis serovar pakistani str. T13001] ZP_04119374.1 0.031 24% ... ...CBRC-TTRU-01-1232 ref|ZP_04119374.1| hypothetical protein bthur0005_11430 [Bacillus

NCBI nr-aa BLAST: CBRC-TTRU-01-1317 [SEVENS

Lifescience Database Archive (English)

Full Text Available thuringiensis serovar pakistani str. T13001] gb|EEM45303.1| hypothetical protein bthur0005_48630 [Bacillus thuringiensis serovar pakistani str. T13001] ZP_04123033.1 0.059 29% ... ...CBRC-TTRU-01-1317 ref|ZP_04123033.1| hypothetical protein bthur0005_48630 [Bacillus

Money or Education?

DEFF Research Database (Denmark)

Rytter, Mikkel

2011-01-01

Tracing life stories and family histories back to rural Punjab, I explore the development and processes of upward social mobility of the Pakistani community in Denmark from the 1960s onwards. I suggest that social mobility among Pakistani immigrants and their descendants must be seen as the outcome...... of the Danish labour market during the late 1970s and 1980s pushed them into two different long-term strategies of money or education respectively. This created a split in the Pakistani community between educated and non-educated families and shaped the second generation’s way of life in terms of, for example...

Establishment of an efficient protocol for micropropagation of some pakistani cultivars of date palm (phonex dactylifera l.) using novel inflorescence explants

International Nuclear Information System (INIS)

Jatoi, M. A.; Markhand, G. S.; Solangi, N.

2015-01-01

An efficient protocol for rapid and large scale In vitro propagation of some Pakistani cultivars of date palm has been established using inflorescence explants at Date Palm Research Institute (DPRI), Shah Abdul Latif University (SALU), Khairpur, Pakistan. Immature inflorescences of desired cultivars of date palm detached from mother palms followed by surface sterilization with low torrent of current tap water and then 30 percentage NaOCl/sub 2/ solution, the outer cover were removed in order to get spike explants and cut into the 2-3 cm small pieces and cultured on modified MS medium supplemented with 0.1 mg l-1 2, 4-D + 0.1 mg l-1 IAA + 5.0 mg l-1 NAA for initiation and establishment of cultures. The obtained somatic embryos were subjected to multiplication medium involved 0.1 mg l-1 NAA + 0.05 mg l-1BA. Rooting was achieved using quarter strength MS medium containing 0.1 mg l-1NAA without activated charcoal (AC) initially and then with 3 g l-1 AC. Strong rooted plantlets with 2-3 leaves were transferred to pots contained sand and peat moss mixture (1:1 v/v) with more than 95 percentage success in acclimatization. The acclimatized plants with at least one compound leaf were shifted to the open field conditions at SALU campus for further studying morphological and fruit characterization to ensure the true-to-type nature of tissue culture derived plantlets. High multiplication efficiency and survival percentage with no any somaclonal variation ensured the efficacy of the protocol developed for the production of elite cultivars of date palm of Pakistan and can be used to optimize production of other cultivars of date palm worldwide. (author)

Leptin promoter variant G2548A is associated with serum leptin and HDL-C levels in a case control observational study in association with obesity in a Pakistani cohort.

Science.gov (United States)

Shabana, -; Hasnain, Shahida

2016-06-01

Leptin is a protein hormone synthesized by adipocytes and is involved in the regulation of food intake and energy expenditure. We hypothesized that any change in the promoter sequence can affect the expression of the gene and hence leptin protein levels in the serum. The aim of the current study was to investigate the relationship of such a promoter variant of the leptin gene, G-2548A polymorphism, with obesity and its effect on various anthropometric and metabolic parameters in a Pakistani cohort consisting of 250 obese and 225 non-obese control subjects. Body weight, height, waist circumference (WC), hip circumference (HC) and blood pressure (BP) were measured by standard methods and levels of fasting blood glucose (FBG), total cholesterol, triglycerides, HDLC, LDLC, and leptin were determined. Genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The results showed that the LEP G-2548A polymorphism showed significant association with obesity in Pakistan. In addition, the polymorphism showed association with weight, height, BMI, WC, HDLC and serum leptin levels. The findings suggest that the leptin promoter G-2548A variant may play its part in the progression to obesity by not only affecting the body's fat distribution but also by changing the serum leptin and HDLC levels.

An exploration and comparison of food and drink availability in homes in a sample of families of White and Pakistani origin within the UK.

Science.gov (United States)

Bryant, Maria; Sahota, Pinki; Santorelli, Gillian; Hill, Andrew

2015-05-01

Knowledge of the types and quantities of foods and drinks available in family homes supports the development of targeted intervention programmes for obesity prevention or management, or for overall diet improvement. In the UK, contemporary data on foods that are available within family homes are lacking. The present study aimed to explore home food and drink availability in UK homes. An exploratory study using researcher-conducted home food availability inventories, measuring all foods and drinks within the categories of fruits, vegetables, snack foods and beverages. Bradford, a town in the north of the UK. Opportunistic sample of mixed ethnicity families with infants approximately 18 months old from the Born in Bradford birth cohort. All homes had at least one type of fruit, vegetable and snack available. Fresh fruits commonly available were oranges, bananas, apples, satsumas and grapes. Commonly available fresh vegetables included potatoes, cucumber, tomatoes and carrots. The single greatest non-fresh fruit available in homes was raisins. Non-fresh vegetables contributing the most were frozen mixed vegetables, tinned tomatoes and tinned peas. Ethnic differences were found for the availability of fresh fruits and sugar-sweetened beverages, which were both found in higher amounts in Pakistani homes compared with White homes. These data contribute to international data on availability and provide an insight into food availability within family homes in the UK. They have also supported a needs assessment of the development of a culturally specific obesity prevention intervention in which fruits and vegetables and sugar-sweetened beverages are targeted.

Disjointed Ways, Disunified Means: Learning From America’s Struggle to Build an Afghan Nation

Science.gov (United States)

2012-05-01

on Pakistani government assets in Kashmir and the rise of the Punjabi Taliban.52 Finally, the Pakistani Army also seeks to protect its own...Transition Com- mand – Afghanistan (CSTC-A). See also Raheel Khan’s “Untan- gling the Punjabi Taliban Network” in the Combating Terrorism Center’s CTC

Using a tailored health information technology- driven intervention to improve health literacy and medication adherence in a Pakistani population with vascular disease (Talking Rx) - study protocol for a randomized controlled trial.

Science.gov (United States)

Kamal, Ayeesha Kamran; Muqeet, Abdul; Farhat, Kashfa; Khalid, Wardah; Jamil, Anum; Gowani, Ambreen; Muhammad, Aliya Amin; Zaidi, Fabiha; Khan, Danyal; Elahi, Touseef; Sharif, Shahrukh; Raz, Sibtain; Zafar, Taha; Bokhari, Syedah Saira; Rahman, Nasir; Sultan, Fateh Ali Tipoo; Sayani, Saleem; Virani, Salim S

2016-03-05

Vascular disease, manifesting as myocardial infarction and stroke, is a major cause of morbidity and mortality, especially in low- and middle-income countries. Current estimates are that only one in six patients have good adherence to medications and very few have sufficient health literacy. Our aim is to explore the effectiveness and acceptability of Prescription Interactive Voice Response (IVR) Talking Prescriptions (Talking Rx) and SMS reminders in increasing medication adherence and health literacy in Pakistani patients with vascular disease. This is a randomized, controlled, single center trial. Adult participants, with access to a cell phone and a history of vascular disease, taking multiple risk-modifying medications (inclusive of anti-platelets and statins) will be selected from cerebrovascular and cardiovascular clinics. They will be randomized in a 1:1 ratio via a block design to the intervention or the control arm with both groups having access to a helpline number to address their queries in addition to standard of care as per institutional guidelines. Participants in the intervention group will also have access to Interactive Voice Response (IVR) technology tailored to their respective prescriptions in the native language (Urdu) and will have the ability to hear information about their medication dosage, correct use, side effects, mechanism of action and how and why they should use their medication, as many times as they like. Participants in the intervention arm will also receive scheduled SMS messages reminding them to take their medications. The primary outcome measure will be the comparison of the difference in adherence to anti-platelet and statin medication between baseline and at 3-month follow-up in each group measured by the Morisky Medication Adherence Scale. To ascertain the impact of our intervention on health literacy, we will also compare a local content-validated and modified version of Test of Health Literacy in Adults (TOFHLA) between

The Impact of 2002 National Teacher Contract Policy Reform on Teacher Absenteeism in Lahore, Pakistan

Science.gov (United States)

Habib, Masooma

2010-01-01

Teacher absenteeism is a persistent problem in Pakistani government schools. Under a new policy, teachers hired in Pakistani schools after 2002 are hired on fixed term contracts that are renewed, in part, based on low absenteeism. This study uses qualitative analysis techniques to assess the impact of contractual hiring on teacher absenteeism…

Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study.

Science.gov (United States)

Gilal, Faheem Gul; Zhang, Jian; Gilal, Naeem Gul; Gilal, Rukhsana Gul

2018-01-01

The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design) and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM]) and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. To the best of the authors' knowledge, the present study is one of the initial attempts to integrate self-determined needs into the relationship between product design and consumer WTP a premium and WOM, and further explore cross-cultural gender-specific differences across Pakistan and China. The findings of the present study may help international marketers in terms of segmenting, targeting, and positioning their markets.

Pakistan tabas surnuks peetud Talibani pealiku / Heiki Suurkask

Index Scriptorium Estoniae

Suurkask, Heiki, 1972-

2010-01-01

Pakistani ja USA eriüksuste haarangus langes vangi mulla Abdul Ghani Baradar, samas on Afganistani kaitseministeerium kinnitanud Baradari hukkumist juba 2007. aastal. Talibani on enim haavanud Pakistani armee suurpealetung 2009. aastal ning Afganistani presidendi Hamid Karzai intriigid, millega Talibani juhtkonna liikmeid meelitatakse üle, ostetakse ära või püütakse lepitada

'What really annoys me is people take it like it's a disability', epilepsy, disability and identity among people of Pakistani origin living in the UK.

Science.gov (United States)

Rhodes, Penny J; Small, Neil A; Ismail, Hanif; Wright, John P

2008-01-01

This paper reports on a study of Pakistani people with epilepsy. It explores their attitudes towards their condition, others' attitudes, its impact on their lives, and the extent to which they considered themselves as disabled. Epilepsy was variously interpreted within biomedical, folk and religious paradigms. In line with popular understandings, participants associated disability with stable, permanent and visible physical impairments and did not consider themselves as disabled. However, they also recognised a social dimension to their experience. Much of the distress and disadvantage they experienced was socially determined, both through direct prejudice and discrimination, and indirectly through a fear of others' negative reactions. However, the invisible and unpredictable nature of epilepsy meant that they could conceal their condition and thereby mitigate its social effects. 'Disability' was not experienced as a static and permanent state but as a potential identity that was both contingent and contested. The literature portrays people moving from biomedical to social interpretations of disability. However, the tensions experienced by people in the study were more between competing religious interpretations of their condition and, to some extent, between religious and medical approaches. Conceptions of disability, which are presented in the literature as antagonistic and mutually exclusive, were experienced as different dimensions reflecting the complexity of experience. The paper concludes by suggesting that for many people, for whom disability is an ambiguous, contingent and contested identity, public self-identification as disabled is an unrealistic goal. Rather than conceiving of disability as primarily physical or primarily social, it would be better construed as a complex interweaving of multiple factors--physical, environmental, socio-cultural and psychological factors.

Nutritional and lifestyle risk behaviors and their association with mental health and violence among Pakistani adolescents: results from the National Survey of 4583 individuals.

Science.gov (United States)

Rao, Saadiyah; Shah, Nadia; Jawed, Nida; Inam, Sumera; Shafique, Kashif

2015-04-28

Unhealthy behaviors are associated with mental health problems and violence in adolescents, yet their combined association has been understudied. Using the Global School Health Survey, this study examined the association between combined unhealthy behaviors (including fast food, soft drink, smoking, other tobacco products and physical inactivity) and anxiety, suicidal ideation and involvement in physical fight among Pakistani adolescents. Data were obtained from the Global School Health Survey conducted in Pakistan (2009). The study population consisted of school going adolescents aged 13 to 15 years. Association of combined unhealthy behaviors with anxiety, suicidal ideation and involvement in physical fight were studied through secondary analysis. We used univariate and multivariate logistic regression analysis by complex sample method, accounting for cluster sampling technique used for data collection. Of the total 4583 students, weighted percentage and unweighted count for one, two, three and four or more unhealthy behaviors was 39.4% (n = 1770), 22.1% (n = 963), 5.9% (n = 274) and 1.2% (n = 62) respectively. The weighted prevalence for anxiety, suicidal ideation and involvement in physical fight were 8.4%, 7.3% and 37.4% respectively. The results of multivariate logistic regression analysis after adjustment showed that students who had four or more unhealthy behaviors had higher odds of; being anxious (OR 2.45, 95%CI 1.31-4.59, p value 0.004), suicide ideation (OR 4.56, 95%CI 2.58-8.07, p value <0.001) and being involved in physical fight (OR 3.15, 95% CI 1.63-6.08, p value <0.001) as compared to those who had not adopted any unhealthy behaviors. This study suggests that the co-occurrence of unhealthy behaviors is associated with anxiety, suicidal ideation and physical fight among adolescents. These findings should be considered when developing interventions to combat detrimental outcomes of unhealthy behaviors during adolescence.

"Everyone just ate good food": 'Good food' in Islamabad, Pakistan.

Science.gov (United States)

Hasnain, Saher

2018-08-01

In recent years, consumption of alternatively produced foods has increased in popularity in response to the deleterious effects of rapidly globalising and industrialised food systems. Concerns over food safety in relation to these changes may result from elevated levels of risk and changing perceptions associated with food production practices. This paper explores how the middle class residents of Islamabad, Pakistan, use the concept of 'good food' to reconnect themselves with nature, changing food systems, and traditional values. The paper also demonstrates how these ideas relate to those of organic, local, and traditional food consumption as currently used in more economically developed states in the Global North. Through research based on participant observation and semi-structured interviews, this paper illustrates that besides price and convenience, purity, freshness, association with specific places, and 'Pakistani-ness' were considered as the basis for making decisions about 'good food'. The results show that while individuals are aware of and have some access to imported organic and local food, they prefer using holistic and culturally informed concepts of 'good food' instead that reconnect them with food systems. I argue that through conceptualisations of 'good food', the urban middle class in Islamabad is reducing their disconnection and dis-embeddedness from nature, the food systems, and their social identities. The paper contributes to literature on food anxieties, reconnections in food geography, and 'good food' perceptions, with a focus on Pakistan. Copyright © 2018. Published by Elsevier Ltd.

CREATIVITY IS EVERYONE’S BUSINESS: HOW TO ENHANCE EMPLOYEE CREATIVITY IN TELECOMMUNICATION SECTOR

Directory of Open Access Journals (Sweden)

KARIM SEHRISH

2016-07-01

Full Text Available With rapid cultural, demographical and economic changes in knowledge oriented economy, employee creativity has become a challenge for organizations, as this works as a core competence. We suggest that leaders with ethical commitment help to nourish creativity in employees. Using social learning theory, authors examined the influence of ethical leadership on employee creativity through the mediation of self-efficacy. This study also explored the moderating role of uncertainty avoidance between the relationship of ethical leadership and employee creativity. Data was collected from 180 employees along with their supervisors from four different telecommunication companies working in Pakistan. The questionnaire was adopted and tested on the criteria of five point Likert scale. Regression and Correlation tests were used to check hypothesis. Supervisors of these four companies evaluated the creativity of the selected staff member groups while the employees and staff members reported the perceptions about their supervisors in terms of ethical leadership. Results showed that ethical leadership was positively related to employee creativity and this relationship was mediated by self-efficacy and this mediation was partial. There was significant negative relationship between uncertainty avoidance and employee creativity, this is the main aspect of present study. According to the results uncertainty is negatively associated with the employee creativity it means high uncertainty results in low creativity of employees. This study was conducted in Pakistani context where uncertain attitude is very common in society so uncertainty avoidance affects creativity of the employee in Pakistani organizations. Our study offer practical implications for telecommunication companies in order to achieve competitive advantage by enhancing employee creativity, as employee creativity makes organization creative.

South Asian Diasporic Youth in Denmark: Socio-Economic Strategies

DEFF Research Database (Denmark)

Singla, Rashmi; Fabricius, Anne Sophie; Holm, Anne

2009-01-01

Based on two empirical studies, this article investigates some socioeconomic aspects of the South Asian diaspora in Denmark. The first longitudinal study explored young adults’ economic strategies in relation to their country of origin. The first wave investigation was conducted in the mid-1990s....... Within a theoretical framework combining positioning theory with life course perspective, in-depth interviews were conducted with young adults of  Indian and Pakistani background (n=5). The second study focussed on second generation Pakistani in Denmark and their remittances to Pakistan. The extent...... and nature of transnational activities among second generation Pakistani has been investigated within a theoretical framework of transnationalism and identity construction. The results indicate three emergent forms of socioeconomic strategies among South Asian youth in Denmark: 1) individual strategies...

An Examination of the Collateral Psychological and Political Damage of Drone Warfare in the FATA Region of Pakistan

Science.gov (United States)

2013-09-01

Pakistan and Afghanistan. Illiteracy and poverty are common and women no have rights in their society. Most children do not attend school.13...attacks. In 2004, Fair concluded that the on-going conflict with India over Kashmir was the main motivator for Pakistanis to join militant...Pakistani government. Most of their efforts are leveraged in India -controlled Kashmir or India proper, and have received the support of the Inter-Services

The Afghanistan Question and the Reset in U.S.-Russian Relations

Science.gov (United States)

2011-10-01

Pakistani cities. In the Pakistani Islamic coffee shops, the Arabs would 40 provide the intellectual framework for creating an Is- lamic government...of law, while his administration’s obsession with Iraq would lead the United States into fighting two wars in the Muslim world simultaneously...warp U.S. foreign policy and distort key American ideals about the rule of law, while his administration’s obsession with Iraq would lead the

Self-reported maternal parenting style and confidence and infant temperament in a multi-ethnic community: results from the Born in Bradford cohort.

Science.gov (United States)

Prady, Stephanie L; Kiernan, Kathleen; Fairley, Lesley; Wilson, Sarah; Wright, John

2014-03-01

Ethnic minority children in the United Kingdom often experience health disadvantage. Parenting influences children's current and future health, but little is known about whether parenting behaviours and mother's perception of her infant vary by ethnicity. Using the Born in Bradford (BiB) birth cohort, which is located in an ethnically diverse and economically deprived UK city, we conducted a cross-sectional analysis of mother's self-reported parenting confidence, self-efficacy, hostility and warmth, and infant temperament at six months of age. We examined responses from women of Pakistani (N = 554) and White British (N = 439) origin. Pakistani mothers reported feeling more confident about their abilities as a parent. Significantly fewer Pakistani women adopted a hostile approach to parenting, an effect that was attenuated after adjustment for socioeconomic status and mental health. Overall, women with more self-efficacious, warm and less hostile parenting styles reported significantly fewer problems with their infant's temperaments. Of women with higher self-efficacy parenting styles, Pakistani mothers were significantly more likely than White British mothers to report more problematic infant temperaments, although absolute differences were small. It is unlikely that the ethnic variation seen in children's cognitive and behavioural outcomes in childhood is attributable to differences in parenting or infant characteristics reported at six months.

Identification and in silico characterization of p.G380R substitution in FGFR3, associated with achondroplasia in a non-consanguineous Pakistani family.

Science.gov (United States)

Ajmal, Muhammad; Mir, Asif; Shoaib, Muhammad; Malik, Salman Akbar; Nasir, Muhammad

2017-07-05

The dimerization efficiency of FGFR3 transmembrane domain plays a critical role in the formation of a normal skeleton through the negative regulation of bone development. Recently, gain-of-function mutations in the transmembrane domain of FGFR3 has been described associated with an aberrant negative regulation, leading to the development of achondroplasia-group disorders, including achondroplasia (ACH), hypochondroplasia (HCH) and thanatophoric dysplasia (TD). Here, we describe a non-consanguineous Pakistani family with achondroplasia to explain hereditary basis of the disease. PCR-based linkage analysis using microsatellite markers was employed to localize the disease gene. Gene specific intronic primers were used to amplify the genomic DNA from all affected as well as phenotypically healthy individuals. Amplified PCR products were then subjected to Sanger sequencing and RFLP analysis to identify a potentially pathogenic mutation. The impact of identified mutation on FGFR3 protein's structure and stability was highlighted through different bioinformatics tools. Genetic screening of the family revealed a previously reported heterozygous c.1138 G > A (p.G380R) mutation in the coding exon 8 of FGFR3 gene. Identified genetic variation was confirmed in all affected individuals while healthy individuals and controls were found genotypically normal. The results were further validated by RFLP analysis as c.1138 G > A substitution generates a unique recognition site for SfcI endonuclease. Following SfcI digestion, the electrophoretic pattern of three bands/DNA fragments for each patient is indicative of heterozygous status of the disease allele. In silico studies of the mutant FGFR3 protein predicted to adversely affect the stability of FGFR3 protein. Mutation in the transmembrane domain may adversely affect the dimerization efficiency and overall stability of the FGFR3, leading to a constitutively active protein. As a result, an uncontrolled intracellular signaling

Perceptions about the cause of schizophrenia and the subsequent help seeking behavior in a Pakistani population – results of a cross-sectional survey

Directory of Open Access Journals (Sweden)

Yousaf Wajeeha

2008-07-01

Full Text Available Abstract Background There is a cultural variability around the perception of what causes the syndrome of schizophrenia. Generally patients with schizophrenia are considered dangerous. They are isolated and treatment is delayed. Studies have shown favorable prognosis with good family and social support, early diagnosis and management. Duration of untreated psychosis is a bad prognostic indicator. We aimed to determine the perceptions regarding the etiology of schizophrenia and the subsequent help seeking behavior. Methods This cross-sectional study was carried out on a sample of 404 people at the out patient departments of Aga Khan University Hospital Karachi. Data was collected via a self-administered questionnaire. Questions were related to a vignette of a young man displaying schizophrenic behavior. Data was analyzed on SPSS v 14. Results The mean age of the participants was 31.4 years (range = 18–72 and 77% of them were males. The majorities were graduates (61.9% and employed (50%. Only 30% of the participants attributed 'mental illness' as the main cause of psychotic symptoms while a large number thought of 'God's will' (32.3%, 'superstitious ideas' (33.1%, 'loneliness' (24.8% and 'unemployment' (19.3% as the main cause. Mental illness as the single most important cause was reported by only 22%. As far as management is concerned, only 40% reported psychiatric consultation to be the single most important management step. Other responses included spiritual healing (19.5% and Sociachanges (10.6 while 14.8% of respondents said that they would do nothing. Gender, age, family system and education level were significantly associated with the beliefs about the cause of schizophrenia (p Conclusion Despite majority of the study population being well educated, only a few recognized schizophrenia as a mental illness and many held superstitious beliefs. A vast majority of Pakistanis have non-biomedical beliefs about the cause of schizophrenia. Their

CTC Sentinel. Volume 5, Issue 8, August 2012

Science.gov (United States)

2012-08-01

Cyberterrorism: Capturing a Broad Range of Activities in Cyberspace By Jonalan Brickey 6 Pakistani Taliban Renew Attacks on Punjabi Heartland By Arif Rafiq...Agency, U.S. Northern Command, and U.S. Army Central Command. Pakistani Taliban Renew Attacks on Punjabi Heartland By Arif Rafiq after an extended...Lashkar-i-Tayyiba as well as the various Punjabi Taliban groups. 25 The Punjab police have made some important arrests in the past year. In

Young Norwegian-Pakistani Women and Sport: How Does Culture and Religiosity Matter?

Science.gov (United States)

Walseth, Kristin; Strandbu, Åse

2014-01-01

Studies from several countries show that girls with an immigrant background participate in organized sports to a lesser extent than other young people. Barriers related to culture and religion serve in many of these studies as explanations. In this article we suggest that the notions of culture and religion in this field of studies could be…

Low maternal folate concentrations and maternal MTHFR C677T polymorphism are associated with an increased risk for neural tube defects in offspring: a case-control study among Pakistani case and control mothers.

Science.gov (United States)

Nauman, Nuzhat; Jalali, Samina; Shami, Sajjad; Rafiq, Shireen; Große, Greta; Hilger, Alina C; Zhang, Rhong; Mansoor, Saira; Ludwig, Michael; Reutter, Heiko

2018-01-01

There is considerable evidence that periconceptional maternal folate deficiency and coding variants in maternal genes coding for critical enzymes in the folate pathway are associated with neural tube defects (NTDs) in offspring. In a case-control study we investigated C677T polymorphism in the 5,10- methylenetetrahydrofolate reductase (MTHFR) gene in case and control mothers of Pakistani origin, and compared these with the respective maternal folate concentrations measured at the time of delivery. A case-control study was conducted among 109 case and 100 control mothers identified through the Holy Family Hospital Rawalpindi, Quaid-i-Azam University, Islamabad, Pakistan. Red blood cell (RBC) and serum folate concentrations and MTHFRC677T polymorphism were compared between case and control mothers. Mean RBC folate and serum folate concentrations were significantly lower in cases compared with control mothers (pcases compared with control mothers (CC vs TT pcases compared with control mothers (C vs T pCase mothers with 677CT or 677TT genotypes had significantly lower serum (pstudy provides further evidence that maternal folate deficiency and MTHFRC677T polymorphism might be associated with an increased risk for NTDs in offspring. Our results are limited by the fact that maternal folate concentrations were not obtained during the periconceptional period, but at delivery. Further analyses, including maternal folate levels during the periconceptional period, are warranted.

Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study

Directory of Open Access Journals (Sweden)

Gilal FG

2018-06-01

Full Text Available Faheem Gul Gilal,1 Jian Zhang,1 Naeem Gul Gilal,2 Rukhsana Gul Gilal3 1Donlinks School of Economics and Management, University of Science and Technology Beijing, Beijing, People’s Republic of China; 2School of Management, Huazhong University of Science and Technology, Wuhan, Hubei, People’s Republic of China; 3Department of Business Administration, Sukkur IBA University, Sindh, Pakistan Background: The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM] and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. Methods: To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. Results: The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. Conclusion: To the best of the

Perceived social image and life satisfaction across cultures.

Science.gov (United States)

Rodriguez Mosquera, Patricia M; Imada, Toshie

2013-01-01

We studied the relationship between perceived social image and life satisfaction in four different cultural groups. One-hundred nine Indian (63 females, 46 males), 67 Pakistani/Bangladeshi (36 females, 31 males), 76 White British (43 females, 33 males), and 94 European Americans (43 females, 48 males) completed measures on the cultural importance of social image, positive and negative emotions, academic achievement, and perceived social image. Indian and Pakistani/Bangladeshi participants valued social image more than White British and European-American participants. Consistent with this value difference, a positive perceived social image predicted life satisfaction among Indian and Pakistani/Bangladeshi participants only. For these participants, perceived social image predicted life satisfaction above and beyond the effects of emotions and academic achievement. Academic achievement only predicted life satisfaction among White British and European Americans. Emotions were significant predictors of life satisfaction for all participants.

IT Project Management in Very Small Software Companies

DEFF Research Database (Denmark)

Shakir, Shahid Nadeem; Nørbjerg, Jacob

2013-01-01

In developing countries very small software companies (VSSCs) with only 1-10 employees play an important role both in the local economy and as providers of software and services to customers in other parts of the world. Understanding and improving their IT project management (ITPM) practices...... and challenges are, therefore, important in the local as well as the larger context of globalized software development. There is, however, very little research into small shop software practices in developing countries. The current paper explores actual ITPM practices in Pakistani VSSCs based on a qualitative...... study of seven Pakistani VSSCs. We find that some Pakistani ITPM practices are similar to what is reported from VSSCs in other parts of the world, while others seem to be related to the companies' position in the global software development chain. This paper is part of a larger research project aiming...

South Asian people and heart disease: an assessment of the importance of socioeconomic position.

Science.gov (United States)

Nazroo, J Y

2001-01-01

Higher rates of mortality from ischemic heart disease among South Asian people are well established and appear to be unrelated to socioeconomic position. However, traditional indicators of socioeconomic position may be inadequate when making comparisons across ethnic groups. This study investigates these issues in a British morbidity survey. The Fourth National Survey was a British cross-sectional study conducted from 1993 to 1994. The study used a national representative community sample, consisting of 2867 white respondents, 2001 Indian respondents, and 1776 Pakistani and Bangladeshi respondents. Data on occupational class and standard of living were used to examine the contribution of socioeconomic factors to differences in rates of reported severe chest pain and diagnosed heart disease. White and Indian respondents had similar rates of reported indicators of heart disease, while Pakistani and Bangladeshi respondents had rates that were considerably higher. There was a clear socioeconomic gradient in reported heart disease for each ethnic group, with those who were poorer having higher rates. Controlling for occupational class made little difference to the greater risk of heart disease found in the Pakistani and Bangladeshi group; however, controlling for a more sensitive indicator of socioeconomic position-standard of living-greatly reduced their disproportionate risk. The findings suggest that South Asian people do not share a uniformly greater risk of heart disease. The more economically advantaged South Asian group, Indians, had rates that are similar to those found among white people, while the poorest groups, Pakistanis and Bangladeshis, had rates that are considerably higher. Socioeconomic position predicted risk in each ethnic group and made a key contribution to the higher risk found for Pakistani and Bangladeshi individuals. Other studies may have failed to identify the important contribution of socioeconomic position because the indicators used were

Understanding the Appeal of the Taliban in Pakistan

Directory of Open Access Journals (Sweden)

Syed Manzar Abbas Zaidi

2010-01-01

Full Text Available This article briefly explores the economics of the "Talibanization" of Pakistan within descriptive and contextual paradigms, while attempting to find a best solution to counter rising militancy in the context of realities facing the population on the ground. One such solution is the National Pakistani Counter Terrorism and Extremism Strategy (NACTES, designed to curb Taliban financing in Pakistan. The strategy is being drafted by National Counter Terrorism Authority (NACTA, the nascent homeland security coordination body set up by the state as the primary public organ entrusted with counterterrorism, counter-extremism, and de-radicalization efforts of the state.

Feeding of Low Birth Weight Newborns in Tertiary Care Hospitals in Pakistan: Do They Follow the World Health Organization Latest Guidelines?

Science.gov (United States)

Khan, Jehangir; Stafstrom, Martin; Martines, Jose Carlos

2015-08-01

To determine the extent the World Health Organization (WHO) guidelines on the care of Low Birth Weight (LBW) newborns are followed in Pakistani hospitals and analyze any difference in policy compliance between different hospitals. Descriptive analytical study. Data was collected from five tertiary care hospitals, one each from Peshawar, Lahore, Quetta, Karachi and Islamabad, from January to June 2012. LBW newborns data derived from medical records was used. It was collected using a questionnaire, which encompassed the recent WHO recommendations for feeding of LBW. Twenty questionnaires were collected from each hospital. STATA11.0 was used to analyze the data. Fifty seven LBW newborns (57%) were fed with mother's own milk, and 9 (9%) were fed on donor human milk. Forty four newborns (44%) were initiated breastfeeding within the first hour after birth. Most of the babies not able to be breastfed were fed with intra gastric tube. Feeding practices varied markedly across hospitals, ranging from one hospital where all newborns were fed formula milk to one where all were fed breast milk. The WHO guidelines were only partially implemented, with significant differences between hospitals in level of implementation of recommended practices. Given the benefits expected from the application of the guidelines, efforts should be made for the establishment and promotion of a single national policy for LBW feeding that follows the WHO new guidelines and streamlines the LBW feeding practices across the country.

Analytical Studies on the Quality and Environmental Impact of Commercial Motor Gasoline Available in Multan Region of Pakistan

Directory of Open Access Journals (Sweden)

Ghulam Yasin

2008-12-01

Full Text Available Physico-chemical characteristics such as specific gravity, reid vapour pressure, copper corrosion, distillation (I.B.P., F.B.P., Total recovery & residue and hydrocarbon contents (saturates, aromatics and polars of gasoline of different oil marketing companies collected from retail outlets in district Multan have been analysed using standard ASTM procedures. Results have been compared with the Pakistani, Indian and European specifications to assess the quality of Pakistani gasoline (petrol. The environmental impact of gasoline has also been assessed.

Analytical studies on the quality and environmental impact of commercial motor gasoline available in multan region of pakistan

International Nuclear Information System (INIS)

Yasin, G.; Ansari, T.M.; Naqvi, S.M.S.R.

2008-01-01

Physico-chemical characteristics such as specific gravity, reid vapour pressure, copper corrosion, distillation (I.B.P., F.B.P., Total recovery and residue) and hydrocarbon contents (saturates, aromatics and polars) of gasoline of different oil marketing companies collected from retail outlets in district Multan have been analysed using standard ASTM procedures. Results have been compared with the Pakistani, Indian and European specifications to assess the quality of Pakistani gasoline (petrol). The environmental impact of gasoline has also been assessed. (author)

The A.Q. Khan case, two years later

International Nuclear Information System (INIS)

Tertrais, Bruno

2005-01-01

Two years after the first public revelations on the importance of Pakistani nuclear trades, the author proposes a critical comment of the so-called A.Q. Khan case. He outlines that making A.Q. Khan the father of the Pakistani atomic bomb is exaggerated, indicates what Khan actually exported (some know-how on head militarization, and on uranium centrifugation). He identifies Khan's motivations and outlines the different situations and relationships associated with the different concerned countries (Iran, North Korea, Libya)

RELATIONSHIP AMONG CORPORATE IMAGE, INTANGIBLE PERCEIVED QUALITY, CHOOSING, HABIT AND CUSTOMER LOYALTY

Directory of Open Access Journals (Sweden)

Maryam REHMAN

2012-01-01

Full Text Available This study explores relationships among Corporate Image, Intangible Perceived Quality, Choosing, Habit and Customer Loyalty and investigates the pivotal role these variables play in establishing and maintaining healthy base of loyal customers. Data were collected from Pakistani bank account holders and the empirical findings showed that corporate image plays the most important role in establishing and maintaining customer loyalty in the markets. Organizations always look forward to long lasting success. In order to be successful in the long run, they need to keep abreast with all of their stakeholders. Out of the stakeholders, customers are considered to be the most important one. Customer Loyalty is a psychological motive which today’s managers are considerate about. This study concludes that long-term success and sustainable reputation of an organization depends on customer loyalty.

A Commentary on Telerehabilitation Services in Pakistan: Current Trends and Future Possibilities

Directory of Open Access Journals (Sweden)

Zeshan Zahid

2017-06-01

Full Text Available A 2014 World Health Organization (WHO study reported that almost 27 million people with disability live in Pakistan with fewer than one allied rehabilitation professional per 10,000 people. The current study sought to determine the attitudes toward telerehabilitation via a survey administered to 329 Pakistani rehabilitation professionals. Study results indicate that rehabilitation professionals in Pakistan are knowledgeable about telerehabilitation and Information and Communication Technology (ICT, and are receptive to employing telerehabilitation programs and applications. Therefore, we can infer that the future of telerehabilitation can be bright in Pakistan but requires the attention of policy makers and non-government organizations to launch an appropriate program nationwide. The authors suggest that a range of telerehabilitation services (e.g., consultation, assessment, and therapy could alleviate the shortage of rehabilitation personnel in Pakistan.

Assessment of association of smoking with bone mineral density (BMD) and fragility fractures in a cohort of pakistani males ages <= 50 years and postmenopausal females

International Nuclear Information System (INIS)

Akhlaq, U.; Ayaz, S.B.

2015-01-01

Objectives: The study aimed to determine the association between smoking, bone mineral density (BMD), and fragility fractures in a cohort of Pakistani males aged > 50 years and postmenopausal females. Methodology: This was a cross-sectional survey carried out at Armed Forces Institute of Rehabilitation Medicine (AFIRM), Rawalpindi from Jan 2010 to Jan 2011. Through non-probability purposive sampling, we included male patients of age > 50 years and postmenopausal women. All subjects were submitted to dual energy X-Ray absorptiometery at lumbar spine (L2 > L4) and at both femoral by Hologic Discovery-A machine . The lowest BMD was noted and expressed in the form of T-score.Using SPSS V 20, descriptive statistics were calculated for the various variables. Independent samples t-test was used to determine the significance of difference between mean T-score in between smokers and non-smokers. Association between smoking and the risk of fracture was carried out using Fisher exact test. A p-value < 0.05 was considered significant. Results: Out of a total of 328 patients, 142 (43.3%) were male (mean age 64 ± 8, range: 50 - 82 years) and 186 (56.7%) were female (mean age 61 ± 8, range: 43 - 92 years). Sixteen (8.6%) females and 52 (36.6%) males were smokers. In males, the mean T-score was -1.6 ± 1.3 in non-smokers and -1.9 ± 1.2 in smokers (p=0.17). Two of the non-smokers and nine of the smokers had a fracture. (p=0.002). In females, the mean T-score was -2.9 ± 1.9 in smokers and -2.3 ± 1.4 in non-smokers (p=0.23). Twelve of the non-smokers and 15 smokers had a fracture. (p<0.001) Conclusion: Smoking was significantly associated with increased percentage of fragility fractures but not with a reduction in BMD in our sample of postmenopausal women and men of age > 50 years. (author)

Processing of Pakistani carbonatites for separation of cerium from adjacent rare earths

International Nuclear Information System (INIS)

Akram, M.; Qazi, N.K.; Khan, M.F.; Hasan, G.H.; Ahmed, N.; Chughtai, N.A.

2003-01-01

Carbonatite rock of Loe-Shilman area in North Western Frontier Province (NWFP) of Pakistan contains rare earth elements. This rock was upgraded in terms of its rare earths content from 2,000 ppm to 10,000 ppm rare earths oxide (REO) by crushing, calcination at 1000 deg. C for 3 hrs and cold leaching with 2% HCl for 1 hr. 80% to 95% of rare earths present in carbonatite powder were digested in nitric acid at 60 deg. C after 2 hrs stirring. Tributyl phosphate (TBP), diluted with dodecane, was used as extractant for extraction of rare earths. Since extraction is dependent on pH of the aqueous feed solution, the role of nitrate ions concentration in the solvent extraction of rare earth elements (REEs) was studied. It was observed that extraction of REEs was maximum at pH 1.1. The solvent had been unable to extract REEs from high acidic feed solutions. Solvents of different molarities were also tried against aqueous phase of pH 1.1. Studies showed a poor gain at 0 M and 0.5 M of organic phase while no gain observed beyond 2 molar solvent. 1 M organic phase gave maximum yield of rare earths salt, Ln(OH)/sub 3/, when stripped solution precipitated with ammonium hydroxide solution. It was also observed that if aqueous solution of 3.0 N was treated with blank solvent (i.e. Molarity = 0), it gave almost the same result. It was further established that optimum quantity of caging agent, Al(NO/sub 3/)/sub 3/-9H/sub 2/O added to aqueous solution prior to pH adjustment (i.e. 10 gm/100 gm powder dissolved) suppressed fluoride ions (F') which were hindering the extraction of rare earths. This improved the extraction efficiency of desired elements. To optimise the process parameters like solvent dilution, aqueous to organic ratio and extraction/stripping times, a' series of experiments were performed. Recovery for the desired elements had been between 78% to 86%. The optimum extraction parameters were found to be TBP concentration 40% (v/v) for aqueous to organic ratio 1:5 and 50

Strengths, weaknesses, opportunities, and threats analysis of integrating the World Health Organization patient safety curriculum into undergraduate medical education in Pakistan: a qualitative case study

Directory of Open Access Journals (Sweden)

Samreen Misbah

2017-12-01

Full Text Available Purpose The purpose of this study was to conduct a strengths, weaknesses, opportunities, and threats (SWOT analysis of integrating the World Health Organization (WHO patient safety curriculum into undergraduate medical education in Pakistan. Methods A qualitative interpretive case study was conducted at Riphah International University, Islamabad, from October 2016 to June 2017. The study included 9 faculty members and 1 expert on patient safety. The interviews were audiotaped, and a thematic analysis of the transcripts was performed using NVivo software. Results Four themes were derived based on the need analysis model. The sub-themes derived from the collected data were arranged under the themes of strengths, weaknesses, opportunities, and threats, in accordance with the principles of SWOT analysis. The strengths identified were the need for a formal patient safety curriculum and its early integration into the undergraduate program. The weaknesses were faculty awareness and participation in development programs. The opportunities were an ongoing effort to develop an appropriate curriculum, to improve the current culture of healthcare, and to use the WHO curricular resource guide. The threats were attitudes towards patient safety in Pakistani culture, resistance to implementation from different levels, and the role of regulatory authorities. Conclusion The theme of patient safety needs to be incorporated early into the formal medical education curriculum, with the main goals of striving to do no harm and seeing mistakes as opportunities to learn. Faculty development activities need to be organized, and faculty members should to be encouraged to participate in them. The lack of a patient safety culture was identified as the primary reason for resistance to this initiative at many levels. The WHO curriculum, amended according to local institutional culture, can be implemented appropriately with support from the corresponding regulatory bodies.

Strengths, weaknesses, opportunities, and threats analysis of integrating the World Health Organization patient safety curriculum into undergraduate medical education in Pakistan: a qualitative case study.

Science.gov (United States)

Misbah, Samreen; Mahboob, Usman

2017-01-01

The purpose of this study was to conduct a strengths, weaknesses, opportunities, and threats (SWOT) analysis of integrating the World Health Organization (WHO) patient safety curriculum into undergraduate medical education in Pakistan. A qualitative interpretive case study was conducted at Riphah International University, Islamabad, from October 2016 to June 2017. The study included 9 faculty members and 1 expert on patient safety. The interviews were audiotaped, and a thematic analysis of the transcripts was performed using NVivo software. Four themes were derived based on the need analysis model. The sub-themes derived from the collected data were arranged under the themes of strengths, weaknesses, opportunities, and threats, in accordance with the principles of SWOT analysis. The strengths identified were the need for a formal patient safety curriculum and its early integration into the undergraduate program. The weaknesses were faculty awareness and participation in development programs. The opportunities were an ongoing effort to develop an appropriate curriculum, to improve the current culture of healthcare, and to use the WHO curricular resource guide. The threats were attitudes towards patient safety in Pakistani culture, resistance to implementation from different levels, and the role of regulatory authorities. The theme of patient safety needs to be incorporated early into the formal medical education curriculum, with the main goals of striving to do no harm and seeing mistakes as opportunities to learn. Faculty development activities need to be organized, and faculty members should to be encouraged to participate in them. The lack of a patient safety culture was identified as the primary reason for resistance to this initiative at many levels. The WHO curriculum, amended according to local institutional culture, can be implemented appropriately with support from the corresponding regulatory bodies.

Do ethnic differences in cord blood leptin levels differ by birthweight category? Findings from the Born in Bradford cohort study.

Science.gov (United States)

West, Jane; Wright, John; Fairley, Lesley; Sattar, Naveed; Whincup, Peter; Lawlor, Debbie A

2014-02-01

There is evidence that South Asian individuals have higher fat mass for a given weight than Europeans. One study reported that the greater fatness for a given birthweight may increase with increasing birth weight, suggesting that any attempt to increase mean birth weight in South Asians would markedly increase their fatness. Our objective was to examine whether differences in cord leptin values between White British and Pakistani infants vary by birth weight category. We examined the difference in cord leptin levels between 659 White British and 823 Pakistani infants recruited to the Born in Bradford cohort study, by clinical categories and thirds of the birth weight distribution. Pakistani infants had a lower mean birthweight but higher cord leptin levels than White British infants [ratio of geometric mean(RGM) of cord leptin adjusted for birth weight = 1.36 (95% CI 1.26,1.46)]. Birthweight was positively associated with cord leptin levels in both groups, with no evidence that the regression lines in the two groups diverged from each other with increasing birthweight.The relative ethnic difference in cord leptin was similar in low (distribution [RGM (95% CI) in lowest, mid and highest thirds were 1.37 (1.20, 1.57), 1.36 (1.20, 1.54) and 1.31 (1.16, 1.52), respectively, P-interaction = 0.51]. We found marked differences in cord leptin levels between Pakistani and White British infants but no evidence that this difference increases with increasing birthweight.

Quantitative study of medicinal plants used by the communities residing in Koh-e-Safaid Range, northern Pakistani-Afghan borders.

Science.gov (United States)

Hussain, Wahid; Badshah, Lal; Ullah, Manzoor; Ali, Maroof; Ali, Asghar; Hussain, Farrukh

2018-04-25

The residents of remote areas mostly depend on folk knowledge of medicinal plants to cure different ailments. The present study was carried out to document and analyze traditional use regarding the medicinal plants among communities residing in Koh-e-Safaid Range northern Pakistani-Afghan border. A purposive sampling method was used for the selection of informants, and information regarding the ethnomedicinal use of plants was collected through semi-structured interviews. The collected data was analyzed through quantitative indices viz. relative frequency citation, use value, and family use value. The conservation status of medicinal plants was enumerated with the help of International Union for Conservation of Nature Red List Categories and Criteria (2001). Plant samples were deposited at the Herbarium of Botany Department, University of Peshawar for future reference. One hundred eight informants including 72 male and 36 female were interviewed. The informants provided information about 92 plants species used in the treatment of 53 ailments. The informant reported maximum number of species used for the treatment of diabetes (16 species), followed by carminatives (12 species), laxatives (11 species), antiseptics (11 species), for cough (10 species), to treat hepatitis (9 species), for curing diarrhea (7 species), and to cure ulcers (7 species), etc. Decoction (37 species, i.e., 40%) was the common method of recipe preparation. Most familiar medicinal plants were Withania coagulans, Caralluma tuberculata, and Artemisia absinthium with relative frequency (0.96), (0.90), and (0.86), respectively. The relative importance of Withania coagulans was highest (1.63) followed by Artemisia absinthium (1.34), Caralluma tuberculata (1.20), Cassia fistula (1.10), Thymus linearis (1.06), etc. This study allows identification of novel uses of plants. Abies pindrow, Artemisia scoparia, Nannorrhops ritchiana, Salvia reflexa, and Vincetoxicum cardiostephanum have not been reported

The End of the Line

DEFF Research Database (Denmark)

Shakir, Shahid Nadeem; Nørbjerg, Jacob

2013-01-01

Most software development companies are very small with only 1-10 employees. In developing countries such companies play an important role both locally and as providers of software and services to customers in other parts of the world. Understanding and improving their project management (PM...... literature, and we have described the implications of those challenges on quality and productivity of Pakistani SSDSs. We also find that some Pakistani SSDS practices are similar to what is reported from SSDSs in other parts of the world, but other practices are related to the companies' position...

Dietary education must fit into everyday life

DEFF Research Database (Denmark)

Folmann Hempler, Nana; Nicic, Sara; Ewers, Bettina

2015-01-01

explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. METHODS: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary...... that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more...

Feeding of low birth weight newborns in tertiary care hospitals in pakistan: do they follow the world health organization latest guidelines

International Nuclear Information System (INIS)

Khan, J.; Stafstrom, M.

2015-01-01

To determine the extent the World Health Organization (WHO) guidelines on the care of Low Birth Weight (LBW) newborns are followed in Pakistani hospitals and analyze any difference in policy compliance between different hospitals. Study Design: Descriptive analytical study. Place and Duration of Study: Data was collected from five tertiary care hospitals, one each from Peshawar, Lahore, Quetta, Karachi and Islamabad, from January to June 2012. Methodology: LBW newborns data derived from medical records was used. It was collected using a questionnaire, which encompassed the recent WHO recommendations for feeding of LBW. Twenty questionnaires were collected from each hospital. STATA 11.0 was used to analyze the data. Results: Fifty seven LBW newborns (57%) were fed with mother's own milk, and 9 (9%) were fed on donor human milk. Forty four newborns (44%) were initiated breast feeding within the first hour after birth. Most of the babies not able to be breast fed were fed with intra gastric tube. Feeding practices varied markedly across hospitals, ranging from one hospital where all newborns were fed formula milk to one where all were fed breast milk. Conclusion: The WHO guidelines were only partially implemented, with significant differences between hospitals in level of implementation of recommended practices. Given the benefits expected from the application of the guidelines, efforts should be made for the establishment and promotion of a single national policy for LBW feeding that follows the WHO new guidelines and streamlines the LBW feeding practices across the country. (author)

Sociopolitical adjustment among Afghan refugees in Pakistan.

Science.gov (United States)

Centlivres, P; Centlivres-demont, M

1987-01-01

Although international organizations and Pakistanis expect Afghans to act like true refugees--dependent, obedient, and grateful--Afghans consider themselves as temporary exiles who, in protest against an anti-Islamic government, found temporary refuge in Pakistan; or as soldiers in the holy wars who temporarily use their Islamic neighbor as a base before returning to fight in Afghanistan. Conforming to this concept and to these objectives, the refugees seek to preserve a certain autonomy and to lean towards forms of organization which are derived either from their traditional social structure, or as is more common now, from the ideology of the Islamic movements. One can understand that this situation may cause many misunderstandings, especially with international organizations which finance and supervise aid to the Afghan refugees in Pakistan. As for anthropologists, it is necessary to go beyond known concepts, to relativize familiar models and to act on changes which have come about in the structures and ideology of the Afghan people.

Exploring gender, age, time and space in research with older Pakistani Muslims in the United Kingdom: formalised research 'ethics' and performances of the public/private divide in 'the field'.

Science.gov (United States)

Zubair, Maria; Victor, Christina

2015-05-01

In recent years, there has been an increasing interest in researching ageing ethnic minority populations in the West. However, older people from such minority communities have received comparatively little attention in wide-ranging discussions on appropriate research methodologies. By a process of critically reflecting on our experiences of undertaking fieldwork for our Economic and Social Research Council New Dynamics of Ageing study of 'Families and Caring in South Asian Communities', this paper maps out the key methodological and ethical challenges we faced and, in the process, highlights the importance of developing socially appropriate research methodologies and ethical frameworks for research with such populations. With a reflexive approach, we specifically explore the significance of gender, age, time and space to the fieldwork processes and the 'field' relationships formed at various stages of the research process. In particular, we explore three key emergent issues which conflicted with our formal research protocols and presented particular challenges for us and our older Pakistani Muslim participants: (a) structuring of time in daily life; (b) gendered use of public and private spaces; and (c) orality of informal social contexts and relationships. Using illustrations from our fieldwork which reveal the particular significance of these issues to our fieldwork experiences and performativities of public/private identities, we highlight important tensions between formalised ethical and methodological dimensions of conducting funded research and the realities of being in 'the field'. We conclude the paper by emphasising the need to explore further not only the ways in which researchers can adopt more socially and culturally sensitive data collection processes and methodologies at the micro level of their interactions with research participants, but also contextualising the particular challenges experienced by researchers and their participants in terms of the

Dietary intake in the early years and its relationship to BMI in a bi-ethnic group: the Born in Bradford 1000 study.

Science.gov (United States)

Mahoney, Samuel; Bryant, Maria; Sahota, Pinki; Barber, Stuart

2018-04-02

To assess relationships between dietary intake at age 12, 18 and 36 months and BMI Z-scores at age 36 months in a bi-ethnic group. A prospective cohort study comparing cross-sectional and longitudinal data. Exposures included dietary intake at 12, 18 and 36 months (FFQ) with an outcome of BMI Z-score at age 36 months. Born in Bradford 1000 study, Bradford, UK. Infants at age 12 months (n 722; 44 % White British, 56 % Pakistani), 18 months (n 779; 44 % White British, 56 % Pakistani) and 36 months (n 845; 45 % White British, 55 % Pakistani). Diet at age 12 months was not associated with BMI Z-score at age 36 months. Higher consumption of vegetables at 18 and 36 months was associated with a lower BMI Z-score at 36 months (model coefficient (95 % CI): -0·20 (-0·36, -0·03) and -0·16 (-0·31, -0·02), respectively). Higher consumption of high-fat chips at age 36 months was associated with a lower BMI Z-score at age 36 months (-0·16 (-0·32, 0·00)). Overall, White British children had higher 36-month BMI Z-scores than Pakistani children (adjusted mean difference (95 % CI): 0·21 (0·02, 0·41)). Our findings indicate that dietary intake at 18 and 36 months was somewhat related to BMI Z-score at age 36 months and suggest the importance of early interventions aimed at establishing healthy eating behaviours.

The Role of Madrasas

DEFF Research Database (Denmark)

Vestenskov, David

This book is the combined result of all three studies edited by the RDDC. The intention is to provide a more nuanced view on the role of madrasas in Afghanistan and Pakistan by addressing some of the core questions pertaining to these institutions: Why do Pakistani parents decide to send...... their children to madrasas instead of public schools? From which sources do the Pakistani madrasas generate their funding, and how dependent are they on this funding? What are recent developments and which groups run madrasas in Afghanistan? This book presents the findings from the extensive data...

Comparing Standards of Business Ethics in USA, China, Jamaica and Pakistan

Directory of Open Access Journals (Sweden)

Abdul Ghani Tabish

2009-06-01

Full Text Available As the business organizations are expanding at a rapid pace, so is the circulation of human resources the world over. Managers and workers are required to work in different socio-economic environments which, at times, may not be similar to those of their home countries. It is imperative therefore for business organizations and individuals to acquire in depth knowledge about the culture and business ethics prevailing in the country of interest. A number of scholars have undertaken research studies to compare the standards of Business Ethics of different countries but such a research on “the Standards of Business Ethics” has been carried out for the first time in Pakistan. Interestingly, either such studies have been carried out in developed countries like Europe, America and Far East or the researchers have been from these countries. The conduct of such a study in Pakistan by a Pakistani would be the first of its nature.Some of the internationally accepted norms have been used as scenarios and respondents have been asked to indicate possibility of their reaction to take action. They have also been asked to give rationale of their decision. An effort has been made in this study, to compare the standards of business ethics of Pakistani business professionals with those of other countries of the world. This would help adjudge differences and similarities of well-established universal norms and ethics prevailing in the world business community. It is expected that this and more such studies would help researchers and business professionals develop good and desirable business practices in Pakistan.Comparing and enhancing awareness about standards of business ethics in Pakistan is the main objective of this research. It is expected that this humble effort would encourage many more researchers to dive deep into the ocean of business ethics.

Organization within Organization Studies

DEFF Research Database (Denmark)

Lopdrup-Hjorth, Thomas

This paper explores how prevalent contemporary problematizations of organizations coincide with a widespread assessment that Organization Studies (OS) has run out of steam. This impasse, the paper argues, is largely due to the emergence of an organization-phobia that has come to seize several...... strands of theorizing. By attending to the wide-ranging and far-reaching history of this organization-phobia, the paper argues that OS has become increasingly incapable of speaking about its core object. I show how organizations went from being conceptualized as entities of major importance to becoming...... credibility and legitimacy to begin with, the organization-phobia resulting from this history has been implicated in dismantling organizations, and in making OS progressively irrelevant to a wider public....

The Fighters of Lashkar-e-Taiba: Recruitment, Training, Deployment and Death

Science.gov (United States)

2013-04-01

false. First,  the vast  majority  of  LeT  fighters  are  Pakistani  and  most  are  Punjabi ,  not  Kashmiri.  It  is  noteworthy  that  there  is...this  database  died  in  Indian‐administered  Kashmir.  This  truth,  taken with  the  predominantly  Pakistani‐ Punjabi   origins  of  the  fighters...2002.    RESIDENCE AND RECRUITMENT    Scholars have  long  claimed  that LeT  is primarily  a  Punjabi   organization  and  that  its  membership  is

The association of marital relationship and perceived social support with mental health of women in Pakistan.

Science.gov (United States)

Qadir, Farah; Khalid, Amna; Haqqani, Sabahat; Zill-e-Huma; Medhin, Girmay

2013-12-09

Marital circumstances have been indicated to be a salient risk factor for disproportionately high prevalence of depression and anxiety among Pakistani women. Although social support is a known buffer of psychological distress, there is no clear evidence as to how different aspects of marital relations interact and associate with depression and anxiety in the lives of Pakistani married women and the role of social supports in the context of their marriage. Two hundred seventy seven married women were recruited from Rawalpindi district of Pakistan using a door knocking approach to psychometrically evaluate five scales for use in the Pakistani context. A confirmatory factor analysis approach was used to investigate the underlying factor structure of Couple satisfaction Index (CSI-4), Locke-Wallace Marital Adjustment Test (LWMAT), Relationship Dynamic Scale (RDS), Multidimensional Scale for Perceived Social Support (MSPSS) and the Hospital Anxiety and Depression Scale (HADS). The interplay of the constructs underlying the three aspects of marital relations, and the role of social support on the mental health of married Pakistani women were examined using the Structural Equation Model. The factor structures of MSPSS, CSI-4, LWMAT, RDS and HADS were similar to the findings reported in the developed and developing countries. Perceived higher social support reduces the likelihood of depression and anxiety by enhancing positive relationship as reflected by a low score on the relationship dynamics scale which decreases CMD symptoms. Moreover, perceived higher social support is positively associated with marital adjustment directly and indirectly through relationship dynamics which is associated with the reduced risk of depression through the increased level of reported marital satisfaction. Nuclear family structure, low level of education and higher socio-economic status were significantly associated with increased risk of mental illness among married women. Findings of this

The association of marital relationship and perceived social support with mental health of women in Pakistan

Science.gov (United States)

2013-01-01

Background Marital circumstances have been indicated to be a salient risk factor for disproportionately high prevalence of depression and anxiety among Pakistani women. Although social support is a known buffer of psychological distress, there is no clear evidence as to how different aspects of marital relations interact and associate with depression and anxiety in the lives of Pakistani married women and the role of social supports in the context of their marriage. Methods Two hundred seventy seven married women were recruited from Rawalpindi district of Pakistan using a door knocking approach to psychometrically evaluate five scales for use in the Pakistani context. A confirmatory factor analysis approach was used to investigate the underlying factor structure of Couple satisfaction Index (CSI-4), Locke-Wallace Marital Adjustment Test (LWMAT), Relationship Dynamic Scale (RDS), Multidimensional Scale for Perceived Social Support (MSPSS) and the Hospital Anxiety and Depression Scale (HADS). The interplay of the constructs underlying the three aspects of marital relations, and the role of social support on the mental health of married Pakistani women were examined using the Structural Equation Model. Results The factor structures of MSPSS, CSI-4, LWMAT, RDS and HADS were similar to the findings reported in the developed and developing countries. Perceived higher social support reduces the likelihood of depression and anxiety by enhancing positive relationship as reflected by a low score on the relationship dynamics scale which decreases CMD symptoms. Moreover, perceived higher social support is positively associated with marital adjustment directly and indirectly through relationship dynamics which is associated with the reduced risk of depression through the increased level of reported marital satisfaction. Nuclear family structure, low level of education and higher socio-economic status were significantly associated with increased risk of mental illness among

Human paraoxonase and HDL-cholesterol in pakistan patients with acute myocardial infarction and normal healthy adults

International Nuclear Information System (INIS)

Iqbal, I.P.; Khan, A.H.; Mehboobali, N.

2007-01-01

Human serum paraoxonase is a high density lipoprotein (HDL)-bound enzyme exhibiting antiatherogenic properties. The aim of this study was to investigate any relationship between serum paraoxonase activity and serum levels of HDL-cholesterol in Pakistani patients with acute myocardial infarction (AMI) compared to normal healthy subjects and to examine possible association between serum paraoxonase activity and AMI in Pakistani population. In a case-control study, serum paraoxonase activity and serum levels of HDL-cholesterol and LDL-cholesterol were monitored in 164 Pakistani patients with AMI and 106 normal healthy adults matched for gender, BMI and age within 10 years. Mean serum concentration of HDL-cholesterol and mean serum paraoxonase activity in AMI patients were not significantly different from the corresponding values in normal healthy subjects. Mean serum paraoxonase activity value was significantly lower in normal healthy subjects with low HDL-cholesterol (serum levels < 40mg/dl) compared to the value in those with normal levels of HDL-cholesterol (P=0.04). In AMI patients, paraoxonase activity was lower in subjects with low HDL-cholesterol compared to those with normal levels of HDL-cholesterol, however, the decrease was not statistically significant. Correlation analyses of the data revealed a moderate association of paraoxonase activity with HDL-cholesterol (Pearson's r= 0.225, P<0.01 for AMI patients and r=0.281, P<0.01 for normal healthy controls). Seventy three percent of normal healthy subjects and 65% of AMI patients in this study had low HDL-cholesterol. Low serum paraoxonase activity and high prevalence of low HDL-cholesterol in Pakistani population could be contributing to the high rates of coronary heart disease in this population. (author)

Both here and there: Diasporic youth in Denmark as agents of development: Based on two qualitative studies

Directory of Open Access Journals (Sweden)

Rashmi Singla

2011-03-01

Full Text Available This article investigates some psychological aspects of South Asian diasporic youth in Denmark with focus on the socioeconomic strategies based on two empirical studies. The first longitudinal study explored young adults’ economic strategies in relation to their country of origin. The original investigation was conducted in the mid-1990s. Within a theoretical framework combining positioning theory with life course perspective, in-depth interviews were conducted with young adults of Indian and Pakistani background (n=5. The second study focussed on second generation Pakistani descendants in Denmark and their remittance to Pakistan. The extent and nature of transnational activities among second generation Pakistani has been investigated within a theoretical framework of transnationalism and identity construction. The results indicate three emergent forms of socioeconomic strategies among South Asian youth in Denmark: 1 individual strategies involving professional, business related investment and direct remittances, 2 awareness of parents’ strategies, although few or no self-initiated strategies and 3 collective strategy through an organisation addressing their position as agents of development in the country of origin. There are considerable temporal as well as qualitative differences in these strategies as compared to the parental generation.

Survey of U.S. Organ Procurement Organizations Regarding Pediatric Organ Donor Management.

Science.gov (United States)

Ream, Robert S; Armbrecht, Eric S

2016-10-01

To describe the current practice of pediatric organ donor management in the United States for donors declared dead based upon neurologic criteria. The study directs particular attention to how pediatric donors are defined, the use of donor management guidelines, the use of donor management goals, and the involvement of pediatric critical care or transplantation expertise. Cross-sectional observational study using a web-based survey and follow-up telephone interview with respondents from U.S. organ procurement organizations. The study also incorporated organ procurement organization-specific data on organ yield for the 4-year period (2010-2013) preceding the study. The 58 U.S. organ procurement organizations. Respondents chosen by each organ procurement organization. None. All 58 U.S. organ procurement organizations participated in the study. Fifty-two respondents (90%) indicated that their organ procurement organization distinguished pediatric from adult donors resulting in 28 unique pediatric definitions. Thirty-nine organ procurement organizations utilized some form of written pediatric management guidelines, and 27 (47%) maintained pediatric donor management goals; compliance was infrequently monitored for both guidelines (28%) and goals (33%). A pediatric intensivist was always or usually involved in pediatric donor management at 47 organ procurement organizations (81%); transplant/organ recovery surgeons were always or usually involved at 12 organ procurement organizations (21%). There was an increase in the number of organs transplanted per donor among donors 11-17 years old for organ procurement organizations that used donor management goals for the duration of the period studied (p procurement organizations that always or usually consulted a transplant/organ recovery surgeon (p = 0.02) although this did not reach our threshold for statistical significance.. There is little consensus among organ procurement organizations regarding the definition of

Pakistan’s national Centre of Excellence contributes to sustaining nuclear security

International Nuclear Information System (INIS)

Dixit, Aabha

2016-01-01

Pakistani front line officers and first responders are in a better position to fight illicit trafficking in nuclear and other radioactive materials, as well as to use advanced radiation detection and monitoring equipment, thanks to training they have received at the country’s Centre of Excellence for Nuclear Security. This is just one of the benefits the country has reaped from the Centre, which is collaborating with the growing International Network for Nuclear Security Training and Support Centres (NSSC Network), building national capacity through training and strengthening technical and scientific support programmes. Since the establishment of the Centre of Excellence, Pakistan has organized training courses on nuclear security for personnel from national and regional organizations. The Centre of Excellence also offers technical support to personnel involved in the maintenance and upgrade of facilities, with a focus on enhancing technical and scientific skills and quality control of equipment.

Hierarchical organization versus self-organization

OpenAIRE

Busseniers, Evo

2014-01-01

In this paper we try to define the difference between hierarchical organization and self-organization. Organization is defined as a structure with a function. So we can define the difference between hierarchical organization and self-organization both on the structure as on the function. In the next two chapters these two definitions are given. For the structure we will use some existing definitions in graph theory, for the function we will use existing theory on (self-)organization. In the t...

Fermilab | About | Organization | Fermilab Organization

Science.gov (United States)

Industry Students and teachers Media Organization Fermilab Organization Organization Fermilab Org Chart Accelerator Division Accelerator Physics Center CMS Center Core Computing Division ESH&Q FESS Finance Section LBNF Project Line Organization LBNF Project Director LCLS-II

Ethnic variations in morbidity and mortality from lower respiratory tract infections: a retrospective cohort study.

Science.gov (United States)

Simpson, Colin R; Steiner, Markus Fc; Cezard, Genevieve; Bansal, Narinder; Fischbacher, Colin; Douglas, Anne; Bhopal, Raj; Sheikh, Aziz

2015-10-01

There is evidence of substantial ethnic variations in asthma morbidity and the risk of hospitalisation, but the picture in relation to lower respiratory tract infections is unclear. We carried out an observational study to identify ethnic group differences for lower respiratory tract infections. A retrospective, cohort study. Scotland. 4.65 million people on whom information was available from the 2001 census, followed from May 2001 to April 2010. Hospitalisations and deaths (any time following first hospitalisation) from lower respiratory tract infections, adjusted risk ratios and hazard ratios by ethnicity and sex were calculated. We multiplied ratios and confidence intervals by 100, so the reference Scottish White population's risk ratio and hazard ratio was 100. Among men, adjusted risk ratios for lower respiratory tract infection hospitalisation were lower in Other White British (80, 95% confidence interval 73-86) and Chinese (69, 95% confidence interval 56-84) populations and higher in Pakistani groups (152, 95% confidence interval 136-169). In women, results were mostly similar to those in men (e.g. Chinese 68, 95% confidence interval 56-82), although higher adjusted risk ratios were found among women of the Other South Asians group (145, 95% confidence interval 120-175). Survival (adjusted hazard ratio) following lower respiratory tract infection for Pakistani men (54, 95% confidence interval 39-74) and women (31, 95% confidence interval 18-53) was better than the reference population. Substantial differences in the rates of lower respiratory tract infections amongst different ethnic groups in Scotland were found. Pakistani men and women had particularly high rates of lower respiratory tract infection hospitalisation. The reasons behind the high rates of lower respiratory tract infection in the Pakistani community are now required. © The Royal Society of Medicine.

Potential social, economic and general health benefits of consanguineous marriage: results from the Born in Bradford cohort study.

Science.gov (United States)

Bhopal, Raj S; Petherick, Emily S; Wright, John; Small, Neil

2014-10-01

More than 1 billion people live in societies where consanguineous marriages are common. When children are born to consanguineous unions, there is an increased probability of the expression of single-gene disorders with a recessive mode of inheritance. There are presumptive social benefits of consanguineous marriages reported in the literature. The UK's Born in Bradford birth cohort study recruited 12 453 women at 26-28 weeks' gestation between 2007 and 2010. In all, 11 396 completed a questionnaire, including questions about their relationship to their baby's father. We compared Pakistani and Other ethnic groups in consanguineous relationships and Pakistani, Other and White British groups not in consanguineous relationships, calculating percentages and age-adjusted prevalence ratios (95% confidence intervals). In the Pakistani group, 59.3% of women (n = 3038) were blood relatives of their baby's father. Consanguinity was uncommon in the Other ethnic group (7.3%, n = 127) and rare (n = 5) in the White British group. Compared with non-consanguineous counterparts, mothers in consanguineous relationships were socially and economically disadvantaged (e.g. never employed, less likely to have higher education). The Pakistani consanguineous group's social, economic and health lifestyle circumstances were equivalent to, in some cases better than, women in non-consanguineous relationships (e.g. up-to-date in paying bills, or in disagreeing that they wished for more warmth in their marital relationship). The consanguineous relationship group had less separation/divorce. Rates of cigarette smoking during pregnancy were lower in mothers in consanguineous relationships. Debate about consanguinity should balance the potential protective effect of consanguineous relationships with established genetic risk of congenital anomaly in children. © The Author 2013. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

A SURVEY OF DEATH ADJUSTMENT IN THE INDIAN SUBCONTINENT.

Science.gov (United States)

Hossain, Mohammad Samir; Irfan, Muhammad; Balhara, Yatan Pal Singh; Giasuddin, Noor Ahmed; Sultana, Syeda Naheed

2015-01-01

The Death Adjustment Hypothesis (DAH) postulates two key themes. Its first part postulates that death should not be considered the end of existence and the second part emphasizes that the belief in immortal pattern of human existence can only be adopted in a morally rich life with the attitude towards morality and materialism balanced mutually. We wanted to explore Death Adjustment in the Indian subcontinent and the differences among, Indians, Pakistanis and Bangladeshis. We also wanted to find the relationship between death adjustment (i.e., adaptation to death), materialistic thoughts and death adjustment thoughts. This was a cross-sectional study, conducted from May 2010 to June 2013. Using a purposive sampling strategy, a sample of 296 participants from the Indian subcontinent [Pakistan (n=100), Bangladesh (n=98) and India (n=98)] was selected. Multidimensional Fear of Death Scale (MFODS) was used to measure death adjustment. The rest of the variables were measured using lists of respective thoughts, described in elaborated DAH. Analyses were carried out using SPSSv13. The mean death adjustment score for Pakistani, Indian and Bangaldeshi population were 115.26 +/- 26.4, 125.87 +/- 24.3 and 114.91 +/- 21.2, respectively. Death adjustment was better with older age (r=0.20) and with lower scores on materialistic thoughts (r = -0.26). However, this was a weak relation. The three nationalities were compared with each other by using Analysis of variance. Death adjustment thoughts and death adjustment were significantly different when Indians were compared with Bangladeshis (p=0.00) and Pakistanis (p=0.006) but comparison between Bangladeshis and Pakistanis showed no significant difference. Subjects with lesser materialistic thoughts showed better death adjustment. There are differences between Muslims and non-Muslims in adjusting to death.

Quarterly Report to the New Energy and Industrial Technology Development Organization, Washington, D.C., by Analysis Review and Critique, dated March 23, 1992

Energy Technology Data Exchange (ETDEWEB)

NONE

1992-03-23

U.S. Government assistance on renewable energy for lesser developed countries and Bush Administration's 1993 budget for renewable energy are reported. The latest renewable energy assistance for less developed countries was for Pakistan, India, Egypt, Morocco, and the Philippines. Facilities in Egypt and Morocco were closed, and the Pakistani facility turned an independent power station not for renewable energy. In 1992, assistance is extended to Costa Rica, Indonesia, and India. Assistance to Mexico is on the increase. The Bush Administration request for fiscal 1993 for renewable energy was only 1.6 percent higher than the funding Congress approved for fiscal 1992. When inflation is taken into account, it means that the real budget expenditure will shrink a few percent. This indicates that the Department of Energy changed its policy several years ago and is now requesting less than what Congress may approve. (NEDO)

Mobius on optimistlikum / Romet Kreek

Index Scriptorium Estoniae

Kreek, Romet, 1972-

2010-01-01

Templeton Asset Managementi Investeerimisguru Mark Mobiuse arvamus maailma majandusarengust. Templeton Asset Management ostab Pakistani ettevõtete aktsiaid, mis on üle maailma sel kuul halvim aktsiaturg

Factors other than hepatitis B virus responsible for hepatocellular carcinomas in lower social class

International Nuclear Information System (INIS)

Pervez, T.; Anwar, M.S.

2002-01-01

Objective: To find out the role of other etiological agents besides hepatitis B virus in the genesis of Hepatocellular carcinoma (HCC) in our social classes. Design: A hospital-based observational study. Place and Duration of Study: The study was conducted in oncology department of services Hospital, Lahore from December 1997 to February 2001. Patients and Methods: One hundred patients of hepatocellular carcinoma ware divided into three groups based on monthly income. Lower socioeconomic group had monthly income less than 3,000 Pakistani rupees. Middle socioeconomic group had monthly income between 3,000-1,000 Pakistani rupees and upper socioeconomic group heard monthly income of more than 10,000 Pakistani rupees. Percentages of HCC patients positive for HbsAg in different socioeconomic groups in our population were compared to assess the social class difference, the possibility and correlation of other factors present in our classes for the formation of hepatocellular carcinoma besides hepatitis B virus. Results: We found that there was no significant difference in HbsAg positively in different classes. Conclusion: If HBV was only responsible for this disease than there should have been consistency in the outcome. But as there is a higher prevalence of HCC in poor class, this reflects that other etiological agents are also operating. This needs further evaluation. (author)

Polymorphisms in methylenetetrahydrofolate reductase gene are not associated with acute myocardial infarction in a Pakistan population

International Nuclear Information System (INIS)

Iqbal, M.P.; Parveen, S.M.S.; Haider, G.

2011-01-01

The objective of the study was to test the association of two polymorphisms of methylenetetrahydrofolate reductase gene, MTHFR C677T; MTHFR AI298C with acute myocardial infarction (AMI). A case-control study involving 308 AMI patients (age 30-74 years; 230 males and 78 females) and 319 age and gender matched normal healthy controls (235 males and 84 females) was carried out on a Pakistani population. Genotyping of the two polymorphisms was done using PCR-RFLP based assays. Fasting levels of plasma homocysteine and other biochemical parameters were determined using kit methods. Plasma homocysteine concentrations were found to be elevated in both cases and controls (18.1 +- 7.7 micro mol/l vs 18.1+- 8.1 micro mol/l, respectively). Compared to Caucasian populations, homozygous variant genotype MTHFR Al 298 C was found to be highly prevalent (27%) in Pakistani population. Neither MTHFR C677T nor MTHFR Al 298 C polymorphism was found to be associated with myocardial infarction (MI). Age-at-onset of MI was significantly affected by MTHFR C677T (TT=39 years vs CT/CC= 49 years; P=0.006). MTHFR polymorphisms appear to have no role in AMI in Pakistani population. (author)

Maternal and newborn outcomes in Pakistan compared to other low and middle income countries in the Global Network's Maternal Newborn Health Registry: an active, community-based, pregnancy surveillance mechanism.

Science.gov (United States)

Pasha, Omrana; Saleem, Sarah; Ali, Sumera; Goudar, Shivaprasad S; Garces, Ana; Esamai, Fabian; Patel, Archana; Chomba, Elwyn; Althabe, Fernando; Moore, Janet L; Harrison, Margo; Berrueta, Mabel B; Hambidge, K; Krebs, Nancy F; Hibberd, Patricia L; Carlo, Waldemar A; Kodkany, Bhala; Derman, Richard J; Liechty, Edward A; Koso-Thomas, Marion; McClure, Elizabeth M; Goldenberg, Robert L

2015-01-01

Despite global improvements in maternal and newborn health (MNH), maternal, fetal and newborn mortality rates in Pakistan remain stagnant. Using data from the Global Network's Maternal Newborn Health Registry (MNHR) the objective of this study is to compare the rates of maternal mortality, stillbirth and newborn mortality and levels of putative risk factors between the Pakistani site and those in other countries. Using data collected through a multi-site, prospective, ongoing, active surveillance system to track pregnancies and births in communities in discrete geographical areas in seven sites across six countries including Pakistan, India, Kenya, Zambia, Guatemala and Argentina from 2010 to 2013, the study compared MNH outcomes and risk factors. The MNHR captures more than 60,000 deliveries annually across all sites with over 10,000 of them in Thatta, Pakistan. The Pakistan site had a maternal mortality ratio almost three times that of the other sites (313/100,000 vs 116/100,000). Stillbirth (56.5 vs 22.9/1000 births), neonatal mortality (50.0 vs 20.7/1000 livebirths) and perinatal mortality rates (95.2/1000 vs 39.0/1000 births) in Thatta, Pakistan were more than twice those of the other sites. The Pakistani site is the only one in the Global Network where maternal mortality increased (from 231/100,000 to 353/100,000) over the study period and fetal and neonatal outcomes remained stagnant. The Pakistan site lags behind other sites in maternal education, high parity, and appropriate antenatal and postnatal care. However, facility delivery and skilled birth attendance rates were less prominently different between the Pakistani site and other sites, with the exception of India. The difference in the fetal and neonatal outcomes between the Pakistani site and the other sites was most pronounced amongst normal birth weight babies. The increase in maternal mortality and the stagnation of fetal and neonatal outcomes from 2010 to 2013 indicates that current levels of

Promiscuous prediction and conservancy analysis of CTL binding epitopes of HCV 3a viral proteome from Punjab Pakistan: an In Silico Approach

Directory of Open Access Journals (Sweden)

Idrees Muhammad

2011-02-01

Full Text Available Abstract Background HCV is a positive sense RNA virus affecting approximately 180 million people world wide and about 10 million Pakistani populations. HCV genotype 3a is the major cause of infection in Pakistani population. One of the major problems of HCV infection especially in the developing countries that limits the limits the antiviral therapy is the long term treatment, high dosage and side effects. Studies of antigenic epitopes of viral sequences of a specific origin can provide an effective way to overcome the mutation rate and to determine the promiscuous binders to be used for epitope based subunit vaccine design. An in silico approach was applied for the analysis of entire HCV proteome of Pakistani origin, aimed to identify the viral epitopes and their conservancy in HCV genotypes 1, 2 and 3 of diverse origin. Results Immunoinformatic tools were applied for the predictive analysis of HCV 3a antigenic epitopes of Pakistani origin. All the predicted epitopes were then subjected for their conservancy analysis in HCV genotypes 1, 2 and 3 of diverse origin (worldwide. Using freely available web servers, 150 MHC II epitopes were predicted as promiscuous binders against 51 subjected alleles. E2 protein represented the 20% of all the predicted MHC II epitopes. 75.33% of the predicted MHC II epitopes were (77-100% conserve in genotype 3; 47.33% and 40.66% in genotype 1 and 2 respectively. 69 MHC I epitopes were predicted as promiscuous binders against 47 subjected alleles. NS4b represented 26% of all the MHC I predicted epitopes. Significantly higher epitope conservancy was represented by genotype 3 i.e. 78.26% and 21.05% for genotype 1 and 2. Conclusions The study revealed comprehensive catalogue of potential HCV derived CTL epitopes from viral proteome of Pakistan origin. A considerable number of predicted epitopes were found to be conserved in different HCV genotype. However, the number of conserved epitopes in HCV genotype 3 was

Ordered organic-organic multilayer growth

Science.gov (United States)

Forrest, Stephen R; Lunt, Richard R

2015-01-13

An ordered multilayer crystalline organic thin film structure is formed by depositing at least two layers of thin film crystalline organic materials successively wherein the at least two thin film layers are selected to have their surface energies within .+-.50% of each other, and preferably within .+-.15% of each other, whereby every thin film layer within the multilayer crystalline organic thin film structure exhibit a quasi-epitaxial relationship with the adjacent crystalline organic thin film.

Variation in Pediatric Organ Donor Management Practices Among US Organ Procurement Organizations.

Science.gov (United States)

Ream, Robert S; Armbrecht, Eric S

2018-03-01

Reports of actual pediatric organ donor management practice among US organ procurement organizations are sparse, and the use of standardized management guidelines is unknown. A recent consensus statement from the Society of Critical Care Medicine, the American College of Chest Physicians, and the Association of Organ Procurement Organizations offers guidelines for the management of the pediatric organ donor. To describe the use of guidelines and routine practices in the management of the pediatric organ donor with respect to hemodynamics, lung and ventilator management, fluid and electrolytes, hormonal replacement therapy, the use of blood products, thermoregulation, and prophylactic antibiotics. Cross-sectional observational study using a survey and follow-up telephone interview with respondents from all 58 US organ procurement organizations. All 58 US Organ Procurement Organizations participated. A majority employed written guidelines for the management of pediatric donor hemodynamics, thermoregulation, fluids, and electrolytes. Management of blood products, the lung, and mechanical ventilation were less commonly committed to written guidelines, but common practices were described. All used various forms of hormonal replacement therapy and the majority administered empiric antibiotic therapy. Wide variation was observed in the management of the lung, mechanical ventilation, and glycemic control. Most OPOs used forms of standardized donor management for the pediatric organ donor although variation in the content of that management exists. Barriers to an evidence-based approach to the pediatric donor need to be determined and addressed.

The organization of organ procurement.

Science.gov (United States)

Prottas, J M

1989-01-01

The American organ procurement system has improved and matured in the last five years. At the same time, the basic challenges facing it have remained substantially the same because the moral and legal framework of the system has not changed. Success at organ procurement continues to depend on the voluntary cooperation of medical professionals and the families of potential organ donors. The generosity of the American public is so great that the primary challenge facing organ procurement agencies is obtaining cooperation from hospitals and medical professionals. This calls for a "marketing" orientation aimed at those hospitals and professionals who are most likely to treat potential donors. The last five years have seen a more general acceptance of this appreciation of the central task of organ procurement. As a result, the overall effectiveness of the system has improved, as measured by the number of organs procured on a per capita basis and by the number of multiorgan donors obtained. Much of this improvement can be attributed to the diffusion of organizational techniques and approaches, and this diffusion has been encouraged by the involvement of national organizations and public bodies in the organ procurement community. The system remains uneven in its effectiveness and further improvement is possible. It is also possible that the next general round of improvement will result from the application of businesslike information management and marketing techniques.

Herbert Ernst Wiegand

African Journals Online (AJOL)

R.B. Ruthven

lexicography (17564), Pakistani lexicography (9865), Mexican (12043) and Chil- .... the African Association for Lexicography (AFRILEX). Aspects of .... mended that every library and especially university libraries, should have a copy.

[Pakistan: emigration in the Gulf and its effects on the home economy].

Science.gov (United States)

Imdad, N

1985-01-01

Pakistani emigration since the early 1970s has been primarily directed toward the oil-rich Gulf states. Over 2 million Pakistanis, 10% of the adult male workforce, now live outside their home country, 3/4 of them in the Gulf states. The emigration has shortterm advantages for Pakistan, which has a high unemployment rate and few other exports. 2 government bureaus and over 300 recruiting agencies encourage Pakistani emigration to the Gulf, and because of the foreign exchange earnings generated, such emigration has become an important concern of the government. Emigration has a long history in Pakistan as part of the migratory movements of the Indian subcontinent in general. Emigration in the 1960s was prompted by mechanization of agriculture and disturbances of traditional agrarian labor arrangements brought on by the Green Revolution. Concentrations of lands among the successful middle-sized producers led to a rural proletariat and exodus towards the cities, where possibilities of employment were scarce. Regions of declining income around the new capital of Islamabad were the 1st to take advantage of new employment opportunities in the Gulf states. Pakistani migration to the Gulf countries is temporary for individual workers, who stay an average of 3-6 years, but the effect is of chain migration as returning workers are replaced by other family members. Workers are not accompanied by family members and have almost no contact with the local Arab populations. They send most of their earnings to their families in Pakistan. 3/4 are under 30 years old, most are of rural origin, and the majority are from the northern provinces. Although 70% are married, only 4% of migrants, the most highly qualified, are accompanied by their families. About 41% are unskilled workers and 42.6% are semiskilled or skilled manual workers. In 1981, the average annual salary repatriated by a Pakistani working in the Gulf was $3000. The Pakistani government has not defined a migration policy

Quarterly Report to the New Energy and Industrial Technology Development Organization, Washington, D.C., by Analysis Review and Critique, dated March 23, 1992

Energy Technology Data Exchange (ETDEWEB)

NONE

1992-03-23

U.S. Government assistance on renewable energy for lesser developed countries and Bush Administration's 1993 budget for renewable energy are reported. The latest renewable energy assistance for less developed countries was for Pakistan, India, Egypt, Morocco, and the Philippines. Facilities in Egypt and Morocco were closed, and the Pakistani facility turned an independent power station not for renewable energy. In 1992, assistance is extended to Costa Rica, Indonesia, and India. Assistance to Mexico is on the increase. The Bush Administration request for fiscal 1993 for renewable energy was only 1.6 percent higher than the funding Congress approved for fiscal 1992. When inflation is taken into account, it means that the real budget expenditure will shrink a few percent. This indicates that the Department of Energy changed its policy several years ago and is now requesting less than what Congress may approve. (NEDO)

Body Image of Pakistani Consumers.

OpenAIRE

Tariq Jalees; Ernest C de Run

2014-01-01

This paper examines how media exposure, self-esteem, and religiosity influence body image of Pakistan consumers. The underpinning of this study is based on Social Comparison Theory with two additional variables (religiosity and self-esteem) for understanding understand consumer attitude towards body image. A self-administered questionnaire was used. 193 persons responded at mall intercepts. The Conceptual framework was empirically tested through SEM. A positive relationship between exposure t...

Organ procurement organizations Internet enrollment for organ donation: Abandoning informed consent

Directory of Open Access Journals (Sweden)

Verheijde Joseph L

2006-12-01

Full Text Available Abstract Background Requirements for organ donation after cardiac or imminent death have been introduced to address the transplantable organs shortage in the United States. Organ procurement organizations (OPOs increasingly use the Internet for organ donation consent. Methods An analysis of OPO Web sites available to the public for enrollment and consent for organ donation. The Web sites and consent forms were examined for the minimal information recommended by the United States Department of Health and Human Services for informed consent. Content scores were calculated as percentages of data elements in four information categories: donor knowledge, donor consent reinforcement, donation promotion, and informed consent. Results There were 60 Web sites for organ donation enrollment serving the 52 states. The median percent (10 percentile-90 percentile content scores of the Web sites for donor knowledge, donor consent reinforcement, and donation promotion were 33% (20–47, 79% (57–86, and 75% (50–100, respectively. The informed consent score was 0% (0–33. The content scores for donor knowledge and informed consent were significantly lower than donor consent reinforcement and donation promotion for all Web sites (P Conclusion The Web sites and consent forms for public enrollment in organ donation do not fulfill the necessary requirements for informed consent. The Web sites predominantly provide positive reinforcement and promotional information rather than the transparent disclosure of organ donation process. Independent regulatory oversight is essential to ensure that Internet enrollment for organ donation complies with legal and ethical standards for informed consent.

U.S. Pacific Command > Organization > Organization Chart

Science.gov (United States)

Responsibility USPACOM Previous Commanders Organization Organization Chart Media News Flickr Photos Video Directory Media Inquiries Home : Organization : Organization Chart About DoD DoD Careers Join the Military

Pakistan needs social change: Can women in physics play a role?

Science.gov (United States)

Hasnain, Aziz Fatima; Islam, Jabeen

2013-03-01

This country report briefly describes the social structure of Pakistan based on socioeconomic indicators and the current status of education along with the opportunities available to girls at the state level. To flourish as a prosperous nation, Pakistani society needs a change in its social setup, where women are given equal rights and status, society has respect for every belief and religion, and there is no economic disparity between the genders. If the women in science and technology, especially the women physicists, are motivated to join international forums like IUPAP and given opportunities for research to develop their career and participate in the economy of the country, we hope that these women will help bring positive change, benefiting Pakistani society.

Outcome of referrals for deceased organ donation to the government organ procurement organization.

Science.gov (United States)

Suguitan, G A; Cabanayan-Casasola, C B; Danguilan, R A; Jaro, J M A

2014-05-01

The Human Organ Preservation Effort is a government organ procurement organization that pioneered the Deceased Organ Donation Program in the Philippines. Deceased organ donation comprises only 20% of kidney transplantation in the Philippines in the last 3 years. Various measures were implemented to improve deceased organ donor referrals and organ retrieval. To compare outcome of deceased organ donor referrals from 2002 to 2008 and 2009 to 2012 in the Philippines. This retrospective study reviewed the deceased organ donor referrals from 2002 to 2008 and 2009 to 2012. There were 437 referrals for potential deceased organ donors from 2009 to 2012, compared to 434 referrals from 2002 to 2008. Referrals were mainly trauma victims (76%) followed by those with cerebrovascular accidents (12%). In the recent cohort, 81% were approached and 60% consented for donation, but only 23% were retrieved and transplanted. Among those not retrieved, the majority (19%) were medically unsuitable and 6% retracted their consent. Although there was an increasing trend of organ donation referrals in the last 4 years, only 25% were procured. The reasons for nonprocurement should be addressed. Copyright © 2014 Elsevier Inc. All rights reserved.

Hamas may evolve as peace champion like Sharon-Musharraf

CERN Multimedia

2006-01-01

"Radical palestinian movement Hamas may follow a political evolution like Israel's premier Ariel Sharon and become champion for peace in the Middle East, pakistani President Pervez Musharraf said" (1/2 page)

South Asia and the Nuclear Future: Rethinking the Causes and Consequences of Nuclear Proliferation

National Research Council Canada - National Science Library

Sechser, Todd S

2004-01-01

... theft, and stop the further spread of nuclear weapons. Analyses of Indian and Pakistani nuclear behavior must consider the domestic political motivations of key decisionmakers and not just national security interests...

U.S. Provides Support During Pakistan Flooding

Science.gov (United States)

U.S. Relief Continues in Pakistan U.S. Helicopters, Cargo Planes Continue Aid U.S., Pakistani Forces History Frequently Asked Questions Available jobs with DOD Top Issues Targeted Operations Against ISIL

USA-s tõsteti terroriohtu kolm aastat vana info peale

Index Scriptorium Estoniae

2004-01-01

Al-Qaida arvutieksperdilt Muhammad Naeem Noor Khaanilt, kes tabati Pakistanis, saadi kätte mitmeid dokumente, luureinfot ja skeeme. Enamik infot oli kogutud enne 11. septembril 2001. aastal toimunud terrorirünnakuid

Emergency department referral for organ donation: more organ donors and more organs per donor.

Science.gov (United States)

Miller, Lisabeth D; Gardiner, Stuart K; Gubler, K Dean

2014-05-01

This study sought to determine whether early referral from the emergency department (ED) would increase the number of organ donors and the number of organs transplanted per donor (OTPD). This is a retrospective cohort analysis of all patients referred to a single organ procurement organization for a period of 60 months. Patients referred for organ donation evaluation from the ED were more likely to become organ donors than patients referred from the intensive care unit (19.3% vs 5.2%, P organ donation from the ED is associated with an increased likelihood of organ recovery and with an increased number of OTPD. Copyright © 2014 Elsevier Inc. All rights reserved.

The use of the FACT-H&N (v4) in clinical settings within a developing country: a mixed method study.

Science.gov (United States)

Bilal, Sobia; Doss, Jennifer Geraldine; Rogers, Simon N

2014-12-01

In the last decade there has been an increasing awareness about 'quality of life' (QOL) of cancer survivors in developing countries. The study aimed to cross-culturally adapt and validate the FACT-H&N (v4) in Urdu language for Pakistani head and neck cancer patients. In this study the 'same language adaptation method' was used. Cognitive debriefing through in-depth interviews of 25 patients to assess semantic, operational and conceptual equivalence was done. The validation phase included 50 patients to evaluate the psychometric properties. The translated FACT-H&N was easily comprehended (100%). Cronbach's alpha for FACT-G subscales ranged from 0.726 - 0.969. The head and neck subscale and Pakistani questions subscale showed low internal consistency (0.426 and 0.541 respectively). Instrument demonstrated known-group validity in differentiating patients of different clinical stages, treatment status and tumor sites (p 0.75) and showed convergent validity (r > 0.90), with little discriminant validity. Factor analysis revealed 6 factors explaining 85.1% of the total variance with very good (>0.8) Kaiser-Meyer-Olkin and highly significant Bartlett's Test of Sphericity (p < 0.001). The cross-culturally adapted FACT-H&N into Urdu language showed adequate reliability and validity to be incorporated in Pakistani clinical settings for head and neck cancer patients. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Global genetic variation in the Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae) and the endosymbiont Wolbachia: links between Iran and the USA detected.

Science.gov (United States)

Lashkari, Mohammadreza; Manzari, Shahab; Sahragard, Ahad; Malagnini, Valeria; Boykin, Laura M; Hosseini, Reza

2014-07-01

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is one of the most serious pests of citrus in the world, because it transmits the pathogen that causes citrus greening disease. To determine genetic variation among geographic populations of D. citri, microsatellite markers, mitochondrial gene cytochrome oxidase I (mtCOI) and the Wolbachia-Diaphorina, wDi, gene wsp sequence data were used to characterize Iranian and Pakistani populations. Also, a Bayesian phylogenetic technique was utilized to elucidate the relationships among the sequences data in this study and all mtCOI and wsp sequence data available in GenBank and the Wolbachia database. Microsatellite markers revealed significant genetic differentiation among Iranian populations, as well as between Iranian and Pakistani populations (FST  = 0.0428, p citri populations in Iran, India, Saudi Arabia, Brazil, Mexico, Florida and Texas (USA) are similar. Wolbachia, wDi, wsp sequences were similar among Iranian populations, but different between Iranian and Pakistani populations. The South West Asia (SWA) group is the most likely source of the introduced Iranian populations of D. citri. This assertion is also supported by the sequence similarity of the Wolbachia, wDi, strains from the Florida, USA and Iranian D. citri. These results should be considered when looking for biological controls in either country. © 2013 Society of Chemical Industry.

Adsorption and desorption characteristic of benzimidazole based fungicide carbendazim in pakistani soils

International Nuclear Information System (INIS)

Ahmad, K.S.; Rashid, N.; Tazaiyen, S.; Nazar, M.F.

2013-01-01

A versatile cost-effective Benzimidazole based fungicide, Carbendazim (methyl 1H-benzimidazole-2 carboxylate ) has been utilized to investigate its sorption-desorption behaviour on physicochemical properties of geographical soils, ranging from hilly to desert areas of Pakistan, via batch equilibrium method. The data obtained in all tests showed that adsorption co-efficient isotherm for Carbendazim in four tested soil were well fitted the freundlich equation. Distribution co-efficient (K d ) parameters are low (3.59 to 11.60 ml micro g/sup -1/) indicating low adsorption. It was observed that Carbendazim showed a relatively greater degree of adsorption on soil samples (Soil 4) that were collected from northern hilly areas Ayubia, Khyber Pakhton khaw (KPK) (Silt loam) i.e.11.60 ml mu g/sup -1/ and least adsorption on sandy Soil of Multan Punjab(Soil 2). While other two soils 1 were collected from Murree region, a boarder of Punjab and KPK mountain area and Soil 3 from Tarnol, Islamabad. Desorption studies reveal that the adsorbed fungicide is firmly retained by soil particles and their adsorption are almost irreversible. The results indicate that soil organic matter (SOM) and appropriate pH also play key role in sorption capacity. (author)

Osama bin Laden - elus või siiski ammu surnud? / Aadu Hiietamm

Index Scriptorium Estoniae

Hiietamm, Aadu, 1954-

2009-01-01

USA on terrorivõrgustiku al Qaeda juhti Osama bin Ladenit jahitud juba kaheksa aastat, kuid tulemusteta. Vandenõuteoreetikute arvates on ta ammu surnud, kuid USA Luure Keskagentuuri juhi arvates varjab ta end Pakistanis

Gender and Behaviour - Vol 7, No 2 (2009)

African Journals Online (AJOL)

Gender and Human Security: Reflection on the Vulnerability of women to ... in Italian Major Symphony Orchestra: Analysis of Women Careers on Podium ... of Women in Pakistani Magazines: Do Magazines Stereotype Women as Model?

Cooperative Monitoring Center Occasional Paper/11: Cooperative Environmental Monitoring in the Coastal Regions of India and Pakistan

Energy Technology Data Exchange (ETDEWEB)

Rajen, Gauray

1999-06-01

The cessation of hostilities between India and Pakistan is an immediate need and of global concern, as these countries have tested nuclear devices, and have the capability to deploy nuclear weapons and long-range ballistic missiles. Cooperative monitoring projects among neighboring countries in South Asia could build regional confidence, and, through gradual improvements in relations, reduce the threat of war and the proliferation of weapons of mass destruction. This paper discusses monitoring the trans-border movement of flow and sediment in the Indian and Pakistani coastal areas. Through such a project, India and Pakistan could initiate greater cooperation, and engender movement towards the resolution of the Sir Creek territorial dispute in their coastal region. The Joint Working Groups dialogue being conducted by India and Pakistan provides a mechanism for promoting such a project. The proposed project also falls within a regional framework of cooperation agreed to by several South Asian countries. This framework has been codified in the South Asian Seas Action Plan, developed by Bangladesh, India, Maldives, Pakistan and Sri Lanka. This framework provides a useful starting point for Indian and Pakistani cooperative monitoring in their trans-border coastal area. The project discussed in this paper involves computer modeling, the placement of in situ sensors for remote data acquisition, and the development of joint reports. Preliminary computer modeling studies are presented in the paper. These results illustrate the cross-flow connections between Indian and Pakistani coastal regions and strengthen the argument for cooperation. Technologies and actions similar to those suggested for the coastal project are likely to be applied in future arms control and treaty verification agreements. The project, therefore, serves as a demonstration of cooperative monitoring technologies. The project will also increase people-to-people contacts among Indian and Pakistani policy

Myocardial infarction incidence and survival by ethnic group: Scottish Health and Ethnicity Linkage retrospective cohort study.

Science.gov (United States)

Bansal, Narinder; Fischbacher, Colin M; Bhopal, Raj S; Brown, Helen; Steiner, Markus Fc; Capewell, Simon

2013-09-13

Inequalities in coronary heart disease mortality by country of birth are large and poorly understood. However, these data misclassify UK-born minority ethnic groups and provide little detail on whether excess risk is due to increased incidence, poorer survival or both. Retrospective cohort study. General resident population of Scotland. All those residing in Scotland during the 2001 Census were eligible for inclusion: 2 972 120 people were included in the analysis. The number still residing in Scotland at the end of the study in 2008 is not known. As specified in the analysis plan, the primary outcome measures were first occurrence of admission or death due to myocardial infarction and time to event. There were no secondary outcome measures. Acute myocardial infarction (AMI) incidence risk ratios (95% CIs) relative to white Scottish populations (100) were highest among Pakistani men (164.1 (142.2 to 189.2)) and women (153.7 (120.5, 196.1)) and lowest for men and women of Chinese (39.5 (27.1 to 57.6) and 59.1 (38.6 to 90.7)), other white British (77 (74.2 to 79.8) and 72.2 (69.0 to 75.5)) and other white (83.1 (75.9 to 91.0) and 79.9 (71.5 to 89.3)) ethnic groups. Adjustment for educational qualification did not eliminate these differences. Cardiac intervention uptake was similar across most ethnic groups. Compared to white Scottish, 28-day survival did not differ by ethnicity, except in Pakistanis where it was better, particularly in women (0.44 (0.25 to 0.78)), a difference not removed by adjustment for education, travel time to hospital or cardiac intervention uptake. Pakistanis have the highest incidence of AMI in Scotland, a country renowned for internationally high cardiovascular disease rates. In contrast, survival is similar or better in minority ethnic groups. Clinical care and policy should focus on reducing incidence among Pakistanis through more aggressive prevention.

Does the ‘Scottish effect’ apply to all ethnic groups? All-cancer, lung, colorectal, breast and prostate cancer in the Scottish Health and Ethnicity Linkage Cohort Study

Science.gov (United States)

Bhopal, Raj S; Bansal, Narinder; Steiner, Markus; Brewster, David H

2012-01-01

Background and objectives Although ethnic group variations in cancer exist, no multiethnic, population-based, longitudinal studies are available in Europe. Our objectives were to examine ethnic variation in all-cancer, and lung, colorectal, breast and prostate cancers. Design, setting, population, measures and analysis This retrospective cohort study of 4.65 million people linked the 2001 Scottish Census (providing ethnic group) to cancer databases. With the White Scottish population as reference (value 100), directly age standardised rates and ratios (DASR and DASRR), and risk ratios, by sex and ethnic group with 95% CI were calculated for first cancers. In the results below, 95% CI around the DASRR excludes 100. Eight indicators of socio-economic position were assessed as potential confounders across all groups. Results For all cancers the White Scottish population (100) had the highest DASRRs, Indians the lowest (men 45.9 and women 41.2) and White British (men 87.6 and women 87.3) and other groups were intermediate (eg, Chinese men 57.6). For lung cancer the DASRRs for Pakistani men (45.0), and women (53.5), were low and for any mixed background men high (174.5). For colorectal cancer the DASRRs were lowest in Pakistanis (men 32.9 and women 68.9), White British (men 82.4 and women 83.7), other White (men 77.2 and women 74.9) and Chinese men (42.6). Breast cancer in women was low in Pakistanis (62.2), Chinese (63.0) and White Irish (84.0). Prostate cancer was lowest in Pakistanis (38.7), Indian (62.6) and White Irish (85.4). No socio-economic indicator was a valid confounding variable across ethnic groups. Conclusions The ‘Scottish effect’ does not apply across ethnic groups for cancer. The findings have implications for clinical care, prevention and screening, for example, responding appropriately to the known low uptake among South Asian populations of bowel screening might benefit from modelling of cost-effectiveness of screening, given comparatively low

Does the 'Scottish effect' apply to all ethnic groups? All-cancer, lung, colorectal, breast and prostate cancer in the Scottish Health and Ethnicity Linkage Cohort Study.

Science.gov (United States)

Bhopal, Raj S; Bansal, Narinder; Steiner, Markus; Brewster, David H

2012-01-01

Although ethnic group variations in cancer exist, no multiethnic, population-based, longitudinal studies are available in Europe. Our objectives were to examine ethnic variation in all-cancer, and lung, colorectal, breast and prostate cancers. DESIGN, SETTING, POPULATION, MEASURES AND ANALYSIS: This retrospective cohort study of 4.65 million people linked the 2001 Scottish Census (providing ethnic group) to cancer databases. With the White Scottish population as reference (value 100), directly age standardised rates and ratios (DASR and DASRR), and risk ratios, by sex and ethnic group with 95% CI were calculated for first cancers. In the results below, 95% CI around the DASRR excludes 100. Eight indicators of socio-economic position were assessed as potential confounders across all groups. For all cancers the White Scottish population (100) had the highest DASRRs, Indians the lowest (men 45.9 and women 41.2) and White British (men 87.6 and women 87.3) and other groups were intermediate (eg, Chinese men 57.6). For lung cancer the DASRRs for Pakistani men (45.0), and women (53.5), were low and for any mixed background men high (174.5). For colorectal cancer the DASRRs were lowest in Pakistanis (men 32.9 and women 68.9), White British (men 82.4 and women 83.7), other White (men 77.2 and women 74.9) and Chinese men (42.6). Breast cancer in women was low in Pakistanis (62.2), Chinese (63.0) and White Irish (84.0). Prostate cancer was lowest in Pakistanis (38.7), Indian (62.6) and White Irish (85.4). No socio-economic indicator was a valid confounding variable across ethnic groups. The 'Scottish effect' does not apply across ethnic groups for cancer. The findings have implications for clinical care, prevention and screening, for example, responding appropriately to the known low uptake among South Asian populations of bowel screening might benefit from modelling of cost-effectiveness of screening, given comparatively low cancer rates.

Innovative Mechanism of Rural Organization Based on Self-Organization

Institute of Scientific and Technical Information of China (English)

2011-01-01

The paper analyzes the basic situation of the formation of innovative rural organizations with the form of self-organization;reveals the features of self-organization,including the four aspects of openness of rural organization,innovation of rural organization far away from equilibrium,the non-linear response mechanism of rural organization innovation and the random rise and fall of rural organization innovation.The evolution mechanism of rural organization innovation is revealed according to the growth stage,the ideal stage,the decline and the fall stage.The paper probes into the basic restriction mechanism of the self-organization evaluation of rural organization from three aspects,including target recognition,path dependence and knowledge sharing.The basic measures on cultivating the innovative mechanism of rural organization are put forward.Firstly,constructing the dissipative structure of rural organization innovation;secondly,cultivating the dynamic study capability of rural organization innovation system;thirdly,selecting the step-by-step evolution strategy of rural organization innovation system.

Analysis of genetic diversity in chickpea ( Cicer arietinum L ...

African Journals Online (AJOL)

Genetic diversity of seven chickpea (Cicer arietinum L.) cultivars of Pakistani origin ... effective method to determine the variations among the chickpea cultivars. ... to broaden the germplasm base in the future for chickpea breeding programs.

African Journal of Biotechnology - Vol 12, No 11 (2013)

African Journals Online (AJOL)

Induction, development and regulation of trimolters: Great progress in the ... Molecular characterization, cloning and sequencing of coat protein gene of a Pakistani ... Effects of hydropriming on seed germination and seedling growth in sage ...

Pakistan andis Osama bin Ladeni jahtimisel alla / Heiki Suurkask

Index Scriptorium Estoniae

Suurkask, Heiki, 1972-

2004-01-01

Pakistani president Pervez Musharrafi sõnul on Osama bin Ladeni otsingud Lõuna-Waziristanis tulemusteta. Edaspidi keskendutakse otsingutel Põhja-Waziristani, oletatakse, et bin Laden võib olla ka Tora Bora koobastikus. Lisa: USA hambutu luureteenistus

Organic waste treatment with organically modified clays

International Nuclear Information System (INIS)

Evans, J.C.; Pancoski, S.E.; Alther, G.

1989-01-01

The use of organically modified clays in hazardous waste management applications offers a significant new and untapped potential. These clays may be used in the stabilization of organic wastes and organically contaminated soils, for waste water treatment, for oil spill control, for liner systems beneath fuel oil storage tanks, and as a component within liner systems of hazardous waste storage treatment and disposal facilities. Organically modified clays (organophilic clays) may be employed in each of these systems to adsorb organic waste constituents, enhancing the performance of the applications

The impact of sexual harassment on job satisfaction, turnover intentions, and absenteeism: findings from Pakistan compared to the United States.

Science.gov (United States)

Merkin, Rebecca S; Shah, Muhammad Kamal

2014-01-01

The purpose of this study was to compare and contrast how differences in perceptions of sexual harassment impact productive work environments for employees in Pakistan as compared to the US; in particular, how it affects job satisfaction, turnover, and/or absenteeism. This study analyzed employee responses in Pakistan (n = 146) and the United States (n = 102, 76) using questionnaire data. Significant results indicated that employees who were sexually harassed reported (a) a decrease in job satisfaction (b) greater turnover intentions and (c) a higher rate of absenteeism. Cross-cultural comparisons indicated that (a) Pakistani employees who were sexually harassed had greater job dissatisfaction and higher overall absenteeism than did their US counterparts and (b) Pakistani women were more likely to use indirect strategies to manage sexual harassment than were US targets.

Characterization of the immuno dominant regions within gp41 of env gene of HIV in Pakistan

International Nuclear Information System (INIS)

Nisar, L.; Qadir, M.I.; Nisa, T.; Malik, S.A.; Tabassum, N.

2011-01-01

Objective of the present study was to characterize the immuno dominant sequences of gp41 in HIV strain in Pakistani population so that vaccine may be prepared based upon these regions. A total of 25 specimens were collected from HIV patients of different areas of Pakistan. The viral RNA was isolated using QIAamp MinElute Spin Kit manufactured by Quiagen, California, USA. RT-PCR was done for amplification of the required region and confirmed by gel electrophoresis. The nucleotides of the required regions were sequenced using Big Dye terminator. Less than 20% of the specimens had mutations in immuno dominant regions, so it may be concluded that immuno dominant regions of gp41 in HIV strain in Pakistani population are conservatives and vaccine based upon these regions may prove active immunization against the disease. (author)

Characterization of the immuno dominant regions within gp41 of env gene of HIV in Pakistan

Energy Technology Data Exchange (ETDEWEB)

Nisar, L; Qadir, M I; Nisa, T; Malik, S A; Tabassum, N

2011-08-15

Objective of the present study was to characterize the immuno dominant sequences of gp41 in HIV strain in Pakistani population so that vaccine may be prepared based upon these regions. A total of 25 specimens were collected from HIV patients of different areas of Pakistan. The viral RNA was isolated using QIAamp MinElute Spin Kit manufactured by Quiagen, California, USA. RT-PCR was done for amplification of the required region and confirmed by gel electrophoresis. The nucleotides of the required regions were sequenced using Big Dye terminator. Less than 20% of the specimens had mutations in immuno dominant regions, so it may be concluded that immuno dominant regions of gp41 in HIV strain in Pakistani population are conservatives and vaccine based upon these regions may prove active immunization against the disease. (author)

An Investigation of Materialism and Life Satisfaction

Directory of Open Access Journals (Sweden)

Afreen Faiza

2017-12-01

Full Text Available The collectivistic culture of Pakistan is perforating with hedonic, modern and lavishing values. People are becoming more concerned with material aspirations and accumulation of wealth. The aim of present study is to investigate the relationship between materialism and life satisfaction among Pakistani individuals. A sample of (N=104 Muslim individuals were recruited through random sampling technique from different areas of Karachi city. Their age ranged from 16-46 years (M= 1.60, S.D=.854. The individuals were administered Richins Material values scale (2004 and Diener et al. the Satisfaction with Life Scale (1985. A significant positive relationship was obtained between materialism and life satisfaction (r=.273, p< .01. The future implementation of strategies for promotion of wellbeing of Pakistani individuals is discussed in the light of findings of present study.

Reporting on terror: Why are the voices of peace unheard?

Directory of Open Access Journals (Sweden)

Shabbir Hussain

2014-10-01

Full Text Available This study combines critical textual analysis with field observations to investigate how Pakistani media have covered the ongoing conflict with the Taliban in the North-West of the country. Using framing theory as its theoretical basis, the study found that the Pakistani Taliban are portrayed as chiefly responsible for the ongoing violence in the country, by placing them within the frame of an enemy image. The victims in the conflict were found to be dismissive of the media's tendency to show greater interest in 'bleeding faces', to quote a tribesman, rather than in portraying the unfolding of a major humanitarian crisis. The peace journalism model is limited by the prevailing media emphasis on the security aspect of this conflict and their tendency to ignore popular perspectives.

Innovative Mechanism of Rural Organization Based on Self-Organization

OpenAIRE

Wang, Xing jin; Gao, Bing

2011-01-01

The paper analyzes the basic situation for the formation of innovative rural organizations with the form of self-organization; revels the features of self-organization, including the four aspects of openness of rural organization, innovation of rural organization is far away from equilibrium, the non-linear response mechanism of rural organization innovation and the random rise and fall of rural organization innovation. The evolution mechanism of rural organization innovation is reveled accor...

A survey of nuclear-related agreements and possibilities for nuclear cooperation in South Asia: Cooperative Monitoring Center Occasional Paper/Draft

International Nuclear Information System (INIS)

Rajen, Gaurav

2000-01-01

Several existing nuclear-related agreements already require India and Pakistan, as members, to share information. The agreements are bilateral, regional, and international. Greater nuclear transparency between India and Pakistan could be promoted by first understanding the information flows required by existing agreements. This understanding is an essential step for developing projects that can incrementally advance the sensitivity of the information being shared. This paper provides a survey of existing nuclear-related agreements involving India and Pakistan, and suggests future confidence-building projects using the frameworks provided by these agreements. The Bilateral Agreement on the Prohibition of Attack against Nuclear Reactors and Nuclear Facilities is discussed as a basis for creating further agreements on restricting the use and deployment of nuclear weapons. The author suggests options for enhancing the value of the list of nuclear facilities exchanged annually as a part of this agreement. The International Atomic Energy Agency's regional cooperation agreement among countries in the Asia-Pacific region is an opportunity for greater subregional nuclear cooperation in South Asia. Linking the regional agreement with South Asian environmental cooperation and marine pollution protection efforts could provide a framework for projects involving Indian and Pakistani coastal nuclear facilities. Programs of the Food and Agriculture Organization of the United Nations that use nuclear techniques to increase food and crop production and optimize water management in arid areas also provide similar opportunities for nuclear cooperation. Other frameworks for nuclear cooperation originate from international conventions related to nuclear safety, transportation of nuclear wastes, worker protection against ionizing radiation, and the nondeployment of nuclear weapons in certain areas. The information shared by existing frameworks includes: laws and regulations (including

A survey of nuclear-related agreements and possibilities for nuclear cooperation in South Asia: Cooperative Monitoring Center Occasional Paper/15

Energy Technology Data Exchange (ETDEWEB)

RAJEN,GAURAV

2000-04-01

Several existing nuclear-related agreements already require India and Pakistan, as members, to share information. The agreements are bilateral, regional, and international. Greater nuclear transparency between India and Pakistan could be promoted by first understanding the information flows required by existing agreements. This understanding is an essential step for developing projects that can incrementally advance the sensitivity of the information being shared. This paper provides a survey of existing nuclear-related agreements involving India and Pakistan, and suggests future confidence-building projects using the frameworks provided by these agreements. The Bilateral Agreement on the Prohibition of Attack against Nuclear Reactors and Nuclear Facilities is discussed as a basis for creating further agreements on restricting the use and deployment of nuclear weapons. The author suggests options for enhancing the value of the list of nuclear facilities exchanged annually as a part of this agreement. The International Atomic Energy Agency's regional cooperation agreement among countries in the Asia-Pacific region is an opportunity for greater subregional nuclear cooperation in South Asia. Linking the regional agreement with South Asian environmental cooperation and marine pollution protection efforts could provide a framework for projects involving Indian and Pakistani coastal nuclear facilities. Programs of the Food and Agriculture Organization of the United Nations that use nuclear techniques to increase food and crop production and optimize water management in arid areas also provide similar opportunities for nuclear cooperation. Other frameworks for nuclear cooperation originate from international conventions related to nuclear safety, transportation of nuclear wastes, worker protection against ionizing radiation, and the nondeployment of nuclear weapons in certain areas. The information shared by existing frameworks includes: laws and regulations

Managing mechanistic and organic structure in health care organizations.

Science.gov (United States)

Olden, Peter C

2012-01-01

Managers at all levels in a health care organization must organize work to achieve the organization's mission and goals. This requires managers to decide the organization structure, which involves dividing the work among jobs and departments and then coordinating them all toward the common purpose. Organization structure, which is reflected in an organization chart, may range on a continuum from very mechanistic to very organic. Managers must decide how mechanistic versus how organic to make the entire organization and each of its departments. To do this, managers should carefully consider 5 factors for the organization and for each individual department: external environment, goals, work production, size, and culture. Some factors may push toward more mechanistic structure, whereas others may push in the opposite direction toward more organic structure. Practical advice can help managers at all levels design appropriate structure for their departments and organization.

"Ajaloo lõpp" on lähedal / Francis Fukuyama ; interv. Adam Piore

Index Scriptorium Estoniae

Fukuyama, Francis

2003-01-01

Ajakirjas Newsweek ilmunud intervjuus vastab filosoof Francis Fukuyama küsimustele 2004. aasta kõige olulisemate probleemide, EL-i, Cancunis toimunud Maailma Kaubandusorganisatsiooni kõneluste, ajaloo lõppu jõudmise, Pakistani presidendile tehtud atentaadi kohta

Pühamees tahtis surra märtrina / Tõnis Erilaid

Index Scriptorium Estoniae

Erilaid, Tõnis, 1943-

2007-01-01

Pakistani pealinna Islamabadi Punase mošee ümber toimunud äärmusislamistide ja armee vastasseisust, mille tulemusena hukkus kuni 70 inimest, teiste seas ka islamivõitlejaid juhtinud pühamees Abdul Rashid Ghazi. Joonis

Organic-organic heteroepitaxy: facts, concepts and perspectives

Energy Technology Data Exchange (ETDEWEB)

Moret, M.; Borghesi, A.; Fumagalli, E.; Raimondo, L.; Sassella, A. [Dipartimento di Scienza dei Materiali, Universita di Milano Bicocca, Milano (Italy); Campione, M. [Dipartimento di Scienze Geologiche e Geotecnologie, Universita di Milano Bicocca, Milano (Italy)

2011-08-15

Organic-organic heteroepitaxy can represent the winning technique for growing crystalline and oriented heterostructures of organic semiconductors. However, a sound physical interpretation of mechanisms that control epitaxy is still missing for these low symmetry molecular systems, generally not obeying the usual lattice matching rules for inorganic systems. We discuss here a couple of paradigmatic examples of organic-organic heteroepitaxy suggesting a possible physical rationale for the formation of the heterostructure interfaces as it arises from experimental characterization and computer modeling with atom-atom potential simulations. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Pakistan's Capital Crisis: Implications for U.S. Policy

National Research Council Canada - National Science Library

Martin, Michael F; Kronstadt, K. A

2008-01-01

...." The Pakistani government reportedly has reached a tentative agreement with the IMF for $7.6 billion in loans, but has reservations about conditions on the assistance, expressing concerns that they may create political and economic problems...

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral .... in a case control observational study in association with obesity in a Pakistani cohort .... (BET) family proteins: New therapeutic targets in major diseases.

Aid cutoff threatens condom program in Pakistan.

Science.gov (United States)

Barron, T

1991-01-01

The Pressler Amendment, a law prohibiting US assistance to any country that does not sign the UN Nuclear Nonproliferation Treaty, is forcing USAID to shut down its highly successful Social Marketing of Contraceptives (SMC) program in Pakistan. Adopted in 1985, the amendment calls for an end of funding for projects in Pakistan as of fiscal year 1991, since the country has refused to sign the treaty. Only previously committed funds have kept SMC running, but it may soon have a close shop. The cutoff comes at an especially inopportune time--just when SMC had begun to make an impact. Introduced 5 years ago, Sathi condoms (the project's main product) account for 2/3 of all condoms used in Pakistan. Sales jumped from 30 million in 1978 to 74 million last year. SMC administrators explain that the country has a vast potential for social marketing. But because of the cutoff in aid, the program will exhaust its supply of condoms by March 1992. The end of the SMC program will mean a serious setback for Pakistan, which already has the 2nd largest population in southern Asia, and which has double the fertility of the most populous country in the region, India. Only 7% of the women in Pakistan rely on a modern method of contraception, compared to 42% in India and 26% in Bangladesh. USAID officials explain that the organization is working with the Pakistani government to find ways to continue funding the program after US funds run out. They add that this development will provide Pakistani Prime Minister Nawaz Sharif an opportunity to demonstrate his stated commitment to curb population growth.

Using matrix organization to manage health care delivery organizations.

Science.gov (United States)

Allcorn, S

1990-01-01

Matrix organization can provide health care organization managers enhanced information processing, faster response times, and more flexibility to cope with greater organization complexity and rapidly changing operating environments. A review of the literature informed by work experience reveals that the use of matrix organization creates hard-to-manage ambiguity and balances of power in addition to providing positive benefits for health care organization managers. Solutions to matrix operating problems generally rely on the use of superior information and decision support systems and extensive staff training to develop attitudes and behavior consistent with the more collegial matrix organization culture. Further improvement in understanding the suitability of matrix organization for managing health care delivery organizations will involve appreciating the impact of partial implementation of matrix organization, temporary versus permanent uses of matrix organization, and the impact of the ambiguity created by dual lines of authority upon the exercise of power and authority.

A Spice Story; Indian & Pakistani food in Norway (Customer perceptions and attitudes towards Indian/Pakistani Food)

OpenAIRE

Butt, Amna tariq; Ahmad, Mian Ummad

2017-01-01

Master's thesis in International hotel and tourism management Food is an integral part of any culture and changes occurring in food culture can indicate changes in the cultural environment of the society. The main purpose of the study was to understand behavior and perception of the Norwegian customers towards sub-continental food in Norwegian food market. This study has used a descriptive design. To find answers for research questions, questionnaire survey was used and two unstructured in...

Thiazole-based organic semiconductors for organic electronics.

Science.gov (United States)

Lin, Yuze; Fan, Haijun; Li, Yongfang; Zhan, Xiaowei

2012-06-19

Over the past two decades, organic semiconductors have been the subject of intensive academic and commercial interests. Thiazole is a common electron-accepting heterocycle due to electron-withdrawing nitrogen of imine (C=N), several moieties based on thiazole have been widely introduced into organic semiconductors, and yielded high performance in organic electronic devices. This article reviews recent developments in the area of thiazole-based organic semiconductors, particularly thiazole, bithiazole, thiazolothiazole and benzobisthiazole-based small molecules and polymers, for applications in organic field-effect transistors, solar cells and light-emitting diodes. The remaining problems and challenges, and the key research direction in near future are discussed. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Organizing education by drawing on organization studies

NARCIS (Netherlands)

Romme, A.G.L.

2003-01-01

This study explores how scholars researching organizations and organizing processes can use and exploit their knowledge not only in terms of course contents, but also in organizing and managing students' learning activity. A design-oriented research approach is used in order to develop grounded

Musharrafi tabasid süüdistused Bhutto mõrvas / Evelyn Kaldoja

Index Scriptorium Estoniae

Kaldoja, Evelyn, 1980-

2007-01-01

Enesetaputerroristi ohvriks langenud Pakistani ekspeaministri Benazir Bhutto matustest ja süüdistustest president Pervez Musharrafi aadressil. Vt. samas: Lipp Bhutto kodu ees oli langetatud; Kes oli Benazir Bhutto? Kommenteerivad: Pervez Musharraf, Ban Ki Moon, Mohhammed Asghar

Terroristijaht keskendub pakistanlastele / Heiki Suurkask

Index Scriptorium Estoniae

Suurkask, Heiki, 1972-

2005-01-01

Egiptuse politsei otsib kuut pakistanlast, keda kahtlustatakse Sharm el-Sheikis toimunud terrorirünnakute toimepanekus. Pakistan peab Egiptuse võimude kahtlustusi alusetuks, riigi presidendi väitel al-Qaidat enam Pakistanis ei eksisteeri. Kaart, graafik: Egiptuse turism

Virtual Organizations: Beyond Network Organization

Directory of Open Access Journals (Sweden)

Liviu Gabriel CRETU

2006-01-01

Full Text Available One of the most used buzz-words in (e-business literature of the last decade is virtual organization. The term "virtual" can be identified in all sorts of combinations regarding the business world. From virtual products to virtual processes or virtual teams, everything that is “touched” by the computer’s processing power instantly becomes virtual. Moreover, most of the literature treats virtual and network organizations as being synonyms. This paper aims to draw a much more distinctive line between the two concepts. Providing a more coherent description of what virtual organization might be is also one of our intentions.

Use of an Individual Plant Examination (IPE) to enhance outage management

International Nuclear Information System (INIS)

Putney, B.; Averett, M.; Riley, J.

1992-10-01

A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor-Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fueb were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and No x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions Erom traditional fuels, and in some cases are significantly lower; generally, emissions are highest for afl fuels in the early stages of combustion

Organic vs. Non-Organic Food Products: Credence and Price Competition

Directory of Open Access Journals (Sweden)

Yi Wang

2017-04-01

Full Text Available We analyze the organic and non-organic production choices of two firms by considering customers’ trust in organic food products. In the context of customers’ possible willingness to pay a premium price and their mistrust in organic food products, two firms first make choices on offering organic and non-organic food products. If offering organic products, a firm can further invest in the credence system to increase customers’ trust in their organic products. At the final stage, two firms determine prices. We provide serval insights. First, we characterize the market conditions in which only one firm, both firms or neither firm will choose to offer organic food products. We find that the higher the production costs or credence investment costs for organic food products are, the more likely firms are to choose to produce non-organic food products. Second, if it is expensive enough to invest in organic credence, offering organic food products may still be uncompetitive, even if organic production cost appears to have no disadvantage compared to non-organic food products. Third, we highlight how the prices of organic food products in equilibrium are affected by market parameters. We show that when only one firm offers organic food products, this firm tends to offer a relatively low price if organic credence investment is expensive. Fourth, we highlight how one firm’s credence investment decision in equilibrium can be affected by the product type choice of the other firm. We find that the investment in organic credence is lower when both firms offer organic food products compared with the case when only one firm offers organic food products.

Does organic crowding out influence organic food demand?

DEFF Research Database (Denmark)

Hansen, Lars Gårn; Andersen, Laura Mørch

All Previous studies of organic food demand that investigating substitution focus on specific food submarkets and have to assume separability from other food consumption. However, consumers typically associate attributes such as e.g. healthiness and environment friendliness with organic variants...... of most types of food. If such general organic attributes are important for consumer behaviour then separability may not hold because the general attribute obtained from one type of organic food may be a close or even perfect substitute for the same attribute obtained from other types of organic food....... In this paper we utilize a unique Danish micro panel where all food demand is registered on a disaggregated level with an organic/nonorganic indicator to estimate a general food demand system with organic variants. We clearly reject the usual separability assumption and find that the behaviour of Danish...

Energy-level alignment at metal-organic and organic-organic interfaces

NARCIS (Netherlands)

Veenstra, Sjoerd; Jonkman, H.T.

2003-01-01

This article reports on the electronic structure at interfaces found in organic semiconductor devices. The studied organic materials are C-60 and poly (para-phenylenevinylene) (PPV)-like oligomers, and the metals are polycrystalline Au and Ag. To measure the energy levels at these interfaces,

Organ Donation

Science.gov (United States)

Organ donation takes healthy organs and tissues from one person for transplantation into another. Experts say that the organs ... and bone marrow Cornea Most organ and tissue donations occur after the donor has died. But some ...

Ethnic differences in oral health and use of dental services: cross-sectional study using the 2009 Adult Dental Health Survey.

Science.gov (United States)

Arora, Garima; Mackay, Daniel F; Conway, David I; Pell, Jill P

2016-06-16

Oral health impacts on general health and quality of life, and oral diseases are the most common non-communicable diseases worldwide. Non-White ethnic groups account for an increasing proportion of the UK population. This study explores whether there are ethnic differences in oral health and whether these are explained by differences in sociodemographic or lifestyle factors, or use of dental services. We used the Adult Dental Health Survey 2009 to conduct a cross-sectional study of the adult general population in England, Wales and Northern Ireland. Ethnic groups were compared in terms of oral health, lifestyle and use of dental services. Logistic regression analyses were used to determine whether ethnic differences in fillings, extractions and missing teeth persisted after adjustment for potential sociodemographic confounders and whether they were explained by lifestyle or dental service mediators. The study comprised 10,435 (94.6 %) White, 272 (2.5 %) Indian, 165 (1.5 %) Pakistani/Bangladeshi and 187 (1.7 %) Black participants. After adjusting for confounders, South Asian participants were significantly less likely, than White, to have fillings (Indian adjusted OR 0.25, 95 % CI 0.17-0.37; Pakistani/Bangladeshi adjusted OR 0.43, 95 % CI 0.26-0.69), dental extractions (Indian adjusted OR 0.33, 95 % CI 0.23-0.47; Pakistani/Bangladeshi adjusted OR 0.41, 95 % CI 0.26-0.63), and dental services. The differences could be partially explained by reported differences in dietary sugar.

Validation and use of DNA markers for sex determination in papaya (Carica papaya)

International Nuclear Information System (INIS)

Ejaz, M.; Iqbal, M.; Ahmed, I.

2015-01-01

Profitable papaya production requires female and hermaphrodite plants in higher number than male plants. This is only possible if sex of plants is determined at an early growth stage. The present study was conducted to validate sex-linked DNA markers using plants from two Pakistani papaya varieties and subsequently utilize them for determination of sex in juvenile papaya plants. One hundred and five plants (including 49 male and 56 female) of two Pakistani Papaya varieties at flowering stage were screened with six DNA markers viz., W-11, T12, SDP, Napf-76Napf-76, PKBT4 and PKBT5. All male plants exhibited amplification of sex-linked alleles with markers T12 and W11, whereas, 96% and 95% of female plants showed the absence of sex-linked allele with these markers, respectively. Markers SDP, PKBT5 and Napf-76 showed the presence of sex-linked alleles in 98%, 96% and 93% of male plants, respectively, whereas the same markers showed the absence of sex-linked alleles in 100%, 96% and 94% of female plants. One marker, PKBT4 could not produce expected PCR amplification reported previously. The five DNA markers were further used to screen 171 papaya seedlings. These markers clearly differentiated male and female sex types in the studied papaya plants. Results of our study are likely to facilitate Pakistani papaya breeders and growers to incorporate DNA based screening at juvenile stage to determine sex at early stage and to ensure profitable papaya production. (author)

A qualitative study in parental perceptions and understanding of SIDS-reduction guidance in a UK bi-cultural urban community.

Science.gov (United States)

Crane, Denise; Ball, Helen L

2016-01-30

Differences in both Sudden Infant Death Syndrome (SIDS) rates and infant care practices between white British and South Asians in UK are well known, but research has not yet examined how these two groups understand and implement SIDS-reduction guidance. This study aimed to discover how white British and Pakistani mothers in Bradford recall, understand and interpret SIDS-reduction guidance, and to explore whether and how they implement this guidance in caring for their infants. In-depth narrative interviews with 46 mothers (25 white British origin and 21 Pakistani origin) of 8-12 week old infants recruited from the pool of participants enrolled in the 'Born in Bradford' (BiB) cohort study. All mothers were aware of UK SIDS-reduction guidance from leaflets presented to them during antenatal or postnatal interactions with health care providers. Pakistani mothers tended to dismiss the guidance in toto as being irrelevant to their cultural practices; white British mothers dismissed, adapted and adopted aspects of the guidance to suit their preferred parenting decisions and personal circumstances. Many mothers misunderstood or misinterpreted the guidance given and explained their infant care behaviour according to their social and cultural circumstances. Current SIDS reduction information in the UK does not meet the needs of immigrant families, and is easily misinterpreted or misunderstood by mothers from all sections of the community. Tailored information acknowledging cultural differences in infant care practices is vital, as is greater discussion with all mothers about the reasons for SIDS reduction guidance.

Agreement on the repatriation of Biharis, July 1988.

Science.gov (United States)

1988-01-01

In July 1988, the Governments of Pakistan and Bangladesh signed an agreement to repatriate from Bangladesh to Pakistan more than a quarter of a million Pakistanis known as Biharis, who had been in Bangladesh since 1971. full text

Hamid Karzai provjol peregovorõ ne na urovne

Index Scriptorium Estoniae

2007-01-01

Afganistani president Hamid Karzai ja USA president George W. Bush pidasid läbirääkimisi Camp Davidis Afganistani ülesehitamise ja koostöö üle terrorismivastases koalitsioonis. Erimeelsustest suhtumises Iraani ja Pakistani küsimusse

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences; Volume 41; Issue 3 ... Asthma is a chronic disease due to inflammation of the airways of lungs that is clinically ... ACE insertion/deletion (I/D) polymorphism, rs4646994, in asthma in Pakistani patients.

Knowledge and perceptions of dementia and Alzheimer's disease in four ethnic groups in Copenhagen, Denmark

DEFF Research Database (Denmark)

Nielsen, T. Rune; Waldemar, Gunhild

2016-01-01

of dementia and Alzheimer's disease (AD) among four ethnic groups in Copenhagen, Denmark, and to assess the influence of education and acculturation. METHODS: Quantitative survey data from 260 participants were analyzed: 100 native Danish, and 47 Polish, 51 Turkish, and 62 Pakistani immigrants. Knowledge...... and perceptions of dementia and AD were assessed with the Dementia Knowledge Questionnaire (DKQ) supplemented with two questions from the Alzheimer's Disease Awareness Test (ADAT). Knowledge and perceptions of dementia and AD in the four groups were compared, and the influence of education and acculturation...... was assessed. RESULTS: Group differences were found on the DKQ total score as well as all sub-domains. Turkish and Pakistani people were most likely to hold normalizing and stigmatizing views of AD. Level of education and acculturation had limited influence on dementia knowledge, accounting for 22...

Do terrorist attacks affect ethnic discrimination in the labour market? Evidence from two randomized field experiments.

Science.gov (United States)

Birkelund, Gunn Elisabeth; Chan, Tak Wing; Ugreninov, Elisabeth; Midtbøen, Arnfinn H; Rogstad, Jon

2018-01-24

Terrorist attacks are known to influence public opinion. But do they also change behaviour? We address this question by comparing the results of two identical randomized field experiments on ethnic discrimination in hiring that we conducted in Oslo. The first experiment was conducted before the 2011 terrorist attacks in Norway; the second experiment was conducted after the attacks. In both experiments, applicants with a typical Pakistani name were significantly less likely to get a job interview compared to those with a typical Norwegian name. But the ethnic gap in call-back rates were very similar in the two experiments. Thus, Pakistanis in Norway still experienced the same level of discrimination, despite claims that Norwegians have become more positive about migrants after the far-right, anti-migrant terrorist attacks of 2011. © London School of Economics and Political Science 2018.

The impact of quality department on organizing quality in organizations

Directory of Open Access Journals (Sweden)

Franc Brcar

2016-06-01

Full Text Available Research Question: The existence of organizations in competitive markets depends on their ability to stay competitive. Quality departments play a key role in organizing and ensuring quality. Purpose: The survey tries to determine the correlation between the existence of quality departments and organization of quality in organizations; our hypothesis is that the correlation is very strong. Method: A survey was performed in 484 large and medium-sized organizations in Slovenia to examine the situation in this area. Pearson's χ2-test was used for data processing and results presented in a contingency table. Results: Organizations with quality departments more frequently also have certificate ISO 9001 in comparison with organizations without quality departments. Also these organizations more frequently have supplier-relations teams, monitoring system of suppliers' progress and excellence centers. In short, the quality in these organizations is organized on a higher level than in organizations without quality departments. Organization: The role of quality department is important for organizations. The findings of the research are important for decision making in organizations. Society: Each organization contributes to efficiency and effectiveness of a nation. The organizational level of the nation can be measured by number of certificates per capita. Originality: The research is unique because of the research model and method applied. Limitations/Future Research: The research is limited to large and medium-sized organizations in Slovenia.

Organic vs. Non-Organic Food Products: Credence and Price Competition

OpenAIRE

Yi Wang; Zhanguo Zhu; Feng Chu

2017-01-01

We analyze the organic and non-organic production choices of two firms by considering customers’ trust in organic food products. In the context of customers’ possible willingness to pay a premium price and their mistrust in organic food products, two firms first make choices on offering organic and non-organic food products. If offering organic products, a firm can further invest in the credence system to increase customers’ trust in their organic products. At the final stage, two firms deter...

Sequential improvements in organ procurement increase the organ donation rate.

Science.gov (United States)

Billeter, Adrian T; Sklare, Seth; Franklin, Glen A; Wright, Jerry; Morgan, Gary; O'Flynn, Paul E; Polk, Hiram C

2012-11-01

Organ demand exceeds availability of transplantable organs. Organ procurement continues to suffer from failures to identify potential donors, inability to obtain consent for donation, as well as failures to retrieve certain organs as donor demographics change. The purpose of this article is to propose how sequentially introduced measures can increase organ donation rates as well as improve organ procurement. We analysed the effect of stepwise improvements in the organ procurement process patients in a university-based surgical intensive care unit over a 20-year period. We related newly introduced measures in the organ retrieval process with changes in donation rates. We specifically targeted these three main steps in the donation process: donor identification, conversion of potential donors to actual donors, and organ protection during the procurement process. Finally, we assessed the effect of the same measures on organ procurement after introduction in other hospitals of the same organ procurement region. Introduction of quality improvement steps increased all of the observed parameters. The number of organ donors was stabilised due to a better identification of potential donors, a major increase in conversion from potential to actual donors, and an increase in extended criteria donor. Improvements in organ protection led to higher rates of organs transplanted per donor and increased recovery of lungs and hearts despite increasing donor age. The same measures were introduced successfully in other hospitals in our organ procurement region. Sequential improvements in organ procurement can increase the yield of retrieved organs. The same measures can be applied to other hospitals and lead to comparable improvements in organ donation. Published by Elsevier Ltd.

Glucose 6-phosphate dehydrogenase deficiency and cystic fibrosis

OpenAIRE

Congdon, P. J.; Aggarwal, R. K.; Littlewood, J. M.; Shapiro, H.

1981-01-01

A child born to Pakistani parents is described. He had both cystic fibrosis and G-6PD-deficiency. So far as can be ascertained, the occurrence of both these conditions in the same individual has not previously been reported.

Londoni plahvatuse järel kasvab vajadus terroristide juhte tabada / Heiki Suurkask

Index Scriptorium Estoniae

Suurkask, Heiki, 1972-

2005-01-01

Briti võimud on veendunud, et 7. juuli terrorirünnaku Londonis korraldasid Pakistani päritoluga Mohammad Sidique Khan, Hasib Mir Hussain, Shehzad Tanweer ja Jamaikal sündinud Germaine Lindsay. Lisa: Haarang Iraanis ja pomm Türgis

USA raport hoiatab tuumaterroristide eest / Karin Volmer

Index Scriptorium Estoniae

Volmer, Karin

2007-01-01

USA-s tegutseva tuumaterrori vastase organisatsiooni Nuclear Threat Initiative (NTI) raport kinnitab maailma edusamme tuumamaterjali turvalisuses, kuid on ka palju ohuallikaid. Analüütikud kahtlevad Venemaa ja Pakistani armee usaldusväärsuses tuumamaterjali hoidmisel. Lisa: Tuumaterrori raport

Reforming mysticism: Sindhi separatist intellectuals in Pakistan

NARCIS (Netherlands)

Verkaaik, O.; Marsden, M.

2010-01-01

Introduction: Anthropology, Islam, and Pakistan / Magnus Marsden -- Of children and jinns : an enquiry into an unexpected friendship during uncertain times / Naveeda Khan -- The modern businessman and the Pakistani saint : the interpenetration of worlds / Katherine P. Ewing -- Islamic influences on

MARKETING ORGANIZATION ACTIVITY IN SPORTS ORGANIZATIONS

Directory of Open Access Journals (Sweden)

Slobodan Župljanin

2012-09-01

Full Text Available Sports organizations as "sui generis" organizations inevitably have to adopt the concept of marketing as a business philosophy, if you want to survive and develop its activities in the modern business environment. Supply and demand as the market, and psychological phenomena are inherent in sports organizations. Sport is a special area of human activity in which marketing has a specific place and role. Sports and sporting events are also a massive public and media events and high level of interest involving multi-million audience. Between direct and indirect participants of these events takes place appropriate communication sociological, psychological and marketing character. The aim of this paper is to present the possibility of more efficient operation of sports organizations using and adopting the marketing concept as a philosophy of action.

The Visual Dimension in Organizing, Organization and Organization Research

DEFF Research Database (Denmark)

van Leeuwen, Theo; Meyer, Renate; Hollerer, Markus

2013-01-01

With the unprecedented rise in the use of visuals, and its undeniable omnipresence in organizational contexts, as well as in the individual's everyday life, organization and management science has recently started to pay closer attention to the to date under-theorized "visual mode" of discourse...... and meaning constriction, Building primarily on insights from the phenomenological tradition in organization theory and from social semiotics, this article sets out to consolidate previous scholarly efforts and to sketch a fertile future research agenda, After briefly exploring the working of visuals, we...... introduce the methodological and theoretical roots of visual studies in a number of disciplines that have a long-standing tradition of incorporating the visual. We then continue by extensively reviewing work in the field of organization and management studies: More specifically, we present five distinct...

Organ printing: from bioprinter to organ biofabrication line.

Science.gov (United States)

Mironov, Vladimir; Kasyanov, Vladimir; Markwald, Roger R

2011-10-01

Organ printing, or the layer by layer additive robotic biofabrication of functional three-dimensional tissue and organ constructs using self-assembling tissue spheroid building blocks, is a rapidly emerging technology that promises to transform tissue engineering into a commercially successful biomedical industry. It is increasingly obvious that similar well-established industries implement automated robotic systems on the path to commercial translation and economic success. The use of robotic bioprinters alone however is not sufficient for the development of large industrial scale organ biofabrication. The design and development of a fully integrated organ biofabrication line is imperative for the commercial translation of organ printing technology. This paper presents recent progress and challenges in the development of the essential components of an organ biofabrication line. Copyright © 2011 Elsevier Ltd. All rights reserved.

Organic superconductors

International Nuclear Information System (INIS)

Bulaevskij, L.N.; Shchegolev, I.F.

1986-01-01

Main achievements in creating new organic conducting materials - synthetic metals and superconductors, are considered. The processes of superconductivity occurrence in organic materials are discussed. It is shown that conjugated bonds between C and H atoms in organic molecules play an important role in this case. At present ''crystal direction'' in organic superconductor synthesis is mainly developed. Later on, organic superconductor crystals are supposed to be introduced into usual polymers, e.g. polyethylene

Tuning COCOMO-II for Software Process Improvement: A Tool Based Approach

Directory of Open Access Journals (Sweden)

SYEDA UMEMA HANI

2016-10-01

Full Text Available In order to compete in the international software development market the software organizations have to adopt internationally accepted software practices i.e. standard like ISO (International Standard Organization or CMMI (Capability Maturity Model Integration in spite of having scarce resources and tools. The aim of this study is to develop a tool which could be used to present an actual picture of Software Process Improvement benefits in front of the software development companies. However, there are few tools available to assist in making predictions, they are too expensive and could not cover dataset that reflect the cultural behavior of organizations for software development in developing countries. In extension to our previously done research reported elsewhere for Pakistani software development organizations which has quantified benefits of SDPI (Software Development Process Improvement, this research has used sixty-two datasets from three different software development organizations against the set of metrics used in COCOMO-II (Constructive Cost Model 2000. It derived a verifiable equation for calculating ISF (Ideal Scale Factor and tuned the COCOMO-II model to bring prediction capability for SDPI (benefit measurement classes such as ESCP (Effort, Schedule, Cost, and Productivity. This research has contributed towards software industry by giving a reliable and low-cost mechanism for generating prediction models with high prediction accuracy. Hopefully, this study will help software organizations to use this tool not only to predict ESCP but also to predict an exact impact of SDPI.

Bridging worlds

DEFF Research Database (Denmark)

Rose, Jeremy; Memon, Saifullah Hassan

2012-01-01

This paper reports a case study where Soft Systems Methodology (SSM) was used to help automate a largely manual administrative (examination) information system in a Pakistani university. Various design suggestions for information system improvements, both administrative and IT-supported were made...

U.S. CWMD Coordination

Science.gov (United States)

2012-12-11

coordination. For example, it conducted joint vehicle inspection training for Pakistani Customs and Border Guard personnel at a US- Mexico border...biological material, including such hazards as: anthrax, botulism, cholera , Ebola virus hemorrhagic fever, E. coli, Plague, and smallpox 79

Download this PDF file

African Journals Online (AJOL)

GB

2017-01-01

Jan 1, 2017 ... expected 1.4 fold increase in CR three months post-discharge. .... Validation of a Scale for Measuring State Self-. Esteem. ... Events in Pakistani Stroke Survivors: A Cross ... 5:89. 17. Schmid AA, Van Puymbroeck M, Knies K,.

Contemporary Radical Islam as a Consequence of Traditional Legacies and Globalization? A Case Study of the Southern Philippines

Science.gov (United States)

2006-03-01

the peaceful transmission of religion and culture. More specifically, they developed kinships by marrying royalty and raising the children under...Turks, Iranians, Pakistanis, Malaysians , Indonesians, and others had fragmented the historic ‘land of Islam’ (dar el-Islam) into communities with

Search Results | Page 75 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Results 741 - 750 of 788 ... ... Information and Networks in Asia and Sub-Saharan Africa 12 Apply ... and their roles in Chinese industrial clusters : a case from Haining city ... exploring how to defuse violence in Pakistani cities, or building new ...

Royal Delicacies at Peasant Prices

DEFF Research Database (Denmark)

Rezaei, Shahamak

2011-01-01

Turkish groceries and fast food restaurants, Chinese barbecues, Pakistani kiosks, Iranian pizzerias and carpet stores, Arabic kebab houses, erotic artists from Eastern Europe and Southeast Asia, exchange agencies across Denmark and many other EU countries, a growing number of wholesale businesses...

Quality and Chemical Composition of Organic and Non-Organic Vetiver Oil

Directory of Open Access Journals (Sweden)

Asep Kadarohman

2014-03-01

Full Text Available Vetiver oil (Vetiveria zizanoides has been used as perfume materials, cosmetics, fragrance soaps, anti-inflammation, repellent, and insecticidal agents. Organic vetiver oil has higher economical value than non-organic vetiver oil and it has been regarded to be able to compete in the global market. Therefore, studies have been carried out using 1 hectare of land and the first generation of organic vetiver oil has produced 0.57% of yield, greater than non-organic (0.50%. The quality of organic and non-organic vetiver oil was analyzed by Indonesian Standard (SNI parameter, pesticide residue test, chemical composition by GC/MS, and the appearance of vetiver root. In general, the result of organic and non-organic vetiver oil has fulfilled the national standard; the quality of organic vetiver oil was better than non-organic one. Physically, the appearance of organic vetiver root was better than non-organic vetiver root; organic vetiver root was denser, more appealing, and did not have any black spots. The pesticide residue of organic vetiver oil was lower than non-organic vetiver oil. Based on SNI test, vetiverol (oxygen compounds in organic vetiver oil was higher than non-organic vetiver oil.

Organic semiconductors for organic field-effect transistors

International Nuclear Information System (INIS)

Yamashita, Yoshiro

2009-01-01

The advantages of organic field-effect transistors (OFETs), such as low cost, flexibility and large-area fabrication, have recently attracted much attention due to their electronic applications. Practical transistors require high mobility, large on/off ratio, low threshold voltage and high stability. Development of new organic semiconductors is key to achieving these parameters. Recently, organic semiconductors have been synthesized showing comparable mobilities to amorphous-silicon-based FETs. These materials make OFETs more attractive and their applications have been attempted. New organic semiconductors resulting in high-performance FET devices are described here and the relationship between transistor characteristics and chemical structure is discussed. (topical review)

Organic semiconductors for organic field-effect transistors

Directory of Open Access Journals (Sweden)

Yoshiro Yamashita

2009-01-01

Full Text Available The advantages of organic field-effect transistors (OFETs, such as low cost, flexibility and large-area fabrication, have recently attracted much attention due to their electronic applications. Practical transistors require high mobility, large on/off ratio, low threshold voltage and high stability. Development of new organic semiconductors is key to achieving these parameters. Recently, organic semiconductors have been synthesized showing comparable mobilities to amorphous-silicon-based FETs. These materials make OFETs more attractive and their applications have been attempted. New organic semiconductors resulting in high-performance FET devices are described here and the relationship between transistor characteristics and chemical structure is discussed.

Spiers memorial lecture. Organic electronics: an organic materials perspective.

Science.gov (United States)

Wudl, Fred

2014-01-01

This Introductory Lecture is intended to provide a background to Faraday Discussion 174: "Organic Photonics and Electronics" and will consist of a chronological, subjective review of organic electronics. Starting with "ancient history" (1888) and history (1950-present), the article will take us to the present. The principal developments involved the processes of charge carrier generation and charge transport in molecular solids, starting with insulators (photoconductors) and moving to metals, to semiconductors and ending with the most popular semiconductor devices, such as organic light-emitting diodes (OLEDs), organic field effect transistors (OFETs) and organic photovoltaics (OPVs). The presentation will be from an organic chemistry/materials point of view.

Export competitiveness of pakistani horticultural products

International Nuclear Information System (INIS)

Akhtar, W.; Akmal, N.; Shah, H.; Tahir, A.; Niazi, M.A.

2013-01-01

This paper examines Pakistan's competitiveness in export of selected horticulture commodities by employing set of revealed comparative advantage (RCA) and revealed competitive advantage indices with respect to global trade. Results demonstrate that Pakistan has comparative and competitive advantage over the period under analysis and indicates a transition from comparative and competitive disadvantage to comparative and competitive advantage during the period under analysis. Tangerines, mandarins, clem have maintained relatively higher revealed comparative advantage as compared to other categories for the whole period under analysis. Onion export has revealed comparative advantage with some fluctuations over time. The research indicates that Pakistan's comparative and competitive advantages have been increasing in all the selected commodities during period under analysis which indicates the potential of horticulture exports for foreign exchange earnings. There is need to strengthen comparative and competitive advantage in horticulture sector by policy support and facilitating role by all stakeholders. (author)

Screening Pakistani cotton for drought tolerance

International Nuclear Information System (INIS)

Soomro, M.H.; Markhand, G.S.

2011-01-01

The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)

Periodontal status of Pakistani orthodontic patients

Directory of Open Access Journals (Sweden)

Yousuf MOOSA

2015-01-01

Full Text Available The objective of this study was to evaluate and compare the periodontal status of orthodontic patients and non-orthodontic patients, aged 15–28 years, of both genders. The cross-sectional study included 100 orthodontic and 100 non-orthodontic patients evaluated using a Community Periodontal Index for Treatment Need (CPITN probe on the index teeth. A questionnaire was distributed to the participants to assess and evaluate the use of oral hygiene aids. The data were analyzed using SPSS version 17, and various comparisons were performed using the chi-square test. The study revealed that there was a statistically significant association in CPITN scores between the orthodontic and non-orthodontic patients (p < 0.01. The study showed that patients undergoing orthodontic treatment have increased plaque accumulation and probing depth resulting in periodontal tissue destruction. Proper oral hygiene practices and interdental aids should be employed to control plaque.

Designing Organizations

DEFF Research Database (Denmark)

changed dramatically with the advent of: new communication systems, adaptive mechanisms, information technology, knowledge management systems, innovation processes and more. This book systemically examines these developments and their impact on OD with contributions from leading scholars in the area....... The individual chapters are organized into five sections: (1) Putting Contingency Theory in its Place, (2) Focus on Individuals who make up the Organization, (3) Innovation Processes and Organization Design, (4) Adaptation and Technology, and (5) Design for Performance. Each chapter examines aspects of the books...... is a benchmark publication in the field of organization design. By focusing on recent developments in organization design, this book will help to create more thoughtful research and stronger empirical analyses in this important area of management and organization....

Human health implications of organic food and organic agriculture

DEFF Research Database (Denmark)

Mie, Axel; Andersen, Helle Raun; Gunnarsson, Stefan

2017-01-01

. Organic food consumption may reduce the risk of allergic disease and of overweight and obesity, but the evidence is not conclusive due to likely residual confounding, as consumers of organic food tend to have healthier lifestyles overall. However, animal experiments suggest that identically composed feed...... benefits associated with organic food production, and application of such production methods is likely to be beneficial within conventional agriculture, e.g., in integrated pest management.......This review summarises existing evidence on the impact of organic food on human health. It compares organic vs. conventional food production with respect to parameters important to human health and discusses the potential impact of organic management practices with an emphasis on EU conditions...

Ethnic variations in five lower gastrointestinal diseases: Scottish Health and Ethnicity Linkage Study

Science.gov (United States)

Bhopal, Raj S; Cezard, Genevieve; Bansal, Narinder; Ward, Hester J T; Bhala, Neeraj

2014-01-01

Objectives Our objective was to augment the limited evidence mainly from local, clinical studies of ethnic differences in gastrointestinal disorders. Our question was: are there ethnic variations in hospitalisation/death for lower gastrointestinal disorders in Scotland? Setting Scotland. Population This retrospective-cohort linked 4.65 (of 4.9) million people in the 2001 census of Scotland (providing data on ethnicity, country of birth and indicators of socioeconomic deprivation) to 9 years of National Health Service hospitalisation and death records. Primary and secondary outcome measures and analysis For appendicitis, we studied all ages; for irritable bowel syndrome, ulcerative colitis, Crohn's disease and diverticular disease, we included those ≥20 years. Using Poisson regression (robust variance) we calculated, by ethnic group and sex, first-hospitalisation/death age-adjusted rates per 100 000 person-years, and relative risks (RRs) with 95% CIs multiplied by 100, so the White Scottish reference population had an RR=100. Results There were ethnic variations; for example, for irritable bowel syndrome, RRs (95% CIs) were comparatively high in Other White British women (128.4 (111.0 to 148.6)), and low in Pakistani women (75.1 (60.6 to 93.1)). For appendicitis, RRs were high in men in Other White British (145.2 (127.8 to 164.9)), and low in most non-White groups, for example, Pakistanis (73.8 (56.9 to 95.6)). For ulcerative colitis, RRs were high in Indian (169.8 (109.7 to 262.7)) and Pakistani (160.8 (104.2 to 248.2)) men. For Crohn's disease, the RR was high in Pakistani men (209.2 (149.6 to 292.6)). For diverticular disease, RRs were high in Irish men (176.0 (156.9 to 197.5)), and any Mixed background women (144.6 (107.4 to 194.8)), and low in most non-White groups, for example, Chinese men (47.1 (31.0 to 71.6) and women (46.0 (30.4 to 69.8)). Conclusions Appendicitis and diverticular disease were comparatively low in most non-White groups, while

Knowledge Organization = Information Organization?

DEFF Research Database (Denmark)

Hjørland, Birger

Are the terms ―information organization‖ (IO), ―organization of information‖ (OI) and ―information architecture‖ (IA) synonyms for knowledge organization (KO)? This study uses bibliometric methods, among others, to determine some relations between these terms and their meanings. Apparently the data...... shows that these terms should not be considered synonyms because each of the terms IO, OI, IA and KO produce a different set of high ranked authors, journals and papers. In many cases the terms are, however, used interchangeably (and thus indicating synonymity) and it is argued that the underlying...

Emotsionaalne sisustus : trend

Index Scriptorium Estoniae

2007-01-01

iOO Designi ruumipoeetilistest objektidest: liigutustele veepinnana reageerivast lauast ja jalajälgedest õitsele puhkevast vaibast, pakistani-ameerika disaineri Osman Khani projektist "Play With Food" Droog Designi väljapanekul ning jaapani disaineri Kenya Hara ujuvate kaladega lauast Milano messil. Kommenteerib Dagmar Kase

In Conversation with Naser Faruqui: A 'Next Generation Water Leader'

International Development Research Centre (IDRC) Digital Library (Canada)

Initially, the Pakistani decision-makers weren't very receptive to the idea of water ... it just doesn't make sense — reusing waste water for growing crops, reusing ... the poor, so they don't have to buy expensive canned or imported vegetables.

Organic spintronics

International Nuclear Information System (INIS)

Naber, W J M; Faez, S; Wiel, W G van der

2007-01-01

We review the emerging field of organic spintronics, where organic materials are applied as a medium to transport and control spin-polarized signals. The contacts for injecting and detecting spins are formed by ferromagnetic metals, oxides, or inorganic semiconductors. First, the basic concepts of spintronics and organic electronics are addressed, and phenomena which are in particular relevant for organic spintronics are highlighted. Experiments using different organic materials, including carbon nanotubes, organic thin films, self-assembled monolayers and single molecules are then reviewed. Observed magnetoresistance points toward successful spin injection and detection, but spurious magnetoresistance effects can easily be confused with spin accumulation. A few studies report long spin relaxation times and lengths, which forms a promising basis for further research. We conclude with discussing outstanding questions and problems. (topical review)

Organizations

DEFF Research Database (Denmark)

Hatch, Mary Jo

and considers many more. Mary Jo Hatch introduces the concept of organizations by presenting definitions and ideas drawn from the a variety of subject areas including the physical sciences, economics, sociology, psychology, anthropology, literature, and the visual and performing arts. Drawing on examples from......Most of us recognize that organizations are everywhere. You meet them on every street corner in the form of families and shops, study in them, work for them, buy from them, pay taxes to them. But have you given much thought to where they came from, what they are today, and what they might become...... prehistory and everyday life, from the animal kingdom as well as from business, government, and other formal organizations, Hatch provides a lively and thought provoking introduction to the process of organization....

Malala and the politics of global iconicity.

Science.gov (United States)

Olesen, Thomas

2016-06-01

The article presents a case analysis of Malala Yousafzai's transformation into a global injustice icon after she was shot in 2012 by the Pakistani Taliban for advocating for girls' right to education. The analysis focuses on the political aspects of this process and is divided into three parts. The first looks at factors that facilitated Malala's iconization as she was undergoing medical treatment and was unable to participate in her iconization. The second part starts when Malala enters the global public sphere and begins to actively contribute to the iconization process. The third part identifies de-iconizing resistance to Malala from Pakistani actors who see her iconization as a symbolic colonization in which Malala has become a vehicle of the West. Theoretically, the article is located within cultural sociology, but expands it in a political and global direction. © London School of Economics and Political Science 2016.

Identifying Determinants of Organizational Development as the Key Developers of Employee Soft Skill

Directory of Open Access Journals (Sweden)

Shahjahan Laghari

2016-10-01

Full Text Available The purpose of this article is to identify the determinants of organizational development as the key developers of employee soft skills. Various studies have been taken where determinants of organizational development defining soft skills in employees are discussed. However, the current study is different in Pakistani industry context as the link was missing about the determinants of organizational development which in synchronized way help in developing soft skills in employees of firm. This research uses explanatory approach; incorporating secondary data extracted under the light of existing school of thoughts paired with quantification through data collected from respondents in Pakistani corporate sector. Hypotheses are tested using structural equation model (SEM technique. Results This research showed an affirmative link between determinants of organizational development and development of soft skills in employees. Finally, the study proposes enriching insights on few missing links that can be researched and triggered achieving maximized outcomes.

Centro-Apical Self-Organization of Organic Semiconductors in a Line-Printed Organic Semiconductor: Polymer Blend for One-Step Printing Fabrication of Organic Field-Effect Transistors.

Science.gov (United States)

Lee, Su Jin; Kim, Yong-Jae; Yeo, So Young; Lee, Eunji; Lim, Ho Sun; Kim, Min; Song, Yong-Won; Cho, Jinhan; Lim, Jung Ah

2015-09-11

Here we report the first demonstration for centro-apical self-organization of organic semiconductors in a line-printed organic semiconductor: polymer blend. Key feature of this work is that organic semiconductor molecules were vertically segregated on top of the polymer phase and simultaneously crystallized at the center of the printed line pattern after solvent evaporation without an additive process. The thickness and width of the centro-apically segregated organic semiconductor crystalline stripe in the printed blend pattern were controlled by varying the relative content of the organic semiconductors, printing speed, and solution concentrations. The centro-apical self-organization of organic semiconductor molecules in a printed polymer blend may be attributed to the combination of an energetically favorable vertical phase-separation and hydrodynamic fluids inside the droplet during solvent evaporation. Finally, a centro-apically phase-separated bilayer structure of organic semiconductor: polymer blend was successfully demonstrated as a facile method to form the semiconductor and dielectric layer for OFETs in one- step.

Organic salmon

DEFF Research Database (Denmark)

Ankamah Yeboah, Isaac; Nielsen, Max; Nielsen, Rasmus

. This study identifies the price premium on organic salmon in the Danish retail sale sector using consumer panel scanner data for households by applying the hedonic price model while permitting unobserved heterogeneity between households. A premium of 20% for organic salmon is found. Since this premium...... is closer to organic labeled agriculture products than to ecolabelled capture fisheries products, it indicates that consumers value organic salmon as an agriculture product more than fisheries product....

Organic chemistry

International Nuclear Information System (INIS)

2003-08-01

This book with sixteen chapter explains organic chemistry on linkage isomerism such as alkane, cycloalkane, alkene, aromatic compounds, stereo selective isomerization, aromatic compounds, stereo selective isomerization, organic compounds, stereo selective isomerization, organic halogen compound, alcohol, ether, aldehyde and ketone, carboxylic acid, dicarboxylic acid, fat and detergent, amino, carbohydrate, amino acid and protein, nucleotide and nucleic acid and spectroscopy, a polymer and medical chemistry. Each chapter has introduction structure and characteristic and using of organic chemistry.

Ethnic differences in women's use of mental health services: do social networks play a role? Findings from a national survey.

Science.gov (United States)

Kapadia, Dharmi; Nazroo, James; Tranmer, Mark

2018-04-01

The reasons for ethnic differences in women's mental health service use in England remain unclear. The aims of this study were to ascertain: ethnic differences in women's usage of mental health services, if social networks are independently associated with service use, and if the association between women's social networks and service use varies between ethnic groups. Logistic regression modelling of nationally representative data from the Ethnic Minority Psychiatric Illness Rates in the Community (EMPIRIC) survey conducted in England. The analytic sample (2260 women, aged 16-74 years) was drawn from the representative subsample of 2340 women in EMPIRIC for whom data on mental health services, and social networks were available. Pakistani and Bangladeshi women were less likely than White women to have used mental health services (Pakistani OR = 0.23, CI = 0.08-0.65, p = .005; Bangladeshi OR = 0.25, CI = 0.07-0.86, p = .027). Frequent contact with relatives reduced mental health service use (OR = 0.45, CI = 0.23-0.89, p = .023). An increase in perceived inadequate support in women's close networks was associated with increased odds of using mental health services (OR = 1.91, CI = 1.11-3.27, p = .019). The influence of social networks on mental health service use did not differ between ethnic groups. The differential treatment of women from Pakistani and Bangladeshi ethnic groups in primary care settings could be a possible reason for the observed differences in mental health service use.

Maternal mental health and its association with infant growth at 6 months in ethnic groups: results from the Born-in-Bradford birth cohort study.

Directory of Open Access Journals (Sweden)

Gemma D Traviss

Full Text Available To identify factors associated with infant growth up to 6 months, with a particular focus on maternal distress, and to explore the effect of ethnicity on any relation between maternal distress and infant growth.Cohort study recruiting White and Pakistani women in the United Kingdom (UK. Infant growth was measured at birth and 6 months. Standard assessment of mental health (GHQ-28 was undertaken in pregnancy (26-28 weeks gestation and 6 months postpartum. Modelling included social deprivation, ethnicity, and other known influences on infant growth such as maternal smoking and alcohol consumption.Maternal distress improved markedly from pregnancy to 6 months postpartum. At both times Pakistani women had more somatic and depression symptoms than White women. Depression in pregnancy (GHQ subscale D was associated with lower infant growth at 6 months. Self-reported social dysfunction in pregnancy (GHQ subscale C was associated with lower gestational age.. Pakistani women reported higher GHQ scores during pregnancy associated with smaller infants at birth. They lived in areas of higher social deprivation, reported less alcohol consumption and smoking postnatally, all independent influences on growth at 6 months.Maternal mental health in pregnancy is an independent influence on infant growth up to 6 months and is associated with ethnicity which was itself associated with deprivation in our sample. There is a complex relationship between symptoms of maternal distress, ethnicity, deprivation, health behaviours, and early infant growth. Measures should include both emotional and somatic symptoms and interventions to reduce risks of poor early growth need to include psychological and social components.

[Plasma vitamin D levels in native and immigrant children under the age of 6 years of different ethnic origins].

Science.gov (United States)

Sánchez Muro, J M; Yeste Fernández, D; Marín Muñoz, A; Fernández Cancio, M; Audí Parera, L; Carrascosa Lezcano, A

2015-05-01

Nutritional rickets is an emergent disease in Spain, and occurs particularly in black and dark-skinned infants and children from immigrant populations. The aim of this work was to ascertain the vitamin D reserve in a population of native and immigrant children under the age of 6 years. A prospective study was conducted at a Primary Healthcare Centre in Salt (Girona). 307 children with the following origin and race distribution: Caucasian (n=85; 28%), Sub-Saharan (n=101; 32.5%); Maghrebí (n=87, 28.0%); Central-American (n=20; 6.4%) and Indo-Pakistani (n=14; 4.5%). The biochemistry blood parameters studied were: calcium, phosphorus, alkaline phosphatase, 25-hydroxivitamin D, and parathormone. A nutritional survey was used to estimate calcium and vitamin D intake and degree of sun exposure. Vitamin D deficiency (<20 ng/ml) was detected in Caucasians (8%), Sub-Saharans (18%), Central-Americans (20%), Maghrebís (34.5%), and Indo-Pakistanis (64%). Of the children studied (n=9), 2.9% had serious vitamin D deficiency (< 10 ng/ml); only one child of Sub-Saharan origin met the biochemical criteria for classical rickets. The prevalence of vitamin D deficiency was significantly higher in children not receiving vitamin D supplements in the first year of life. Plasma vitamin D concentrations were deficient in 22.5% of children under the age of six, being more prevalent in children of Indo-Pakistani and Maghrebí origin. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

China's Organic Revolution

OpenAIRE

Paull, John

2008-01-01

Agriculture in China is at the onset of an Organic Revolution. From 2000 to 2006, China has moved from 45th to 2nd position in the world in number of hectares under organic management. China now has more land under organic horticulture than any other country. In the year 2005/2006, China added 12% to the world’s organic area. This accounted for 63% of the world’s annual increase in organic land, and China now has 11% of the world’s organically managed land. The antecedents to China’s Organic ...

Organ dosimetry

International Nuclear Information System (INIS)

Kaul, Dean C.; Egbert, Stephen D.; Otis, Mark D.; Kuhn, Thomas; Kerr, George D.; Eckerman, Keith F.; Cristy, Mark; Ryman, Jeffrey C.; Tang, Jabo S.; Maruyama, Takashi

1987-01-01

This chapter describes the technical approach, complicating factors, and sensitivities and uncertainties of calculations of doses to the organs of the A-bomb survivors. It is the object of the effort so described to provide data that enables the dosimetry system to determine the fluence, kerma, absorbed dose, and similar quantities in 14 organs and the fetus, specified as being of radiobiological interest. This object was accomplished through the use of adjoint Monte Carlo computations, which use a number of random particle histories to determine the relationship of incident neutrons and gamma rays to those transported to a target organ. The system uses these histories to correlate externally-incident energy- and angle-differential fluences with the fluence spectrum (energy differential only) within the target organ. In order for the system to work in the most efficient manner possible, two levels of data were provided. The first level, represented by approximately 6,000 random adjoint-particle histories, enables the computation of the fluence spectrum with sufficient precision to provide statistically reliable (± 6 %) mean doses within any given organ. With this limited history inventory, the system can be run rapidly for all survivors. Mean organ dose and dose uncertainty are obtainable in this mode. The second mode of operation enables the system to produce a good approximation to fluence spectrum within any organ or to produce the dose in each of an array of organ subvolumes. To be statistically reliable, this level of detail requires far more random histories, approximately 40,000 per organ. Thus, operation of the dosimetry system in this mode (i.e., with this data set) is intended to be on an as-needed, organ-specific basis, since the system run time is eight times that in the mean dose mode. (author)

(Re)scaling identities

DEFF Research Database (Denmark)

Koefoed, Lasse Martin; Simonsen, Kirsten

2012-01-01

of Pakistani origin, the study employs theoretical ideas of estrangement, identification and recognition in order to obtain a thorough understanding of the complexity and the contradictory character of their spatial identities and affiliations. A turning point in the double processes of estrangement...... of identity....

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Genetic analysis of a consanguineous Pakistani family with Leber congenital amaurosis identifies a novel mutation in GUCY2D gene. Muzammil Ahmad Khan Verena Rupp Muhammad Ayaz Khan Muhammad Pervaiz Khan Muhammad Ansar Christian Windpassinger. Research Note Volume 93 Issue 2 August 2014 pp ...

Sequence comparison and phylogenetic analysis of core gene of ...

African Journals Online (AJOL)

Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

Interleukin-10 gene promoter polymorphism as a potential host ...

African Journals Online (AJOL)

10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

The Foreign Fighter Problem Analyzing the Impact of Social Media and the Internet

Science.gov (United States)

2015-06-01

describe how Egyptians , Saudis, and Pakistanis aided Afghan fighters against the Soviets. While used sporadically from 1988 to 2001, the term exploded...anonymity, which government agencies can exploit. Long-term anonymity is difficult to achieve, since the architecture of the internet is designed to track

The Trade and Gender Interface: A Perspective from Pakistan

NARCIS (Netherlands)

K.A. Siegmann (Karin Astrid)

2008-01-01

textabstractIntroduction: News on Pakistan’s trade performance is rarely found side by side, or even associated with, headlines on gender equality. Yet both are burning issues for Pakistani society. This article aims at highlighting their connections. Put differently, it shows how the world

Briti eksimpeerium käib koos / Allan Espenberg

Index Scriptorium Estoniae

Espenberg, Allan

2007-01-01

Ugandas peeti Briti Rahvaste Ühenduse (e. Commonwealth) valitsusjuhtide tippkohtumist. Kohtumise avas Briti kuninganna Elizabeth II, kes on ühenduse paljude maade nominaalne riigipea. Seoses keerulise sisepoliitilise olukorraga Pakistanis ja sealse presidendi Pervez Musharaffi tegevusega otsustati Pakistan ühenduse koosseisust ajutiselt välja arvata

Ellis-van Creveld Syndrome and Profound Deafness Resulted by ...

Indian Academy of Sciences (India)

Navya

2017-04-04

Apr 4, 2017 ... However, the disorder is more common in the old Amish ... In vitro studies revealed that EVC and EVC2 proteins interact with each other to ..... (2007) reported a frequency of 3.4% in a cohort of 557 families of Pakistani origin,.

English-Teaching Institutions in Pakistan.

Science.gov (United States)

Rahman, Tariq

2001-01-01

Discusses English medium teaching in Pakistan and suggests that at the moment it is an elitist preserve and a stumbling block for Pakistanis not taught through English. Indicates that exposing other students to English could counteract growing cultural and religious intolerance in Pakistan. (Author/VWL)

Heuristics and Biases in Military Decision Making

Science.gov (United States)

2010-10-01

collision, yet organizational efforts to avoid colli - sions increased due to the subjective impression that collisions were now somehow more likely. People...Consider a problem from Afghanistan: We suspect two primary drug trafficking routes along the Afghan-Pakistani border . A small village is located

Organic Donor-Acceptor Complexes as Novel Organic Semiconductors.

Science.gov (United States)

Zhang, Jing; Xu, Wei; Sheng, Peng; Zhao, Guangyao; Zhu, Daoben

2017-07-18

Organic donor-acceptor (DA) complexes have attracted wide attention in recent decades, resulting in the rapid development of organic binary system electronics. The design and synthesis of organic DA complexes with a variety of component structures have mainly focused on metallicity (or even superconductivity), emission, or ferroelectricity studies. Further efforts have been made in high-performance electronic investigations. The chemical versatility of organic semiconductors provides DA complexes with a great number of possibilities for semiconducting applications. Organic DA complexes extend the semiconductor family and promote charge separation and transport in organic field-effect transistors (OFETs) and organic photovoltaics (OPVs). In OFETs, the organic complex serves as an active layer across extraordinary charge pathways, ensuring the efficient transport of induced charges. Although an increasing number of organic semiconductors have been reported to exhibit good p- or n-type properties (mobilities higher than 1 or even 10 cm 2 V -1 s -1 ), critical scientific challenges remain in utilizing the advantages of existing semiconductor materials for more and wider applications while maintaining less complicated synthetic or device fabrication processes. DA complex materials have revealed new insight: their unique molecular packing and structure-property relationships. The combination of donors and acceptors could offer practical advantages compared with their unimolecular materials. First, growing crystals of DA complexes with densely packed structures will reduce impurities and traps from the self-assembly process. Second, complexes based on the original structural components could form superior mixture stacking, which can facilitate charge transport depending on the driving force in the coassembly process. Third, the effective use of organic semiconductors can lead to tunable band structures, allowing the operation mode (p- or n-type) of the transistor to be

Organics.

Science.gov (United States)

Chian, Edward S. K.; DeWalle, Foppe B.

1978-01-01

Presents water analysis literature for 1978. This review is concerned with organics, and it covers: (1) detergents and surfactants; (2) aliphatic and aromatic hydrocarbons; (3) pesticides and chlorinated hydrocarbons; and (4) naturally occurring organics. A list of 208 references is also presented. (HM)

Organizers.

Science.gov (United States)

Callison, Daniel

2000-01-01

Focuses on "organizers," tools or techniques that provide identification and classification along with possible relationships or connections among ideas, concepts, and issues. Discusses David Ausubel's research and ideas concerning advance organizers; the implications of Ausubel's theory to curriculum and teaching; "webbing," a…

Organ Trade

NARCIS (Netherlands)

J.A.E. Ambagtsheer (Frederike)

2017-01-01

markdownabstractOrgan trade constitutes the sale and purchase of organs for financial or material gain. Although prohibited since the 1980s, an increasing number of reports indicate its proliferation across the globe. Yet, many knowledge gaps exist on organ trade, in particular on the demand -and

Organic electroluminescence

CERN Document Server

Kafafi, Zakya H

2005-01-01

Organic light-emitting diode(OLED) technology has achieved significant penetration in the commercial market for small, low-voltage and inexpensive displays. Present and future novel technologies based on OLEDs involve rigid and flexible flat panel displays, solid-state lighting, and lasers. Display applications may range from hand-held devices to large flat panel screens that can be rolled up or hung flat on a wall or a ceiling. Organic Electroluminescence gives an overview of the on-going research in the field of organic light-emitting materials and devices, covering the principles of electroluminescence in organic thin films, as well as recent trends, current applications, and future potential uses. The book begins by giving a background of organic electroluminescence in terms of history and basic principles. It offers details on the mechanism(s) of electroluminescence in thin organic films. It presentsin-depth discussions of the parameters that control the external electroluminescence quantum efficien...

Organizing design work

DEFF Research Database (Denmark)

Scheuer, John Damm

2016-01-01

The aim of this paper is to demonstrate the importance of the kind of understanding of organizing that is implied by design theories for project managers' understanding and organizing of design work. Five theories and their organizing consequences for project managers organizing of design work...... are analyzed. The paper contributes to design research and organization studies by putting the organizing of design projects on the research agenda. It also contributes by demonstrating the importance of being aware of the ontological and epistemological assumptions and organizing consequences of different...... design theories. The selected theories of design thus represent different views on what design is, address different design areas and are based on different ontological and epistemological assumptions that influence their views on how design processes should be organized....

The WSPC Reference on Organic Electronics: Organic Semiconductors

KAUST Repository

Bredas, Jean-Luc

2015-05-12

In this chapter, we provide a basic theoretical perspective on charge-carrier transport in organic semiconductors, with a focus on organic molecular crystals. We introduce the microscopic parameters relevant to the intrinsic charge-transport properties of these materials and describe some of the common quantum-chemical approaches used for their evaluation. We also discuss the nature of the possible charge-transport mechanisms in organic molecular crystals.

Organic optoelectronics

CERN Document Server

Hu, Wenping; Gong, Xiong; Zhan, Xiaowei; Fu, Hongbing; Bjornholm, Thomas

2012-01-01

Written by internationally recognized experts in the field with academic as well as industrial experience, this book concisely yet systematically covers all aspects of the topic.The monograph focuses on the optoelectronic behavior of organic solids and their application in new optoelectronic devices. It covers organic electroluminescent materials and devices, organic photonics, materials and devices, as well as organic solids in photo absorption and energy conversion. Much emphasis is laid on the preparation of functional materials and the fabrication of devices, from materials synthesis a

Organ mass measurements

International Nuclear Information System (INIS)

Kawamura, H.

1998-01-01

The term, anatomical measurements, in the context of this Co-ordinated Research Programme refers to measurements of masses of internal organs, although the human body is composed of internal organs and tissues such as skeleton, muscle, skin and adipose. The mass of an organ containing a radionuclide (source organ), and the mass of a target organ which absorbs energy of the radiation, are essential parameters in the ICRP dosimetric model derived from the MIRD method. Twelve specific organs of interest were proposed at the Coordinated Research Programme Project Formulation Meeting (PFM) in 1988. A slightly different set of thirteen organs with potential significance for radiation protection were selected for study at the Research Co-ordination Meeting held at the Bhabha Atomic Research Centre in 1991. The dimensions of the organs could also be useful information, but were considered unimportant for internal dose assessment. Due to the strong concern about the unified method for collecting organ mass data at the PFM, a guide-line was established stressing the need for organ data from subjects that were healthy and normal, at least until shortly before death, or from sudden death cases, following the Japanese experience. In this report, masses of nine to thirteen organs are presented from seven participating countries. Three participants have also reported the organ masses as fractions of the total body mass

Designing Organizations

DEFF Research Database (Denmark)

Book Description The design of organizations has been an ongoing concern of management theory and practice over the past several decades. Over this time, there has been little change in the fundamental theory, principles and concepts of Organization Design (OD). Recently organizational life has...... changed dramatically with the advent of: new communication systems, adaptive mechanisms, information technology, knowledge management systems, innovation processes and more. This book systemically examines these developments and their impact on OD with contributions from leading scholars in the area...... is a benchmark publication in the field of organization design. By focusing on recent developments in organization design, this book will help to create more thoughtful research and stronger empirical analyses in this important area of management and organization....

Organic optoelectronic materials

CERN Document Server

Li, Yongfang

2015-01-01

This volume reviews the latest trends in organic optoelectronic materials. Each comprehensive chapter allows graduate students and newcomers to the field to grasp the basics, whilst also ensuring that they have the most up-to-date overview of the latest research. Topics include: organic conductors and semiconductors; conducting polymers and conjugated polymer semiconductors, as well as their applications in organic field-effect-transistors; organic light-emitting diodes; and organic photovoltaics and transparent conducting electrodes. The molecular structures, synthesis methods, physicochemical and optoelectronic properties of the organic optoelectronic materials are also introduced and described in detail. The authors also elucidate the structures and working mechanisms of organic optoelectronic devices and outline fundamental scientific problems and future research directions. This volume is invaluable to all those interested in organic optoelectronic materials.

Organic synthesis

International Nuclear Information System (INIS)

Lallemand, J.Y.; Fetizon, M.

1988-01-01

The 1988 progress report of the Organic Synthesis Chemistry laboratory (Polytechnic School, France), is presented. The laboratory activities are centered on the chemistry of natural products, which have a biological activity and on the development of new reactions, useful in the organic synthesis. The research works involve the following domains: the natural products chemistry which are applied in pharmacology, the plants and insects chemistry, the organic synthesis, the radical chemistry new reactions and the bio-organic physicochemistry. The published papers, the congress communications and the thesis are listed [fr

Organic aerosols

International Nuclear Information System (INIS)

Penner, J.E.

1994-01-01

Organic aerosols scatter solar radiation. They may also either enhance or decrease concentrations of cloud condensation nuclei. This paper summarizes observed concentrations of aerosols in remote continental and marine locations and provides estimates for the sources of organic aerosol matter. The anthropogenic sources of organic aerosols may be as large as the anthropogenic sources of sulfate aerosols, implying a similar magnitude of direct forcing of climate. The source estimates are highly uncertain and subject to revision in the future. A slow secondary source of organic aerosols of unknown origin may contribute to the observed oceanic concentrations. The role of organic aerosols acting as cloud condensation nuclei (CCN) is described and it is concluded that they may either enhance or decrease the ability of anthropogenic sulfate aerosols to act as CCN