WorldWideScience

Sample records for pakistani organizations

  1. Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

    International Nuclear Information System (INIS)

    Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

    2017-01-01

    Objective: To determine the frequency of organic acidurais (OA) and amino acidopathies (AA) in selected high-risk patients screened in two years. Study Design: Retrospective Observational study. Place and Duration of Study: The Aga Khan University Hospital (AKUH), Karachi, from January 2013 to December 2014. Methodology: Patients with OA and AA were included in the study and patients with IMDs other than OA and AA were excluded. Amino acids and organic acids were analyzed on high performance liquid chromatography and gas chromatography-mass spectrometry respectively. Clinical data and chromatograms of patients screened for IMDs were reviewed by chemical pathologist and metabolic physician. Results: Eighty-eight cases (4.7 percent) were diagnosed including 41 OA (46.5 percent), 28 AA (31.8 percent) and 19 others (21.5 percent) from 1,866 specimens analyzed. Median age of the patients was 1.1 years, with high consanguinity rate (64.8 percent). Among OA, methyl CoA mutase deficiency was diagnosed in 9 (10.2 percent) and was suspected in 2 (2.3 percent) cases. Five (5.7 percent) cases of MHBD (2-methyl-3-hydroxybutyryl-CoA), 4 (4.5 percent) each of PPA (propionic aciduria) and HMG-CoA lyase deficiency, 3 (3.4 percent) cases each of IVA (isovaleric aciduria), multiple carboxylase deficiency, fructose-1, 6-biphosphatase deficiency, fumarase deficiency, GA-1 (glutaric aciduria type 1) and 2 (2.3 percent) cases of EMA (ethyl-malonic aciduria). AA included 8 (9.1 percent) cases of MSUD (maple syrup urine disease), 6 (6.8 percent) cases of CBS (cystathionine beta-synthetase) and UCDs (urea cycle disorders) each, 5 (5.7 percent) cases of hyperphenylalaninemia and 3 (3.4 percent) cases of hyperprolinemia were reported. Other inherited metabolic disorders included: 9 (10.2 percent) cases of intracellular cobalamin defects, 2 (2.3 percent) cases each of alkaptonuria, Canavan's disease, SUCL (succinate CoA ligase) deficiency, and 1 (1.1 percent) case each of DPD

  2. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  3. Stories of pain and health by elderly Pakistani women in Norway.

    Science.gov (United States)

    Sverre, Beate Lie; Solbrække, Kari Nyheim; Eilertsen, Grethe

    2014-11-01

    This ethnographic study investigates the stories of elderly Pakistani women living in Norway. Migration studies indicate that elderly migrant women are passive, ill victims caught in a marginalized position due to age, ethnicity and gender, and thus have little access to opposition and agency. To broaden the picture it is necessary to develop an innovative approach to understand what is implicated in the process of migration. The importance of considering life conditions that surrounds potential health promotion behaviors of immigrants is stressed by several researchers. However, up to now limited research guided by this perspective has been done in Norway. Therefore, this study explored how elderly Pakistani women in Norway promote their health and well-being through some distinct social interactions. The intention is to bring awareness to how health, even by so-called disadvantaged social groups, may take place. These practices are important to take into consideration when developing health-promoting policies for elderly immigrants. An ethnographic study of 15 Pakistani women, aged 53-75, was carried out in a multisided fieldwork in Oslo using participant observation and ethnographic interviews. The analytical approach was inspired by the constructivist theoretical framework of narrative ethnography. The elderly Pakistani women in Norway construct stories of living in-between cultures and experiences of acculturative stress caused by being elderly, immigrants and women. However, this analysis also suggests that through distinct social relationships, primarily in the context of a voluntary organization, elderly Pakistani women do health by the way they interact and construct a repertoire of social identities. The healing practices taking place among elderly Pakistani women may counteract the negative health outcomes associated with age, migration and gender implications for immigrant health-promoting policy in Norway may be to increase the establishment and

  4. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah

    2005-01-01

    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  5. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.

    1992-10-01

    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  6. PAKISTANIS IN ITALY: THE DISENCHANTMENTS OF “LIVING TRANSNATIONALLY”

    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad

    2010-12-01

    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  7. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  8. Brand equity in the Pakistani hotel industry

    OpenAIRE

    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

    2014-01-01

    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  9. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  10. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements

    Science.gov (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim

    2015-01-01

    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  11. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  12. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  13. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.

    2015-01-01

    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  14. Access to Power: Governance and Development in the Pakistani Electrical Power Sector

    Science.gov (United States)

    Naqvi, Ijlal

    This dissertation explores governance in Pakistan through a study of the state-run electrical power sector. At both the micro and macro level, the Pakistani power sector provides a lens into the heart of the Pakistani state and its governance institutions. This ethnographic and historical study offers an in-depth look at state operations in a developing country, situates the current Pakistani power crisis in a larger context of continuity through periods of dictatorship and democracy, and suggests how efforts to make state service delivery more responsive to citizens might be reconceived. A historical review of the Pakistani power sector establishes first and foremost that the current crisis is the product of longer-term processes for which the policy solutions currently being proposed (with the support of international donors and multilateral lenders) are inadequate. Depoliticized attempts at power sector reform have little to offer in light of the pervasively informal and negotiated nature of the fragmented Pakistani state. The institutions of power sector governance are mutually constituted by the formal rules and the informal---personal relationships, language, violence, money, and power. These rules of the game are as relevant to relations within and between public sector organizations as they are to the engagement of citizens with their state. The same rules apply at the margins of the state---informal squatter settlements---as at the core, though the resources brought to bear and the resultant outcomes are different. The internal incoherence of this state underscores the limitations of formal rules in determining outcomes, and the poor prospects for reform efforts that focus exclusively on the formal aspects of governance. To proactively engage with the question of political will leads away from top-down policy perspectives and counter to the depoliticizing tendencies that currently shape policy reforms. Instead, an energized and informed local participation

  15. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif

    2017-09-01

    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  16. Suicidal ideation in Pakistani college students.

    Science.gov (United States)

    Khokher, Sehar; Khan, Murad M

    2005-01-01

    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  17. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  18. PECUNIA EX MACHINA: PAKISTANI ENTREPRENEURS IN THE CITY OF BARCELONA

    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García

    2010-12-01

    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  19. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2007-01-01

    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  20. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq

    2012-03-01

    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  1. Acceptability of GM foods among Pakistani consumers

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-01-01

    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  2. Acceptability of GM foods among Pakistani consumers.

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-04-02

    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  3. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2006-01-01

    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  4. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  5. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  6. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2012-12-01

    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  7. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.

    2016-01-01

    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  8. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

    Science.gov (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

    2010-01-01

    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  9. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  10. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.

    2018-01-01

    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  11. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  12. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  13. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan

    2014-08-01

    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  14. Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

    Science.gov (United States)

    Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

    2018-02-02

    Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

  15. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia.

    Science.gov (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali

    2008-06-30

    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  16. Understanding the Influence of the Pakistani Government in South Asia

    Science.gov (United States)

    2010-11-01

    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  17. Factors Affecting job satisfaction of employees in Pakistani banking sector

    OpenAIRE

    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

    2010-01-01

    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

  18. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    OpenAIRE

    Syeda Bushra Zaidi

    2016-01-01

    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  19. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  20. LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

    Directory of Open Access Journals (Sweden)

    Muhammad Usman

    2014-12-01

    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  1. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

    Science.gov (United States)

    Ali, Zarqa S.

    2014-01-01

    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  2. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    OpenAIRE

    Summaira Naz

    2015-01-01

    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  3. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-

    2006-01-01

    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  4. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen.

    Science.gov (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes

    2017-01-20

    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  5. Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

    Directory of Open Access Journals (Sweden)

    Shahid Ubeera

    2011-09-01

    Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

  6. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

    OpenAIRE

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-01-01

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  7. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  8. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  9. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

    2013-11-29

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  10. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

    2016-01-01

    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  11. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

    2013-01-01

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  12. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

    2012-01-01

    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  13. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K

    2017-01-01

    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  14. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

    OpenAIRE

    Saghir, Sheeba; Hyland, Lynda

    2017-01-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  15. Important TQM Implementation Contributors in Pakistani Petrochemical Sector

    Directory of Open Access Journals (Sweden)

    Yasir Latif

    2014-10-01

    Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

  16. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    Directory of Open Access Journals (Sweden)

    Syeda Bushra Zaidi

    2016-05-01

    Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

  17. Analysis of toxic metals in branded Pakistani herbal products

    International Nuclear Information System (INIS)

    Saeed, M.; Muhammad, N.; Khan, H.

    2010-01-01

    The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

  18. Statistical Analysis of Pakistani Currency Regime before and after Floatation

    Directory of Open Access Journals (Sweden)

    Shahid ALI

    2011-05-01

    Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

  19. HVDC Transmission an Outlook and Significance for Pakistani Power Sector

    Science.gov (United States)

    Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

    2018-04-01

    Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

  20. Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

    Science.gov (United States)

    Qureshi, Mustafa; Abbas, Zaigham

    2015-01-01

    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  1. Lenses on metacognition: Teachers’ perceptions toward strategies in reading in a Pakistani context

    Directory of Open Access Journals (Sweden)

    Channa, Mansoor A.

    2017-03-01

    Full Text Available The research in the field of metacognition for developing reading is not new; metacognition has been used for many years to identify ways to develop students’ reading comprehension. Most previous research has addressed either primary or secondary level students. However, notably few studies have been conducted at the undergraduate level. This study has attempted to initiate strategies to assist first-year engineering students in developing their reading abilities within a Pakistani context. The primary objective of this research was to identify what strategies first-year engineering students use in developing their reading at Quaid-e-Awam University of engineering science and technology in Pakistan. This study used qualitative instruments that included semi-structured interviews with teachers and classroom observations during read-aloud sessions. The data were organized through NVivo version 8 for obtaining nodes, codes, and main themes for interpreting the results. The results of this study demonstrated that teachers should use metacognitive strategies for developing students’ reading abilities. Findings also revealed that reading strategies, such as text scanning, guesses from contextual clues, drawing on prior knowledge, and using a dictionary, are the most important strategies to use for developing the reading skills and comprehension of engineering students. This study has suggested metacognitive strategies be used for promoting students’ reading abilities and that teachers should design and develop more courses using these strategies to enhance the reading and listening skills of engineering students.

  2. Mineralization and volatilization of 14C-ring labelled 2,4-dichlorophenoxy acetic acid in Pakistani soils

    International Nuclear Information System (INIS)

    Hussain, Altaf; Iqbal, Zafar; Asi, Muhammad Rafique; Chaudhry, Jamil Anwar

    2001-01-01

    The mineralization and volatilization of [U-ring 14 C] 2,4-D in three Pakistani soils was investigated under laboratory conditions using 50 g of soil and uniform distribution of 1.345 μg/g of 2,4-D. Maximum losses of 14 CO 2 and volatile organic compounds occurred at day 7 and losses gradually slowed down after 21 days of incubation. The relative distribution of 14 C losses differed with soil type. Volatilization was higher in control soil as compared to test and treated soil in both the study seasons. The contribution of volatile material to the total loss in 1997 was highest in test soil (24.4%), and lowest in farm soil (19.8%) but in 1998 was highest in control soil (26%) and lowest in test and farm soils (7%) during 1998. (author)

  3. Rigid Basement and the Evolution of the Pakistani Convergent Margin

    Science.gov (United States)

    Haq, S. S.; Davis, D. M.

    2007-12-01

    In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

  4. Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

    Science.gov (United States)

    Mac an Ghaill, Mairtin; Haywood, Chris

    2014-01-01

    This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

  5. Bacteriological (fecal and total coliform) quality of Pakistani coastal water

    International Nuclear Information System (INIS)

    Mashiatullah, A.; Qureshi, R.M.; Javed, T.; Khan, M.S.; Chaudhary, M.Z.; Khalid, F.

    2010-01-01

    The coliform bacteria group consists of several genera of bacteria belonging to the family enterobacteriaceae. These are harmless bacteria, mostly live in soil, water, and digestive system of animals. Fecal coliform bacteria, which belongs to this group, are present in large numbers in feces and intestinal tract of human beings and other warm-blooded animals which can enter into water bodies from human and animal waste. Swimming in water having high levels of Fecal coliform bacteria increases the chance of developing illness (fever, nausea or stomach cramps) from pathogens entering the body through mouth, nose, ears or cuts in the skin. The objective of the present study was to characterize the bathing quality of Pakistani coastal water with respect to coliform bacteria. Total and Fecal coliform bacteria were determined at seven different locations along Pakistan coast using membrane filtration (MF) technique. 100 ml of water was passed through 0.45 micron (mu) filter paper. These filter papers were put on pads, soaked in Lauryle sulphate broth in petri-dishes and incubated at 44 deg. C for Fecal and 37 deg. for Total coliform for 24 hours. Significantly high population of Fecal and Total coliform bacteria was recorded at Karachi harbour area and Indus delta region. Results indicate that a large amount of domestically originated waste is being discharged into these locations without any pre-treatment (e.g., screening, activated sludge, by using filtration beds etc.) resulting in a poor seawater quality making it unfit for bathing. (author)

  6. Coronary anomalies in Pakistani children with tetralogy of fallot

    International Nuclear Information System (INIS)

    Hussain, I.; Patel, N.

    2010-01-01

    To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

  7. Genetic characterization of different pakistani date palm varieties

    International Nuclear Information System (INIS)

    Akhtar, W.; Rashid, A.; Mahmood, T.

    2014-01-01

    Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

  8. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi

    2012-09-01

    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  9. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2003-01-01

    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  10. The prevalence of Y chromosome microdeletions in Pakistani infertile men

    Directory of Open Access Journals (Sweden)

    Rubina Tabassum Siddiqui

    2013-01-01

    Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.

  11. OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

    Directory of Open Access Journals (Sweden)

    Khan Shoaib

    2016-07-01

    Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

  12. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

    Science.gov (United States)

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-04-23

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

  13. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  14. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    Directory of Open Access Journals (Sweden)

    Summaira Naz

    2015-03-01

    Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

  15. Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

    Science.gov (United States)

    Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

    2015-05-01

    In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

  16. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  17. Evaluation of genetic diversity in different Pakistani wheat land races

    International Nuclear Information System (INIS)

    Mahmood, T.; Siddiqua, A.; Rasheed, A.; Nazar, N.

    2011-01-01

    Wheat is one of the main sources of nutrition worldwide. Genetic improvement of the seed makes wheat a source of high quality flour for human consumption and for other industrial uses. With the help of molecular markers, the available germplasm of wheat can be assessed for future breeding programs. Therefore, the aim of the present work was to analyze the genetic diversity among 15 Pakistani wheat land races based on Random Amplified Polymorphism DNA (RAPD) markers. A total of 284 DNA fragments were amplified, ranging in size from 200bp to 1100bp by using six primers. The number of DNA fragments for each primer varied from 2 (OPC-6) to 9 (OPC-8) with an average of 6 fragments per primer. Out of 284 amplified products, 120 were monomorphic and 137 were polymorphic showing an average of 7.8% polymorphism per primer. One specific marker was detected both for OPC-1 and OPC-8, two for OPC-5, while no RAPD specific marker was detected for the remaining primers. The genetic similarity index values ranged from 0.36 to 0.93, with an average of 0.64. Maximum genetic similarity (91%) was observed between Sur bej and Khushkawa. On the contrary, minimum genetic similarity (32%) was observed in Khushkaba-1 and Khushkawa. The dendrogram resulting from the NTSYS cluster analysis showed that the studied genotypes are divided into two main clusters from the same node. The first cluster contained 13 land races, while the second cluster contained only 2 land races. The dendrogram clustered the genotypes into 5 groups and showed efficiency in identifying genetic variability. These results indicated the usefulness of RAPD technique in estimating the genetic diversity among wheat genetic resources. (author)

  18. Cultural perceptions and the productive roles of rural Pakistani women.

    Science.gov (United States)

    Ibraz, T S

    1992-01-01

    The roles of rural Pakistani women in agricultural production are described with numerous examples from a village study by Anwar and Bilquees, and the author's research in a Punjabi village (Rajpur) to show cultural perceptions of women and their work, and the nature of productive activities inside the house and outside on the farm. The cultural perceptions are related to the image of women as dependent/private wives and mothers. A broad definition of production is used to include activities, such as churning milk which generates income and saves expenditures and making butter which fulfills household needs and is sold in the market for cash. Rajpur is a village engaged in social change. Men seek work outside the villages, and women take on work previously assumed by men. Women contribute considerably to the year-round production and processing of major crops. The productive labor of women by major crop type and activity type are described and charted. Tending livestock is performed exclusively by men. Handicraft activity at home reduces expenditure for buying these items in the local markets. Most women were unaware of the savings and "indirect" income their work contributed to the household. Work for wages is viewed as men's work. Women's mobility beyond the fields and home is still limited; market activity must be conducted with a male present and women do not earn cash. The division of labor is conceived by men for women because of women's cultural identity. Women are perceived as "chase daughters/sisters, fertile wives, and nurturing mothers." There are punishments or social rewards for proper behavior. Women in their private domain are expected to "look good within the house," which is viewed as a feminine world. The outside world is masculine. Women are also seen as lacking reasoning ability and their motherhood roles limit their capability to cope with external affairs. There is great value attached to the invisibility of women physically, socially, and

  19. Pakistani medical students' specialty preference and the influencing factors.

    Science.gov (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

    2011-07-01

    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  20. Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

    Science.gov (United States)

    Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

    2015-01-01

    The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

  1. Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2016-01-01

    The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

  2. Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

    Science.gov (United States)

    Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

    2015-01-01

    Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

  3. Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Claussen Bjorgulf

    2006-06-01

    Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

  4. Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2007-01-01

    Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

  5. Comparative Analysis of the Indian and Pakistani Nuclear Energy Development Programmes

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2015-01-01

    Full Text Available Due to the traditional competition between India and Pakistan, their strategic fields developing are interdependent. Nuclear power development programs are concerned as well. Pakistan falls behind India in this branch, however the specifics of the nuclear infrastructure let the potential of the states be relatively balanced. After Nuclear Suppliers Group granted a waiver to India in 2008 and Russia, France and USA, the new participants, broke into the market, India obtained an opportunity to make a breakthrough in the national nuclear program development, thus violating a status quo in fuel cycle technologies. Such chances stimulated China to violate the NSG guidelines and non-proliferations principles to get involved in Pakistani nuclear program development. The nuclear power Indian-Pakistani competition prospects largely depend on the Chinese position. Despite the international community suspects the Pakistani officials in nuclear black market dealing and the NSG guidelines China obviously supports the Pakistani nuclear field. This may result in preventing of escalation of tensions in the region. 

  6. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  7. Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

    Science.gov (United States)

    Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

    2011-01-01

    Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

  8. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  9. Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

    Science.gov (United States)

    Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

    2011-01-01

    This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

  10. Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

    OpenAIRE

    Shakari, Yasmine

    2013-01-01

    Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

  11. She stands alone: Pakistani woman film director, Shireen Pasha.

    Science.gov (United States)

    Mustafa, A

    1995-01-01

    This article describes the activities of film director Shireen Pasha in promoting truth in the mass media in Pakistan. Pasha is described as one who finds it inexcusable in a state-subsidized system that national problems of poverty are not aired openly. Pasha has pursued the goal of exposing the real lives of Pakistanis on film in contrast to the publicly aired segments of "pretty girls in nice drawing rooms." Foreign channels available through satellite communications technology are viewed by Pasha as inappropriate with regard to people's needs and uncreative. Pakistan began with one channel, PTV, which recently refused to air her documentary on living conditions in Pakistan's rural areas "The Travelogue Pakistan." "The Walled City of Lahore" was her film about life in the old city. Both films poetically depicted the honor of humans and their struggle to stay alive. Some of her documentaries are made to show the value of indigenous skills, centuries old know-how, and traditions, regardless of the poverty. Pasha is described as fighting with PTV management over use of resources. Pasha desires to invest in training people to do documentaries or be more field-oriented rather than investing in equipment. Pasha joined PTV in 1975 and left in 1990. Pasha is recognized for her isolation as a woman in the business world, her commitment to exposing remote cultures and truth, and the odds she must confront in attaining her goals. Pasha is committed to doing extensive research, usually conducted during the summer months, in order to construct a credible story line that is produced usually during the winter months. One model of film story line is defined as one where women are portrayed as starting from an indigenous skill or knowledge and shifting to a greater position of power and control over their lives. Pasha believes that people who make films have the responsibility to evoke a reaction in people and to offer solutions. Two acclaimed films, which were supported by

  12. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

    Science.gov (United States)

    Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

    2006-07-10

    In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

  13. British-Pakistani women's perspectives of diabetes self-management: the role of identity.

    Science.gov (United States)

    Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

    2015-09-01

    To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

  14. Sorption-desorption characteristics of benzimidazole based fungicide 2-(4-fluorophenyl)-1h-benzimidazole on physicochemical properties of selected pakistani soils

    International Nuclear Information System (INIS)

    Ahmad, K.S.

    2014-01-01

    A batch equilibrium method has been utilized to investigate the sorption-desorption behavior of a versatile cost-effective fungicide2-(4-fluorophenyl)-1H-benzimidazole) FBNZ on four Pakistani soils geographically distant, from hilly to desert areas. FBNZ is a newly synthesized fungicide prepared in the laboratory and is cost effective than the commercially available fungicides. The adsorption and desorption data were fitted to the Freundlich equation, with values of na = 1, which points to a C-type isotherm. Sorption increases with soil organic carbon content, with greater degree of adsorption for hilly soil and least adsorption on sandy soil of Multan, Punjab. Desorption studies reveal that the adsorbed fungicide are firmly retained by soil particles and present a certain degree of irreversibility. The results indicate that the soil organic matters followed by clay content are the most important soil properties governing the fungicide sorption capacity. (author)

  15. Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

    Directory of Open Access Journals (Sweden)

    Abdul Haque

    2011-01-01

    Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

  16. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

    Science.gov (United States)

    Saghir, Sheeba; Hyland, Lynda

    2017-07-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

  17. Social and cultural construction of obesity among Pakistani Muslim women in North West England.

    Science.gov (United States)

    Ludwig, Alison F; Cox, Peter; Ellahi, Basma

    2011-10-01

    The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

  18. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

    Science.gov (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

    2017-10-01

    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  19. HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Naqi, N.; Ahmed, T.A.; Bashir, M.M.

    2011-01-01

    Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

  20. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

    OpenAIRE

    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

    2013-01-01

    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  1. Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

    Directory of Open Access Journals (Sweden)

    Barton Pelham M

    2011-06-01

    Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

  2. Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

    Directory of Open Access Journals (Sweden)

    IRFAN UL HASAN

    Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

  3. Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

    Science.gov (United States)

    Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

    2013-01-01

    Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

  4. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Hussain Akthar

    2006-07-01

    Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

  5. Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

    Science.gov (United States)

    Mythen, Gabe

    2012-09-01

    Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

  6. Impact of leadership styles on employees’ attitude towards their leader and performance: Empirical evidence from Pakistani banks

    Directory of Open Access Journals (Sweden)

    Muhammad Asrar-ul-Haq

    2016-06-01

    Full Text Available This paper reports the findings of a study examining the impact of managers’ leadership styles on subordinates’ performance. The impact of leadership styles on employee performance outcomes is explored theoretically and tested empirically in the Pakistani banking sector. The sample of the study consisted of 224 full-time employees in the banking sector of Pakistan. Findings of this study reveal that there exists a significant relationship between transformational leadership and employee performance outcomes. However, laissez-faire leadership style showed negative relationship with employee performance outcomes in terms of effectiveness, and employee satisfaction. Banking industry in Pakistan is prone to numerous challenges including employee turnover. Model presented in the study will be helpful for the human resource managers and top management to design effective leadership development programs. HRD department can be established and HRD professionals can be hired to assist the managers in organizing training and development programs. Further, it may help to design strategies to satisfy, retain and motivate the employees. Also, it will help the managers decide, which leadership style they should choose in terms of outcomes.

  7. Different sex ratios of children born to Indian and Pakistani immigrants in Norway

    Directory of Open Access Journals (Sweden)

    Brekke Torkel

    2010-08-01

    Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

  8. A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

    Science.gov (United States)

    Chaudhry, N; Husain, N; Tomenson, B; Creed, F

    2012-06-01

    The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

  9. Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

    Science.gov (United States)

    Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

    2007-01-01

    Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

  10. A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-04-11

    Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  11. Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2014-01-01

    The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

  12. Effective heart disease prevention: lessons from a qualitative study of user perspectives in Bangladeshi, Indian and Pakistani communities.

    Science.gov (United States)

    Netto, G; McCloughan, L; Bhatnagar, A

    2007-03-01

    Coronary heart disease (CHD) has a high mortality, incidence and prevalence among Indian, Pakistani and Bangladeshi communities in the UK, indicating the need for effective heart disease prevention initiatives for these communities. This paper considers how service user perspectives can be used to develop effective, culturally focused CHD prevention interventions for these target groups by addressing identified barriers, including deeply held cultural beliefs. A qualitative research study, using a longitudinal action research approach. This was a community-based study in Edinburgh. Six focus group discussions--two for each community--were organized with participants from these communities at the beginning of the project. A further six focus group discussions for the same communities were organized six months later. Over the period examined, participants reported varying changes in levels of knowledge relating to the nature, causes and symptoms of CHD. Some participants reported taking slight to significant steps to reduce or prevent heart disease, while others did not. The project was viewed as helpful in increasing knowledge about CHD and preventive measures and encouraging healthier lifestyles. However, persistent barriers to change were also identified, requiring changes to the project that involved not only matching intervention materials and messages to observable, superficial characteristics of the target population, but more fundamental changes that address the cultural, social, historical, environmental and psychological forces that influence health behaviour. CHD prevention initiatives need to identify and respond to deep-rooted influences on health-behaviour in 'at-risk' groups, in addition to superficial characteristics of the target populations. It is important for specific prevention initiatives to be linked into wider CHD frameworks to ensure transferability of learning and integration within wider service provision.

  13. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  14. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    OpenAIRE

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

  15. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    Science.gov (United States)

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

  16. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  17. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  18. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

    Science.gov (United States)

    Islam, Kazi Md Mukitul; Asadullah, M Niaz

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

  19. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad

    2014-06-01

    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  20. Molecular and clinical studies of X-linked deafness among Pakistani families.

    Science.gov (United States)

    Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

    2011-07-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

  1. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.

    2015-01-01

    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  2. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    Energy Technology Data Exchange (ETDEWEB)

    Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

    2011-06-15

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  3. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    International Nuclear Information System (INIS)

    Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

    2011-01-01

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  4. Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

    Science.gov (United States)

    Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

    2015-01-01

    Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

  5. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  6. Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2010-11-01

    To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

  7. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

    Science.gov (United States)

    Islam, Kazi Md. Mukitul

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

  8. Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

    Science.gov (United States)

    Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

    2017-07-01

    Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

  9. Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

    Directory of Open Access Journals (Sweden)

    Jaworek Thomas J

    2012-06-01

    Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

  10. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

    Science.gov (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

    2014-01-01

    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  11. "Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

    Science.gov (United States)

    Ghaffar-Kucher, Ameena

    2015-01-01

    Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

  12. Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

    NARCIS (Netherlands)

    Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

    Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

  13. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  14. A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

    NARCIS (Netherlands)

    Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

    2014-01-01

    With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

  15. Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

    Science.gov (United States)

    Nauman, Sarwat; Hussain, Nasreen

    2017-01-01

    Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

  16. A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

    Science.gov (United States)

    Khurshid, Ayesha

    2012-01-01

    Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

  17. When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

    OpenAIRE

    Marwah, Ane Frislid Sveinhaug

    2008-01-01

    This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

  18. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  19. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  20. Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

    Directory of Open Access Journals (Sweden)

    Habib Hussain Khan

    2017-06-01

    Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

  1. STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

    Directory of Open Access Journals (Sweden)

    Abdul RAZIQ

    2014-10-01

    Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

  2. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

    Science.gov (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

    2015-06-01

    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  3. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2011-06-01

    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  4. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  5. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    International Nuclear Information System (INIS)

    Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

    2010-01-01

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  6. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  7. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

    2010-04-15

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  8. Visual representation of gender in flood coverage of Pakistani print media

    Directory of Open Access Journals (Sweden)

    Zarqa S. Ali

    2014-08-01

    Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

  9. Religion, male violence, and the control of women: Pakistani Muslim men in Bradford, UK.

    Science.gov (United States)

    Macey, M

    1999-03-01

    This paper examines Pakistani Muslim male violence in the public and private spheres in Bradford, UK. The article also explores the relationship between male violence and ideas of culture and religion. The material used was collected over a 4-year period from students and staff in further and higher education institutions; working women (prostitutes); survivors of domestic violence; police personnel who work with Asian women fleeing domestic violence or forced marriages; and staff of a children's society working with teenage prostitutes. Methodologies included lectures, seminars, focus groups, and interviews. Findings reveal that there is a difference between male and female attitudes towards Islam. Some men are using it to justify violence against women, while women of all ages and backgrounds are using it as a source of strength and to negotiate (with ingenuity and humor) the cultural and religious requirements which men try to impose upon them.

  10. Patient perspectives on type 2 diabetes and medicine use during Ramadan among Pakistanis in Denmark

    DEFF Research Database (Denmark)

    Mygind, Anna; Kristiansen, Maria; Wittrup, Inge

    2013-01-01

    of Ramadan without adequate counselling on how to adjust their medicines. Objective To explore patient perspectives on medicine use during Ramadan, reasons for fasting and experiences with counselling on medicine use during Ramadan among people of Pakistani background with type 2 diabetes and at least one...... (six interviewers). Results All interviewees pointed out that Islam allows ill people to refrain from fasting during Ramadan. However, all had fasted during Ramadan despite being diagnosed with type 2 diabetes. While fasting, they adapted their use of medicines in different ways, e.g. by changing...... the time of intake or by skipping morning medicines. Fasting during Ramadan meant a feeling of improvement in well-being for all interviewees. Reasons for this improvement included physiological, social and religious aspects. Healthcare professionals were rarely included in the decision-making process...

  11. Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

    DEFF Research Database (Denmark)

    Andersen, Rikke; Brot, Christine; Mejborn, Heddie

    2009-01-01

    Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

  12. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  13. Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

    International Nuclear Information System (INIS)

    Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

    2017-01-01

    To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

  14. Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

    International Nuclear Information System (INIS)

    Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

    2017-01-01

    Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

  15. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

    Science.gov (United States)

    Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

    2012-01-01

    The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

  16. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-04-01

    Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

  17. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2014-12-01

    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  18. Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

    Science.gov (United States)

    Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

    2011-08-01

    The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

  19. Organics.

    Science.gov (United States)

    Chian, Edward S. K.; DeWalle, Foppe B.

    1978-01-01

    Presents water analysis literature for 1978. This review is concerned with organics, and it covers: (1) detergents and surfactants; (2) aliphatic and aromatic hydrocarbons; (3) pesticides and chlorinated hydrocarbons; and (4) naturally occurring organics. A list of 208 references is also presented. (HM)

  20. Organizers.

    Science.gov (United States)

    Callison, Daniel

    2000-01-01

    Focuses on "organizers," tools or techniques that provide identification and classification along with possible relationships or connections among ideas, concepts, and issues. Discusses David Ausubel's research and ideas concerning advance organizers; the implications of Ausubel's theory to curriculum and teaching; "webbing," a…

  1. Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

    Directory of Open Access Journals (Sweden)

    Dr. Abdul Muhaimin

    2017-02-01

    Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

  2. Dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children.

    Science.gov (United States)

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2011-11-25

    There is no data on diet- and activity-related behaviors associated with overweight and obesity among Pakistani school-aged children. The study aimed to explore dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children. A population-based cross-sectional study was conducted with a representative multistage random cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Overweight (>+1 SD) and obesity (>+2 SD) were defined using the World Health Organization reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to body mass index (BMI). Logistic regression was used to quantify the independent predictors and adjusted odds ratios (aOR) with 95% confidence intervals (CI) were obtained. Statistical significance was considered at Psedentary lifestyle>one hour a day (49%) were significantly more likely to be overweight and obese while those participating in physical activity>twice a week (53%) were significantly less likely to be overweight and obese (all Psedentary lifestyle (Ptwice a week (aOR 0.49, 95% CI 0.34-0.70) and sedentary lifestyle>one hour a day (aOR 1.56, 95% CI 1.19-2.03) were independent predictors of being overweight. Skipping breakfast had independent inverse association with physical activity (aOR 0.63, 95% CI 0.45-0.89) and eating fast food and snacks had independent positive association with sedentary lifestyle (aOR 1.79, 95% CI 1.49-2.16). Female gender was independently associated with skipping breakfast (aOR 1.50, 95% CI 1.04-2.16). Male gender (aOR 1.64, 95% CI 1.33-2.02), urban area with high SES (aOR 5.09, 95% CI 3.02-8.60) and higher parental education (aOR 1.74, 95% CI 1.12-2.68) were significant independent predictors of eating fast food and snacks≥once a week. Living in the rural area was

  3. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    OpenAIRE

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2012-01-01

    Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

  4. Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

    Science.gov (United States)

    Uphoff, Eleonora P; Pickett, Kate E; Wright, John

    2016-10-01

    This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

  5. Organizations

    DEFF Research Database (Denmark)

    Hatch, Mary Jo

    and considers many more. Mary Jo Hatch introduces the concept of organizations by presenting definitions and ideas drawn from the a variety of subject areas including the physical sciences, economics, sociology, psychology, anthropology, literature, and the visual and performing arts. Drawing on examples from......Most of us recognize that organizations are everywhere. You meet them on every street corner in the form of families and shops, study in them, work for them, buy from them, pay taxes to them. But have you given much thought to where they came from, what they are today, and what they might become...... prehistory and everyday life, from the animal kingdom as well as from business, government, and other formal organizations, Hatch provides a lively and thought provoking introduction to the process of organization....

  6. Assessment of potential toxicity of a smokeless tobacco product (naswar) available on the Pakistani market.

    Science.gov (United States)

    Zakiullah; Saeed, Muhammad; Muhammad, Naveed; Khan, Saeed Ahmad; Gul, Farah; Khuda, Fazli; Humayun, Muhammad; Khan, Hamayun

    2012-07-01

    'Naswar' is a smokeless tobacco product (STP) widely used in Pakistan. It has been correlated with oral and oesophageal cancer in recent clinical studies. The toxic effects associated with STPs have been associated with trace level contaminants present in these products. The toxin levels of Pakistani naswar are reported for the first time in this study. A total of 30 Pakistani brands of naswar were tested for a variety of toxic constituents and carcinogens such as cadmium, arsenic, lead and other carcinogenic metals, nitrite and nitrate, and nicotine and pH. The average values of all the toxins studied were well above their allowable limits, making the product a health risk for consumers. Calculated lifetime cancer risk from cadmium and lead was 1 lac (100,000) to 10 lac (1,000,000) times higher than the minimum 10E-4 (0.00001) to 10E-6 (0.000001), which is the 'target range' for potentially hazardous substances, according to the US Environmental Protection Agency. Similarly, the level of arsenic was in the range of 0.15 to 14.04 μg/g, the average being 1.25 μg/g. The estimated average bioavailable concentration of arsenic is 0.125-0.25 μg/g, which is higher than the allowable standard of 0.01 μg/g. Similarly, the average minimum daily intake of chromium and nickel was 126.97 μg and 122.01 μg, as compared to allowable 30-35 μg and 35 μg, respectively; a 4-5 times higher exposure. However, beryllium was not detected in any of the brands studied. The pH was highly basic, averaging 8.56, which favours the formation of tobacco specific amines thus making the product potentially toxic. This study validates clinical studies correlating incidence of cancer with naswar use in Pakistan. This study shows that the production, packaging, sale and consumption of naswar should be regulated so as to protect the public from the health hazards associated with its consumption.

  7. Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

    2017-12-01

    South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

  8. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

    Science.gov (United States)

    Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

    2016-12-09

    There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  9. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

    Directory of Open Access Journals (Sweden)

    Atta Abbas Naqvi

    2016-12-01

    Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  10. Correlation of bone mineral density with biochemical markers in different menopausal statuses of Pakistani women

    International Nuclear Information System (INIS)

    Maqsood, A.; Nadia, N.; Farzana, A.; Bashir, A.

    2005-01-01

    Aim: The present study is aimed to use bone mineral density (BMD) and various biochemical markers to predict the fracture risk at different menopausal statuses in Pakistani women. Method: Seventy women aged between 28-80 years at various menopausal statuses participated in this study. BMD (T score) of right calcaneus was determined using SAHARA ultrasound bone densitometer that measures the transmission of high frequency from heel. Various biochemical markers such as alkaline phosphates, calcium and inorganic phosphorus were measured from the serum of venous blood using standard kits of Randox. Results: Alkaline phosphates was raised in per menopausal, postmenopausal and postmenopausal with hysterectomy and ligation groups of women as compared to premenopausal women but did not achieve significance (P>0.05). Serum calcium level was significantly lower in postmenopausal women than premenopausal women and inorganic phosphorus decrease significantly when compared with premenopausal and postmenopausal with ligation and hysterectomy. BMD (T score) values of postmenopausal osteopenic and postmenopausal osteoprotic women were significantly lower than those of premenopausal women. BMD values of women under study have negative correlation with age, alkaline phosphates and calcium. Conclusion: Our study conclude that in addition to BMD, serum levels of alkaline phosphate, calcium and inorganic phosphorus can be valuable biochemical markers in predicting bone fracture risk at different menopausal states. (author)

  11. Toxic metals distribution in different components of Pakistani and imported cigarettes by electrothermal atomic absorption spectrometer

    International Nuclear Information System (INIS)

    Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.

    2009-01-01

    It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy

  12. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  13. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  14. Construct validation of emotional labor scale for a sample of Pakistani corporate employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-02-01

    To translate, adapt and validate emotional labour scale for Pakistani corporate employees. This study was conducted in locale of Rawalpindi and Islamabad from October 2014 to December 2015, and comprised customer service employees of commercial banks and telecommunication companies. It comprised of two independent parts. Part one had two steps. Step one involved translation and adaptation of the instrument. In the second step psychometric properties of the translated scale were established by administering it to customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of emotional labour. Part two comprised the main study. Commercial bank employees were included in the sample by using convenient sampling technique. SPSS 20 was used for data analysis. There were 145 participants in the first study and 495 in the second study . Exploratory factor analysis initially generated three-factor model of emotional labour which was further confirmed by confirmatory factor analysis suggesting that emotional labour had three distinct dimensions, i.e. surface acting, deep acting and genuine expressions of emotions. The emotional labour scale was found to be a valid and reliable measure.

  15. Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

    Directory of Open Access Journals (Sweden)

    Muhammad Arif Soomro

    2016-08-01

    Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

  16. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  17. Chemical composition of particles from traditional burning of Pakistani wood species

    Science.gov (United States)

    Shahid, Imran; Kistler, Magdalena; Mukhtar, Azam; Ramirez-Santa Cruz, Carlos; Bauer, Heidi; Puxbaum, Hans

    2015-11-01

    Total particulate matter (TPM) emitted during burning of three types of Pakistani wood (eucalyptus camaldulensis, local name Safeeda; acacia nilotica, local name Kikar, Babul; dalbergia sissoo, Shisham, Tali) in a traditional brick stove were collected and analyzed for anhydrosugars, sugar alcohols, trace metals, soluble ions and carbonaceous species. This is a first study reporting anhydrosugars in wood smoke particles emitted during traditional burning of common wood types in Pakistan. Carbonaceous species showed the highest contribution to the particulate matter. Although the total carbon (TC) contribution was similar for all burnings (64.8-70.2%), the EC/OC ratio varied significantly, from 0.2 to 0.3 for Accacia and Dalbergia to 0.7-0.8 for Eucalyptus and Wood-mix. Among inorganic constituents potassium chloride and silicon were found at levels higher than 1%. The levoglucosan concentrations ranged from 3.0 to 6.6% (average 5.6%) with the highest value for Accacia and lowest value for the wood-mix. The high levoglucosan/mannosan ratios of 20-28 were typical for hardwood. The ratio between levoglucosan and galactosan varied stronger and was found to be around 13-20 for Accacia, Eucalyptus and Wood mix, and 43 for Dalbergia. The determined levoglucosan concentrations allowed assessing the conversion factor for calculation of biomass smoke contribution to ambient particulate matter levels in Pakistan.

  18. Assessment of dietary intake of trace elements through Pakistani integrated diets

    International Nuclear Information System (INIS)

    Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

    1994-01-01

    A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

  19. Research Output of the Pakistani Library and Information Science Authors: A Bibliometric Evaluation of Their Impact

    Directory of Open Access Journals (Sweden)

    Anwar, Mumtaz Ali

    2017-06-01

    Full Text Available This paper uses 601 cited papers of Pakistani LIS researchers with the purpose to examine the individual performance of these Library and Information Science (LIS researchers in terms of their research output and its impact on the LIS (national/international literature by using various bibliometric indicators. A list of 139 authors was compiled with the help of the Library, Information Science, and Technology Abstracts (LISTA and some other sources. Data were collected from Google Scholar and SPSS version 20 was utilized in order to identify the relationship between self-citations and various performance indices of the authors. The average citations received per paper vary from 1.80 to 10.08. About half of the papers were single-authored whereas less than one-fifth were by three or more authors. The authors who worked in collaboration produced more papers and received more citations. The h-index, g-index, hI-index, hI-norm, and e-index were used to determine the rank for each author. The intra-group citations grid revealed the volume of self-citations and a small group who cite each other more due to close academic and social relationships. The correlations between self-citations and the impact indices used revealed significant differences. Findings are useful for concerned institutions regarding award, promotions, etc. Further, future research should seriously consider the self-citations and social networking of authors while examining their citations-based research performance.

  20. Pakistani Immigrant Children and Adults in Denmark Have Severely Low Vitamin D Status

    DEFF Research Database (Denmark)

    Andersen, Rikke; Mølgaard, C.; Skovgaard, L. T.

    2008-01-01

    association with S-25OHD for men (P = 0.04) and women (P = 0.0008). Twenty-one per cent of the women and 34% of the men had osteopenia. Neither S-25OHD nor S-iPTH was associated with lumbar spine or whole body bone mineral content. Conclusions: Severely low vitamin D status and elevated S-iPTH is common among......, Copenhagen (55 degrees N), January- November. Serum 25-hydroxyvitamin D (S-25OHD), serum intact parathyroid hormone (S-iPTH), bone turnover markers and whole body and lumbar spine bone mineral density were measured. Sun, smoking and clothing habits, age, body mass index (BMI), and vitamin D and calcium from......Objective: To determine vitamin D and bone status in adolescent girls, pre-menopausal women and men of Pakistani origin, to single out determinants of vitamin D status and to determine the association between vitamin D status, bone metabolism and bone status. Subjects/Methods: Cross-sectional study...

  1. Viral Etiologies of Acute Dehydrating Gastroenteritis in Pakistani Children: Confounding Role of Parechoviruses

    Directory of Open Access Journals (Sweden)

    Muhammad Masroor Alam

    2015-01-01

    Full Text Available Despite substantial interventions in the understanding and case management of acute gastroenteritis, diarrheal diseases are still responsible for a notable amount of childhood deaths. Although the rotavirus is known to cause a considerable burden of pediatric diarrheal cases, the roles of other viruses remain undefined for the Pakistani population. This study was based on tertiary care hospital surveillance, from January 2009 to December 2010, including the detection of rotavirus, norovirus, astrovirus, and human parechovirus in children under the age of five using serological or molecular assays. Rotavirus, human parechovirus, norovirus, and astrovirus were detected in 66%, 21%, 19.5%, and 8.5% subjects, respectively. Human parechovirus genotypes, determined through analysis of VP1 gene sequences, showed a great diversity among co-circulating strains. Eighty percent of hospitalized children had dual or multiple viral infections, while 98% parechovirus positive cases were co-infected with rotavirus. The remarkable diversity of viruses associated with the childhood diarrhea in Pakistan calls for large-scale epidemiological surveys, coupled with case control studies, to ascertain their role in clinical manifestations. In addition, these findings also highlight the need for the implementation of up-to-date health interventions, such as the inclusion of a rotavirus vaccine in routine immunization programs for the improvement of quality in child health care.

  2. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  3. Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

    2014-01-01

    Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

  4. Experience of dietary advice among Pakistani-born persons with type 2 diabetes in Oslo.

    Science.gov (United States)

    Fagerli, Rønnaug Aa; Lien, Marianne E; Wandel, Margareta

    2005-12-01

    Experience and implementation of dietary advice are influenced by various factors including ethnic, cultural and religious background. The aim is to explore how ethnic minority persons with diabetes experience dietary advice given by Norwegian health-workers, which strategies they have in response to the advice and how they explain their actions. In-depth interviews were performed with 15 Pakistani-born persons with type 2 diabetes living in Oslo. The analyses are based on the principles of Giorgi's interpretation of phenomenology. The participants expressed great concern to follow the advice. However, narratives about constraints were numerous. These concerned different life-situational factors, but more importantly they were related to communication problems arising from discontinuities between universalising medical knowledge and lay knowledge, as well as between different types of culturally defined lay knowledge. As a consequence, advice was generally experienced as inadequately based on the participant's food-cultural background, leaving the person with diabetes to do the translation between different levels of knowledge. In general health-workers would benefit from expanding their knowledge of the many positive aspects of their patients' cultural background, and apply their knowledge thereafter, whether it concerns (food)-culture or the impact of religion in everyday life.

  5. Depressive disorder and social stress in Pakistan compared to people of Pakistani origin in the UK.

    Science.gov (United States)

    Husain, Nusrat; Chaudhry, Nasim; Tomenson, Barbara; Jackson, Judy; Gater, Richard; Creed, Francis

    2011-11-01

    Depressive disorder is more common in low to middle than high-income countries, but the reasons for this have not been explicitly defined. We compared the results of two population-based studies of people of Pakistani origin: one living in rural Pakistan and one in UK. Both samples were screened with the self-reporting questionnaire followed by research interview to determine depressive disorders and social stress. Logistic regression was used to compare the prevalence of depressive disorder in the two countries after adjustment for socio-demographic characteristics and social stress. The estimated prevalence of depression for men was 35.8% (95% CI 16.1-55.5) in Pakistan and 9% (5.0-13.0) in Manchester (pstress (both sexes). 35% of women in Pakistan and 71% of those in UK had received 8 years or more of education. Extremely poor housing and marked poverty were experienced by 36.1% of women in Pakistan and 0.6% of those in Manchester. In Pakistan, housing and poverty predominated as correlates of depression, whereas in Manchester it was marked difficulties in physical health and close relationships. The results suggest that the higher rate of depressive disorder amongst women in Pakistan compared to UK can be attributed to less education and frequent severe social difficulties. These differences have implications for treatment.

  6. Attitudes towards euthanasia and physician-assisted suicide among Pakistani and Indian doctors: A survey

    Directory of Open Access Journals (Sweden)

    Syed Qamar Abbas

    2008-01-01

    Full Text Available Aim: This study attempts to assess the attitude of Pakistani and Indian doctors to euthanasia and physician-assisted suicide. Methods: We used a questionnaire survey that included one case history of a patient with cancer and another of one suffering from motor neurone disease (MND. Results: Fifty-two of 100 doctors from Pakistan returned the completed questionnaires. Eight of the 52 (15.3% doctors agreed with the concept of euthanasia being an acceptable option for the patient with MND. Six of the 52 (11.5% supported a similar approach for the cancer patient. From India, 60/100 doctors returned the completed questionnaires. Sixteen of the 60 (26.6% doctors supported euthanasia as an option for the patient with MND whereas 15 (25% supported a similar option for the cancer patient. Conclusion: We conclude that only a minority of the doctors support euthanasia. This group belongs to a younger age group. In Pakistan, they were more likely to be males. The religion of the doctors did not appear to be a determining factor.

  7. Characterizing bread wheat genotypes of Pakistani origin for grain zinc biofortification potential.

    Science.gov (United States)

    Rehman, Abdul; Farooq, Muhammad; Nawaz, Ahmad; Al-Sadi, Abdullah M; Al-Hashmi, Khalid S; Nadeem, Faisal; Ullah, Aman

    2018-03-15

    Zinc (Zn) is essential for all life forms and its deficiency is a major issue of malnutrition in humans. This study was carried out to characterize 28 wheat genotypes of Pakistani origin for grain zinc biofortification potential, genetic diversity and relatedness. There was low genetic differentiation among the tested genotypes. However, they differed greatly in yield-related traits, grain mineral (Zn, calcium (Ca) and protein) concentrations and Zn bioavailability. Zinc application increased the concentration of Zn in wheat grain (32.1%), embryo (19.8%), aleurone (47%) and endosperm (23.7%), with an increase in bioavailable Zn (22.2%) and a reduction in phytate concentration (6.8%). Application of Zn also enhanced grain protein and Ca concentrations. Among wheat genotypes, Blue Silver had the highest concentration of Zn in grain, embryo, aleurone and endosperm, with high bioavailable Zn, while Kohinoor-83 had low phytate concentration. Wheat genotypes of Pakistan are genetically less diverse owing to continuous focus on the development of high-yielding varieties only. Therefore genetically diverse wheat genotypes with high endospermic Zn concentration and better grain yield should be used in breeding programs approaches, aiming at improving Zn bioavailability. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  8. Prevalence and risk factors of helicobacter pylori infection among Pakistani population

    International Nuclear Information System (INIS)

    Rasheed, F.; Ahmad, T.; Bilal, B.

    2012-01-01

    Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

  9. Impact on indoor air quality during burning of Pakistani coal briquettes

    International Nuclear Information System (INIS)

    Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.

    1993-01-01

    A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside

  10. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  11. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    International Nuclear Information System (INIS)

    Bhatti, S.M.; Dhakam, S.; Khan, M.A.

    2009-01-01

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  12. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

    International Nuclear Information System (INIS)

    Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

    2010-01-01

    Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

  13. Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

    International Nuclear Information System (INIS)

    RIZK, M.A.

    2010-01-01

    This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

  14. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

    Science.gov (United States)

    Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

    2012-02-27

    A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

  15. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

    Science.gov (United States)

    Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

    2017-01-01

    Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

  16. The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

    Science.gov (United States)

    Goodwin, Laura; Hunter, Billie; Jones, Aled

    2018-02-01

    In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  17. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

  18. POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

    Science.gov (United States)

    Rafique, Rafia; Anjum, Afifa

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  19. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Mir Mohammed

    2012-02-01

    Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

  20. Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Hempler NF

    2015-02-01

    Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

  1. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA

    2017-07-01

    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  2. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    International Nuclear Information System (INIS)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S.

    2013-01-01

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  3. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    Energy Technology Data Exchange (ETDEWEB)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S. [Mayo Hospital, Lahore (Pakistan). Dept. of Medicine

    2013-01-15

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  4. Genotype and phenotype relationships in 10 Pakistani unrelated patients with inherited factor VII deficiency.

    Science.gov (United States)

    Borhany, M; Boijout, H; Pellequer, J-L; Shamsi, T; Moulis, G; Aguilar-Martinez, P; Schved, J-F; Giansily-Blaizot, M

    2013-11-01

    Inherited factor VII (FVII) deficiency is one of the commonest rare bleeding disorders. It is characterized by a wide molecular and clinical heterogeneity and an autosomal recessive pattern of inheritance. Factor VII-deficient patients are still scarcely explored in Pakistan although rare bleeding disorders became quite common as a result of traditional consanguineous marriages. The aim of the study was to give a first insight of F7 gene mutations in Pakistani population. Ten unrelated FVII-deficient patients living in Pakistan were investigated (median FVII:C = 2%; range = 2-37%). A clinical questionnaire was filled out for each patient and direct sequencing was performed on the coding regions, intron/exon boundaries and 5' and 3' untranslated regions of the F7 gene. Nine different mutations (eight missense mutations and one located within the F7 promoter) were identified on the F7 gene. Five of them were novel (p.Cys82Tyr, p.Cys322Ser, p.Leu357Phe, p.Thr410Ala, c-57C>T, the last being predicted to alter the binding site of transcription factor HNF-4). Half of the patients had single mutations in Cys residues involved in disulfide bridges. The p.Cys82Arg mutation was the most frequent in our series. Six of seven patients with FVII:C levels below 10% were homozygous in connection with the high percentage of consanguinity in our series. In addition, we graded the 10 patients according to three previously published classifications for rare bleeding disorders. The use of the bleeding score proposed by Tosetto and co-workers in 2006 appears to well qualify the bleeding tendency in our series. © 2013 John Wiley & Sons Ltd.

  5. Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya.

    Science.gov (United States)

    Adnan, Muhammad; Hölscher, Dirk

    2012-12-01

    Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya Medicinal plants collected in Himalayan forests play a vital role in the livelihoods of regional rural societies and are also increasingly recognized at the international level. However, these forests are being heavily transformed by logging. Here we ask how forest transformation influences the diversity and composition of medicinal plants in northwestern Pakistan, where we studied old-growth forests, forests degraded by logging, and regrowth forests. First, an approximate map indicating these forest types was established and then 15 study plots per forest type were randomly selected. We found a total of 59 medicinal plant species consisting of herbs and ferns, most of which occurred in the old-growth forest. Species number was lowest in forest degraded by logging and intermediate in regrowth forest. The most valuable economic species, including six Himalayan endemics, occurred almost exclusively in old-growth forest. Species composition and abundance of forest degraded by logging differed markedly from that of old-growth forest, while regrowth forest was more similar to old-growth forest. The density of medicinal plants positively correlated with tree canopy cover in old-growth forest and negatively in degraded forest, which indicates that species adapted to open conditions dominate in logged forest. Thus, old-growth forests are important as refuge for vulnerable endemics. Forest degraded by logging has the lowest diversity of relatively common medicinal plants. Forest regrowth may foster the reappearance of certain medicinal species valuable to local livelihoods and as such promote acceptance of forest expansion and medicinal plants conservation in the region. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s12231-012-9213-4) contains supplementary material, which is available to authorized users.

  6. Evidence based workplace interventions to promote breastfeeding practices among Pakistani working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina

    2013-03-01

    Breastfeeding is an essential source of nutrition for young babies; however, it is challenging for employed mothers to continue breastfeeding with employment, especially if workplace support is minimal or missing. In Pakistan, from 1983 to 2008, the prevalence of breastfeeding at 6 months has decreased from 96% to 31%. In this region, workplace barriers have been reported as one of the reasons that result in early cessation of breastfeeding among working mothers. This paper aims at reviewing global literature to explore workplace interventions that can promote the breastfeeding practices among working mothers in Pakistan. A literature search of peer reviewed databases, including CINHAL (1980-2009), MEDLINE (1980-2009), Pub Med (1980-2009), Springer Link (1980-2008), and Cochrane Database of Systematic Reviews (3rd quarter, 2008), was undertaken. Considering the pre-set inclusion and exclusion criteria, out of more than 500 literature sources, 50 were shortlisted and reviewed. A review of global literature revealed that in order to promote breastfeeding practices among employed mothers, the most powerful workplace interventions include: educating working mothers about management of breastfeeding with employment; enhancing employers' awareness about benefits of breastfeeding accommodation at workplace; arranging physical facilities for lactating mothers (including privacy, childcare facilities, breast pumps, and breast milk storage facilities); providing job-flexibility to working mothers; and initiating mother friendly policies at workplace that support breastfeeding. In Pakistani workplace settings, where little attention is paid to sustain breastfeeding practices among working mothers, there is a need to initiate lactation support programmes. These programmes can be made effective by implementing composite interventions at the level of breastfeeding working mothers, employers, and workplace. Copyright © 2012 Australian College of Midwives. Published by Elsevier

  7. A case - control study of risk factors for coronary artery disease in Pakistani females

    International Nuclear Information System (INIS)

    Nazeer, M.; Naveed, T.; Ullah, A.

    2010-01-01

    Objectives: To establish the strength of association of conventional risk factors for coronary artery disease in native Pakistani females. Methods: We conducted a case - control hospital based study on 198 females (age 30 - 80 years) scheduled for their first coronary angiography at Punjab Institute of Cardiology, Lahore. Patients were divided into pre-menopausal group (age: 45.1 +- 6.3) and post-menopausal group (62.1 +- 9.1). For each risk factor, patients with significant CAD (= 50% luminal diameter stenosis) were regarded as cases an those without significant CAD were taken as controls. Odds Ratios (OR) and their 95% confidence intervals (CI) were calculated by univariate analysis. Results: In total study cohort, Diabetes mellitus (OR 3.65 95% CI 2.0 - 6.5), Family history of premature coronary artery disease (OR 2.3, 95% CI 1.2 - 4.4), and increased waist circumference (OR 2.11, 95% CI 1.2 - 3.8) were strongly associated with significant CAD. In post menopausal age group, diabetes mellitus (OR 2.66 CI 1.3 - 5.1), hyperlipidaemia (OR 2.25 CI 1.2 - 2.3) and increased waist circumference (OR 2.16 CI 1.1 - 4.2) reached statistical significance. In pre-menopausal females only diabetes was strongly associated with significant coronary artery disease (OR 10 CI 2.6 - 37.4). Association of hypertension was not significant in any of subgroups studied. Very few cases of smoking (6 / 198) were found in our study to merit any further statistical analysis. Conclusions: Diabetes mellitus was the only risk factor in pre-menopausal females associated with coronary artery disease While diabetes, hyperlipidaemia and increased waist circumference were significantly associated with CAD in post menopausal females. (author)

  8. Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

    Directory of Open Access Journals (Sweden)

    Vaqar Talha

    2008-04-01

    Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

  9. Nucleic acid amplification test for detection of west nile virus infection in pakistani blood donors

    International Nuclear Information System (INIS)

    Niazi, S.K.; Alam, M.

    2017-01-01

    Background: The study was planned to determine the presence of West Nile Virus (WNV) infection in Pakistani blood donors, using Nucleic Acid Amplification Test (NAT). Methods: The blood donors for study were selected on the basis of the standard questionnaire and routine screening results. Six donors were pooled using an automated pipettor and NAT for WNV was performed on Roche Cobas s 201 NAT system. The reactive pools were resolved in Individual Donation-NAT (ID-NAT) format and a sample from FFP bags of reactive donations was retrieved. NAT was again performed on retrieved plasma bag (RPB) sample to confirm the reactive donations. The donors were also recalled and interviewed about history of illness related to recent WNV infection. Results: After serological screening of 1929 donors during the study period, 1860 donors were selected for NAT test for WNV detection. The mean age of the donors was 28±8.77 (range: 18–57 years). 1847 (99.3%) donors were male and 13 (0.7%) were female. NAT for WNV identified six initially reactive pools (0.32%). On follow-up testing with RPB samples, 4 donors (0.21%) were found confirmed reactive for WNV RNA (NAT yield of 1 in 465 blood donors). Conclusion: WNV is a threat to safety of blood products in Pakistan. A screening strategy can be implemented after a large-scale study and financial considerations. One of the reduced cost screening strategies is seasonal screening of blood donors for WNV, with pooling of samples. (author)

  10. Postoperative pain assessment using four behavioral scales in Pakistani children undergoing elective surgery

    Directory of Open Access Journals (Sweden)

    Faisal Shamim

    2015-01-01

    Full Text Available Background: Several measurement tools have been used for assessment of postoperative pain in pediatric patients. Self-report methods have limitations in younger children and parent, nurse or physician assessment can be used as a surrogate measure. These tools should be tested in different cultures as pain can be influenced by sociocultural factors. The objective was to assess the inter-rater agreement on four different behavioral pain assessment scales in our local population. Materials and Methods: This prospective, descriptive, observational study was conducted in Pakistan. American Society of Anesthesiologists I and II children, 3-7 years of age, undergoing elective surgery were enrolled. Four pain assessment scales were used, Children′s Hospital of Eastern Ontario Pain Scale (CHEOPS, Toddler Preschool Postoperative Pain Scale (TPPPS, objective pain scale (OPS, and Face, Legs, Activity, Cry, Consolability (FLACC. After 15 and 60 min of arrival in the postanesthesia care unit (PACU, each child evaluated his/her postoperative pain by self-reporting and was also independently assessed by the PACU nurse, PACU anesthetist and the parent. The sensitivity and specificity of the responses of the four pain assessment scales were compared to the response of the child. Results: At 15 min, sensitivity and specificity were >60% for doctors and nurses on FLACC, OPS, and CHEOPS scales and for FLACC and CHEOPS scale for the parents. Parents showed poor agreement on OPS and TPPS. At 60 min, sensitivity was poor on the OPS scale by all three observers. Nurses showed a lower specificity on FLACC tool. Parents had poor specificity on CHEOPS and rate of false negatives was high with TPPS. Conclusions: We recommend the use of FLACC scale for assessment by parents, nurses, and doctors in Pakistani children aged between 3 and 7.

  11. Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

    Directory of Open Access Journals (Sweden)

    Malik Samina

    2010-01-01

    Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

  12. Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

    2017-10-26

    Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

  13. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  14. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  15. Relationship of thyroid-stimulating hormone with metabolic syndrome in a sample of euthyroid Pakistani population

    International Nuclear Information System (INIS)

    Saleem, M.S.; Khan, K.A.

    2011-01-01

    Metabolic Syndrome is a group of factors that predispose to cardiovascular diseases. The prevalence of metabolic syndrome is rising rapidly. Recently, a few studies have suggested that lower thyroid function in the reference range may be associated with metabolic syndrome, but the issue remains unsettled. We aimed to elucidate the relationship between thyroid function and components of metabolic syndrome in a sample of euthyroid Pakistani population. Methods: This analytical, cross-sectional study was conducted at the Department of Physiology, University of Health Sciences, Lahore, Pakistan, and extended over a period of 12 months. It included 100 subjects with metabolic syndrome in the study group and thirty subjects without metabolic syndrome in the control group with age ranging 45-55 years. Both groups had normal thyroid function. After a detailed history and clinical examination, fasting blood was analysed for glucose, triglycerides, high density lipoprotein-cholesterol along with thyroid-stimulating hormone (TSH) and free thyroxine. Results: Serum TSH was significantly higher in study group than in control group (p=0.040). Serum free thyroxine values of study group were slightly but not significantly lower than those of control group. Serum TSH correlated significantly and positively with serum triglycerides in all subjects and with waist circumference and diastolic blood pressure in men. Serum TSH showed a positive and linear relationship with the number of components of metabolic syndrome (p=0.016) in all subjects. Conclusion: High-normal TSH is associated with metabolic syndrome and its components. There may be increased risk of cardiovascular diseases with high-normal TSH levels. (author)

  16. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Science.gov (United States)

    Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad

    2014-01-01

    Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

  17. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, S M; Dhakam, S; Khan, M.A., E-mail: drsehran@yahoo.co

    2009-10-15

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P< 0.0001). Regarding triglyceride concentrations, 16% had high-risk triglyceride levels, 34% were in the borderline-risk category, whereas 50% had a low-risk triglyceride levels (P< 0.0001). Patient proportion with None, One, Two, or Three Values outside clinical targets on percentage basis were 2, 16, 48, and 34%, respectively (P< 0.0001). Women were found to have greater odds of having LDL cholesterol above the target level i.e. >100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  18. Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-10-01

    To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

  19. Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-06-01

    To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

  20. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  1. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    Energy Technology Data Exchange (ETDEWEB)

    Kamal, N.

    1999-01-01

    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  2. Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

    Science.gov (United States)

    Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

    2013-01-01

    Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

  3. Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

    Directory of Open Access Journals (Sweden)

    Syed Muhammad Aamir Shah

    2012-09-01

    Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

  4. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  5. The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

  6. Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

    Science.gov (United States)

    Tahir, Khazima

    2017-01-01

    This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

  7. Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ilyas Mahwish

    2007-09-01

    Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

  8. Pharmacokinetic study of atorvastain after single dose administration among pakistani population

    International Nuclear Information System (INIS)

    Maqsood, I.; Najmi, M. H.; Mazhar, W.; Janjua, A.; Tayyaba, B.; Sabah, S.; Bader, Z.

    2017-01-01

    Objective: To obtain pharmacokinetic data of Orvastin, a newly launched formulation of atorvastatin, in healthy males of Pakistan. Study Design: It was quasi-experimental design. Place and Duration of Study: Study was conducted at Centre for Research in Experimental and Applied Medicine (CREAM) Army Medical College, Rawalpindi and duration of study was about ten months. Material and Methods: Twenty-four healthy male subjects were taken conveniently from Pakistani population. Two tablets of Orvastin, each containing atorvastatin 40mg, were administered orally as a single dose. Multiple blood samples were taken with small gaps in between up to the period of 48hrs. High Performance Liquid Chromatography (HPLC) with UV-detector was used for quantification of atorvastatin in plasma; wavelength of UV-detector was adjusted at 247nm. Mobile phase was made up of 60 percent acetonitrile and 40 percent 0.05M sodium phosphate buffer. Flow rate of mobile phase was maintained at 1.5ml/min with 5.5 pH. Progesterone was used as an internal standard. Stock solutions of atorvastatin were made by dissolving it into methanol and acetonitrile was used for making stock solution of progesterone. Calibration curves were made for atorvastatin and internal standard from oncentration time data, values for time to achieve maximum plasma concentration. (Tmax) and maximum plasma concentration (Cmax) were directly calculated. Computer program (APO, MW PHARM, and Ver. 3.60) was used for calculation of pharmacokinetic profile of atorvastatin. Results: Atorvastatin was detected in plasma samples of all volunteers. The absorption rate constant (Ka) was 0.41 l/hr. Cmax was 26.69 ± 6.67 µg/l and Tmax was 3.33 ± 0.41 hrs. Apparent volume of distribution (Vd), of atorvastatin, was 3244.84 ± 1237.36 liters. The elimination rate constant was 0.15 l/hr. Elimination half-life of atorvastatin was 6.14 hours. Trapezoidal rule was used for calculation of AUC /sub 0-48/ and AUC /sub 0-∞/ and it was found

  9. Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families.

    Directory of Open Access Journals (Sweden)

    Sobia Shafique

    Full Text Available The frequency of inherited bilateral autosomal recessive non-syndromic hearing loss (ARNSHL in Pakistan is 1.6/1000 individuals. More than 50% of the families carry mutations in GJB2 while mutations in MYO15A account for about 5% of recessive deafness. In the present study a cohort of 30 ARNSHL families was initially screened for mutations in GJB2 and MYO15A. Homozygosity mapping was performed by employing whole genome single nucleotide polymorphism (SNP genotyping in the families that did not carry mutations in GJB2 or MYO15A. Mutation analysis was performed for the known ARNSHL genes present in the homozygous regions to determine the causative mutations. This allowed the identification of a causative mutation in all the 30 families including 9 novel mutations, which were identified in 9 different families (GJB2 (c.598G>A, p.Gly200Arg; MYO15A (c.9948G>A, p.Gln3316Gln; c.3866+1G>A; c.8767C>T, p.Arg2923* and c.8222T>C, p.Phe2741Ser, TMC1 (c.362+18A>G, BSND (c.97G>C, p.Val33Leu, TMPRSS3 (c.726C>G, p.Cys242Trp and MSRB3 (c.20T>G, p.Leu7Arg. Furthermore, 12 recurrent mutations were detected in 21 other families. The 21 identified mutations included 10 (48% missense changes, 4 (19% nonsense mutations, 3 (14% intronic mutations, 2 (9% splice site mutations and 2 (9% frameshift mutations. GJB2 accounted for 53% of the families, while mutations in MYO15A were the second most frequent (13% cause of ARNSHL in these 30 families. The identification of novel as well as recurrent mutations in the present study increases the spectrum of mutations in known deafness genes which could lead to the identification of novel founder mutations and population specific mutated deafness genes causative of ARNSHL. These results provide detailed genetic information that has potential diagnostic implication in the establishment of cost-efficient allele-specific analysis of frequently occurring variants in combination with other reported mutations in Pakistani populations.

  10. Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

    2013-06-01

    breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

  11. A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

    Directory of Open Access Journals (Sweden)

    Rebecca Garcia

    2017-04-01

    Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  12. Preservation of Cultural Heritage Embodied in Traditional Crafts in the Developing Countries. A Case Study of Pakistani Handicraft Industry

    Directory of Open Access Journals (Sweden)

    Yongzhong Yang

    2018-04-01

    Full Text Available Cultural heritage embodied in traditional crafts is an integral part of any nation which reflects the culture and tradition of a particular region. Although the importance of handicraft has been widely recognized, the literature regarding preservation of traditional craft is scarce. The present paper aimed to explore and identify issues faced by traditional craftsmanship in developing countries and to address those issues in order to contribute to the sustainability of traditional craft heritage and ensure continuous transmission of craft skills and knowledge from generation to generation. Our study identified several key issues which poses substantial challenges to the preservation of traditional craft heritage in developing countries. In order to add empirical evidence, we examined the case of Pakistani handicraft industry that provided further understanding of highlighted issues which traditional craft heritage face. We have suggested some policies to promote, develop and preserve the traditional craft heritage. The significance of these policy suggestions is underlined with the case study of Pakistan.

  13. The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

    Science.gov (United States)

    Williams, Lisa; Ralphs, Rob; Gray, Paul

    2017-03-21

    The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

  14. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  15. Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

    Directory of Open Access Journals (Sweden)

    Barton Pelham

    2011-08-01

    Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

  16. Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2013-01-01

    To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

  17. Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

    Science.gov (United States)

    Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

    2010-06-01

    Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

  18. Isolation, identification, screening of toxicity and oligopeptides of some marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the search for bioactive natural compounds

    OpenAIRE

    Hameed, Shaista

    2009-01-01

    Cyanobacteria produce a number of bioactive compounds, most of them are oligopeptides. Almost all are known from freshwater species. The aim of this study was to search for marine and brackish water species producing bioactive compounds. To reach this goal, new strains were isolated from Norwegian and Pakistani coastal waters. These and additional strains from NIVA, UiO and UiB culture collections (24 in total), belonging to Chroococcales and Oscillatoriales, were identified based on morpholo...

  19. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  20. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  1. Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Eivind Andersen

    2011-08-01

    Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

  2. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

    Science.gov (United States)

    Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

    2017-09-01

    Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

  3. Frequency of different disorders requiring warfarin therapy and its outcome in terms of dosage and inr value in pakistani population

    International Nuclear Information System (INIS)

    Qayyum, A.; Najmi, M.H.

    2014-01-01

    To determine the frequency of different disorders requiring warfarin therapy and to see the target INR and warfarin dose requirement in Pakistani population. Study Design:Descriptive study. Setting and Duration of Study: The study was carried out at Armed Forces Institut e of Cardiology (AFIC) Rawalpindi, Military Hospital Rawalpindi and National Institute of Cardiovascular Diseases (NICVD), Karachi, Pakistan from October 2010 to March 2012. Patients and Methods: Stable patients taking warfarin therapy were recruited after detailed medical history, physical examination and laboratory tests. The demographic and clinical data of individuals were entered in a pre-structured proforma. Patients suffering from hepatic and renal disease, any co-morbid disease or taking any concurrent medication or diet which would have affected warfarin therapy, were excluded. Data was analyzed using PSS version 20.0. Results: A total of 607 stable patients fulfilling the eligibility criteria, participated in the study. There were 297 (48.9%) male and 310 (51.1%) female patients. The mean age was 37.93 +- 12.23 years (range 18-65 years). The most common indication for warfarin therapy was valvular heart diseases (93.4%) followed by atrial fibrillation (2.3%) whereas other indications for warfarin use are less commonly seen in our study population. Patients had mean international normalized ratio (INR) value of 2.3 +9- 0.8 (range 1.5-3.5). Mean daily dose of warfarin calculated in 607 patients was 5.62 and 1.98 mg with the range of 0.36-15 g whereas mean weekly dose was 39.36 +- 13.8 mg with the range of 2.5-105 mg. Conclusion: In Pakistani population the most common indications for warfarin use are valvular heart diseases followed by atrial fibrillation. The mean INR values were within recommended range of 2-3. The mean daily dose observed in long-term therapy is comparable to the empirical dose of 5 mg routinely started in clinical practice. (author)

  4. Bilateral Moyamoya Disease in a 2-Year-Old Pakistani Male Treated with Bilateral Encephaloduroarteriosynangiosis: A Positive Outcome

    Directory of Open Access Journals (Sweden)

    Shahvaiz Magsi

    2016-01-01

    Full Text Available Background. We present a rare case of bilateral moyamoya disease presenting as multiple strokes and neurological deficits, treated with the neurosurgical procedure, encephaloduroarteriosynangiosis (EDAS, in a 2-year-old male Pakistani minor. A positive outcome was achieved and the patient recovered fully. Case Summary. Our patient presented with a history of seizures and multiple episodes of hemiparesis (on and off weakness at the age of 2 years. He had a delayed speech development and could not speak more than a few words. He had a slight slurring of speech too. He was diagnosed with bilateral moyamoya disease on Computed Tomography Angiography (CTA. Bilateral EDAS was done in the same year, after which his symptoms improved and patient had moderate functional recovery. Conclusion. A rare disease, moyamoya has been left unexplored in Pakistan; physicians and surgeons when dealing with cases in the pediatric population presenting with symptoms of stroke, signs of generalized weakness, and seizures should consider moyamoya disease as a possibility. Furthermore, this case demonstrates the effectiveness of EDAS procedure for the treatment of moyamoya disease.

  5. TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

    Science.gov (United States)

    Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

    2015-01-01

    A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

  6. Influences of religion and culture on continuing bonds in a sample of British Muslims of Pakistani origin.

    Science.gov (United States)

    Hussein, Hanan; Oyebode, Jan R

    2009-11-01

    This study considered the nature of continuing bonds with deceased relatives in a sample of Pakistani Muslims living in the United Kingdom. Ten participants were interviewed following a cultural psychology approach and transcripts were analyzed using grounded theory methodology. Dreaming, talking with others about the deceased, following the deceased's example, keeping memories and mementos, and doing actions thought to help the deceased were forms of continued relationship found. These were intertwined with the process of grieving and were influenced by the family, culture, and religion. Religion was a strong influence on the prominence given by participants to finishing well and on the notion of doing actions thought to help the deceased. Cultural mores, such as the community, and collectivist ethos and the expectation that emotion would be expressed around the time of death, were found to be supportive for some but sources of tension for other participants. Expressing a continuing bond through following the deceased's example so as to make them proud or happy seemed to be reinforced by cultural roots in respect for elders. Participants gave instances of tensions in areas such as expression of emotion and communality versus individualism that arose as a result of their position between two cultural frameworks, some illustrating how assimilation into the host culture set up conflict with the expected norms of their family/ancestral culture. The study highlights how understanding different cultural and religious influences may enrich the concept of continuing bonds.

  7. The Effect of Perceiving a Calling on Pakistani Nurses' Organizational Commitment, Organizational Citizenship Behavior, and Job Stress.

    Science.gov (United States)

    Afsar, Bilal; Shahjehan, Asad; Cheema, Sadia; Javed, Farheen

    2018-03-01

    People differ considerably in the way in which they express and experience their nursing careers. The positive effects associated with having a calling may differ substantially based on individuals' abilities to live out their callings. In a working world where many individuals have little to no choice in their type of employment and thus are unable to live out a calling even if they have one, the current study examined how perceiving a calling and living a calling interacted to predict organizational commitment, organizational citizenship behavior, and job stress with career commitment mediating the effect of the interactions on the three outcome variables. The purpose of the study is to investigate the mediating effect of career commitment between the relationships of calling and (a) nurses' attitudes (organizational commitment), (b) behaviors (organizational citizenship behavior), and (c) subjective experiences regarding work (job stress). Using a descriptive exploratory design, data were collected from 332 registered nurses working in Pakistani hospitals. Descriptive analysis and hierarchical regression analysis were used for data analysis. Living a calling moderated the effect of calling on career commitment, organizational citizenship behavior, and job stress, and career commitment fully mediated the effect of calling on organizational commitment, organizational citizenship behavior, and job stress. Increasing the understanding of calling, living a calling, and career commitment may increase nurses' organizational commitment and organizational citizenship behavior and decrease job stress. The study provided evidence to help nursing managers and health policy makers integrate knowledge and skills related to calling into career interventions and help nurses discover their calling.

  8. "What is this genetics, anyway?" Understandings of genetics, illness causality and inheritance among British Pakistani users of genetic services.

    Science.gov (United States)

    Shaw, Alison; Hurst, Jane A

    2008-08-01

    Misconceptions about basic genetic concepts and inheritance patterns may be widespread in the general population. This paper investigates understandings of genetics, illness causality and inheritance among British Pakistanis referred to a UK genetics clinic. During participant observation of genetics clinic consultations and semi-structured interviews in Urdu or English in respondents' homes, we identified an array of environmental, behavioral and spiritual understandings of the causes of medical and intellectual problems. Misconceptions about the location of genetic information in the body and of genetic mechanisms of inheritance were common, reflected the range of everyday theories observed for White British patients and included the belief that a child receives more genetic material from the father than the mother. Despite some participants' conversational use of genetic terminology, some patients had assimilated genetic information in ways that conflict with genetic theory with potentially serious clinical consequences. Additionally, skepticism of genetic theories of illness reflected a rejection of a dominant discourse of genetic risk that stigmatizes cousin marriages. Patients referred to genetics clinics may not easily surrender their lay or personal theories about the causes of their own or their child's condition and their understandings of genetic risk. Genetic counselors may need to identify, work with and at times challenge patients' understandings of illness causality and inheritance.

  9. Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

    Science.gov (United States)

    Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

    2016-01-01

    We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  10. Urdu translation and validation of shorter version of Positive Affect and Negative Affect Schedule (PANAS) on Pakistani bank employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-10-01

    To translate, adapt and validate shorter version of positive affect and negative affect scale on Pakistani corporate employees. This cross-sectional study was conducted in the twin cities of Islamabad and Rawalpindi from October 2014 to December 2015. The study was completed into two independent parts. In part one, the scale was translated by forward translation. Then it was pilot-tested and administered on customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of positive affect and negative affect scale. Part two comprised the main study. Commercial bank employees were included in the sample using convenient sampling technique. Data of the main study was analysed using confirmatory factor analysis in order to establish construct validity of positive affect and negative affect scale. There were145 participants in the first part of the study and 495 in the second. Results of confirmatory factor analysis confirmed the two-factor structure of positive affect and negative affect scale suggesting that the scale has two distinct domains, i.e. positive affect and negative affect. The shorter version of positive affect and negative affect scale was found to be a valid and reliable measure.

  11. Study of Biochemical Changes and Elevated Levels of Enzymes in Salmonella typhi Infected Patients in Pakistani Population

    Directory of Open Access Journals (Sweden)

    Ayesha Shamim

    2012-04-01

    Full Text Available Typhoid fever causes significant biochemical changes and hepatic complications. As many studies have indicated several biochemical parameters that are involved in developing the risk of typhoid fever. The current study was designed to evaluate these risk factors in general Pakistani population. Serum biochemistry and liver enzymes were studied to investigate the relationship of these risk factors to Typhoid fever. Total 100 subjects were studied, 50 healthy individuals and 50 typhoid patients. Blood samples were collected from Allied and National Hospital, Faisalabad, Pakistan. In this study, Nested PCR was used to test the samples. Elevated level of ALT (P<0.0001 and AST (P<0.0001 were observed in typhoid patients. Typhoid patients had significantly higher concentrations of Triglyceride (P=0.0044, Globulin (P=0.0004 and Total protein (P=0.0978 while LDL (P=0.0197, Albumin (P<0.0001, Glucose (P=0.0006, HDL-cholesterol (P<0.0001 and Cholesterol (P=0.04 were significantly lower than those of healthy individuals. This study appears to be ample evidence based on the physiological and biochemical parameters in typhoid patients to explain influence of typhoid morbidity. Extensive research in this field would enable us to make modern drugs to treat typhoid fever patients.

  12. Evaluation of a cross-cultural training program for Pakistani educators: Lessons learned and implications for program planning.

    Science.gov (United States)

    Mazur, Rebecca; Woodland, Rebecca H

    2017-06-01

    In this paper, we share the results of a summative evaluation of PEILI, a US-based adult professional development/training program for secondary school Pakistani teachers. The evaluation was guided by the theories of cultural competence (American Psychological Association, 2003; Bamberger, 1999; Wadsworth, 2001) and established frameworks for the evaluation of professional development/training and instructional design (Bennett, 1975; Guskey, 2002; King, 2014; Kirkpatrick, 1967). The explicit and implicit stakeholder assumptions about the connections between program resources, activities, outputs, and outcomes are described. Participant knowledge and skills were measured via scores on a pre/posttest of professional knowledge, and a standards-based performance assessment rubric. In addition to measuring short-term program outcomes, we also sought to incorporate theory-driven thinking into the evaluation design. Hence, we examined participant self-efficacy and access to social capital, two evidenced-based determinants or "levers" that theoretically explain the transformative space between an intervention and its outcomes (Chen, 2012). Data about program determinants were collected and analyzed through a pre/posttest of self-efficacy and social network analysis. Key evaluation findings include participant acquisition of new instructional skills, increased self-efficacy, and the formation of a nascent professional support network. Lessons learned and implications for the design and evaluation of cross-cultural teacher professional development programs are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Investigation of total seed storage proteins of pakistani and japanese maize (zea mays l.) through sds-page markers

    International Nuclear Information System (INIS)

    Shinwari, Z.K.

    2014-01-01

    The assessment of genetic diversity among the members of a species is of vital importance for successful breeding and adaptability. In the present study 83 genotypes of maize of Pakistani and Japanese origin were evaluated for the total seed storage proteins using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) through vertical slab unit. The total protein subunits were separated on 12% polyacrylamide gel using standard protocols. A total of 18 protein subunits were noted out of which 7 (39%) were monomorphic and 11 (61%) were polymorphic, with molecular weight ranging from 10 to 122 kDa. Coefficients of similarity among the accessions ranged between 0.89 and 1.00. The dendrogram obtained through UPGMA clustering method showed two main clusters: 1 and 2. First cluster comprised of 9 genotypes including Sahiwal-2002, while second cluster contained 74 genotypes including Aaiti-2002 and Sadaf. Over all a low level of polymorphism was observed in total seed storage protein patterns of maize genotypes from Pakistan as well as Japan. It is inferred from the present study that more genotypes of maize could be brought under study and more advanced biochemical techniques with more reliable results could be followed to bring assessment of genetic diversity of maize for planning breeding programs. (author)

  14. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector. Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy. Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  15. Angiotensin Converting Enzyme Gene I/D Polymorphism in Pakistani Rheumatic Heart Disease Patients and Healthy Controls

    Directory of Open Access Journals (Sweden)

    Sadia Rehman

    2015-09-01

    Full Text Available Background: Valve scarring and collagen deposition are crucial in pathogenesis of Rheumatic Heart Disease (RHD, an autoimmune disorder of the heart. Angiotensin I-Converting Enzyme (ACE plays a major role in fibrous tissue formation. Objectives: The present research work aimed to assess the role of ACE Insertion/Deletion (I/D polymorphism in progress of RHD. Patients and Methods: DNA was pre pared from blood samples from 156 RHD patients (156 and 204 healthy ethnically-matched controls. Then, it was screened using sequence-specific Primers. Polymerase chain reaction and Agarose gel electrophoresis. The data were analyzed using Vassar stats (http://faculty.vassar.edu/lowry/VassarStats.html. Results: I allele (P = 0.024, OR = 1.42 and II genotype (P = 0.001, OR = 3.07 were significantly higher in Pakistani RHD patients compared to the healthy controls. Also, a significant difference was found between the female, but not male, patients and the controls regarding I allele and II genotype. Conclusions: The study results provided information about involvement of ACE I/D polymorphism in molecular mechanism of RHD. Thus, it can become one of the useful tools in risk assessment and help with designing strategies to combat the disease.

  16. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector.Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy.Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  17. Investigating Social Commerce as an Alternate Model for Online Commerce in Developing Countries: a case of Pakistani Economy

    Directory of Open Access Journals (Sweden)

    Amina Talat

    2013-05-01

    Full Text Available The study is an empirical quantitative research. In light of intense literature review it proposes a new model for effectiveness of social commerce in Pakistan. It has three objectives. It firstly investigates the relationship between perceived risk, social networking focus, and perceived value effect trust. It secondly investigates the relationship between affective influence, word of mouth, affective influence, advertising influence, purchasing experience and viral reach on social commerce. Lastly it investigates how consumer value (adoption and purchase intention is affected by social commerce focus and trust. The software used is SPSS 15.0. Multiple regression equation has been employed to verify the hypotheses. Results show and validate the literature that positive or favorable views of users trigger positive attitude. However, there are two variables and dimensions that do not affect the attitude of users on social networks from the perspective of shopping i.e. social commerce; these are viral reach and previous purchasing experience on different websites. The results show that Pakistani users will welcome social commerce even if they have no previous experience for purchasing goods and services online.

  18. Young Norwegian-Pakistani Women and Sport: How Does Culture and Religiosity Matter?

    Science.gov (United States)

    Walseth, Kristin; Strandbu, Åse

    2014-01-01

    Studies from several countries show that girls with an immigrant background participate in organized sports to a lesser extent than other young people. Barriers related to culture and religion serve in many of these studies as explanations. In this article we suggest that the notions of culture and religion in this field of studies could be…

  19. Perspectives of UK Pakistani women on their behaviour change to prevent type 2 diabetes: qualitative study using the theory domain framework.

    Science.gov (United States)

    Penn, Linda; Dombrowski, Stephan U; Sniehotta, Falko F; White, Martin

    2014-07-08

    Type 2 diabetes (T2D) is a debilitating disease, highly prevalent in UK South Asians, and preventable by lifestyle intervention. The 'New life, New you' (NLNY) physical activity (PA) and dietary intervention for T2D prevention was culturally adapted to better engage minority ethnic populations and tested for feasibility. To investigate Pakistani female participants' perspectives of their behaviour change and of salient intervention features. A community-based 8-week programme of group delivered PA sessions with behavioural counselling and dietary advice, culturally adapted for ethnic minority populations, in an area of socioeconomic deprivation. Participants to NLNY were recruited through screening events in community venues across the town. Interviews were conducted with 20 Pakistani female NLNY participants, aged 26-45 (mean 33.5) years, from different parts of town. Within the a priori Theoretical Domains Framework (intentions and goals, reinforcement, knowledge, nature of the activity, social role and identity, social influences, capabilities and skills, regulation and decision, emotion and environment), we identified the importance of social factors relating to participants' own PA and dietary behaviour change. We also identified cross-cutting themes as collateral benefits of the intervention including participants' 'psychological health'; 'responsibility' (for others' health, especially family members included in the new PA and diet regimes) and 'inclusion' (an ethos of accommodating differences). Our findings suggest that culturally adapted interventions for Pakistani women at risk of T2D, delivered via group PA sessions with counselling and dietary advice, may encourage their PA and dietary behaviour change, and have collateral health and social benefits. The NLNY intervention appeared to be acceptable. We plan to evaluate recruitment, retention and likely effect of the intervention on participant behaviour prior to definitive evaluation. Published by the

  20. Promoting smoking cessation in Bangladeshi and Pakistani male adults: design of a pilot cluster randomised controlled trial of trained community smoking cessation workers

    Directory of Open Access Journals (Sweden)

    Gill Paramjit

    2009-08-01

    Full Text Available Abstract Background The prevalence of smoking is higher among Pakistani and Bangladeshi males than among the general population. Smokers who receive behavioural support and medication quadruple their chances of stopping smoking, but evidence suggests that these populations do not use National Health Service run stop smoking clinics as frequently as would be expected given their high prevalence of smoking. This study aims to tackle some of the main barriers to use of stop smoking services and adherence to treatment programmes by redesigning service delivery to be more acceptable to these adult male populations. The study compares the effectiveness of trained Pakistani and Bangladeshi smoking cessation workers operating in an outreach capacity ('clinic + outreach' with standard care ('clinic only' to improve access to and success of National Health Service smoking cessation services. Methods/design This is a pilot cluster randomised controlled trial based in Birmingham, UK. Super output areas of Birmingham will be identified in which more than 10% of the population are of Pakistani and/or Bangladeshi origin. From these areas, 'natural geographical communities' will be identified. Sixteen aggregated agglomerations of super output areas will be identified, separating areas from each other using buffer regions in order to reduce potential contamination. These natural communities will be randomised to 'clinic + outreach' (intervention or 'clinic only' (control arms. The use of stop smoking services and the numbers of people quitting smoking (defined as prolonged self-reported abstinence at four weeks, three months and six months will be assessed in each area. In addition, we will assess the impact of the intervention on adherence to smoking cessation treatments and patient satisfaction. Trial registration Current Controlled Trials ISRCTN 82127540.

  1. Autozygosity mapping of a large consanguineous Pakistani family reveals a novel non-syndromic autosomal recessive mental retardation locus on 11p15-tel

    DEFF Research Database (Denmark)

    Rehman, Shoaib ur; Baig, Shahid Mahmood; Eiberg, Hans

    2011-01-01

    done in all sampled individuals in the family. The nuclear central loop in the five generation family showed homozygosity for a 6-Mb telomeric region on 11p15, whereas all other linkage regions were excluded by calculation of logarithm of odds (LOD) for the SNP microarray data. A maximum LOD score of Z......Autosomal recessive inherited mental retardation is an extremely heterogeneous disease and accounts for approximately 25% of all non-syndromic mental retardation cases. Autozygosity mapping of a large consanguineous Pakistani family revealed a novel locus for non-syndromic autosomal recessive...

  2. Genetic analysis of basmati and non-basmati Pakistani rice (oryza sativa l.) cultivars using microsatellite markers

    International Nuclear Information System (INIS)

    Rabbani, M.A.; Masood, M.A.; Shinwari, Z.K.

    2010-01-01

    Information of genetic variability and relatedness among rice genotypes is essential for future breeding programmes and derivation of superior cultivars. The objective of the present study was to evaluate the genetic relationship among traditional and improved cultivars of Pakistani rice and to determine differences in the patterns of variation between two indica rice groups: basmati and nonbasmati. Forty-one cultivars were evaluated by means of 30 microsatellite markers distributed over the whole rice genome. A total of 104 alleles were detected by 30 markers, all of them (100%) were polymorphic. The number of alleles generated by each marker ranged from 2 to 6 with an average of 3.5 alleles marker-1. Polymorphism information content (PIC) varied from 0.259 to 0.782 with an average of 0.571. A significant positive correlation (r = 0.71) was found between the number of alleles at SSR locus and the PIC values. Pair-wise Nei and Li's similarity coefficients ranged from 0.10 to 0.99. A dendrogram based on cluster analysis by microsatellite polymorphism grouped 41 rice cultivars into 2 major groups effectively differentiating the late maturing, tall and slender-grain basmati and other aromatic rice cultivars from the early, short statured, short bold and long bold grain non-aromatic cultivars. Higher level of genetic diversity between basmati and non-basmati support the concept that former had a long history of independent evolution and diverged from nonbasmati rice a long time ago through human selection and patronage. Present investigation further indicated that genetically basmati rice is different from that of coarse indica and japonica type. The results suggested that microsatellite markers could efficiently be utilized for diversity analysis, and differentiation of basmati and non-basmati rice cultivars. In addition, marker-based identification of traditional basmati rice may help in maintaining the integrity of this high quality product to the benefit of both

  3. Clinical safety and parameters of maximum oxygen uptake (Vo/sub 2/ max) testing in pakistani patients with heart failure

    International Nuclear Information System (INIS)

    Hussain, S.; Kayani, A.M.

    2015-01-01

    To determine the parameters of maximum oxygen uptake (VO2 max) in a Pakistani systolic heart failure cohort and its safety in a clinical setting. Study Design: Descriptive study. Place and Duration of Study: Armed Forces Institute of Cardiology, National Institute of Heart Diseases, Rawalpindi, from June 2011 to January 2013. Methodology: Maximum oxygen uptake test was performed in patients with severe heart failure, who could perform the VO2 max treadmill test. Age, Body Mass Index (BMI) ejection fraction, VO2 max and respiratory exchange ratios and their correlations were determined. Results: Out of 135 patients, 77% (n=104) were males, with a mean age of 45.9 ± 15.7 years. Weight of patients ranged from 30 kg to 107 kg (mean 63.29 ± 13.6 kg); mean BMI was 23.16 ± 4.56 kg/m2. All patients presented with either NYHA class of III (50.3%; n=68) or IV (49.7%; n=67); mean ejection fraction was 22.54 ± 5.7% (10 - 35%, IQ:20 - 25). The VO2 max of the patients ranged from 3 to 32 ml/kg/minute (mean 12.85 ± 4.49 ml/kg/minute). Respiratory exchange ratio was over 1 for all patients (1.12 - 1.96, mean = 1.36 ± 0.187). There was a negative correlation with age (r = -0.204; p = 0.028) whereas a positive correlation was found with exercise time (r = 0.684; p = 0.000), hemoglobin (r = 0.190; p = 0.047) and ejection fraction (r = 0.187 ; p = 0.044). Conclusion: Cardiopulmonary exercise testing in a high-risk heart failure cohort is safe and provides information beyond the routine clinical evaluation of heart failure patients. (author)

  4. Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Mubashir Zafar

    2013-01-01

    Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

  5. Meaning of 9/11 for two Pakistani communities: from external intruders to the internalisation of a negative self-image.

    Science.gov (United States)

    Rousseau, Cécile; Jamil, Uzma

    2008-12-01

    Since September 11, the increase in international tensions and the subsequent wars in Afghanistan and Iraq have created turmoil and fears in immigrant communities, fanned by the media in the context of the war against terrorism. This paper aims to compare the meaning systems evoked around 9/11 within two Pakistani groups-an immigrant community in Montreal and a group in Karachi. It also intends to examine the representation of themselves and of the 'Other' within these two groups. Results suggest that both Karachi and Montreal Pakistani respondents favour a conspiracy scenario which protects the Muslim community from the responsibility of 9/11 events. They refer to an argumentation process based on 'proofs', thus mirroring the political rhetoric used by the US government and its allies to justify the military intervention in Iraq. In the Montreal group, the pervasive feeling of fear and the bleak image that the community has of itself support the hypothesis of an immigrant internalisation of the negative representations of Muslim and South Asian identities in the North American context. The negative self-image observed in these minority groups indicates that more effort than ever should be dedicated to understanding the impact of the present international context on minority-majority relations in multi-ethnic societies. It is as if America is sitting right here in the living room with us … We have to ask them permission to breathe. (Parveen, Karachi).

  6. Processing of Pakistani carbonatites for separation of cerium from adjacent rare earths

    International Nuclear Information System (INIS)

    Akram, M.; Qazi, N.K.; Khan, M.F.; Hasan, G.H.; Ahmed, N.; Chughtai, N.A.

    2003-01-01

    Carbonatite rock of Loe-Shilman area in North Western Frontier Province (NWFP) of Pakistan contains rare earth elements. This rock was upgraded in terms of its rare earths content from 2,000 ppm to 10,000 ppm rare earths oxide (REO) by crushing, calcination at 1000 deg. C for 3 hrs and cold leaching with 2% HCl for 1 hr. 80% to 95% of rare earths present in carbonatite powder were digested in nitric acid at 60 deg. C after 2 hrs stirring. Tributyl phosphate (TBP), diluted with dodecane, was used as extractant for extraction of rare earths. Since extraction is dependent on pH of the aqueous feed solution, the role of nitrate ions concentration in the solvent extraction of rare earth elements (REEs) was studied. It was observed that extraction of REEs was maximum at pH 1.1. The solvent had been unable to extract REEs from high acidic feed solutions. Solvents of different molarities were also tried against aqueous phase of pH 1.1. Studies showed a poor gain at 0 M and 0.5 M of organic phase while no gain observed beyond 2 molar solvent. 1 M organic phase gave maximum yield of rare earths salt, Ln(OH)/sub 3/, when stripped solution precipitated with ammonium hydroxide solution. It was also observed that if aqueous solution of 3.0 N was treated with blank solvent (i.e. Molarity = 0), it gave almost the same result. It was further established that optimum quantity of caging agent, Al(NO/sub 3/)/sub 3/-9H/sub 2/O added to aqueous solution prior to pH adjustment (i.e. 10 gm/100 gm powder dissolved) suppressed fluoride ions (F') which were hindering the extraction of rare earths. This improved the extraction efficiency of desired elements. To optimise the process parameters like solvent dilution, aqueous to organic ratio and extraction/stripping times, a' series of experiments were performed. Recovery for the desired elements had been between 78% to 86%. The optimum extraction parameters were found to be TBP concentration 40% (v/v) for aqueous to organic ratio 1:5 and 50

  7. Differences in the pregnancy gestation period and mean birth weights in infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK: a retrospective analysis of routinely collected data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-08-11

    To compare mean birth weights and gestational age at delivery of infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK. Retrospective analysis using routinely recorded secondary data in Ciconia Maternity information System, between 2008 and 2013. Luton, UK. Mothers whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian and living in Luton, aged over 16, who had a live singleton birth over 24 weeks of gestation were included in the analysis (n=14 871). Primary outcome measures were mean birth weight and gestational age at delivery. After controlling for maternal age, smoking, diabetes, gestation age, parity and maternal height and body mass index at booking, a significant difference in infants' mean birth weight was found between white British and Indian, Pakistani and Bangladeshi infants, F(3, 12 287)=300.32, pmothers, compared with Indian mothers (Wald=8.192, df 1, pmothers and preterm delivery, when compared with Pakistani, Bangladeshi and white British women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. Adsorption and desorption characteristic of benzimidazole based fungicide carbendazim in pakistani soils

    International Nuclear Information System (INIS)

    Ahmad, K.S.; Rashid, N.; Tazaiyen, S.; Nazar, M.F.

    2013-01-01

    A versatile cost-effective Benzimidazole based fungicide, Carbendazim (methyl 1H-benzimidazole-2 carboxylate ) has been utilized to investigate its sorption-desorption behaviour on physicochemical properties of geographical soils, ranging from hilly to desert areas of Pakistan, via batch equilibrium method. The data obtained in all tests showed that adsorption co-efficient isotherm for Carbendazim in four tested soil were well fitted the freundlich equation. Distribution co-efficient (K d ) parameters are low (3.59 to 11.60 ml micro g/sup -1/) indicating low adsorption. It was observed that Carbendazim showed a relatively greater degree of adsorption on soil samples (Soil 4) that were collected from northern hilly areas Ayubia, Khyber Pakhton khaw (KPK) (Silt loam) i.e.11.60 ml mu g/sup -1/ and least adsorption on sandy Soil of Multan Punjab(Soil 2). While other two soils 1 were collected from Murree region, a boarder of Punjab and KPK mountain area and Soil 3 from Tarnol, Islamabad. Desorption studies reveal that the adsorbed fungicide is firmly retained by soil particles and their adsorption are almost irreversible. The results indicate that soil organic matter (SOM) and appropriate pH also play key role in sorption capacity. (author)

  9. A systematic review of treatment response rates in Pakistani hepatitis C virus patients; current prospects and future challenges

    Science.gov (United States)

    Ali, Muhammad; Afzal, Samia; Zia, Asad; Hassan, Ahmed; Khalil, Ali Talha; Ovais, Muhammad; Shinwari, Zabta Khan; Idrees, Muhammad

    2016-01-01

    Abstract Background: The estimated hepatitis C virus (HCV) carriers are approximately 10 million in Pakistan which usually progresses to chronic hepatitis, with rare cases of spontaneous viral eradication. The present article reviews the treatment status of HCV infection in Pakistani population and various factors associated with the treatment response rates. Methods: Literature on anti-HCV therapy was searched in PubMed, Google Scholar and PakMediNet. Thirty three different studies representing different geographic regions of Pakistan published from 2002 to 2016 were included in the present review. Weighted mean, standard error estimates (SE) and standard deviation (SD) were determined for each population group. Results: Mean value for sustained virological response (SVR) for standard IFN plus ribavirin (RBV) combination therapy was 68.38% ± 14.13% (range 33.8%–87.10%; SE 3.08) and pegylated-IFN plus RBV combination therapy 64.38% ± 8.68% (range 55.0%–76.00%; SE 3.88). The lowest value for SVR has been reported to be 24.3% (for genotype 1; administering INF-α 2b 3MU 3 times/week and RBV 1000–1200 mg/day for 48 weeks) while highest of 87.5% (genotype 3a; INF-α 2a 3MU 3 times/week and RBV 1000–1200 mg/day for 24 weeks). The mean value for rapid virological response (RVR) was found to be 48.18% ± 29.20% (SE 9.73). As PEG-interferon and direct acting antivirals (DAAs) are relatively expensive, interferon-alfa (IFN-α) and RBV combination therapy have been used widely to treat HCV infected patients in Pakistan for the last one and half decade. On average, 2.45% of the patients discontinued treatment due to severe side effects. Conclusion: We encourage further studies on understanding host and viral factors associated with specific focus on harder to treat viral variants (relapsers and nonresponders). These variants are currently rising in the country. PMID:27977575

  10. A review on the elemental contents of Pakistani medicinal plants: Implications for folk medicines.

    Science.gov (United States)

    Aziz, Muhammad Abdul; Adnan, Muhammad; Begum, Shaheen; Azizullah, Azizullah; Nazir, Ruqia; Iram, Shazia

    2016-07-21

    Substantially, plants produce chemicals such as primary and secondary metabolites, which have significant applications in modern therapy. Indigenous people mostly rely on traditional medicines derived from medicinal plants. These plants have the capacity to absorb a variety of toxic elements. The ingestion of such plants for medicinal purpose can have imperative side effects. Hence, with regard to the toxicological consideration of medicinal plants, an effort has been made to review the elemental contents of ethno medicinally important plants of Pakistan and to highlight the existing gaps in knowledge of the safety and efficacy of traditional herbal medications. Literature related to the elemental contents of ethno medicinal plants was acquired by utilizing electronic databases. We reviewed only macro-elemental and trace elemental contents of 69 medicinal plant taxa, which are traditionally used in Pakistan for the treatment of sundry ailments, including anemia, jaundice, cancer, piles, diarrhea, dysentery, headache, diabetes, asthma, blood purification, sedative and ulcer. A majority of plants showed elemental contents above the permissible levels as recommended by the World health organization (WHO). As an example, the concentrations of Cadmium (Cd) and Lead (Pb) were reportedly found higher than the WHO permissible levels in 43 and 42 medicinal plants, respectively. More specifically, the concentrations of Pb (54ppm: Silybum marianum) and Cd (5.25ppm: Artemisia herba-alba) were found highest in the Asteraceae family. The reported medicinal plants contain a higher amount of trace and toxic elements. Intake of these plants as traditional medicines may trigger the accumulation of trace and toxic elements in human bodies, which can cause different types of diseases. Thus, a clear understanding about the nature of toxic substances and factors affecting their concentrations in traditional medicines are essential prerequisites for efficacious herbal therapeutics with

  11. Spectrum Of Inherited Metabolic Disorders In Pakistani Children Presenting At A Tertiary Care Centre

    International Nuclear Information System (INIS)

    Cheema, H. A.; Malik, H. S.; Parkash, A.; Fayyaz, Z.

    2016-01-01

    Objective: To determine the frequency, presentation and outcome of various inherited metabolic diseases in children presenting in a tertiary care hospital, Lahore, Pakistan. Study Design: An observational study. Place and Duration of Study: Gastroenterology, Hepatology and Nutrition Department of The Children Hospital and Institute of Child Health, Lahore, from January 2011 to October 2014. Methodology: All children aged < 14 years with high suspicion of a metabolic disorder were inducted. Routine and radiological investigation were carried out at the study place. Comprehensive diagnostic testing of particular metabolic disorder was sent abroad. Those with a specific metabolic disorder were included in the study while those with normal metabolic work-up were excluded. All data was collected on preformed proforma. Result: A total of 239 patients were enrolled. Nineteen different types of inherited metabolic disorders were diagnosed in 180 patients; age ranged from 8 days to 14 years. Consanguinity was positive in 175 (97 percentage) among the parents of the affected children, with previously affected siblings in 64 (35.5 percentage). The most frequent disorders were inherited disorders of carbohydrate metabolism (92, 51 percentage), lipid storage disease (59, 32.7 percentage), organic acidemia and energy defects (18, 10 percentage), amino acid disorder (6, 3.3 percentage), and miscellaneous (4, 2.2 percentage). Fifty-eight (32.2 percentage) presented with acute metabolic crisis, 28 (15.5 percentage) patients presented with early onset liver failure, and 24 (13.3 percentage) with mental retardation. Out of these, 16 (8.8 percentage) expired. Conclusion: Glycogen storage disorders being the commonest followed by Gaucher disease and Galactosemia. The associated complications resulted in high morbidity and mortality. (author)

  12. Association of food security status with overweight and dietary intake: exploration of White British and Pakistani-origin families in the Born in Bradford cohort.

    Science.gov (United States)

    Yang, T C; Sahota, P; Pickett, K E; Bryant, M

    2018-04-24

    Food insecurity has been associated with dietary intake and weight status in UK adults and children although results have been mixed and ethnicity has not been explored. We aimed to compare prevalence and trajectories of weight and dietary intakes among food secure and insecure White British and Pakistani-origin families. At 12 months postpartum, mothers in the Born in Bradford cohort completed a questionnaire on food security status and a food frequency questionnaire (FFQ) assessing their child's intake in the previous month; at 18 months postpartum, mothers completed a short-form FFQ assessing dietary intake in the previous 12 months. Weights and heights of mothers and infants were assessed at 12-, 24-, and 36-months postpartum, with an additional measurement of children taken at 4-5 years. Associations between food security status and dietary intakes were assessed using Wilcoxon-Mann-Whitney for continuous variables and χ 2 or Fisher's exact tests for categorical variables. Quantile and logistic regression were used to determine dietary intakes adjusting for mother's age. Linear mixed effects models were used to assess longitudinal changes in body mass index (BMI) in mothers and BMI z-scores in children. At 12 months postpartum, White British mothers reported more food insecurity than Pakistani-origin mothers (11% vs 7%; p secure (β = 0.44 units, 95% CI: 0.33, 0.55). This was also found in Pakistani-origin children (BMI z-score: food insecure β = 0.40 units, 95% CI: 0.22, 0.59; food secure β = 0.25 units, 95% CI: 0.20, 0.29). No significant increases in BMI were observed for food secure or insecure White British mothers while BMI z-score increased by 0.17 (95% CI: 0.13, 0.21) for food secure White British children. Food insecure mothers and children had dietary intakes of poorer quality, with fewer vegetables and higher consumption of sugar-sweetened drinks. Food security status is associated with body weight and dietary intakes

  13. Estimating risk of atherosclerotic cardiovascular diseases in non-atherosclerotic Pakistani patients: Study conducted at National Institute of Cardiovascular Diseases, Karachi, Pakistan

    International Nuclear Information System (INIS)

    Ashraf, T.; Achakzai, A.S.; Farooq, F.; Memon, M.A.

    2017-01-01

    This cross-sectional study was carried out at the National Institute of Cardiovascular Disease, Karachi, from July 2014 to March 2015, and comprised male and female subjects with multi-ethnic background, aged 20-79 years and having non-atherosclerotic disease. SPSS 22 was used for data analysis. Results: Of the 437 participants, 174(39.8%) were men and 263(60.2%) were women. The overall mean age was 42.65+-11.45 years. The mean age of men was 43.3+-12.1 years and that of women was 42.2+-10.8 years. Moreover, ten-year and lifetime risk assessment rates were higher in men (50[28.2%] and 86[49.4%] respectively) compared to women (28[10.6%] and 84[31.9%], respectively). Conclusion: Urdu-speaking Pakistanis were found to be at higher risk from atherosclerotic cardiovascular disease.

  14. Association of body fat and vitamin D status and the effect of body fat on the response to vitamin D supplementation in Pakistani immigrants in Denmark

    DEFF Research Database (Denmark)

    Grønborg, Ida Marie; Lundby, M.; Mølgaard, C.

    2015-01-01

    Vitamin D deficiency and obesity are both prevalent conditions in the northern countries, especially among immigrants. The aims were to assess the possible relationship between body fat and vitamin D status, and to investigate the effect of body fat on the response to oral vitamin D supplementation...... in Pakistani immigrants in Denmark. Data were obtained from a 1-year double-blind randomised controlled trial with oral vitamin D supplementation. A total of 122 women and men received either vitamin D3 supplementation (10 or 20 μg/day) or placebo. No association was found between body fat percentage...... and vitamin D status in a multiple linear regression model (Passociation between body fat percentage and vitamin D status, and body fat percentage had...

  15. Addressing key issues in the consanguinity-related risk of autosomal recessive disorders in consanguineous communities: lessons from a qualitative study of British Pakistanis.

    Science.gov (United States)

    Darr, A; Small, N; Ahmad, W I U; Atkin, K; Corry, P; Modell, B

    2016-01-01

    Currently, there is no consensus regarding services required to help families with consanguineous marriages manage their increased genetic reproductive risk. Genetic services for communities with a preference for consanguineous marriage in the UK remain patchy, often poor. Receiving two disparate explanations of the cause of recessive disorders (cousin marriage and recessive inheritance) leads to confusion among families. Further, the realisation that couples in non-consanguineous relationships have affected children leads to mistrust of professional advice. British Pakistani families at-risk for recessive disorders lack an understanding of recessive disorders and their inheritance. Such an understanding is empowering and can be shared within the extended family to enable informed choice. In a three-site qualitative study of British Pakistanis, we explored family and health professional perspectives on recessively inherited conditions. Our findings suggest, firstly, that family networks hold strong potential for cascading genetic information, making the adoption of a family-centred approach an efficient strategy for this community. However, this is dependent on provision of high-quality and timely information from health care providers. Secondly, families' experience was of ill-coordinated and time-starved services, with few having access to specialist provision from Regional Genetics Services; these perspectives were consistent with health professionals' views of services. Thirdly, we confirm previous findings that genetic information is difficult to communicate and comprehend, further complicated by the need to communicate the relationship between cousin marriage and recessive disorders. A communication tool we developed and piloted is described and offered as a useful resource for communicating complex genetic information.

  16. Minority ethnic community participation in needs assessment and service development in primary care: perceptions of Pakistani and Bangladeshi people about psychological distress.

    Science.gov (United States)

    Kai, Joe; Hedges, Clive

    1999-03-01

    OBJECTIVES: To promote community participation in exploring perceptions of psychological distress amongst Pakistani and Bangladeshi people, in order to develop appropriate services. DESIGN: Training and facilitation of resident community members (as community project workers), to define and conduct qualitative research involving semistructured interviews in their own communities, informing primary care led commissioning and service decision making. Setting A socio-economically disadvantaged inner-city locality in the UK. Participants One-hundred and four South Asian people (49 of Pakistani and 55 of Bangladeshi origin), interviewed by 13 resident community members. RESULTS: All community project workers completed training leading to a National Vocational Qualification, and successfully executed the research. Most study respondents located their main sources of stress within pervasive experience of racism and socio-economic disadvantage. They were positive about 'talking' and neutral listening as helpful, but sought strategies beyond non-directive counselling services that embraced practical welfare advice and social support. The roles of primary health care professionals were believed to be restricted to physical ill health rather than personal distress. The importance of professionals' sex, age, ethnicity and social status were emphasized as affecting open communication. Practical recommendations for the re-orientation and provision of services were generated and implemented in response to the findings, through dialogue with a primary care commissioning group, Health and Local Authority, and voluntary agencies. CONCLUSIONS: The work illustrates the feasibility and value of a community participation approach to research and service development in addressing a challenging and neglected area of minority ethnic health need. It offers one model for generating responsive service change in the context of current health policy in the UK, whilst also imparting skills and

  17. Maternity services in multi-cultural Britain: using Q methodology to explore the views of first- and second-generation women of Pakistani origin.

    Science.gov (United States)

    Cross-Sudworth, Fiona; Williams, Amanda; Herron-Marx, Sandy

    2011-08-01

    to explore first- and second-generation Pakistani women's experiences of maternity services and the inter generational differences/comparisons. a retrospective Q methodology study of Pakistani women following childbirth. two Children's Centres in an inner city in the West Midlands. women self-identified following distribution of information leaflets at Children's Centres. Fifteen women took part in interviews (Stage one) using a semi-structured design and 16 women participated in the completion of the Q grid sorting (Stage four). a standard five-stage Q methodology process took place: (1) initial data were gathered using a combination of individual face-to-face and focus group semi-structured community-based interviews (developing the concourse); (2) transcribed interviews were analysed for 'themes'; (3) the themes were reduced to 'statements' that reflected the overall content of the concourse using an unstructured evolving approach (giving the Q set); (4) participants were asked to sort the statements (Q sorting) according to a pre-designed distribution grid providing individual participant response grids; and (5) the response grids were factor analysed using PQ Method (V2.11), which generates clusters of participants rather than clusters of variables. Factor loadings were calculated using factor analysis by principal components with varimax rotation. This produced a list of factors, each of which represents a 'story' of women's experiences of maternity services. Throughout the process, an Urdu interpreter was involved. six factors were identified: (1) confidence and empowerment of women who had attended higher education and had family support; (2) isolation of some women from both family and maternity services; (3) women who had poor experiences of maternity services but good family support, and wanted opportunities to be involved in service development; (4) women with positive experiences of maternity care and influenced by traditional cultural practices; (5

  18. Clinical Utility of a Coronary Heart Disease Risk Prediction Gene Score in UK Healthy Middle Aged Men and in the Pakistani Population.

    Directory of Open Access Journals (Sweden)

    Katherine E Beaney

    Full Text Available Numerous risk prediction algorithms based on conventional risk factors for Coronary Heart Disease (CHD are available but provide only modest discrimination. The inclusion of genetic information may improve clinical utility.We tested the use of two gene scores (GS in the prospective second Northwick Park Heart Study (NPHSII of 2775 healthy UK men (284 cases, and Pakistani case-control studies from Islamabad/Rawalpindi (321 cases/228 controls and Lahore (414 cases/219 controls. The 19-SNP GS included SNPs in loci identified by GWAS and candidate gene studies, while the 13-SNP GS only included SNPs in loci identified by the CARDIoGRAMplusC4D consortium.In NPHSII, the mean of both gene scores was higher in those who went on to develop CHD over 13.5 years of follow-up (19-SNP p=0.01, 13-SNP p=7x10-3. In combination with the Framingham algorithm the GSs appeared to show improvement in discrimination (increase in area under the ROC curve, 19-SNP p=0.48, 13-SNP p=0.82 and risk classification (net reclassification improvement (NRI, 19-SNP p=0.28, 13-SNP p=0.42 compared to the Framingham algorithm alone, but these were not statistically significant. When considering only individuals who moved up a risk category with inclusion of the GS, the improvement in risk classification was statistically significant (19-SNP p=0.01, 13-SNP p=0.04. In the Pakistani samples, risk allele frequencies were significantly lower compared to NPHSII for 13/19 SNPs. In the Islamabad study, the mean gene score was higher in cases than controls only for the 13-SNP GS (2.24 v 2.34, p=0.04. There was no association with CHD and either score in the Lahore study.The performance of both GSs showed potential clinical utility in European men but much less utility in subjects from Pakistan, suggesting that a different set of risk loci or SNPs may be required for risk prediction in the South Asian population.

  19. Antimicrobial activity of the bioactive components of essential oils from Pakistani spices against Salmonella and other multi-drug resistant bacteria

    Science.gov (United States)

    2013-01-01

    Background The main objective of this study was the phytochemical characterization of four indigenous essential oils obtained from spices and their antibacterial activities against the multidrug resistant clinical and soil isolates prevalent in Pakistan, and ATCC reference strains. Methods Chemical composition of essential oils from four Pakistani spices cumin (Cuminum cyminum), cinnamon (Cinnamomum verum), cardamom (Amomum subulatum) and clove (Syzygium aromaticum) were analyzed on GC/MS. Their antibacterial activities were investigated by minimum inhibitory concentration (MIC) and Thin-Layer Chromatography-Bioautographic (TLC-Bioautographic) assays against pathogenic strains Salmonella typhi (D1 Vi-positive), Salmonella typhi (G7 Vi-negative), Salmonella paratyphi A, Escherichia coli (SS1), Staphylococcus aureus, Pseudomonas fluorescens and Bacillus licheniformis (ATCC 14580). The data were statistically analyzed by using Analysis of Variance (ANOVA) and Least Significant Difference (LSD) method to find out significant relationship of essential oils biological activities at p essential oils, oil from the bark of C. verum showed best antibacterial activities against all selected bacterial strains in the MIC assay, especially with 2.9 mg/ml concentration against S. typhi G7 Vi-negative and P. fluorescens strains. TLC-bioautography confirmed the presence of biologically active anti-microbial components in all tested essential oils. P. fluorescens was found susceptible to C. verum essential oil while E. coli SS1 and S. aureus were resistant to C. verum and A. subulatum essential oils, respectively, as determined in bioautography assay. The GC/MS analysis revealed that essential oils of C. cyminum, C. verum, A. subulatum, and S. aromaticum contain 17.2% cuminaldehyde, 4.3% t-cinnamaldehyde, 5.2% eucalyptol and 0.73% eugenol, respectively. Conclusions Most of the essential oils included in this study possessed good antibacterial activities against selected multi

  20. Representation of Oriental Travelees and Locus in Jurgen Wasim Frembgen’s Travelogue: The Closed Valley: With Fierce Friends in Pakistani Himalays

    Directory of Open Access Journals (Sweden)

    Ahmad Gholi

    2016-11-01

    Full Text Available The oft despised and ignored genre of travel writing was recognized as worthy of scholarly investigation in 1970s thanks to Edward Said’s Orientalism, the wave of deconstructionism, and postcolonialism (Calzati, 2015. For these scholars, travel writers do not present a transparent window to an alien space and its residents even though they normally claim it. For them the representation of the traveled terrain and travelees is an ideological construction which is tainted with the travel writer’s ‘habitus’ and ‘field’ and crafted through fictional devices. In this regard, by drawing on postcolonial methodology, the current study seeks to evince how Frembgen in his travelogue, The Closed Valley: With Fierce Friends in Pakistani Himalayas which narrates his voyage to Harban, a far-flung mountainous region in Pakistan Himalaya, reproduces the pitfalls of previous Western travel writers when he depicts his destination and travelees in negative terms. From his perspective, his timeless traveled locus is rife with violence, yet a space to escape from dehumanizing ambience of the West. Additionally, for him the women in this tribal region are tyrannized by husbands and victimized by Muslim extremists. Last but not least, he portrays this remote oriental space as an object of curiosity which needs to be salvaged textually.

  1. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  2. Experimental investigations on a diesel engine operated with fuel blends derived from a mixture of Pakistani waste tyre oil and waste soybean oil biodiesel.

    Science.gov (United States)

    Qasim, Muhammad; Ansari, Tariq Mahmood; Hussain, Mazhar

    2017-10-18

    The waste tyre and waste cooking oils have a great potential to be used as alternative fuels for diesel engines. The aim of this study was to convert light fractions of pyrolysis oil derived from Pakistani waste vehicle tyres and waste soybean oil methyl esters into valuable fuel and to reduce waste disposal-associated environmental problems. In this study, the waste tyre pyrolysis liquid (light fraction) was collected from commercial tyre pyrolysis plant and biodiesel was prepared from waste soybean oil. The fuel blends (FMWO10, FMWO20, FMWO30, FMWO40 and FMWO50) were prepared from a 30:70 mixture of waste tyre pyrolysis liquid and waste soybean oil methyl esters with different proportions of mineral diesel. The mixture was named as the fuel mixture of waste oils (FMWO). FT-IR analysis of the fuel mixture was carried out using ALPHA FT-IR spectrometer. Experimental investigations on a diesel engine were carried out with various FMWO blends. It was observed that the engine fuel consumption was marginally increased and brake thermal efficiency was marginally decreased with FMWO fuel blends. FMWO10 has shown lowest NOx emissions among all the fuel blends tested. In addition, HC, CO and smoke emissions were noticeably decreased by 3.1-15.6%, 16.5-33.2%, and 1.8-4.5%, respectively, in comparison to diesel fuel, thereby qualifying the blends to be used as alternative fuel for diesel engines.

  3. Novel VPS13B Mutations in Three Large Pakistani Cohen Syndrome Families Suggests a Baloch Variant with Autistic-Like Features.

    Science.gov (United States)

    Rafiq, Muhammad Arshad; Leblond, Claire S; Saqib, Muhammad Arif Nadeem; Vincent, Akshita K; Ambalavanan, Amirthagowri; Khan, Falak Sher; Ayaz, Muhammad; Shaheen, Naseema; Spiegelman, Dan; Ali, Ghazanfar; Amin-ud-Din, Muhammad; Laurent, Sandra; Mahmood, Huda; Christian, Mehtab; Ali, Nadir; Fennell, Alanna; Nanjiani, Zohair; Egger, Gerald; Caron, Chantal; Waqas, Ahmed; Ayub, Muhammad; Rasheed, Saima; Forgeot d'Arc, Baudouin; Johnson, Amelie; So, Joyce; Brohi, Muhammad Qasim; Mottron, Laurent; Ansar, Muhammad; Vincent, John B; Xiong, Lan

    2015-06-25

    Cohen Syndrome (COH1) is a rare autosomal recessive disorder, principally identified by ocular, neural and muscular deficits. We identified three large consanguineous Pakistani families with intellectual disability and in some cases with autistic traits. Clinical assessments were performed in order to allow comparison of clinical features with other VPS13B mutations. Homozygosity mapping followed by whole exome sequencing and Sanger sequencing strategies were used to identify disease-related mutations. We identified two novel homozygous deletion mutations in VPS13B, firstly a 1 bp deletion, NM_017890.4:c.6879delT; p.Phe2293Leufs*24, and secondly a deletion of exons 37-40, which co-segregate with affected status. In addition to COH1-related traits, autistic features were reported in a number of family members, contrasting with the "friendly" demeanour often associated with COH1. The c.6879delT mutation is present in two families from different regions of the country, but both from the Baloch sub-ethnic group, and with a shared haplotype, indicating a founder effect among the Baloch population. We suspect that the c.6879delT mutation may be a common cause of COH1 and similar phenotypes among the Baloch population. Additionally, most of the individuals with the c.6879delT mutation in these two families also present with autistic like traits, and suggests that this variant may lead to a distinct autistic-like COH1 subgroup.

  4. An exploration and comparison of food and drink availability in homes in a sample of families of White and Pakistani origin within the UK.

    Science.gov (United States)

    Bryant, Maria; Sahota, Pinki; Santorelli, Gillian; Hill, Andrew

    2015-05-01

    Knowledge of the types and quantities of foods and drinks available in family homes supports the development of targeted intervention programmes for obesity prevention or management, or for overall diet improvement. In the UK, contemporary data on foods that are available within family homes are lacking. The present study aimed to explore home food and drink availability in UK homes. An exploratory study using researcher-conducted home food availability inventories, measuring all foods and drinks within the categories of fruits, vegetables, snack foods and beverages. Bradford, a town in the north of the UK. Opportunistic sample of mixed ethnicity families with infants approximately 18 months old from the Born in Bradford birth cohort. All homes had at least one type of fruit, vegetable and snack available. Fresh fruits commonly available were oranges, bananas, apples, satsumas and grapes. Commonly available fresh vegetables included potatoes, cucumber, tomatoes and carrots. The single greatest non-fresh fruit available in homes was raisins. Non-fresh vegetables contributing the most were frozen mixed vegetables, tinned tomatoes and tinned peas. Ethnic differences were found for the availability of fresh fruits and sugar-sweetened beverages, which were both found in higher amounts in Pakistani homes compared with White homes. These data contribute to international data on availability and provide an insight into food availability within family homes in the UK. They have also supported a needs assessment of the development of a culturally specific obesity prevention intervention in which fruits and vegetables and sugar-sweetened beverages are targeted.

  5. Establishment of an efficient protocol for micropropagation of some pakistani cultivars of date palm (phonex dactylifera l.) using novel inflorescence explants

    International Nuclear Information System (INIS)

    Jatoi, M. A.; Markhand, G. S.; Solangi, N.

    2015-01-01

    An efficient protocol for rapid and large scale In vitro propagation of some Pakistani cultivars of date palm has been established using inflorescence explants at Date Palm Research Institute (DPRI), Shah Abdul Latif University (SALU), Khairpur, Pakistan. Immature inflorescences of desired cultivars of date palm detached from mother palms followed by surface sterilization with low torrent of current tap water and then 30 percentage NaOCl/sub 2/ solution, the outer cover were removed in order to get spike explants and cut into the 2-3 cm small pieces and cultured on modified MS medium supplemented with 0.1 mg l-1 2, 4-D + 0.1 mg l-1 IAA + 5.0 mg l-1 NAA for initiation and establishment of cultures. The obtained somatic embryos were subjected to multiplication medium involved 0.1 mg l-1 NAA + 0.05 mg l-1BA. Rooting was achieved using quarter strength MS medium containing 0.1 mg l-1NAA without activated charcoal (AC) initially and then with 3 g l-1 AC. Strong rooted plantlets with 2-3 leaves were transferred to pots contained sand and peat moss mixture (1:1 v/v) with more than 95 percentage success in acclimatization. The acclimatized plants with at least one compound leaf were shifted to the open field conditions at SALU campus for further studying morphological and fruit characterization to ensure the true-to-type nature of tissue culture derived plantlets. High multiplication efficiency and survival percentage with no any somaclonal variation ensured the efficacy of the protocol developed for the production of elite cultivars of date palm of Pakistan and can be used to optimize production of other cultivars of date palm worldwide. (author)

  6. Effect of a regimen of optimal medical therapy on brain natriuretic peptide (BNP) levels in heart failure in the Pakistani population

    International Nuclear Information System (INIS)

    Hussain, S.; Kayani, M.; Munir, R

    2012-01-01

    Objective: To document the effect of optimal medical therapy (OMT) on BNP levels in heart failure in Pakistani population. Methodology: In this Quasi experimental study, 75 consecutive stage C heart failure patients that had not been on OMT were included. These patients had been referred to AFIC-NIHD Heart Transplantation Department for assessment regarding heart transplantation. Initial assessments were carried out in hospital. Patients who were on OMT already were excluded. The prescription (carvedilol, lisinopril, spironolactone) was introduced as in patient as per pre defined protocol after clinical, imaging and lab evaluation. The patients were followed up in clinic and the dose escalation was done at regular intervals in out patients department. Clinical and lab variables were collected included BNP levels before starting treatment and 4 weeks after treatment. Results : Males were 75% and females were 25%. Mean age was 38.69 +- 12.98 years (range 18-70 years). Mean Ejection fraction was 23.9% (range 15 - 34%). At one month clinical status of all patients improved except one. The patients had improved from NYHA class-III to NYHA class-II of dyspnoea. The mean baseline BNP level was 1331 pg/ mL, and the BNP level 4 weeks after the OMT trial was 951.9 pg/mL. This reduction was statistically significant (p=0.016). Conclusion: OMT improves the BNP levels within a span of one month in patients with advanced systolic heart failure. This also correlated with the clinical improvement in the patients, and it was observed that BNP levels helped to monitor patients objectively and adjust OMT. (author)

  7. Nutritional and lifestyle risk behaviors and their association with mental health and violence among Pakistani adolescents: results from the National Survey of 4583 individuals.

    Science.gov (United States)

    Rao, Saadiyah; Shah, Nadia; Jawed, Nida; Inam, Sumera; Shafique, Kashif

    2015-04-28

    Unhealthy behaviors are associated with mental health problems and violence in adolescents, yet their combined association has been understudied. Using the Global School Health Survey, this study examined the association between combined unhealthy behaviors (including fast food, soft drink, smoking, other tobacco products and physical inactivity) and anxiety, suicidal ideation and involvement in physical fight among Pakistani adolescents. Data were obtained from the Global School Health Survey conducted in Pakistan (2009). The study population consisted of school going adolescents aged 13 to 15 years. Association of combined unhealthy behaviors with anxiety, suicidal ideation and involvement in physical fight were studied through secondary analysis. We used univariate and multivariate logistic regression analysis by complex sample method, accounting for cluster sampling technique used for data collection. Of the total 4583 students, weighted percentage and unweighted count for one, two, three and four or more unhealthy behaviors was 39.4% (n = 1770), 22.1% (n = 963), 5.9% (n = 274) and 1.2% (n = 62) respectively. The weighted prevalence for anxiety, suicidal ideation and involvement in physical fight were 8.4%, 7.3% and 37.4% respectively. The results of multivariate logistic regression analysis after adjustment showed that students who had four or more unhealthy behaviors had higher odds of; being anxious (OR 2.45, 95%CI 1.31-4.59, p value 0.004), suicide ideation (OR 4.56, 95%CI 2.58-8.07, p value <0.001) and being involved in physical fight (OR 3.15, 95% CI 1.63-6.08, p value <0.001) as compared to those who had not adopted any unhealthy behaviors. This study suggests that the co-occurrence of unhealthy behaviors is associated with anxiety, suicidal ideation and physical fight among adolescents. These findings should be considered when developing interventions to combat detrimental outcomes of unhealthy behaviors during adolescence.

  8. Exploring Asian Indian and Pakistani views about cancer and participation in cancer genetics research: toward the development of a community genetics intervention.

    Science.gov (United States)

    Leader, Amy E; Mohanty, Salini; Selvan, Preethi; Lum, Ray; Giri, Veda N

    2018-01-01

    Cancer is a leading cause of mortality among the three million Asian Indian/Pakistanis (AIPs) in the USA. AIPs have traditionally been underrepresented in cancer-related research, although reasons remain largely unexplored. We sought to understand AIP's awareness and perceptions of cancer to improve their participation in risk assessment and cancer genetics research. Four focus groups, stratified by gender and birthplace (US-born vs. foreign-born), were held at an AIP cultural center. Discussions focused on knowledge and awareness of cancer risk; how AIP culture influences cancer perceptions; access to health care services for cancer screening, diagnosis, or treatment; and willingness to or experiences with participating in cancer genetics research. Sessions were audio-recorded, transcribed verbatim, and content analyzed using NVivo ® 11 for dominant themes. Thirty-two AIP adults participated in a focus group. Information on family cancer history is challenging to obtain due to the desire for privacy, cancer stigma, and loss of medical records. Interest in genetic testing for cancer risk was mixed: some were in favor of knowing their personal risk, yet many noted that future generations in their family would benefit more by knowing their risk. Participants felt that the AIP community has largely been overlooked in recruitment efforts for research studies. Recommendations for improving recruitment efforts included partnering with community events and festivities, posting culturally and linguistically relevant recruitment materials, and focusing on population-wide health improvement. Understanding the culture and perceptions of AIPs, separate from Asian Americans at large, will allow for more tailored approaches for including this population in cancer genetics research.

  9. Zinc deficiency in pakistani children with decompensated chronic liver disease; a cross-sectional survey at a hospital in lahore, pakistan

    International Nuclear Information System (INIS)

    Shoaib, M.; Ayaz, S.B.; Ashraf, M.N.

    2015-01-01

    This study aimed to objectively assess mean serum zinc levels and influence of age, gender and primary etiology of chronic liver disease (CLD) on these levels in a sample of Pakistani pediatric patients with decompensated CLD (DCLD). Methodology: It was a cross-sectional survey carried out at Combined Military Hospital, Lahore, from August 2013 to February 2014. Through non-probability consecutive sampling we included 100 cases belonging to both genders, fitting in the age-range of 1 - 12 years and having DCLD based on Child-Pugh classification score = 6. Patients with diarrhea, respiratory or urinary tract infection, liver tumors or receiving treatments with immune suppressants, antifungals, antivirals and zinc supplementation were excluded. Results After exclusion, off 74 cases, 58.1% were male. Majority belonged to the age group of 6 - 12 years (54.1%). Idiopathic DCLD was the most prevalent primary etiology (40.5%). Mean serum zinc levels (44.5 ± 4.7 mu g/dL) were significantly lower (p< 0.001) than the minimum normal serum zinc levels (65 micro g/dL). The mean serum zinc levels were lower significantly in children with idiopathic CLD as the primary etiology (p=0.012) and insignificantly in females and children belonging to the age group of 1- < 6 years (p= 0.08 and p= 0.59 respectively) Conclusion Mean serum zinc levels in our sample of pediatric patients with DCLD were significantly lower than the reference values for normal children, were lowest in children suffering from idiopathic CLD and were not dependent on gender and age. (author)

  10. 'What really annoys me is people take it like it's a disability', epilepsy, disability and identity among people of Pakistani origin living in the UK.

    Science.gov (United States)

    Rhodes, Penny J; Small, Neil A; Ismail, Hanif; Wright, John P

    2008-01-01

    This paper reports on a study of Pakistani people with epilepsy. It explores their attitudes towards their condition, others' attitudes, its impact on their lives, and the extent to which they considered themselves as disabled. Epilepsy was variously interpreted within biomedical, folk and religious paradigms. In line with popular understandings, participants associated disability with stable, permanent and visible physical impairments and did not consider themselves as disabled. However, they also recognised a social dimension to their experience. Much of the distress and disadvantage they experienced was socially determined, both through direct prejudice and discrimination, and indirectly through a fear of others' negative reactions. However, the invisible and unpredictable nature of epilepsy meant that they could conceal their condition and thereby mitigate its social effects. 'Disability' was not experienced as a static and permanent state but as a potential identity that was both contingent and contested. The literature portrays people moving from biomedical to social interpretations of disability. However, the tensions experienced by people in the study were more between competing religious interpretations of their condition and, to some extent, between religious and medical approaches. Conceptions of disability, which are presented in the literature as antagonistic and mutually exclusive, were experienced as different dimensions reflecting the complexity of experience. The paper concludes by suggesting that for many people, for whom disability is an ambiguous, contingent and contested identity, public self-identification as disabled is an unrealistic goal. Rather than conceiving of disability as primarily physical or primarily social, it would be better construed as a complex interweaving of multiple factors--physical, environmental, socio-cultural and psychological factors.

  11. In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

    Science.gov (United States)

    Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

    2013-09-24

    Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

  12. Organization within Organization Studies

    DEFF Research Database (Denmark)

    Lopdrup-Hjorth, Thomas

    This paper explores how prevalent contemporary problematizations of organizations coincide with a widespread assessment that Organization Studies (OS) has run out of steam. This impasse, the paper argues, is largely due to the emergence of an organization-phobia that has come to seize several...... strands of theorizing. By attending to the wide-ranging and far-reaching history of this organization-phobia, the paper argues that OS has become increasingly incapable of speaking about its core object. I show how organizations went from being conceptualized as entities of major importance to becoming...... credibility and legitimacy to begin with, the organization-phobia resulting from this history has been implicated in dismantling organizations, and in making OS progressively irrelevant to a wider public....

  13. 'They say Islam has a solution for everything, so why are there no guidelines for this?' Ethical dilemmas associated with the births and deaths of infants with fatal abnormalities from a small sample of Pakistani Muslim couples in Britain.

    Science.gov (United States)

    Shaw, Alison

    2012-11-01

    This paper presents ethical dilemmas concerning the termination of pregnancy, the management of childbirth, and the withdrawal of life-support from infants in special care, for a small sample of British Pakistani Muslim parents of babies diagnosed with fatal abnormalities. Case studies illustrating these dilemmas are taken from a qualitative study of 66 families of Pakistani origin referred to a genetics clinic in Southern England. The paper shows how parents negotiated between the authoritative knowledge of their doctors, religious experts, and senior family members in response to the ethical dilemmas they faced. There was little knowledge or open discussion of the view that Islam permits the termination of pregnancy for serious or fatal abnormality within 120 days and there was considerable disquiet over the idea of ending a pregnancy. For some parents, whether their newborn baby would draw breath was a main worry, with implications for the baby's Muslim identity and for the recognition of loss the parents would receive from family and community. This concern sometimes conflicted with doctors' concerns to minimize risk to future pregnancies by not performing a Caesarean delivery if a baby is sure to die. The paper also identifies parents' concerns and feelings of wrong-doing regarding the withdrawal of artificial life-support from infants with multiple abnormalities. The conclusion considers some of the implications of these observations for the counselling and support of Muslim parents following the pre- or neo-natal diagnosis of fatal abnormalities in their children. © 2011 Blackwell Publishing Ltd.

  14. Do General Practices of Management Play Role as Drivers for Employee Job Satisfaction in Pakistani Entrepreneurial Companies?

    Directory of Open Access Journals (Sweden)

    Sergey Nikolaevich Polbitsyn

    2017-03-01

    Full Text Available Using general practices of management is management philosophy; many organizations practice these tools that endeavor to improve their efficiency and competitiveness in the business markets. It is an integrated approach to reaching and maintaining high-quality production and services focusing on the maintenance and continuous improvement of operations in order to satisfy or exceed the customer satisfaction. Many researchers have done a lot of work on other management practices; total quality management is an important one of them in this competitive era, which has rarely studied especially in small and medium size entrepreneurial companies in Pakistan. This quantitative research study tried to determine the impact of Total Quality Management practices on job satisfaction level of the employees of those small and medium size companies based on new and creative ideas in the capital city. The conducted survey among 550 employees of small and medium size entrepreneurial companies in the capital of Pakistan got 200 employees response properly in filling out the questionnaire. The collected data was analyzed after applying software (version 20 Statistical Package for Social Sciences. Multiple regression was applied to test the proposed model, which was found satisfied. Leadership and top management support were founded the most dominant practice among the selected Total Quality Management practices which has a significant effect on employee job satisfaction. The findings of this study prove that the implementation of Total Quality Management practices can help in increasing employees’ job satisfaction which intern would increase Productivity of small and medium size entrepreneurial companies.

  15. Identification and in silico characterization of p.G380R substitution in FGFR3, associated with achondroplasia in a non-consanguineous Pakistani family.

    Science.gov (United States)

    Ajmal, Muhammad; Mir, Asif; Shoaib, Muhammad; Malik, Salman Akbar; Nasir, Muhammad

    2017-07-05

    The dimerization efficiency of FGFR3 transmembrane domain plays a critical role in the formation of a normal skeleton through the negative regulation of bone development. Recently, gain-of-function mutations in the transmembrane domain of FGFR3 has been described associated with an aberrant negative regulation, leading to the development of achondroplasia-group disorders, including achondroplasia (ACH), hypochondroplasia (HCH) and thanatophoric dysplasia (TD). Here, we describe a non-consanguineous Pakistani family with achondroplasia to explain hereditary basis of the disease. PCR-based linkage analysis using microsatellite markers was employed to localize the disease gene. Gene specific intronic primers were used to amplify the genomic DNA from all affected as well as phenotypically healthy individuals. Amplified PCR products were then subjected to Sanger sequencing and RFLP analysis to identify a potentially pathogenic mutation. The impact of identified mutation on FGFR3 protein's structure and stability was highlighted through different bioinformatics tools. Genetic screening of the family revealed a previously reported heterozygous c.1138 G > A (p.G380R) mutation in the coding exon 8 of FGFR3 gene. Identified genetic variation was confirmed in all affected individuals while healthy individuals and controls were found genotypically normal. The results were further validated by RFLP analysis as c.1138 G > A substitution generates a unique recognition site for SfcI endonuclease. Following SfcI digestion, the electrophoretic pattern of three bands/DNA fragments for each patient is indicative of heterozygous status of the disease allele. In silico studies of the mutant FGFR3 protein predicted to adversely affect the stability of FGFR3 protein. Mutation in the transmembrane domain may adversely affect the dimerization efficiency and overall stability of the FGFR3, leading to a constitutively active protein. As a result, an uncontrolled intracellular signaling

  16. Assessment of association of smoking with bone mineral density (BMD) and fragility fractures in a cohort of pakistani males ages <= 50 years and postmenopausal females

    International Nuclear Information System (INIS)

    Akhlaq, U.; Ayaz, S.B.

    2015-01-01

    Objectives: The study aimed to determine the association between smoking, bone mineral density (BMD), and fragility fractures in a cohort of Pakistani males aged > 50 years and postmenopausal females. Methodology: This was a cross-sectional survey carried out at Armed Forces Institute of Rehabilitation Medicine (AFIRM), Rawalpindi from Jan 2010 to Jan 2011. Through non-probability purposive sampling, we included male patients of age > 50 years and postmenopausal women. All subjects were submitted to dual energy X-Ray absorptiometery at lumbar spine (L2 > L4) and at both femoral by Hologic Discovery-A machine . The lowest BMD was noted and expressed in the form of T-score.Using SPSS V 20, descriptive statistics were calculated for the various variables. Independent samples t-test was used to determine the significance of difference between mean T-score in between smokers and non-smokers. Association between smoking and the risk of fracture was carried out using Fisher exact test. A p-value < 0.05 was considered significant. Results: Out of a total of 328 patients, 142 (43.3%) were male (mean age 64 ± 8, range: 50 - 82 years) and 186 (56.7%) were female (mean age 61 ± 8, range: 43 - 92 years). Sixteen (8.6%) females and 52 (36.6%) males were smokers. In males, the mean T-score was -1.6 ± 1.3 in non-smokers and -1.9 ± 1.2 in smokers (p=0.17). Two of the non-smokers and nine of the smokers had a fracture. (p=0.002). In females, the mean T-score was -2.9 ± 1.9 in smokers and -2.3 ± 1.4 in non-smokers (p=0.23). Twelve of the non-smokers and 15 smokers had a fracture. (p<0.001) Conclusion: Smoking was significantly associated with increased percentage of fragility fractures but not with a reduction in BMD in our sample of postmenopausal women and men of age > 50 years. (author)

  17. Quantitative study of medicinal plants used by the communities residing in Koh-e-Safaid Range, northern Pakistani-Afghan borders.

    Science.gov (United States)

    Hussain, Wahid; Badshah, Lal; Ullah, Manzoor; Ali, Maroof; Ali, Asghar; Hussain, Farrukh

    2018-04-25

    The residents of remote areas mostly depend on folk knowledge of medicinal plants to cure different ailments. The present study was carried out to document and analyze traditional use regarding the medicinal plants among communities residing in Koh-e-Safaid Range northern Pakistani-Afghan border. A purposive sampling method was used for the selection of informants, and information regarding the ethnomedicinal use of plants was collected through semi-structured interviews. The collected data was analyzed through quantitative indices viz. relative frequency citation, use value, and family use value. The conservation status of medicinal plants was enumerated with the help of International Union for Conservation of Nature Red List Categories and Criteria (2001). Plant samples were deposited at the Herbarium of Botany Department, University of Peshawar for future reference. One hundred eight informants including 72 male and 36 female were interviewed. The informants provided information about 92 plants species used in the treatment of 53 ailments. The informant reported maximum number of species used for the treatment of diabetes (16 species), followed by carminatives (12 species), laxatives (11 species), antiseptics (11 species), for cough (10 species), to treat hepatitis (9 species), for curing diarrhea (7 species), and to cure ulcers (7 species), etc. Decoction (37 species, i.e., 40%) was the common method of recipe preparation. Most familiar medicinal plants were Withania coagulans, Caralluma tuberculata, and Artemisia absinthium with relative frequency (0.96), (0.90), and (0.86), respectively. The relative importance of Withania coagulans was highest (1.63) followed by Artemisia absinthium (1.34), Caralluma tuberculata (1.20), Cassia fistula (1.10), Thymus linearis (1.06), etc. This study allows identification of novel uses of plants. Abies pindrow, Artemisia scoparia, Nannorrhops ritchiana, Salvia reflexa, and Vincetoxicum cardiostephanum have not been reported

  18. Perceptions about the cause of schizophrenia and the subsequent help seeking behavior in a Pakistani population – results of a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Yousaf Wajeeha

    2008-07-01

    Full Text Available Abstract Background There is a cultural variability around the perception of what causes the syndrome of schizophrenia. Generally patients with schizophrenia are considered dangerous. They are isolated and treatment is delayed. Studies have shown favorable prognosis with good family and social support, early diagnosis and management. Duration of untreated psychosis is a bad prognostic indicator. We aimed to determine the perceptions regarding the etiology of schizophrenia and the subsequent help seeking behavior. Methods This cross-sectional study was carried out on a sample of 404 people at the out patient departments of Aga Khan University Hospital Karachi. Data was collected via a self-administered questionnaire. Questions were related to a vignette of a young man displaying schizophrenic behavior. Data was analyzed on SPSS v 14. Results The mean age of the participants was 31.4 years (range = 18–72 and 77% of them were males. The majorities were graduates (61.9% and employed (50%. Only 30% of the participants attributed 'mental illness' as the main cause of psychotic symptoms while a large number thought of 'God's will' (32.3%, 'superstitious ideas' (33.1%, 'loneliness' (24.8% and 'unemployment' (19.3% as the main cause. Mental illness as the single most important cause was reported by only 22%. As far as management is concerned, only 40% reported psychiatric consultation to be the single most important management step. Other responses included spiritual healing (19.5% and Sociachanges (10.6 while 14.8% of respondents said that they would do nothing. Gender, age, family system and education level were significantly associated with the beliefs about the cause of schizophrenia (p Conclusion Despite majority of the study population being well educated, only a few recognized schizophrenia as a mental illness and many held superstitious beliefs. A vast majority of Pakistanis have non-biomedical beliefs about the cause of schizophrenia. Their

  19. Knowledge Organization = Information Organization?

    DEFF Research Database (Denmark)

    Hjørland, Birger

    Are the terms ―information organization‖ (IO), ―organization of information‖ (OI) and ―information architecture‖ (IA) synonyms for knowledge organization (KO)? This study uses bibliometric methods, among others, to determine some relations between these terms and their meanings. Apparently the data...... shows that these terms should not be considered synonyms because each of the terms IO, OI, IA and KO produce a different set of high ranked authors, journals and papers. In many cases the terms are, however, used interchangeably (and thus indicating synonymity) and it is argued that the underlying...

  20. Organ Donation

    Science.gov (United States)

    Organ donation takes healthy organs and tissues from one person for transplantation into another. Experts say that the organs ... and bone marrow Cornea Most organ and tissue donations occur after the donor has died. But some ...

  1. Body Image of Pakistani Consumers.

    OpenAIRE

    Tariq Jalees; Ernest C de Run

    2014-01-01

    This paper examines how media exposure, self-esteem, and religiosity influence body image of Pakistan consumers. The underpinning of this study is based on Social Comparison Theory with two additional variables (religiosity and self-esteem) for understanding understand consumer attitude towards body image. A self-administered questionnaire was used. 193 persons responded at mall intercepts. The Conceptual framework was empirically tested through SEM. A positive relationship between exposure t...

  2. Fermilab | About | Organization | Fermilab Organization

    Science.gov (United States)

    Industry Students and teachers Media Organization Fermilab Organization Organization Fermilab Org Chart Accelerator Division Accelerator Physics Center CMS Center Core Computing Division ESH&Q FESS Finance Section LBNF Project Line Organization LBNF Project Director LCLS-II

  3. Organic superconductors

    International Nuclear Information System (INIS)

    Bulaevskij, L.N.; Shchegolev, I.F.

    1986-01-01

    Main achievements in creating new organic conducting materials - synthetic metals and superconductors, are considered. The processes of superconductivity occurrence in organic materials are discussed. It is shown that conjugated bonds between C and H atoms in organic molecules play an important role in this case. At present ''crystal direction'' in organic superconductor synthesis is mainly developed. Later on, organic superconductor crystals are supposed to be introduced into usual polymers, e.g. polyethylene

  4. Organic salmon

    DEFF Research Database (Denmark)

    Ankamah Yeboah, Isaac; Nielsen, Max; Nielsen, Rasmus

    . This study identifies the price premium on organic salmon in the Danish retail sale sector using consumer panel scanner data for households by applying the hedonic price model while permitting unobserved heterogeneity between households. A premium of 20% for organic salmon is found. Since this premium...... is closer to organic labeled agriculture products than to ecolabelled capture fisheries products, it indicates that consumers value organic salmon as an agriculture product more than fisheries product....

  5. Organic chemistry

    International Nuclear Information System (INIS)

    2003-08-01

    This book with sixteen chapter explains organic chemistry on linkage isomerism such as alkane, cycloalkane, alkene, aromatic compounds, stereo selective isomerization, aromatic compounds, stereo selective isomerization, organic compounds, stereo selective isomerization, organic halogen compound, alcohol, ether, aldehyde and ketone, carboxylic acid, dicarboxylic acid, fat and detergent, amino, carbohydrate, amino acid and protein, nucleotide and nucleic acid and spectroscopy, a polymer and medical chemistry. Each chapter has introduction structure and characteristic and using of organic chemistry.

  6. Low maternal folate concentrations and maternal MTHFR C677T polymorphism are associated with an increased risk for neural tube defects in offspring: a case-control study among Pakistani case and control mothers.

    Science.gov (United States)

    Nauman, Nuzhat; Jalali, Samina; Shami, Sajjad; Rafiq, Shireen; Große, Greta; Hilger, Alina C; Zhang, Rhong; Mansoor, Saira; Ludwig, Michael; Reutter, Heiko

    2018-01-01

    There is considerable evidence that periconceptional maternal folate deficiency and coding variants in maternal genes coding for critical enzymes in the folate pathway are associated with neural tube defects (NTDs) in offspring. In a case-control study we investigated C677T polymorphism in the 5,10- methylenetetrahydrofolate reductase (MTHFR) gene in case and control mothers of Pakistani origin, and compared these with the respective maternal folate concentrations measured at the time of delivery. A case-control study was conducted among 109 case and 100 control mothers identified through the Holy Family Hospital Rawalpindi, Quaid-i-Azam University, Islamabad, Pakistan. Red blood cell (RBC) and serum folate concentrations and MTHFRC677T polymorphism were compared between case and control mothers. Mean RBC folate and serum folate concentrations were significantly lower in cases compared with control mothers (pcases compared with control mothers (CC vs TT pcases compared with control mothers (C vs T pCase mothers with 677CT or 677TT genotypes had significantly lower serum (pstudy provides further evidence that maternal folate deficiency and MTHFRC677T polymorphism might be associated with an increased risk for NTDs in offspring. Our results are limited by the fact that maternal folate concentrations were not obtained during the periconceptional period, but at delivery. Further analyses, including maternal folate levels during the periconceptional period, are warranted.

  7. Leptin promoter variant G2548A is associated with serum leptin and HDL-C levels in a case control observational study in association with obesity in a Pakistani cohort.

    Science.gov (United States)

    Shabana, -; Hasnain, Shahida

    2016-06-01

    Leptin is a protein hormone synthesized by adipocytes and is involved in the regulation of food intake and energy expenditure. We hypothesized that any change in the promoter sequence can affect the expression of the gene and hence leptin protein levels in the serum. The aim of the current study was to investigate the relationship of such a promoter variant of the leptin gene, G-2548A polymorphism, with obesity and its effect on various anthropometric and metabolic parameters in a Pakistani cohort consisting of 250 obese and 225 non-obese control subjects. Body weight, height, waist circumference (WC), hip circumference (HC) and blood pressure (BP) were measured by standard methods and levels of fasting blood glucose (FBG), total cholesterol, triglycerides, HDLC, LDLC, and leptin were determined. Genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The results showed that the LEP G-2548A polymorphism showed significant association with obesity in Pakistan. In addition, the polymorphism showed association with weight, height, BMI, WC, HDLC and serum leptin levels. The findings suggest that the leptin promoter G-2548A variant may play its part in the progression to obesity by not only affecting the body's fat distribution but also by changing the serum leptin and HDLC levels.

  8. Organ Trade

    NARCIS (Netherlands)

    J.A.E. Ambagtsheer (Frederike)

    2017-01-01

    markdownabstractOrgan trade constitutes the sale and purchase of organs for financial or material gain. Although prohibited since the 1980s, an increasing number of reports indicate its proliferation across the globe. Yet, many knowledge gaps exist on organ trade, in particular on the demand -and

  9. Designing Organizations

    DEFF Research Database (Denmark)

    changed dramatically with the advent of: new communication systems, adaptive mechanisms, information technology, knowledge management systems, innovation processes and more. This book systemically examines these developments and their impact on OD with contributions from leading scholars in the area....... The individual chapters are organized into five sections: (1) Putting Contingency Theory in its Place, (2) Focus on Individuals who make up the Organization, (3) Innovation Processes and Organization Design, (4) Adaptation and Technology, and (5) Design for Performance. Each chapter examines aspects of the books...... is a benchmark publication in the field of organization design. By focusing on recent developments in organization design, this book will help to create more thoughtful research and stronger empirical analyses in this important area of management and organization....

  10. Organic spintronics

    International Nuclear Information System (INIS)

    Naber, W J M; Faez, S; Wiel, W G van der

    2007-01-01

    We review the emerging field of organic spintronics, where organic materials are applied as a medium to transport and control spin-polarized signals. The contacts for injecting and detecting spins are formed by ferromagnetic metals, oxides, or inorganic semiconductors. First, the basic concepts of spintronics and organic electronics are addressed, and phenomena which are in particular relevant for organic spintronics are highlighted. Experiments using different organic materials, including carbon nanotubes, organic thin films, self-assembled monolayers and single molecules are then reviewed. Observed magnetoresistance points toward successful spin injection and detection, but spurious magnetoresistance effects can easily be confused with spin accumulation. A few studies report long spin relaxation times and lengths, which forms a promising basis for further research. We conclude with discussing outstanding questions and problems. (topical review)

  11. Organic electroluminescence

    CERN Document Server

    Kafafi, Zakya H

    2005-01-01

    Organic light-emitting diode(OLED) technology has achieved significant penetration in the commercial market for small, low-voltage and inexpensive displays. Present and future novel technologies based on OLEDs involve rigid and flexible flat panel displays, solid-state lighting, and lasers. Display applications may range from hand-held devices to large flat panel screens that can be rolled up or hung flat on a wall or a ceiling. Organic Electroluminescence gives an overview of the on-going research in the field of organic light-emitting materials and devices, covering the principles of electroluminescence in organic thin films, as well as recent trends, current applications, and future potential uses. The book begins by giving a background of organic electroluminescence in terms of history and basic principles. It offers details on the mechanism(s) of electroluminescence in thin organic films. It presentsin-depth discussions of the parameters that control the external electroluminescence quantum efficien...

  12. Organic optoelectronics

    CERN Document Server

    Hu, Wenping; Gong, Xiong; Zhan, Xiaowei; Fu, Hongbing; Bjornholm, Thomas

    2012-01-01

    Written by internationally recognized experts in the field with academic as well as industrial experience, this book concisely yet systematically covers all aspects of the topic.The monograph focuses on the optoelectronic behavior of organic solids and their application in new optoelectronic devices. It covers organic electroluminescent materials and devices, organic photonics, materials and devices, as well as organic solids in photo absorption and energy conversion. Much emphasis is laid on the preparation of functional materials and the fabrication of devices, from materials synthesis a

  13. Organic synthesis

    International Nuclear Information System (INIS)

    Lallemand, J.Y.; Fetizon, M.

    1988-01-01

    The 1988 progress report of the Organic Synthesis Chemistry laboratory (Polytechnic School, France), is presented. The laboratory activities are centered on the chemistry of natural products, which have a biological activity and on the development of new reactions, useful in the organic synthesis. The research works involve the following domains: the natural products chemistry which are applied in pharmacology, the plants and insects chemistry, the organic synthesis, the radical chemistry new reactions and the bio-organic physicochemistry. The published papers, the congress communications and the thesis are listed [fr

  14. Organization aspect

    NARCIS (Netherlands)

    Grefen, P.W.P.J.; Mehandjiev, N.; Mehandjiev, N.; Grefen, P.W.P.J.

    2010-01-01

    Following the BOAT framework discussed in Chapter 1, this chapter describes the organization aspect of the CrossWork approach. It shows how the business requirements identified in the previous chapter can be fulfilled by dynamic organization structures and business processes in Networks of

  15. Organic hydrotrioxides

    International Nuclear Information System (INIS)

    Shereshovets, Valerii V; Khursan, Sergei L; Komissarov, Vladilen D; Tolstikov, Genrikh A

    2001-01-01

    The results of studies on the synthesis, structure, thermochemistry and oxidising capacity of organic hydrotrioxides are generalised. Particular emphasis is placed on the analysis of thermal and catalytic decomposition of ROOOH and on generation of free radicals and singlet molecular oxygen. Problems concerning the mechanisms of formation and decomposition of organic hydrotrioxides are also considered. The bibliography includes 154 references.

  16. Government Organizations

    DEFF Research Database (Denmark)

    Krause Hansen, Hans; Salskov-Iversen, Dorte

    2017-01-01

    , with clearly defined boundaries between the public and private; and in terms of polycentrism, where power and authority are seen as dispersed among state and nonstate organizations, including business and civil society organizations. Globalization and new media technologies imply changes in the relationship...... democracy and the public sphere; and discourse approaches to studying the intersections of government, organizational change, and information and communication technology....

  17. Matching Organs

    Science.gov (United States)

    ... to know FAQ Living donation What is living donation? Organs Types Being a living donor First steps Being ... brochures What Every Patient Needs to Know Living Donation Multiple Listing Visit UNOS Store Learn more How organs are matched How to become a living donor ...

  18. Organ Facts

    Science.gov (United States)

    ... to know FAQ Living donation What is living donation? Organs Types Being a living donor First steps Being ... brochures What Every Patient Needs to Know Living Donation Multiple Listing Visit UNOS Store Learn more How organs are matched How to become a living donor ...

  19. Designing Organizations

    DEFF Research Database (Denmark)

    Book Description The design of organizations has been an ongoing concern of management theory and practice over the past several decades. Over this time, there has been little change in the fundamental theory, principles and concepts of Organization Design (OD). Recently organizational life has...... changed dramatically with the advent of: new communication systems, adaptive mechanisms, information technology, knowledge management systems, innovation processes and more. This book systemically examines these developments and their impact on OD with contributions from leading scholars in the area...... is a benchmark publication in the field of organization design. By focusing on recent developments in organization design, this book will help to create more thoughtful research and stronger empirical analyses in this important area of management and organization....

  20. Organic photovoltaics

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    Within the International Conference and Exhibition at 16th September,2010 at the Maritim Hotel (Wuerzburg, Federal Republic of Germany) the following lectures were held: (1) History of Organic Photovoltaics (Niyazi Serdar Sariciftci); (2) PV Activities at the ZAE Bayern (Vladimir Dyakonov); (3) Progress in Solid State DSC (Peter Erk); (4) Polymer Semiconductors for OPV (Mats Andersson); (5) Fullerene Derivative N-Types in Organic Solar Cells (David Kronholm); (6) Modelling Charge-Transport in Organic Photovoltaic Materials (Jenny Nelson); (7) Multi Junction Modules R and D Status and Outlook (Paul Blom); (8) Imaging Technologies for Organic Solar Cells (Jonas Bachmann); (9) Production of Multi-junction Organic Photovoltaic Cells and Modules (Martin Pfeiffer); (10) Upscaling of Polymer Solar Cell Fabrication Using Full Roll-to-roll Processing (Frederik Christian Krebs); (11) Industrial Aspects and Large Scale OPV Production (Jens Hauch).

  1. Organic aerosols

    International Nuclear Information System (INIS)

    Penner, J.E.

    1994-01-01

    Organic aerosols scatter solar radiation. They may also either enhance or decrease concentrations of cloud condensation nuclei. This paper summarizes observed concentrations of aerosols in remote continental and marine locations and provides estimates for the sources of organic aerosol matter. The anthropogenic sources of organic aerosols may be as large as the anthropogenic sources of sulfate aerosols, implying a similar magnitude of direct forcing of climate. The source estimates are highly uncertain and subject to revision in the future. A slow secondary source of organic aerosols of unknown origin may contribute to the observed oceanic concentrations. The role of organic aerosols acting as cloud condensation nuclei (CCN) is described and it is concluded that they may either enhance or decrease the ability of anthropogenic sulfate aerosols to act as CCN

  2. Organ dosimetry

    International Nuclear Information System (INIS)

    Kaul, Dean C.; Egbert, Stephen D.; Otis, Mark D.; Kuhn, Thomas; Kerr, George D.; Eckerman, Keith F.; Cristy, Mark; Ryman, Jeffrey C.; Tang, Jabo S.; Maruyama, Takashi

    1987-01-01

    This chapter describes the technical approach, complicating factors, and sensitivities and uncertainties of calculations of doses to the organs of the A-bomb survivors. It is the object of the effort so described to provide data that enables the dosimetry system to determine the fluence, kerma, absorbed dose, and similar quantities in 14 organs and the fetus, specified as being of radiobiological interest. This object was accomplished through the use of adjoint Monte Carlo computations, which use a number of random particle histories to determine the relationship of incident neutrons and gamma rays to those transported to a target organ. The system uses these histories to correlate externally-incident energy- and angle-differential fluences with the fluence spectrum (energy differential only) within the target organ. In order for the system to work in the most efficient manner possible, two levels of data were provided. The first level, represented by approximately 6,000 random adjoint-particle histories, enables the computation of the fluence spectrum with sufficient precision to provide statistically reliable (± 6 %) mean doses within any given organ. With this limited history inventory, the system can be run rapidly for all survivors. Mean organ dose and dose uncertainty are obtainable in this mode. The second mode of operation enables the system to produce a good approximation to fluence spectrum within any organ or to produce the dose in each of an array of organ subvolumes. To be statistically reliable, this level of detail requires far more random histories, approximately 40,000 per organ. Thus, operation of the dosimetry system in this mode (i.e., with this data set) is intended to be on an as-needed, organ-specific basis, since the system run time is eight times that in the mean dose mode. (author)

  3. Using a tailored health information technology- driven intervention to improve health literacy and medication adherence in a Pakistani population with vascular disease (Talking Rx) - study protocol for a randomized controlled trial.

    Science.gov (United States)

    Kamal, Ayeesha Kamran; Muqeet, Abdul; Farhat, Kashfa; Khalid, Wardah; Jamil, Anum; Gowani, Ambreen; Muhammad, Aliya Amin; Zaidi, Fabiha; Khan, Danyal; Elahi, Touseef; Sharif, Shahrukh; Raz, Sibtain; Zafar, Taha; Bokhari, Syedah Saira; Rahman, Nasir; Sultan, Fateh Ali Tipoo; Sayani, Saleem; Virani, Salim S

    2016-03-05

    Vascular disease, manifesting as myocardial infarction and stroke, is a major cause of morbidity and mortality, especially in low- and middle-income countries. Current estimates are that only one in six patients have good adherence to medications and very few have sufficient health literacy. Our aim is to explore the effectiveness and acceptability of Prescription Interactive Voice Response (IVR) Talking Prescriptions (Talking Rx) and SMS reminders in increasing medication adherence and health literacy in Pakistani patients with vascular disease. This is a randomized, controlled, single center trial. Adult participants, with access to a cell phone and a history of vascular disease, taking multiple risk-modifying medications (inclusive of anti-platelets and statins) will be selected from cerebrovascular and cardiovascular clinics. They will be randomized in a 1:1 ratio via a block design to the intervention or the control arm with both groups having access to a helpline number to address their queries in addition to standard of care as per institutional guidelines. Participants in the intervention group will also have access to Interactive Voice Response (IVR) technology tailored to their respective prescriptions in the native language (Urdu) and will have the ability to hear information about their medication dosage, correct use, side effects, mechanism of action and how and why they should use their medication, as many times as they like. Participants in the intervention arm will also receive scheduled SMS messages reminding them to take their medications. The primary outcome measure will be the comparison of the difference in adherence to anti-platelet and statin medication between baseline and at 3-month follow-up in each group measured by the Morisky Medication Adherence Scale. To ascertain the impact of our intervention on health literacy, we will also compare a local content-validated and modified version of Test of Health Literacy in Adults (TOFHLA) between

  4. Exploring gender, age, time and space in research with older Pakistani Muslims in the United Kingdom: formalised research 'ethics' and performances of the public/private divide in 'the field'.

    Science.gov (United States)

    Zubair, Maria; Victor, Christina

    2015-05-01

    In recent years, there has been an increasing interest in researching ageing ethnic minority populations in the West. However, older people from such minority communities have received comparatively little attention in wide-ranging discussions on appropriate research methodologies. By a process of critically reflecting on our experiences of undertaking fieldwork for our Economic and Social Research Council New Dynamics of Ageing study of 'Families and Caring in South Asian Communities', this paper maps out the key methodological and ethical challenges we faced and, in the process, highlights the importance of developing socially appropriate research methodologies and ethical frameworks for research with such populations. With a reflexive approach, we specifically explore the significance of gender, age, time and space to the fieldwork processes and the 'field' relationships formed at various stages of the research process. In particular, we explore three key emergent issues which conflicted with our formal research protocols and presented particular challenges for us and our older Pakistani Muslim participants: (a) structuring of time in daily life; (b) gendered use of public and private spaces; and (c) orality of informal social contexts and relationships. Using illustrations from our fieldwork which reveal the particular significance of these issues to our fieldwork experiences and performativities of public/private identities, we highlight important tensions between formalised ethical and methodological dimensions of conducting funded research and the realities of being in 'the field'. We conclude the paper by emphasising the need to explore further not only the ways in which researchers can adopt more socially and culturally sensitive data collection processes and methodologies at the micro level of their interactions with research participants, but also contextualising the particular challenges experienced by researchers and their participants in terms of the

  5. The organization of organ procurement.

    Science.gov (United States)

    Prottas, J M

    1989-01-01

    The American organ procurement system has improved and matured in the last five years. At the same time, the basic challenges facing it have remained substantially the same because the moral and legal framework of the system has not changed. Success at organ procurement continues to depend on the voluntary cooperation of medical professionals and the families of potential organ donors. The generosity of the American public is so great that the primary challenge facing organ procurement agencies is obtaining cooperation from hospitals and medical professionals. This calls for a "marketing" orientation aimed at those hospitals and professionals who are most likely to treat potential donors. The last five years have seen a more general acceptance of this appreciation of the central task of organ procurement. As a result, the overall effectiveness of the system has improved, as measured by the number of organs procured on a per capita basis and by the number of multiorgan donors obtained. Much of this improvement can be attributed to the diffusion of organizational techniques and approaches, and this diffusion has been encouraged by the involvement of national organizations and public bodies in the organ procurement community. The system remains uneven in its effectiveness and further improvement is possible. It is also possible that the next general round of improvement will result from the application of businesslike information management and marketing techniques.

  6. Exploring Multidimensional View of Intellectual Capital and Business Ethics on Organizational Performance by Using Bootstrapping Method: Evidence from Pakistani Pharmaceutical Industry

    Directory of Open Access Journals (Sweden)

    Rizwan Raheem Ahmed

    2017-03-01

    Full Text Available The objective of this research is to examine the effect of business ethics (BE and intellectual capital (IC on the organizational performance (OP. In order to run this study, a conceptual model was designed based on the literature review, and the employees of the knowledge-based organization in pharmaceutical sector were surveyed using a closed-ended questionnaire. Modern successful and thriving organizations are those that create IC and convert it into applicable methods to improve their activities and performance within the boundaries of BE. This research is exploratory and quantitative in nature: 400 responses were directly gathered from the employees of the pharmaceutical industry through five-scaled questionnaire. This research examined the direct and indirect effect of BE and IC on the OP. Structural equation modeling (SEM, descriptive statistics, correlation, multiple regression techniques were used to analyze the impact of IC and BE on the performance. Bootstrapping method is employed in order to test the mediating effect of variables. Two-step SEM was used to the models to regress the cause and effect relation. The findings depicted that there is a very significant effect on BE and IC in the performance of pharmaceutical organizations. General BE, ethics in finance, ethics in human resource management, and ethics in sales and marketing have direct and significant impact on the OP. Human capital, structural capital and relational capital have significant indirect (mediating effect on the performance of the pharmaceutical industry. Finally, it has been concluded from the results of the research study that IC is the major contributor of the OP as a mediating variable with defined set of principles of BE in the pharmaceutical sector of Pakistan.

  7. Organic photovoltaics

    DEFF Research Database (Denmark)

    Demming, Anna; Krebs, Frederik C; Chen, Hongzheng

    2013-01-01

    's supply, even at our increasingly ravenous rate of global energy consumption [1]. But it's not what you have got it's what you do with it. Hence the intense focus on photovoltaic research to find more efficient ways to harness energy from the Sun. Recently much of this research has centred on organic...... solar cells since they offer simple, low-cost, light-weight and large-area flexible photovoltaic structures. This issue with guest editors Frederik C Krebs and Hongzheng Chen focuses on some of the developments at the frontier of organic photovoltaic technology. Improving the power conversion efficiency...... of organic photovoltaic systems, while maintaining the inherent material, economic and fabrication benefits, has absorbed a great deal of research attention in recent years. Here significant progress has been made with reports now of organic photovoltaic devices with efficiencies of around 10%. Yet operating...

  8. Organ Transplantation

    Science.gov (United States)

    ... Medical Error Mental Health in Children and Adolescents Nanotechnology Nature, Human Nature, and Biotechnology Neonatal Care Newborn ... 415. Sean Vincent Murphy and Anthony Atala, "Organ Engineering: Combining Stem Cells, Biomaterials, and Bioreactors to Produce ...

  9. Organic Conductors

    DEFF Research Database (Denmark)

    Andersen, Jan Rud; Jacobsen, Claus S.; Rindorf, Grethe

    1975-01-01

    2,3,6,7-Tetramethyl-1,4,5,8-tetraselenafulvalene reacts with 2,5-dimethyl-7,7′,8,8′-tetracyano-p-quinodi-methane to give a highly conducting organic solid.......2,3,6,7-Tetramethyl-1,4,5,8-tetraselenafulvalene reacts with 2,5-dimethyl-7,7′,8,8′-tetracyano-p-quinodi-methane to give a highly conducting organic solid....

  10. Organic superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Jerome, D; Ribault, M [Paris-11 Univ., 91 - Orsay (France). Lab. de Physique des Solides; Bechgaard, K [Copenhagen Univ. (Denmark). H.C. Oersted Inst.

    1980-07-10

    The history of superconductivity is traced and the recent discovery of the property in organic materials is discussed. It has been shown that in those organic chemicals in which flat molecules are stacked like tiles, conditions are created in which electrons can flow unhindered. It is reasonable to believe that superconductivity at 20k is now a feasible goal though the dream of resistance-less conduction at room temperature still appears a remote dream.

  11. Organic superconductors

    International Nuclear Information System (INIS)

    Jerome, D.; Ribault, M.; Bechgaard, K.

    1980-01-01

    The history of superconductivity is traced and the recent discovery of the property in organic materials is discussed. It has been shown that in those organic chemicals in which flat molecules are stacked like tiles, conditions are created in which electrons can flow unhindered. It is reasonable to believe that superconductivity at 20k is now a feasible goal though the dream of resistance-less conduction at room temperature still appears a remote dream. (UK)

  12. Colloidal organization

    CERN Document Server

    Okubo, Tsuneo

    2015-01-01

    Colloidal Organization presents a chemical and physical study on colloidal organization phenomena including equilibrium systems such as colloidal crystallization, drying patterns as an example of a dissipative system and similar sized aggregation. This book outlines the fundamental science behind colloid and surface chemistry and the findings from the author's own laboratory. The text goes on to discuss in-depth colloidal crystallization, gel crystallization, drying dissipative structures of solutions, suspensions and gels, and similar-sized aggregates from nanosized particles. Special emphas

  13. Organization Design

    OpenAIRE

    Milton Harris; Artur Raviv

    2002-01-01

    This paper attempts to explain organization structure based on optimal coordination of interactions among activities. The main idea is that each manager is capable of detecting and coordinating interactions only within his limited area of expertise. Only the CEO can coordinate company wide interactions. The optimal design of the organization trades off the costs and benefits of various configurations of managers. Our results consist of classifying the characteristics of activities and manager...

  14. Virtual Organizations: Beyond Network Organization

    Directory of Open Access Journals (Sweden)

    Liviu Gabriel CRETU

    2006-01-01

    Full Text Available One of the most used buzz-words in (e-business literature of the last decade is virtual organization. The term "virtual" can be identified in all sorts of combinations regarding the business world. From virtual products to virtual processes or virtual teams, everything that is “touched” by the computer’s processing power instantly becomes virtual. Moreover, most of the literature treats virtual and network organizations as being synonyms. This paper aims to draw a much more distinctive line between the two concepts. Providing a more coherent description of what virtual organization might be is also one of our intentions.

  15. [Artificial organs].

    Science.gov (United States)

    Raguin, Thibaut; Dupret-Bories, Agnès; Debry, Christian

    2017-01-01

    Research has been fighting against organ failure and shortage of donations by supplying artificial organs for many years. With the raise of new technologies, tissue engineering and regenerative medicine, many organs can benefit of an artificial equivalent: thanks to retinal implants some blind people can visualize stimuli, an artificial heart can be proposed in case of cardiac failure while awaiting for a heart transplant, artificial larynx enables laryngectomy patients to an almost normal life, while the diabetic can get a glycemic self-regulation controlled by smartphones with an artificial device. Dialysis devices become portable, as well as the oxygenation systems for terminal respiratory failure. Bright prospects are being explored or might emerge in a near future. However, the retrospective assessment of putative side effects is not yet sufficient. Finally, the cost of these new devices is significant even if the advent of three dimensional printers may reduce it. © 2017 médecine/sciences – Inserm.

  16. Organic Computing

    CERN Document Server

    Würtz, Rolf P

    2008-01-01

    Organic Computing is a research field emerging around the conviction that problems of organization in complex systems in computer science, telecommunications, neurobiology, molecular biology, ethology, and possibly even sociology can be tackled scientifically in a unified way. From the computer science point of view, the apparent ease in which living systems solve computationally difficult problems makes it inevitable to adopt strategies observed in nature for creating information processing machinery. In this book, the major ideas behind Organic Computing are delineated, together with a sparse sample of computational projects undertaken in this new field. Biological metaphors include evolution, neural networks, gene-regulatory networks, networks of brain modules, hormone system, insect swarms, and ant colonies. Applications are as diverse as system design, optimization, artificial growth, task allocation, clustering, routing, face recognition, and sign language understanding.

  17. Safety organization

    International Nuclear Information System (INIS)

    Lutz, M.

    1984-06-01

    After a rapid definition of a nuclear basis installation, the national organization of nuclear safety in France is presented, as also the main organizations concerned and their functions. This report shows how the licensing procedure leading to the construction and exploitation of such installations is applied in the case of nuclear laboratories of research and development: examinations of nuclear safety problems are carried out at different levels: - centralized to define the frame out of which the installation has not to operate, - decentralized to follow in a more detailed manner its evolution [fr

  18. Organizing Valuations

    DEFF Research Database (Denmark)

    Hauge, Amalie Martinus

    With this dissertation I take up a problem currently traversing popular, political and academic arenas, namely the potential demise of values in public organizations allegedly instigated by management tools deriving from industrial sectors. Taking a pragmatic stance, inspired by John Dewey......, this dissertation sets out to develop a practical and situation-based understanding of the relationship between these management tools, values and organizations, which can contribute to pushing forward the currently detached and polarized debates over New Public Management. In this endeavor the dissertation engages...

  19. Transnational Organizing

    DEFF Research Database (Denmark)

    Henriksen, Lasse Folke; Seabrooke, Leonard

    2016-01-01

    An ongoing question for institutional theory is how organizing occurs transnationally, where institution building occurs in a highly ambiguous environment. This article suggests that at the core of transnational organizing is competition and coordination within professional and organizational...... professionals’ operate in two-level professional and organizational networks to control issues. This two-level network provides the context for action in which professionals do their institutional work. The two-level network carries information about professional incentives and also norms about how issues...

  20. Organic Nanodiamonds

    OpenAIRE

    Zapata, Todd; Bennett, Neil; Struzhkin, Viktor; Fei, Yingwei; Jelezko, Fedor; Biskupek, Johannes; Kaiser, Ute; Reuter, Rolf; Wrachtrup, Joerg; Ghannam, Fahad Al; Hemmer, Philip

    2017-01-01

    Nano-crystalline diamond is a new carbon phase with numerous intriguing physical and chemical properties and applications. Small doped nanodiamonds for example do find increased use as novel quantum markers in biomedical applications. However, growing doped nanodiamonds below sizes of 5 nm with controlled composition has been elusive so far. Here we grow nanodiamonds under conditions where diamond-like organic seed molecules do not decompose. This is a key first step toward engineered growth ...

  1. IVS Organization

    Science.gov (United States)

    2004-01-01

    International VLBI Service (IVS) is an international collaboration of organizations which operate or support Very Long Baseline Interferometry (VLBI) components. The goals are: To provide a service to support geodetic, geophysical and astrometric research and operational activities. To promote research and development activities in all aspects of the geodetic and astrometric VLBI technique. To interact with the community of users of VLBI products and to integrate VLBI into a global Earth observing system.

  2. Organic Nanowires

    DEFF Research Database (Denmark)

    Balzer, Frank; Schiek, Manuela; Al-Shamery, Katharina

    Single crystalline nanowires from fluorescing organic molecules like para-phenylenes or thiophenes are supposed to become key elements in future integrated optoelectronic devices [1]. For a sophisticated design of devices based on nanowires the basic principles of the nanowire formation have...... atomic force microscopy and from polarized far-field optical microscopy for various prototypical molecules are reproduced by electrostatic and Monte Carlo calculations. Based on the crystal structure, predictions on the growth habit from other conjugated molecules become in reach....

  3. Organized DFM

    Science.gov (United States)

    Sato, Takashi; Honma, Michio; Itoh, Hiroyuki; Iriki, Nobuyuki; Kobayashi, Sachiko; Miyazaki, Norihiko; Onodera, Toshio; Suzuki, Hiroyuki; Yoshioka, Nobuyuki; Arima, Sumika; Kadota, Kazuya

    2009-04-01

    The category and objective of DFM production management are shown. DFM is not limited to an activity within a particular unit process in design and process. A new framework for DFM is required. DFM should be a total solution for the common problems of all processes. Each of them must be linked to one another organically. After passing through the whole of each process on the manufacturing platform, quality of final products is guaranteed and products are shipped to the market. The information platform is layered with DFM, APC, and AEC. Advanced DFM is not DFM for partial optimization of the lithography process and the design, etc. and it should be Organized DFM. They are managed with high-level organizational IQ. The interim quality between each step of the flow should be visualized. DFM will be quality engineering if it is Organized DFM and common metrics of the quality are provided. DFM becomes quality engineering through effective implementation of common industrial metrics and standardized technology. DFM is differential technology, but can leverage standards for efficient development.

  4. Entangling Organizations

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    2018-01-01

    The chapter accounts for the process of becoming of a changed practice within the area of disability care in the Municipality of Aalborg in Denmark. Across a period of a few months in the fall of 2015 a group of employees across the organization and an action researcher from Aalborg University (t....../ability and thereby the model opened the possibility for reworking the binary of ability/disability to the benefit of restorying the citizen’s ability in the practices of changing the disability care....

  5. Organic superconductivity

    International Nuclear Information System (INIS)

    Jerome, D.

    1980-01-01

    We present the experimental evidences for the existence of a superconducting state in the Quasi One Dimensional organic conductor (TMTSF) 2 PF 6 . Superconductivity occuring at 1 K under 12 kbar is characterized by a zero resistance diamagnetic state. The anistropy of the upper critical field of this type II superconductor is consistent with the band structure anistropy. We present evidences for the existence of large superconducting precursor effects giving rise to a dominant paraconductive contribution below 40 K. We also discuss the anomalously large pressure dependence of T sb(s), which drops to 0.19 K under 24 kbar in terms of the current theories. (author)

  6. Organic photovoltaics

    Science.gov (United States)

    Demming, Anna; Krebs, Frederik C.; Chen, Hongzheng

    2013-12-01

    Energy inflation, the constant encouragement to economize on energy consumption and the huge investments in developing alternative energy resources might seem to suggest that there is a global shortage of energy. Far from it, the energy the Sun beams on the Earth each hour is equivalent to a year's supply, even at our increasingly ravenous rate of global energy consumption [1]. But it's not what you have got it's what you do with it. Hence the intense focus on photovoltaic research to find more efficient ways to harness energy from the Sun. Recently much of this research has centred on organic solar cells since they offer simple, low-cost, light-weight and large-area flexible photovoltaic structures. This issue with guest editors Frederik C Krebs and Hongzheng Chen focuses on some of the developments at the frontier of organic photovoltaic technology. Improving the power conversion efficiency of organic photovoltaic systems, while maintaining the inherent material, economic and fabrication benefits, has absorbed a great deal of research attention in recent years. Here significant progress has been made with reports now of organic photovoltaic devices with efficiencies of around 10%. Yet operating effectively across the electromagnetic spectrum remains a challenge. 'The trend is towards engineering low bandgap polymers with a wide optical absorption range and efficient hole/electron transport materials, so that light harvesting in the red and infrared region is enhanced and as much light of the solar spectrum as possible can be converted into an electrical current', explains Mukundan Thelakkat and colleagues in Germany, the US and UK. In this special issue they report on how charge carrier mobility and morphology of the active blend layer in thin film organic solar cells correlate with device parameters [2]. The work contributes to a better understanding of the solar-cell characteristics of polymer:fullerene blends, which form the material basis for some of the most

  7. Entangled Organizations

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    the model opened the possibility for reworking the binary. The offset of the becoming of the revised model for cooperation was taken from a quantum approach to organizational development and change coined as ‘Organizational scenography’ as part of the methodology of Material Storytelling (Strand 2012). Here...... to embrace other dis/ability care facilities and dis/ability care workers/professionals nearby as well as the neighborhood of the village of citizens surrounding these facilities. Thus reworking previously upheld cuts between areas of responsibility of the Municipality/relatives and of Municipality...... for the employees and thereby support the bringing about of a cultural transformation. A changed relationality indeed brought about though reworking the binary dis/able. From the standpoint of a diffractive methodology (Barad 2007) the paper accounts for this project by being organized in four parts that together...

  8. Organizing Process

    DEFF Research Database (Denmark)

    Hull Kristensen, Peer; Bojesen, Anders

    This paper invites to discuss the processes of individualization and organizing being carried out under what we might see as an emerging regime of change. The underlying argumentation is that in certain processes of change, competence becomes questionable at all times. The hazy characteristics...... of this regime of change are pursued through a discussion of competencies as opposed to qualifications illustrated by distinct cases from the Danish public sector in the search for repetitive mechanisms. The cases are put into a general perspective by drawing upon experiences from similar change processes...... in MNCs. The paper concludes by asking whether we can escape from a regime of competence in a world defined by a rhetoric of change and create a more promising world in which doubt and search serve as a strategy for gaining knowledge and professionalism that improve on our capability for mutualism....

  9. transplanted organs

    Directory of Open Access Journals (Sweden)

    Rafal Szadujkis-Szadurski

    2014-08-01

    Full Text Available Rho-kinase and GTP-ase Rho are important regulators of vascular tone and blood pressure. The aim of this study was to investigate the role of Rho-kinase in artery reactions induced by angiotensin II (ANG II and the effects of ischemia-reperfusion injury as well as the function of intra- and extracellular calcium in these reactions. Experiments were performed on mesenteric superior arteries procured from cadaveric organ donors and conserved under the same conditions as transplanted kidneys. The vascular contraction in reaction to ANG II was measured in the presence of Rho-kinase inhibitor Y-27632, after ischemia and reperfusion, in Ca2+ and Ca2+-free solution. The maximal response to ANG II was reduced after ischemia, while an increase was observed after reperfusion. Vascular contraction induced by ANG II was decreased by Y-27632. Y-27632 reduced vascular contraction after reperfusion, both in Ca2+ and Ca2+-free solution. Reperfusion augments vascular contraction in reaction to ANG II. The Rho-kinase inhibitor Y-27632 reduces the hypersensitivity to ANG II after reperfusion mediated by both intra- and extracellular calcium. These results confirm the role of Rho-kinase in receptor-independent function of ANG II and in reperfusion-induced hypersensitivity.

  10. Export competitiveness of pakistani horticultural products

    International Nuclear Information System (INIS)

    Akhtar, W.; Akmal, N.; Shah, H.; Tahir, A.; Niazi, M.A.

    2013-01-01

    This paper examines Pakistan's competitiveness in export of selected horticulture commodities by employing set of revealed comparative advantage (RCA) and revealed competitive advantage indices with respect to global trade. Results demonstrate that Pakistan has comparative and competitive advantage over the period under analysis and indicates a transition from comparative and competitive disadvantage to comparative and competitive advantage during the period under analysis. Tangerines, mandarins, clem have maintained relatively higher revealed comparative advantage as compared to other categories for the whole period under analysis. Onion export has revealed comparative advantage with some fluctuations over time. The research indicates that Pakistan's comparative and competitive advantages have been increasing in all the selected commodities during period under analysis which indicates the potential of horticulture exports for foreign exchange earnings. There is need to strengthen comparative and competitive advantage in horticulture sector by policy support and facilitating role by all stakeholders. (author)

  11. Adrenal insufficiency in pakistani hiv infected patients

    International Nuclear Information System (INIS)

    Afreen, B.; Khan, K.A.; Riaz, A.

    2017-01-01

    Background: Adrenal insufficiency (AI) is the most common endocrine complication among patients with AIDS/HIV infection and there are number of causes of AI in HIV patients. Human immunodeficiency virus directly as well as indirectly destroys adrenal glands. The estimates of its prevalence and severity vary. AI is the most life threatening but readily correctable endocrine complication that occurs in persons with HIV infection. This study was carried out to determine the frequency of Adrenal Insufficiency in HIV patients and their clinical features as proper diagnosis and timely treatment have been shown to improve quality of life and long-term mortality in AIDS patients. Methods: It was a cross sectional survey conducted at HIV clinic and Jinnah Allama Iqbal Institute of Diabetes and Endocrinology, Jinnah Hospital Lahore. Sixty-four HIV positive patients, both male and female, aged above 15 years were included in the study. HIV patients who had recently taken steroids, ketoconazole or rifampicin, determined on history, were excluded from the study. The data was collected on a structured proforma and analysis was performed in SPSS-21.0. Frequency and percentages for adrenal insufficiency and its characteristics were calculated. Chi-square test was used with p<0.05 as statistically significant. Results: In this study, 9 (14.06%) HIV patients were diagnosed with adrenal insufficiency, male to female ratio was 3.5:1 and AI was found statistically significantly associated with fatigue (p<0.008) and weight loss (p<0.001). Conclusion: Adrenal insufficiency was high among the patients with HIV, it was not gender specific but it was found to be associated with fatigue and weight loss. (author)

  12. Periodontal status of Pakistani orthodontic patients

    Directory of Open Access Journals (Sweden)

    Yousuf MOOSA

    2015-01-01

    Full Text Available The objective of this study was to evaluate and compare the periodontal status of orthodontic patients and non-orthodontic patients, aged 15–28 years, of both genders. The cross-sectional study included 100 orthodontic and 100 non-orthodontic patients evaluated using a Community Periodontal Index for Treatment Need (CPITN probe on the index teeth. A questionnaire was distributed to the participants to assess and evaluate the use of oral hygiene aids. The data were analyzed using SPSS version 17, and various comparisons were performed using the chi-square test. The study revealed that there was a statistically significant association in CPITN scores between the orthodontic and non-orthodontic patients (p < 0.01. The study showed that patients undergoing orthodontic treatment have increased plaque accumulation and probing depth resulting in periodontal tissue destruction. Proper oral hygiene practices and interdental aids should be employed to control plaque.

  13. Screening Pakistani cotton for drought tolerance

    International Nuclear Information System (INIS)

    Soomro, M.H.; Markhand, G.S.

    2011-01-01

    The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)

  14. Factors causing stress among Pakistani working women

    OpenAIRE

    Arif, Ahmed; Naveed, Shaheryar; Aslam, Ramsha

    2017-01-01

    Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to e...

  15. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Erah

    Exercise of self-management was strongly linked to the philosophy of the patients regarding nature ... patients' attitudes and behavior towards self- .... What is your experience of health care and health care professionals? 10. ... food and try to use lots of fruits and liquids. I ... pressure was not controlled; so as I see, diet plans ...

  16. Physicians' Migration: Perceptions of Pakistani Medical Students.

    Science.gov (United States)

    Hossain, Nazli; Shah, Nusrat; Shah, Tahira; Lateef, Sidra Binte

    2016-08-01

    To study the perceptions of medical students about factors responsible for physicians'migration. Cross-sectional survey. Dow Medical College and Civil Hospital, Karachi, from April to May 2015. Aself-administered structured questionnaire was used including demographic details, attitudes about push and pull factors of migration, and reasons for migrating or not migrating abroad. Final year students and interns were included. Likert scale from 1 to 4 (1=strongly disagree to 4=strongly agree) was used to assess attitudes. Data was analyzed by SPSS version 16. Atotal of 240 medical students, mostly females (n=181, 75%) (60% final year and 40% interns), participated in the study. Majority wished to go abroad (n=127; 54%) with United States being the favourite destination (n=80; 66.1%) and internal medicine fields being the preferred choice for specialization (n=126; 54%). The major pull factors were better quality of postgraduate education abroad (n=110; 48.2%) and economic prospects (80; 35.2%); while the push factors were a weak healthcare system (n=219; 94.3%), inadequate salary structure (n=205; 88.3%), insecurity (n=219; 93.9%) and increasing religious intolerance in Pakistan (n=183; 78.5%). This survey highlights the continuing trend of physician migration from Pakistan owing to an interplay of various push and pull factors. Majority of our medical students wish to migrate, mainly due to low salaries, poor job structure, and insecurity. Urgent interventions are required to reverse this trend of medical brain-drain.

  17. Information Technology in Libraries. A Pakistani Perspective.

    Science.gov (United States)

    Mahmood, Khalid

    This book presents an overview of the present status of the use of library automation hardware and software in Pakistan. The following 20 articles are included: (1) "The Status of Library Automation in Pakistan"; (2) "Promoting Information Technology in Pakistan: the Netherlands Library Development Project"; (3) "Library…

  18. Hierarchical organization versus self-organization

    OpenAIRE

    Busseniers, Evo

    2014-01-01

    In this paper we try to define the difference between hierarchical organization and self-organization. Organization is defined as a structure with a function. So we can define the difference between hierarchical organization and self-organization both on the structure as on the function. In the next two chapters these two definitions are given. For the structure we will use some existing definitions in graph theory, for the function we will use existing theory on (self-)organization. In the t...

  19. Sequential versus Organized Rehearsal

    Science.gov (United States)

    Weist, Richard M.; Crawford, Charlotte

    1973-01-01

    The purpose of this research was to test the hypothesis that organization in rehearsal is a necessary condition for organization in recall; that is, if recall is organized, then rehearsal must have been organized. (Author)

  20. Comparative efficiency of high (trip super phosphate) and low (rock phosphate) grade p nutrition source enriched with organic amendment in maize crop

    International Nuclear Information System (INIS)

    Sabah, N.U.; Sarwar, G.; Tahir, M.A.

    2016-01-01

    Pakistan falls under arid to semi-arid climate and therefore, Pakistani soils are sufferer of phosphorus deficiency. Costly phosphatic commercial fertilizers and their unavailability at the time of crop demand is the burning issue in Pakistan. Under such circumstances, use of locally available rock phosphate (RP) grasps the interest of researchers now a day. Pakistan has blessed with considerable quantity of cheaper low grade RP in Abbottabad and Hazara districts of KPK province. Due to this scenario, a pot experiment was carried out to evaluate growth efficiency of maize crop by adding organic manure fortified with RP in comparison with TSP in normal soil (pHs= 8.15, ECe= 1.28 dSm-1, SAR = 4.77 mmol L-1, saturation percentage = 29% and sandy clay loam texture). The study was comprised of 7 treatments replicated three times including: T1 = Control (0 P); T2 = Recommended NK + organic material; T3 = Recommended NK + RRP; T4 = Recommended NK + RRP + OM; T5 = Recommended NK + TSP; T6 = Recommended NK + TSP + OM and T7 = N + K + TSP + 0.5 Organic manure. It was concluded that integrated use of organic amendment with RP (Local Hazara Red Rock Phosphate) and TSP proved superior as compared to their sole use on maize crop growth. A significant increase in available P concentration of the growth medium was observed due to addition of organic material along with TSP as a source of P. Addition of organic material also enhanced the soil carbon level as compared to control. It can be concluded that rock phosphate (RP) could be an effective and economic substitution for TSP when it is integrated with suitable organic amendment with specific size. (author)

  1. Ordered organic-organic multilayer growth

    Science.gov (United States)

    Forrest, Stephen R; Lunt, Richard R

    2015-01-13

    An ordered multilayer crystalline organic thin film structure is formed by depositing at least two layers of thin film crystalline organic materials successively wherein the at least two thin film layers are selected to have their surface energies within .+-.50% of each other, and preferably within .+-.15% of each other, whereby every thin film layer within the multilayer crystalline organic thin film structure exhibit a quasi-epitaxial relationship with the adjacent crystalline organic thin film.

  2. Organizing education by drawing on organization studies

    NARCIS (Netherlands)

    Romme, A.G.L.

    2003-01-01

    This study explores how scholars researching organizations and organizing processes can use and exploit their knowledge not only in terms of course contents, but also in organizing and managing students' learning activity. A design-oriented research approach is used in order to develop grounded

  3. Organic waste treatment with organically modified clays

    International Nuclear Information System (INIS)

    Evans, J.C.; Pancoski, S.E.; Alther, G.

    1989-01-01

    The use of organically modified clays in hazardous waste management applications offers a significant new and untapped potential. These clays may be used in the stabilization of organic wastes and organically contaminated soils, for waste water treatment, for oil spill control, for liner systems beneath fuel oil storage tanks, and as a component within liner systems of hazardous waste storage treatment and disposal facilities. Organically modified clays (organophilic clays) may be employed in each of these systems to adsorb organic waste constituents, enhancing the performance of the applications

  4. Agriculture: Organic Farming

    Science.gov (United States)

    Organic Farming - Organically grown food is food grown and processed using no synthetic fertilizers or pesticides. Pesticides derived from natural sources (such as biological pesticides) may be used in producing organically grown food.

  5. Organizations Utilize Lateral Relationships

    OpenAIRE

    Jacqueline C.

    2017-01-01

    The structures that subscribe to different organization play a major role and determine how information flows throughout an organization as well as the reporting structure within the organization. In some organization, decision making rely with the top management, and in other organizations, decision making responsibilities may be distributed within the organization. The latter part is what mainly constitutes a lateral structural arrangement where various departments work hand in hand in achi...

  6. Yersinia enterocolitica organism (image)

    Science.gov (United States)

    This picture shows the organism Yersinia enterocolitica . Yersinia organisms cause a wide range of disease but are most often associated with diarrhea or gastrointestinal symptoms. Yersinia infection is ...

  7. Theology and Organization

    DEFF Research Database (Denmark)

    Meier Sørensen, Bent; Spoelstra, Sverre; Höpfl, Heather

    2012-01-01

    of religious practices in organizations. Instead, theology of organization recognizes that the way we think about and act in organizations is profoundly structured by theological concepts. In this editorial to the special issue we have three aims: to outline what theology of organization is, to show how...

  8. Soluble organic nutrient fluxes

    Science.gov (United States)

    Robert G. Qualls; Bruce L. Haines; Wayne Swank

    2014-01-01

    Our objectives in this study were (i) compare fluxes of the dissolved organic nutrients dissolved organic carbon (DOC), DON, and dissolved organic phosphorus (DOP) in a clearcut area and an adjacent mature reference area. (ii) determine whether concentrations of dissolved organic nutrients or inorganic nutrients were greater in clearcut areas than in reference areas,...

  9. China's Organic Revolution

    OpenAIRE

    Paull, John

    2008-01-01

    Agriculture in China is at the onset of an Organic Revolution. From 2000 to 2006, China has moved from 45th to 2nd position in the world in number of hectares under organic management. China now has more land under organic horticulture than any other country. In the year 2005/2006, China added 12% to the world’s organic area. This accounted for 63% of the world’s annual increase in organic land, and China now has 11% of the world’s organically managed land. The antecedents to China’s Organic ...

  10. Soil organic matter studies

    International Nuclear Information System (INIS)

    1977-01-01

    A total of 77 papers were presented and discussed during this symposium, 37 are included in this Volume II. The topics covered in this volume include: biochemical transformation of organic matter in soils; bitumens in soil organic matter; characterization of humic acids; carbon dating of organic matter in soils; use of modern techniques in soil organic matter research; use of municipal sludge with special reference to heavy metals constituents, soil nitrogen, and physical and chemical properties of soils; relationship of soil organic matter and plant metabolism; interaction between agrochemicals and organic matter; and peat. Separate entries have been prepared for those 20 papers which discuss the use of nuclear techniques in these studies

  11. Feeding of low birth weight newborns in tertiary care hospitals in pakistan: do they follow the world health organization latest guidelines

    International Nuclear Information System (INIS)

    Khan, J.; Stafstrom, M.

    2015-01-01

    To determine the extent the World Health Organization (WHO) guidelines on the care of Low Birth Weight (LBW) newborns are followed in Pakistani hospitals and analyze any difference in policy compliance between different hospitals. Study Design: Descriptive analytical study. Place and Duration of Study: Data was collected from five tertiary care hospitals, one each from Peshawar, Lahore, Quetta, Karachi and Islamabad, from January to June 2012. Methodology: LBW newborns data derived from medical records was used. It was collected using a questionnaire, which encompassed the recent WHO recommendations for feeding of LBW. Twenty questionnaires were collected from each hospital. STATA 11.0 was used to analyze the data. Results: Fifty seven LBW newborns (57%) were fed with mother's own milk, and 9 (9%) were fed on donor human milk. Forty four newborns (44%) were initiated breast feeding within the first hour after birth. Most of the babies not able to be breast fed were fed with intra gastric tube. Feeding practices varied markedly across hospitals, ranging from one hospital where all newborns were fed formula milk to one where all were fed breast milk. Conclusion: The WHO guidelines were only partially implemented, with significant differences between hospitals in level of implementation of recommended practices. Given the benefits expected from the application of the guidelines, efforts should be made for the establishment and promotion of a single national policy for LBW feeding that follows the WHO new guidelines and streamlines the LBW feeding practices across the country. (author)

  12. Feeding of Low Birth Weight Newborns in Tertiary Care Hospitals in Pakistan: Do They Follow the World Health Organization Latest Guidelines?

    Science.gov (United States)

    Khan, Jehangir; Stafstrom, Martin; Martines, Jose Carlos

    2015-08-01

    To determine the extent the World Health Organization (WHO) guidelines on the care of Low Birth Weight (LBW) newborns are followed in Pakistani hospitals and analyze any difference in policy compliance between different hospitals. Descriptive analytical study. Data was collected from five tertiary care hospitals, one each from Peshawar, Lahore, Quetta, Karachi and Islamabad, from January to June 2012. LBW newborns data derived from medical records was used. It was collected using a questionnaire, which encompassed the recent WHO recommendations for feeding of LBW. Twenty questionnaires were collected from each hospital. STATA11.0 was used to analyze the data. Fifty seven LBW newborns (57%) were fed with mother's own milk, and 9 (9%) were fed on donor human milk. Forty four newborns (44%) were initiated breastfeeding within the first hour after birth. Most of the babies not able to be breastfed were fed with intra gastric tube. Feeding practices varied markedly across hospitals, ranging from one hospital where all newborns were fed formula milk to one where all were fed breast milk. The WHO guidelines were only partially implemented, with significant differences between hospitals in level of implementation of recommended practices. Given the benefits expected from the application of the guidelines, efforts should be made for the establishment and promotion of a single national policy for LBW feeding that follows the WHO new guidelines and streamlines the LBW feeding practices across the country.

  13. The Visual Dimension in Organizing, Organization and Organization Research

    DEFF Research Database (Denmark)

    van Leeuwen, Theo; Meyer, Renate; Hollerer, Markus

    2013-01-01

    With the unprecedented rise in the use of visuals, and its undeniable omnipresence in organizational contexts, as well as in the individual's everyday life, organization and management science has recently started to pay closer attention to the to date under-theorized "visual mode" of discourse...... and meaning constriction, Building primarily on insights from the phenomenological tradition in organization theory and from social semiotics, this article sets out to consolidate previous scholarly efforts and to sketch a fertile future research agenda, After briefly exploring the working of visuals, we...... introduce the methodological and theoretical roots of visual studies in a number of disciplines that have a long-standing tradition of incorporating the visual. We then continue by extensively reviewing work in the field of organization and management studies: More specifically, we present five distinct...

  14. MARKETING ORGANIZATION ACTIVITY IN SPORTS ORGANIZATIONS

    Directory of Open Access Journals (Sweden)

    Slobodan Župljanin

    2012-09-01

    Full Text Available Sports organizations as "sui generis" organizations inevitably have to adopt the concept of marketing as a business philosophy, if you want to survive and develop its activities in the modern business environment. Supply and demand as the market, and psychological phenomena are inherent in sports organizations. Sport is a special area of human activity in which marketing has a specific place and role. Sports and sporting events are also a massive public and media events and high level of interest involving multi-million audience. Between direct and indirect participants of these events takes place appropriate communication sociological, psychological and marketing character. The aim of this paper is to present the possibility of more efficient operation of sports organizations using and adopting the marketing concept as a philosophy of action.

  15. Organic Solvent Tropical Report

    International Nuclear Information System (INIS)

    COWLEY, W.L.

    2000-01-01

    This report provides the basis for closing the organic solvent safety issue. Sufficient information is presented to conclude that risk posed by an unmitigated organic solvent fire is within risk evaluation guidelines

  16. Organics in radwaste

    International Nuclear Information System (INIS)

    Taylor, N.K.

    1988-10-01

    Seventeen papers, each processed separately cover the types of organic materials in radioactive wastes, their effect on repository performance and destruction of organics, including incineration, peroxide and wet oxidation and acid and biological digestion. (U.K.)

  17. Organizing design work

    DEFF Research Database (Denmark)

    Scheuer, John Damm

    2016-01-01

    The aim of this paper is to demonstrate the importance of the kind of understanding of organizing that is implied by design theories for project managers' understanding and organizing of design work. Five theories and their organizing consequences for project managers organizing of design work...... are analyzed. The paper contributes to design research and organization studies by putting the organizing of design projects on the research agenda. It also contributes by demonstrating the importance of being aware of the ontological and epistemological assumptions and organizing consequences of different...... design theories. The selected theories of design thus represent different views on what design is, address different design areas and are based on different ontological and epistemological assumptions that influence their views on how design processes should be organized....

  18. Organ Improvisation - An Introduction

    NARCIS (Netherlands)

    Fidom, J.

    2008-01-01

    Whereas musicological attention to improvisation tended to neglect organ improvisation,new initiatives, both musically and musicologically, indicate an imminent rehabilitation. Such rehabilitation is more than justified: organ improvisation is the only unbroken western improvisation tradition,

  19. Understanding Identity and Organizations

    DEFF Research Database (Denmark)

    Christensen, Lars Thøger

    2013-01-01

    The article reviews the book "Understanding Identity and Organizations," by Kate Kenny, Andrea Whitle, and Hugh Wilmott.......The article reviews the book "Understanding Identity and Organizations," by Kate Kenny, Andrea Whitle, and Hugh Wilmott....

  20. Organic electrochemical transistors

    KAUST Repository

    Rivnay, Jonathan; Inal, Sahika; Salleo, Alberto; Owens, Ró isí n M.; Berggren, Magnus; Malliaras, George G.

    2018-01-01

    Organic electrochemical transistors (OECTs) make effective use of ion injection from an electrolyte to modulate the bulk conductivity of an organic semiconductor channel. The coupling between ionic and electronic charges within the entire volume

  1. Organic optoelectronic materials

    CERN Document Server

    Li, Yongfang

    2015-01-01

    This volume reviews the latest trends in organic optoelectronic materials. Each comprehensive chapter allows graduate students and newcomers to the field to grasp the basics, whilst also ensuring that they have the most up-to-date overview of the latest research. Topics include: organic conductors and semiconductors; conducting polymers and conjugated polymer semiconductors, as well as their applications in organic field-effect-transistors; organic light-emitting diodes; and organic photovoltaics and transparent conducting electrodes. The molecular structures, synthesis methods, physicochemical and optoelectronic properties of the organic optoelectronic materials are also introduced and described in detail. The authors also elucidate the structures and working mechanisms of organic optoelectronic devices and outline fundamental scientific problems and future research directions. This volume is invaluable to all those interested in organic optoelectronic materials.

  2. Behaviour in an Organization

    OpenAIRE

    Klímová, Kateřina

    2009-01-01

    Diploma thesis "The behavior in the organization" at a practical level, integrates the knowledge of psychology, sociology and management. It explains bahavior of people in the organization, which seeks to use this knowledge for the benefit of the organizaton and its management. It focuses on individual differences among people in the organization, organizational culture, relationships between people in workplace, organizational structure, communication within the organization, motivation, dev...

  3. Organic photovoltaic films

    OpenAIRE

    Nelson, Jenny

    2002-01-01

    Organic electronic materials are of interest for future applications in solar cells. Although results for single layer organic materials have been disappointing, high photocurrent quantum efficiencies can be achieved in composite systems including both electron donating and electron accepting components. Efficiencies of over 2% have now been reported in four different types of organic solar cell. Performance is limited by the low red absorption of organic materials, poor charge transport, and...

  4. The Matrix Organization Revisited

    DEFF Research Database (Denmark)

    Gattiker, Urs E.; Ulhøi, John Parm

    1999-01-01

    This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively).......This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively)....

  5. Values in Organic Farming

    DEFF Research Database (Denmark)

    Kjærgård, Bente; Pedersen, Kirsten Bransholm; Land, Birgit

    The study focuses on the recent debate about what is, or what constitutes, organic farming and what is the right path for organic farming in the future. The study is based on a critical discourse analysis of the controversy about suspending the private standard for organic farming adopted by the ...

  6. Organic chemistry in space

    Science.gov (United States)

    Johnson, R. D.

    1977-01-01

    Organic cosmochemistry, organic materials in space exploration, and biochemistry of man in space are briefly surveyed. A model of Jupiter's atmosphere is considered, and the search for organic molecules in the solar system and in interstellar space is discussed. Materials and analytical techniques relevant to space exploration are indicated, and the blood and urine analyses performed on Skylab are described.

  7. Building synthetic cellular organization

    OpenAIRE

    Polka, Jessica K.; Silver, Pamela A.

    2013-01-01

    The elaborate spatial organization of cells enhances, restricts, and regulates protein–protein interactions. However, the biological significance of this organization has been difficult to study without ways of directly perturbing it. We highlight synthetic biology tools for engineering novel cellular organization, describing how they have been, and can be, used to advance cell biology.

  8. Nanostructured Organic Solar Cells

    DEFF Research Database (Denmark)

    Radziwon, Michal Jędrzej; Rubahn, Horst-Günter; Madsen, Morten

    Recent forecasts for alternative energy generation predict emerging importance of supporting state of art photovoltaic solar cells with their organic equivalents. Despite their significantly lower efficiency, number of application niches are suitable for organic solar cells. This work reveals...... the principles of bulk heterojunction organic solar cells fabrication as well as summarises major differences in physics of their operation....

  9. Fiction and Organization Studies

    NARCIS (Netherlands)

    Savage, P. (Paul); J.P. Cornelissen (Joep); Franck, H. (Henrika)

    2017-01-01

    textabstractThe topic of fiction is in itself not new to the domain of organization studies. However, prior research has often separated fiction from the reality of organizations and used fiction metaphorically or as a figurative source to describe and interpret organizations. In this article, we go

  10. Organ mass measurements

    International Nuclear Information System (INIS)

    Kawamura, H.

    1998-01-01

    The term, anatomical measurements, in the context of this Co-ordinated Research Programme refers to measurements of masses of internal organs, although the human body is composed of internal organs and tissues such as skeleton, muscle, skin and adipose. The mass of an organ containing a radionuclide (source organ), and the mass of a target organ which absorbs energy of the radiation, are essential parameters in the ICRP dosimetric model derived from the MIRD method. Twelve specific organs of interest were proposed at the Coordinated Research Programme Project Formulation Meeting (PFM) in 1988. A slightly different set of thirteen organs with potential significance for radiation protection were selected for study at the Research Co-ordination Meeting held at the Bhabha Atomic Research Centre in 1991. The dimensions of the organs could also be useful information, but were considered unimportant for internal dose assessment. Due to the strong concern about the unified method for collecting organ mass data at the PFM, a guide-line was established stressing the need for organ data from subjects that were healthy and normal, at least until shortly before death, or from sudden death cases, following the Japanese experience. In this report, masses of nine to thirteen organs are presented from seven participating countries. Three participants have also reported the organ masses as fractions of the total body mass

  11. Organic consumption behavior

    NARCIS (Netherlands)

    Du, Shuili; Bartels, Jos; Reinders, Machiel; Sen, Sankar

    2017-01-01

    Consumer demand for organic food and non-food products has been growing dramatically. This study examines organic consumption behavior from a social identification perspective. Focusing on the central role of organic consumer identification (OCI), or the extent to which individuals categorize

  12. Stability of Organic Nanowires

    DEFF Research Database (Denmark)

    Balzer, F.; Schiek, M.; Wallmann, I.

    2011-01-01

    The morphological stability of organic nanowires over time and under thermal load is of major importance for their use in any device. In this study the growth and stability of organic nanowires from a naphthyl end-capped thiophene grown by organic molecular beam deposition is investigated via ato...

  13. Organic 'Plastic' Optoelectronic Devices

    International Nuclear Information System (INIS)

    Sariciftci, N.S.

    2006-01-01

    Recent developments on conjugated polymer based photovoltaic diodes and photoactive organic field effect transistors (photOFETs) are discussed. The photophysics of such devices is based on the photoinduced charge transfer from donor type semiconducting conjugated polymers onto acceptor type conjugated polymers or acceptor molecules such as Buckminsterfullerene, C 6 0. Potentially interesting applications include sensitization of the photoconductivity and photovoltaic phenomena as well as photoresponsive organic field effect transistors (photOFETs). Furthermore, organic polymeric/inorganic nanoparticle based 'hybrid' solar cells will be discussed. This talk gives an overview of materials' aspect, charge-transport, and device physics of organic diodes and field-effect transistors. Furthermore, due to the compatibility of carbon/hydrogen based organic semiconductors with organic biomolecules and living cells there can be a great opportunity to integrate such organic semiconductor devices (biOFETs) with the living organisms. In general the largely independent bio/lifesciences and information technology of today, can be thus bridged in an advanced cybernetic approach using organic semiconductor devices embedded in bio-lifesciences. This field of bio-organic electronic devices is proposed to be an important mission of organic semiconductor devices

  14. Organic food processing

    DEFF Research Database (Denmark)

    Kahl, Johannes; Alborzi, Farnaz; Beck, Alexander

    2014-01-01

    In 2007 EU Regulation (EC) 834/2007 introduced principles and criteria for organic food processing. These regulations have been analysed and discussed in several scientific publications and research project reports. Recently, organic food quality was described by principles, aspects and criteria....... These principles from organic agriculture were verified and adapted for organic food processing. Different levels for evaluation were suggested. In another document, underlying paradigms and consumer perception of organic food were reviewed against functional food, resulting in identifying integral product...... identity as the underlying paradigm and a holistic quality view connected to naturalness as consumers' perception of organic food quality. In a European study, the quality concept was applied to the organic food chain, resulting in a problem, namely that clear principles and related criteria were missing...

  15. Immunity of international organizations

    CERN Document Server

    Schrijver, Nico

    2015-01-01

    Immunity rules are part and parcel of the law of international organizations. It has long been accepted that international organizations and their staff need to enjoy immunity from the jurisdiction of national courts. However, it is the application of these rules in practice that increasingly causes controversy. Claims against international organizations are brought before national courts by those who allegedly suffer from their activities. These can be both natural and legal persons such as companies. National courts, in particular lower courts, have often been less willing to recognize the immunity of the organization concerned than the organization s founding fathers. Likewise, public opinion and legal writings frequently criticize international organizations for invoking their immunity and for the lack of adequate means of redress for claimants. It is against this background that an international conference was organized at Leiden University in June 2013. A number of highly qualified academics and practit...

  16. The Expressive Organization

    DEFF Research Database (Denmark)

    This text challenges beliefs about organizational identity, reputation, and branding. It contains a wealth of new ideas for finding the elusive answers to questions troubling contemporary organizations. How does an organization create a strong reputation? What are the implications of corporate br...... students of management, business strategy, accounting, marketing, and communication studies; MBA students; Managers and consultants.......This text challenges beliefs about organizational identity, reputation, and branding. It contains a wealth of new ideas for finding the elusive answers to questions troubling contemporary organizations. How does an organization create a strong reputation? What are the implications of corporate...... branding on organizational structures and processes? How do organizations discover their identities? These are some of the vexing problems addressed in this book by a diverse international team of contributors. According to the authors, the future lies with "the expressive organization". Such organizations...

  17. Doped Organic Transistors.

    Science.gov (United States)

    Lüssem, Björn; Keum, Chang-Min; Kasemann, Daniel; Naab, Ben; Bao, Zhenan; Leo, Karl

    2016-11-23

    Organic field-effect transistors hold the promise of enabling low-cost and flexible electronics. Following its success in organic optoelectronics, the organic doping technology is also used increasingly in organic field-effect transistors. Doping not only increases device performance, but it also provides a way to fine-control the transistor behavior, to develop new transistor concepts, and even improve the stability of organic transistors. This Review summarizes the latest progress made in the understanding of the doping technology and its application to organic transistors. It presents the most successful doping models and an overview of the wide variety of materials used as dopants. Further, the influence of doping on charge transport in the most relevant polycrystalline organic semiconductors is reviewed, and a concise overview on the influence of doping on transistor behavior and performance is given. In particular, recent progress in the understanding of contact doping and channel doping is summarized.

  18. Focus on Organic Conductors

    Directory of Open Access Journals (Sweden)

    Shinya Uji, Takehiko Mori and Toshihiro Takahashi

    2009-01-01

    Full Text Available Organic materials are usually thought of as electrical insulators. Progress in chemical synthesis, however, has brought us a rich variety of conducting organic materials, which can be classified into conducting polymers and molecular crystals. Researchers can realize highly conducting molecular crystals in charge-transfer complexes, where suitable combinations of organic electron donor or acceptor molecules with counter ions or other organic molecules provide charge carriers. By means of a kind of chemical doping, the charge-transfer complexes exhibit high electrical conductivity and, thanks to their highly crystalline nature, even superconductivity has been observed. This focus issue of Science and Technology of Advanced Materials is devoted to the research into such 'organic conductors'The first organic metal was (TTF(TCNQ, which was found in 1973 to have high conductivity at room temperature and a metal–insulator transition at low temperatures. The first organic superconductor was (TMTSF2PF6, whose superconductivity under high pressures was reported by J´erome in 1980. After these findings, the research on organic conductors exploded. Hundreds of organic conductors have been reported, among which more than one hundred exhibit superconductivity. Recently, a single-component organic conductor has been found with metallic conductivity down to low temperatures.In these organic conductors, in spite of their simple electronic structures, much new physics has arisen from the low dimensionality. Examples are charge and spin density waves, characteristic metal–insulator transitions, charge order, unconventional superconductivity, superconductor–insulator transitions, and zero-gap conductors with Dirac cones. The discovery of this new physics is undoubtedly derived from the development of many intriguing novel organic conductors. High quality single crystals are indispensable to the precise measurement of electronic states.This focus issue

  19. Organically bound tritium

    International Nuclear Information System (INIS)

    Diabate, S.; Strack, S.

    1993-01-01

    Tritium released into the environment may be incorporated into organic matter. Organically bound tritium in that case will show retention times in organisms that are considerably longer than those of tritiated water which has significant consequences on dose estimates. This article reviews the most important processes of organically bound tritium production and transport through food networks. Metabolic reactions in plant and animal organisms with tritiated water as a reaction partner are of great importance in this respect. The most important production process, in quantitative terms, is photosynthesis in green plants. The translocation of organically bound tritium from the leaves to edible parts of crop plants should be considered in models of organically bound tritium behavior. Organically bound tritium enters the human body on several pathways, either from the primary producers (vegetable food) or at a higher tropic level (animal food). Animal experiments have shown that the dose due to ingestion of organically bound tritium can be up to twice as high as a comparable intake of tritiated water in gaseous or liquid form. In the environment, organically bound tritium in plants and animals is often found to have higher specific tritium concentrations than tissue water. This is not due to some tritium enrichment effects but to the fact that no equilibrium conditions are reached under natural conditions. 66 refs

  20. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laiho, Aki; Laine, Jari

    Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, Procurement organizations constantly have to evolve in order to match these demands. A conceptual model...... is presented and results of a first case study discussed. The findings highlight the importance of taking a contingency perspective on Procurement organization, understanding the internal and internal contingency factors. From a theoretical perspective, it opens up insights that can be furthermore leveraged...... in future studies in the fields of hybrid procurement organizations, global sourcing organizations as well as international procurement offices (IPOs). From a practical standpoint, an assessment of external and internal contingencies provides the opportunity to consciously match organization to its...

  1. Organic Farming in Europe

    OpenAIRE

    Willer, Helga

    2014-01-01

    In this article latest developments in Europe are presented: › Current statistics › Review of the European political and legal framework for organic agriculture › EU regulation on organic farming › Policy support › Action plans › Research › Progress of the OrganicDataNetwork project › Successful policy work of IFOAM EU › Further reading › Websites

  2. Organic Molecular Solids

    CERN Document Server

    Schwoerer, Marcus

    2007-01-01

    This is the first comprehensive textbook on the physical aspects of organic solids. All phenomena which are necessary in order to understand modern technical applications are being dealt with in a way which makes the concepts of the topics accessible for students. The chapters - from the basics, production and characterization of organic solids and layers to organic semiconductors, superconductors and opto-electronical applications - have been arranged in a logical and well thought-out order.

  3. Public Sector Organizations

    DEFF Research Database (Denmark)

    Meyer, Renate; Leixnering, Stephan

    2015-01-01

    New public management-inspired reforms created numerous autonomous units with many different faces and labels. This variety of organizations and organizational forms precludes a straightforward definition of what constitutes a public sector organization and blurs the boundaries between the public...... and private sectors as well as the boundaries of single organizations. In addition, the complexity of the interlocking arrangements and relationships in this public organizational landscape has resulted in considerable governance problems with serious implications for coordination and policy coherence....

  4. Information Aggregation in Organizations

    OpenAIRE

    Schulte, Elisabeth

    2006-01-01

    This dissertation contributes to the analysis of information aggregation procedures within organizations. Facing uncertainty about the consequences of a collective decision, information has to be aggregated before making a choice. Two main questions are addressed. Firstly, how well is an organization suited for the aggregation of decision-relevant information? Secondly, how should an organization be designed in order to aggregate information efficiently? The main part deals with information a...

  5. Colour and Organization Studies

    DEFF Research Database (Denmark)

    Beyes, Timon

    2017-01-01

    Colour is inescapable. It fills and forms the world, shaping what can be felt and known, desired and expressed. It thus becomes social technology and organizational tool. At the same time, however, colour betrays, undermines and subverts the attempts to manage it. Based on an understanding...... of colour as aesthetic force and medium of transformation, the essay presents a montage of scenes that set up encounters with what colour does: how it affects organization, and how it is affected by organization; how it organizes what is given to perception, knowledge and organization itself, and how...

  6. Management of information organizations

    CERN Document Server

    Afzal, Waseem

    2012-01-01

    This book is a significant step towards developing a body of management knowledge pertinent to the context of Library Information Science (LIS) and provides a succinct but deep account of management and information organizations. Management of Information Organizations presents a broad view of the information organizations and the nature of management in these organizations, and how information professionals are affected by such management systems. The book equips the reader with the knowledge that will enable them to develop a strong intellectual foundation relating to management and its mani

  7. Organizers in Development.

    Science.gov (United States)

    Anderson, Claire; Stern, Claudio D

    2016-01-01

    An "organizer" is formally defined as a region, or group of cells in an embryo that can both induce (change the fate) and pattern (generate an organized set of structures) adjacent embryonic cells. To date, about four such regions have been demonstrated: the primary or Spemann organizer (Hensen's node in amniotes), the notochord, the zone of polarizing activity of the limb bud, and the mid-hindbrain boundary. Here we review the evidence for these and compare them with a few other regions which have been proposed to represent other organizers and we speculate on why so few such regions have been discovered. © 2016 Elsevier Inc. All rights reserved.

  8. Education within the organization

    Directory of Open Access Journals (Sweden)

    Zlata Kastelic

    2016-09-01

    Full Text Available Research Question (RQ: What is the importance of education within the organization? Purpose: The purpose and objective of the research is to examine and present education within the organization and how to education affects on the performance and on the profits of the company. The objective of the task is to examine the education of employees for achieving business excellence and how the organization meets the needs and expectations of employees, and determine what is the process of acquiring and developing knowledge for the successful operation of the organization. Method: Quantitative - survey, qualitative – interview Results: The concrete examples or development organizations, opinion based on the profession. The results showed that the education within the organization is essential and that the future of companies largely depends on motivated and educated employees, who are able to quickly react and adapt to a changing business environment. Organization: Education is intended to all employees within the organization. Company: By education we want to influence on the entire organization, in terms of development. The originality: Research is original. Restrictions/further research: Limits of the study is that we deal with only a limited number of resources.

  9. Organizing Core Tasks

    DEFF Research Database (Denmark)

    Boll, Karen

    has remained much the same within the last 10 years. However, how the core task has been organized has changed considerable under the influence of various “organizing devices”. The paper focusses on how organizing devices such as risk assessment, output-focus, effect orientation, and treatment...... projects influence the organization of core tasks within the tax administration. The paper shows that the organizational transformations based on the use of these devices have had consequences both for the overall collection of revenue and for the employees’ feeling of “making a difference”. All in all...

  10. Titan's organic chemistry

    Science.gov (United States)

    Sagan, C.; Thompson, W. R.; Khare, B. N.

    1985-01-01

    Voyager discovered nine simple organic molecules in the atmosphere of Titan. Complex organic solids, called tholins, produced by irradiation of the simulated Titanian atmosphere, are consistent with measured properties of Titan from ultraviolet to microwave frequencies and are the likely main constituents of the observed red aerosols. The tholins contain many of the organic building blocks central to life on earth. At least 100-m, and possibly kms thicknesses of complex organics have been produced on Titan during the age of the solar system, and may exist today as submarine deposits beneath an extensive ocean of simple hydrocarbons.

  11. The Visual Dimension in Organizing, Organization, and Organization Research

    DEFF Research Database (Denmark)

    Meyer, Renate E.; Höllerer, Markus A.; Jancsary, Dennis

    2013-01-01

    and meaning construction. Building primarily on insights from the phenomenological tradition in organization theory and from social semiotics, this article sets out to consolidate previous scholarly efforts and to sketch a fertile future research agenda. After briefly exploring the workings of visuals, we...... approaches to feature visuals in research designs and to include the visual dimension in scholarly inquiry. Subsequently, we outline, in some detail, promising avenues for future research, and close with a reflection on the impact of visualization on scientific practice itself....

  12. U.S. Pacific Command > Organization > Organization Chart

    Science.gov (United States)

    Responsibility USPACOM Previous Commanders Organization Organization Chart Media News Flickr Photos Video Directory Media Inquiries Home : Organization : Organization Chart About DoD DoD Careers Join the Military

  13. Innovative Mechanism of Rural Organization Based on Self-Organization

    OpenAIRE

    Wang, Xing jin; Gao, Bing

    2011-01-01

    The paper analyzes the basic situation for the formation of innovative rural organizations with the form of self-organization; revels the features of self-organization, including the four aspects of openness of rural organization, innovation of rural organization is far away from equilibrium, the non-linear response mechanism of rural organization innovation and the random rise and fall of rural organization innovation. The evolution mechanism of rural organization innovation is reveled accor...

  14. Communicative Constitution of Organizations

    DEFF Research Database (Denmark)

    Schoeneborn, Dennis; Vasquez, Consuelo

    2017-01-01

    The notion of the communicative constitution of organizations (CCO) is at the center of a growing theoretical development within organizational communication studies. CCO scholarship is based on the idea that organization emerges in and is sustained and transformed by communication. This entry...

  15. Creating spatial organizations

    NARCIS (Netherlands)

    Lekanne Deprez, F.R.E.; Tissen, R.J.

    2009-01-01

    This paper addresses the spatial design of modern organizations in the context of a fundamental change which is currently taking place in the way companies view their organizations and the inherent performance expectations, requirements and results underlying these. This change involves a managerial

  16. Chromatin meets its organizers.

    Science.gov (United States)

    Bodnar, Megan S; Spector, David L

    2013-06-06

    Chromatin organization and gene-gene interactions are critical components of carrying out developmental programs. Phillips-Cremins et al. identify a series of unexpected architectural proteins that work in a combinatorial manner to functionally organize chromatin in a cell-type-specific manner at the submegabase-length scale. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Mintzberg on organizations

    Directory of Open Access Journals (Sweden)

    Prof. Ph.D. Sorin-George Toma

    2008-05-01

    Full Text Available Henry Mintzberg is considered as one of the most representative writers in management.Until now,he has written more than 140 monographs and articles, and 13 books,mostly in the management field. On the basis of his research findings, Mintzberg proposed a typology of organizations. Taking into account their structure, he discovered seven major types of organizations

  18. Mintzberg on organizations

    OpenAIRE

    Sorin-George Toma

    2008-01-01

    Henry Mintzberg is considered as one of the most representative writers in management.Until now,he has written more than 140 monographs and articles, and 13 books,mostly in the management field. On the basis of his research findings, Mintzberg proposed a typology of organizations. Taking into account their structure, he discovered seven major types of organizations

  19. LOCAL ORGANIZING COMMITTEE

    Indian Academy of Sciences (India)

    Prof. B. B. P. Gupta

    INDIAN ACADEMY OF SCIENCES. Bengaluru. 83rd ANNUAL MEETING. 3–5 November 2017, NEHU, Shillong. LOCAL ORGANIZING COMMITTEE. Local Organizing Committee. 1. Prof. S. K. Srivastava. Chairman. Vice-Chancellor, NEHU, Shillong. 2. Prof. B. B. P. Gupta. Organising Secretary. Department of Zoology ...

  20. Person-Organization Pairing

    Science.gov (United States)

    Scirotino, P. T.; Madden, Denis

    1973-01-01

    Malfunctioning organizations do not facilitate the accomplishment of the purposes of their members in a number of ways and for a number of reasons. This paper used Maslow's hierarchy of needs model in an attempt to describe one view of that malfunction. Leadership is examined briefly as a functioning organization's facilitating arrangement.…

  1. Soil organic matter

    International Nuclear Information System (INIS)

    1976-01-01

    The nature, content and behaviour of the organic matter, or humus, in soil are factors of fundamental importance for soil productivity and the development of optimum conditions for growth of crops under diverse temperate, tropical and arid climatic conditions. In the recent symposium on soil organic matter studies - as in the two preceding ones in 1963 and 1969 - due consideration was given to studies involving the use of radioactive and stable isotopes. However, the latest symposium was a departure from previous efforts in that non-isotopic approaches to research on soil organic matter were included. A number of papers dealt with the behaviour and functions of organic matter and suggested improved management practices, the use of which would contribute to increasing agricultural production. Other papers discussed the turnover of plant residues, the release of plant nutrients through the biodegradation of organic compounds, the nitrogen economy and the dynamics of transformation of organic forms of nitrogen. In addition, consideration was given to studies on the biochemical transformation of organic matter, characterization of humic acids, carbon-14 dating and the development of modern techniques and their impact on soil organic matter research

  2. MICROWAVES IN ORGANIC SYNTHESIS

    Science.gov (United States)

    The effect of microwaves, a non-ionizing radiation, on organic reactions is described both in polar solvents and under solvent-free conditions. The special applications are highlighted in the context of solventless organic synthesis which involve microwave (MW) exposure of neat r...

  3. French nuclear organization

    International Nuclear Information System (INIS)

    Naudet, G.

    1993-01-01

    The French nuclear organization is characterized by two main features: the small number of firms involved and the role of the Government. In this text we give the French organization for nuclear industry and the role of Government and public authorities. 7 figs

  4. Are Learning Organizations Pragmatic?

    Science.gov (United States)

    Cavaleri, Steven A.

    2008-01-01

    Purpose: The purpose of this paper is to evaluate the future prospects of the popular concept known as the learning organization; to trace the influence of philosophical pragmatism on the learning organization and to consider its potential impact on the future; and to emphasize how pragmatic theories have shaped the development of Deming's total…

  5. Organizing Rural Health Care

    DEFF Research Database (Denmark)

    Bunkenborg, Mikkel

    2012-01-01

    to organize rural health care is more regulatory and distanced in its emphasis on nudging patients and doctors towards the right decisions through economic incentives. This bureaucratic approach to organizing health individually offers a sharp contrast to the religious collectivities that form around health...

  6. Sustainable Learning Organizations

    Science.gov (United States)

    Velazquez, Luis E.; Esquer, Javier; Munguia, Nora E.; Moure-Eraso, Rafael

    2011-01-01

    Purpose: The purpose of this paper is to debate how companies may better become a sustainable learning organization by offering the most used and insightful concepts of sustainability. Design/methodology/approach: Through literature review, learning organization and sustainability perspectives are explored and compared. Findings: Learning…

  7. Organic food and farming

    DEFF Research Database (Denmark)

    Kledal, Paul Rye

    The paper is based on research conducted for DARCOF II (Danish Research Centre for Organic Farming, www.darcof.dk). The aim of the research project is to analyze the future development of the Danish organic food sector through focusing on two agro-commodities: vegetables and pork. Emphasis...... is placed on identification of economic forces within the supply chains. The main conclusions of the paper – being the results from the organic vegetable chain – are that the rules and regulations, and the development of alternative transaction processes in organic food and farming have so far been founded...... conventional farmers – declining prices, concentration of production and shift in bargaining power to the retailers. Logically, this situation will lead eventually to increasing conflicts between organic values and their subordination to free market forces, i.e. conventionalization. In the same time retailers...

  8. Artificial organs and transplantation.

    Science.gov (United States)

    Splendiani, G; Cipriani, S; Vega, A; Casciani, C U

    2003-05-01

    Nowadays artificial devices are not able to totally and undefinitely replace the loss of function of all vital organs and artificial organs can be used only to bridge the time to transplantation, which must be considered the first choice in the therapeutical approach for many chronic diseases. Since general population aging process is leading to an increase of organ demand, the gap between performed and requested transplantation is hard to fill. Xenotransplantation is nowadays only an experimental alternative solution and we have to do our best using available artificial organs to increase and improve the survival of patients waiting for transplantation. In this meeting we particularly dealt about organ function replacing therapy, especially regarding the kidney, heart, liver, pancreas and ear.

  9. Organic semiconductor crystals.

    Science.gov (United States)

    Wang, Chengliang; Dong, Huanli; Jiang, Lang; Hu, Wenping

    2018-01-22

    Organic semiconductors have attracted a lot of attention since the discovery of highly doped conductive polymers, due to the potential application in field-effect transistors (OFETs), light-emitting diodes (OLEDs) and photovoltaic cells (OPVs). Single crystals of organic semiconductors are particularly intriguing because they are free of grain boundaries and have long-range periodic order as well as minimal traps and defects. Hence, organic semiconductor crystals provide a powerful tool for revealing the intrinsic properties, examining the structure-property relationships, demonstrating the important factors for high performance devices and uncovering fundamental physics in organic semiconductors. This review provides a comprehensive overview of the molecular packing, morphology and charge transport features of organic semiconductor crystals, the control of crystallization for achieving high quality crystals and the device physics in the three main applications. We hope that this comprehensive summary can give a clear picture of the state-of-art status and guide future work in this area.

  10. Agreements in Virtual Organizations

    Science.gov (United States)

    Pankowska, Malgorzata

    This chapter is an attempt to explain the important impact that contract theory delivers with respect to the concept of virtual organization. The author believes that not enough research has been conducted in order to transfer theoretical foundations for networking to the phenomena of virtual organizations and open autonomic computing environment to ensure the controllability and management of them. The main research problem of this chapter is to explain the significance of agreements for virtual organizations governance. The first part of this chapter comprises explanations of differences among virtual machines and virtual organizations for further descriptions of the significance of the first ones to the development of the second. Next, the virtual organization development tendencies are presented and problems of IT governance in highly distributed organizational environment are discussed. The last part of this chapter covers analysis of contracts and agreements management for governance in open computing environments.

  11. Organ donations after death

    Directory of Open Access Journals (Sweden)

    Bernarda Logar

    2003-09-01

    Full Text Available The paper discusses public opinion on post-mortem organ donation, especially the difference between high support of public opinion to transplant activity, its general readiness to donate organs and the low number of signed organ donor cards. Through different approaches the article tries to point out possible factors relevant to the decision to donate organs. Early studies showed demographic variables and information as significant factors when deciding to donate organs after death. As there was not enough evidence that long-term effect through these factors is significant, the need for new investigation has grown. Social cognition theories helped understanding the difference mentioned above. It seems that the use of this approach might contribute to the understanding the problem and to delimit most useful factors when working with public.

  12. Self-organizing plasmas

    International Nuclear Information System (INIS)

    Hayashi, T.; Sato, T.

    1999-01-01

    The primary purpose of this paper is to extract a grand view of self-organization through an extensive computer simulation of plasmas. The assertion is made that self-organization is governed by three key processes, i.e. the existence of an open complex system, the existence of information (energy) sources and the existence of entropy generation and expulsion processes. We find that self-organization takes place in an intermittent fashion when energy is supplied continuously from outside. In contrast, when the system state is suddenly changed into a non-equilibrium state externally, the system evolves stepwise and reaches a minimum energy state. We also find that the entropy production rate is maximized whenever a new ordered structure is created and that if the entropy generated during the self-organizing process is expelled from the system, then the self-organized structure becomes more prominent and clear. (author)

  13. Doping of organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Luessem, B.; Riede, M.; Leo, K. [Institut fuer Angewandte Photophysik, TU Dresden (Germany)

    2013-01-15

    The understanding and applications of organic semiconductors have shown remarkable progress in recent years. This material class has been developed from being a lab curiosity to the basis of first successful products as small organic LED (OLED) displays; other areas of application such as OLED lighting and organic photovoltaics are on the verge of broad commercialization. Organic semiconductors are superior to inorganic ones for low-cost and large-area optoelectronics due to their flexibility, easy deposition, and broad variety, making tailor-made materials possible. However, electrical doping of organic semiconductors, i.e. the controlled adjustment of Fermi level that has been extremely important to the success of inorganic semiconductors, is still in its infancy. This review will discuss recent work on both fundamental principles and applications of doping, focused primarily to doping of evaporated organic layers with molecular dopants. Recently, both p- and n-type molecular dopants have been developed that lead to efficient and stable doping of organic thin films. Due to doping, the conductivity of the doped layers increases several orders of magnitude and allows for quasi-Ohmic contacts between organic layers and metal electrodes. Besides reducing voltage losses, doping thus also gives design freedom in terms of transport layer thickness and electrode choice. The use of doping in applications like OLEDs and organic solar cells is highlighted in this review. Overall, controlled molecular doping can be considered as key enabling technology for many different organic device types that can lead to significant improvements in efficiencies and lifetimes. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Doping of organic semiconductors

    International Nuclear Information System (INIS)

    Luessem, B.; Riede, M.; Leo, K.

    2013-01-01

    The understanding and applications of organic semiconductors have shown remarkable progress in recent years. This material class has been developed from being a lab curiosity to the basis of first successful products as small organic LED (OLED) displays; other areas of application such as OLED lighting and organic photovoltaics are on the verge of broad commercialization. Organic semiconductors are superior to inorganic ones for low-cost and large-area optoelectronics due to their flexibility, easy deposition, and broad variety, making tailor-made materials possible. However, electrical doping of organic semiconductors, i.e. the controlled adjustment of Fermi level that has been extremely important to the success of inorganic semiconductors, is still in its infancy. This review will discuss recent work on both fundamental principles and applications of doping, focused primarily to doping of evaporated organic layers with molecular dopants. Recently, both p- and n-type molecular dopants have been developed that lead to efficient and stable doping of organic thin films. Due to doping, the conductivity of the doped layers increases several orders of magnitude and allows for quasi-Ohmic contacts between organic layers and metal electrodes. Besides reducing voltage losses, doping thus also gives design freedom in terms of transport layer thickness and electrode choice. The use of doping in applications like OLEDs and organic solar cells is highlighted in this review. Overall, controlled molecular doping can be considered as key enabling technology for many different organic device types that can lead to significant improvements in efficiencies and lifetimes. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  15. Self-Organizing Robots

    CERN Document Server

    Murata, Satoshi

    2012-01-01

    It is man’s ongoing hope that a machine could somehow adapt to its environment by reorganizing itself. This is what the notion of self-organizing robots is based on. The theme of this book is to examine the feasibility of creating such robots within the limitations of current mechanical engineering. The topics comprise the following aspects of such a pursuit: the philosophy of design of self-organizing mechanical systems; self-organization in biological systems; the history of self-organizing mechanical systems; a case study of a self-assembling/self-repairing system as an autonomous distributed system; a self-organizing robot that can create its own shape and robotic motion; implementation and instrumentation of self-organizing robots; and the future of self-organizing robots. All topics are illustrated with many up-to-date examples, including those from the authors’ own work. The book does not require advanced knowledge of mathematics to be understood, and will be of great benefit to students in the rob...

  16. The discipline of organizing

    CERN Document Server

    2013-01-01

    Organizing is such a common activity that we often do it without thinking much about it. In our daily lives we organize physical things--books on shelves, cutlery in kitchen drawers--and digital things--Web pages, MP3 files, scientific datasets. Millions of people create and browse Web sites, blog, tag, tweet, and upload and download content of all media types without thinking "I'm organizing now" or "I'm retrieving now." This book offers a framework for the theory and practice of organizing that integrates information organization (IO) and information retrieval (IR), bridging the disciplinary chasms between Library and Information Science and Computer Science, each of which views and teaches IO and IR as separate topics and in substantially different ways. It introduces the unifying concept of an Organizing System--an intentionally arranged collection of resources and the interactions they support--and then explains the key concepts and challenges in the design and deployment of Organizing Systems in many do...

  17. Individual and Organizations

    DEFF Research Database (Denmark)

    Felin, Teppo; Foss, Nicolai Juul

    2006-01-01

    Making links between micro and macro levels has been problematic in the social sciences, and the literature in strategic management and organization theory is no exception The purpose of this chapter is to raise theoretical issues in developing micro-foundations for strategic management and organ......Making links between micro and macro levels has been problematic in the social sciences, and the literature in strategic management and organization theory is no exception The purpose of this chapter is to raise theoretical issues in developing micro-foundations for strategic management...

  18. Self-organizing representations

    Energy Technology Data Exchange (ETDEWEB)

    Kohonen, T.

    1983-01-01

    A property which is commonplace in the brain but which has always been ignored in learning machines is the spatial order of the processing units. This order is clearly highly significant and in nature it develops gradually during the lifetime of the organism. It then serves as the basis for perceptual and cognitive processes, and memory, too. The spatial order in biological organisms is often believed to be genetically determined. It is therefore intriguing to learn that a meaningful and optimal spatial order is formed in an extremely simple self-organizing process whereby certain feature maps are formed automatically. 8 references.

  19. Neurology and international organizations.

    Science.gov (United States)

    Mateen, Farrah J

    2013-07-23

    A growing number of international stakeholders are engaged with neurologic diseases. This article provides a brief overview of important international stakeholders in the practice of neurology, including global disease-specific programs, United Nations agencies, governmental agencies with international influence, nongovernmental organizations, international professional organizations, large private donors, private-public partnerships, commercial interests, armed forces, and universities and colleges. The continued engagement of neurologists is essential for the growing number of international organizations that can and should incorporate neurologic disease into their global agendas.

  20. Chloric organic compound

    International Nuclear Information System (INIS)

    Moalem, F.

    2000-01-01

    Since many years ago, hazardous and toxic refuses which are results of human activities has been carelessly without any Biological and Engineering facts and knowledge discharged into our land and water. The effects of discharging those materials in environment are different. Some of refuse materials shows short and other has long-time adverse effects in our environment, Among hazardous organic chemical materials, chlorine, consider, to be the main element. Organic materials with chlorine is called chlorine hydrocarbon as a hazardous compound. This paper discuss the hazardous materials especially chloric organic compound and their misuse effects in environment and human being

  1. Organized organic ultrathin films fundamentals and applications

    CERN Document Server

    Ariga, Katsuhiko

    2012-01-01

    This handy reference is the first comprehensive book covering both fundamentals and recent developments in the field with an emphasis on nanotechnology. Written by a highly regarded author in the field, the book details state-of-the-art preparation, characterization and applications of thin films of organic molecules and biomaterials fabricated by wet processes and also highlights applications in nanotechnology The categories of films covered include monomolecular films (monolayers) both on a water surface and on a solid plate, Langmuir-Blodgett films (transferred multilayer films on a solid plate from a water surface), layer-by-layer films (adsorbed multilayer films on a solid support), and spontaneously assembled films in solution.

  2. Strengths, weaknesses, opportunities, and threats analysis of integrating the World Health Organization patient safety curriculum into undergraduate medical education in Pakistan: a qualitative case study

    Directory of Open Access Journals (Sweden)

    Samreen Misbah

    2017-12-01

    Full Text Available Purpose The purpose of this study was to conduct a strengths, weaknesses, opportunities, and threats (SWOT analysis of integrating the World Health Organization (WHO patient safety curriculum into undergraduate medical education in Pakistan. Methods A qualitative interpretive case study was conducted at Riphah International University, Islamabad, from October 2016 to June 2017. The study included 9 faculty members and 1 expert on patient safety. The interviews were audiotaped, and a thematic analysis of the transcripts was performed using NVivo software. Results Four themes were derived based on the need analysis model. The sub-themes derived from the collected data were arranged under the themes of strengths, weaknesses, opportunities, and threats, in accordance with the principles of SWOT analysis. The strengths identified were the need for a formal patient safety curriculum and its early integration into the undergraduate program. The weaknesses were faculty awareness and participation in development programs. The opportunities were an ongoing effort to develop an appropriate curriculum, to improve the current culture of healthcare, and to use the WHO curricular resource guide. The threats were attitudes towards patient safety in Pakistani culture, resistance to implementation from different levels, and the role of regulatory authorities. Conclusion The theme of patient safety needs to be incorporated early into the formal medical education curriculum, with the main goals of striving to do no harm and seeing mistakes as opportunities to learn. Faculty development activities need to be organized, and faculty members should to be encouraged to participate in them. The lack of a patient safety culture was identified as the primary reason for resistance to this initiative at many levels. The WHO curriculum, amended according to local institutional culture, can be implemented appropriately with support from the corresponding regulatory bodies.

  3. Strengths, weaknesses, opportunities, and threats analysis of integrating the World Health Organization patient safety curriculum into undergraduate medical education in Pakistan: a qualitative case study.

    Science.gov (United States)

    Misbah, Samreen; Mahboob, Usman

    2017-01-01

    The purpose of this study was to conduct a strengths, weaknesses, opportunities, and threats (SWOT) analysis of integrating the World Health Organization (WHO) patient safety curriculum into undergraduate medical education in Pakistan. A qualitative interpretive case study was conducted at Riphah International University, Islamabad, from October 2016 to June 2017. The study included 9 faculty members and 1 expert on patient safety. The interviews were audiotaped, and a thematic analysis of the transcripts was performed using NVivo software. Four themes were derived based on the need analysis model. The sub-themes derived from the collected data were arranged under the themes of strengths, weaknesses, opportunities, and threats, in accordance with the principles of SWOT analysis. The strengths identified were the need for a formal patient safety curriculum and its early integration into the undergraduate program. The weaknesses were faculty awareness and participation in development programs. The opportunities were an ongoing effort to develop an appropriate curriculum, to improve the current culture of healthcare, and to use the WHO curricular resource guide. The threats were attitudes towards patient safety in Pakistani culture, resistance to implementation from different levels, and the role of regulatory authorities. The theme of patient safety needs to be incorporated early into the formal medical education curriculum, with the main goals of striving to do no harm and seeing mistakes as opportunities to learn. Faculty development activities need to be organized, and faculty members should to be encouraged to participate in them. The lack of a patient safety culture was identified as the primary reason for resistance to this initiative at many levels. The WHO curriculum, amended according to local institutional culture, can be implemented appropriately with support from the corresponding regulatory bodies.

  4. Aging of Organic Nanowires

    DEFF Research Database (Denmark)

    Balzer, Frank; Schiek, Manuela; Osadnik, Andreas

    2012-01-01

    Organic semiconductors formed by epitaxial growth from small molecules such as the para-phenylenes or squaraines promise a vast application potential as the active ingredient in electric and optoelectronic devices. Their self-organization into organic nanowires or "nanofibers" adds a peculiar...... attribute, making them especially interesting for light generation in OLEDs and for light-harvesting devices such as solar cells. Functionalization of the molecules allows the customization of optical and electrical properties. However, aging of the wires might lead to a considerable decrease in device...... performance over time. In this study the morphological stability of organic nanoclusters and nanowires from the methoxy functionalized quaterphenylene, 4,4'''dimethoxy-1,1':4',1''4'',1'''-quaterphenylene (MOP4), is investigated in detail. Aging experiments conducted by atomic force microscopy under ambient...

  5. Professionalism and nonprofit organizations.

    Science.gov (United States)

    Majone, G

    1984-01-01

    Many professionals prefer to work in nonprofit organizations, rather than in either for-profit or bureaucratic organizations. This preference suggests that nonprofits may be successful in reducing the tension between professional principles and institutional requirements. Professionals in for-profit organizations must submit to the control of a manager who is motivated to overrule them whenever their decisions come into conflict with the goal of profit maximization. Bureaucratic organizations stress predictability of results and adherence to rules as the overriding criteria of evaluation and control. This paper argues that nonprofits are on the whole superior from the point of view of professional ideology and practice. Thus, given a commitment to the values of professionalism, the preference for the nonprofit form becomes understandable, even without the usual assumptions about income-maximizing behavior.

  6. Destruction of organics

    International Nuclear Information System (INIS)

    Cowlam, S.K.

    1988-01-01

    This paper summarises the processes for the treatment of organic matter in radioactive waste. Pyrolysis, incineration, and digestion, wet oxidation, immobilisation, alkaline hydrolysis and cementation are compared and evaluated. (U.K.)

  7. Transparency in Organizing

    DEFF Research Database (Denmark)

    Albu, Oana Brindusa

    This dissertation provides a critical analysis of transparency in the context of organizing. The empirical material is based on qualitative studies of international cooperative organizations. The dissertation seeks to contribute to transparency and organizing scholarship by adopting a communication...... centred approach to explore the implications of pursuing ideals of transparency in organizational relationships. The dissertation is comprised of four papers each contributing to extant debates in organizational studies and transparency literature. The findings indicate that transparency, in contrast...... to being a solution for efficiency and democratic organizing, is a communicatively contested process which may lead to unintended consequences. The dissertation shows that transparency is performative: it can impact authority by de/legitimating action, shape the processes of organizational identity co...

  8. Biomaterials for artificial organs

    CERN Document Server

    Lysaght, Michael J

    2010-01-01

    The worldwide demand for organ transplants far exceeds available donor organs. Consequently some patients die whilst waiting for a transplant. Synthetic alternatives are therefore imperative to improve the quality of, and in some cases, save people's lives. Advances in biomaterials have generated a range of materials and devices for use either outside the body or through implantation to replace or assist functions which may have been lost through disease or injury. Biomaterials for artificial organs reviews the latest developments in biomaterials and investigates how they can be used to improve the quality and efficiency of artificial organs. Part one discusses commodity biomaterials including membranes for oxygenators and plasmafilters, titanium and cobalt chromium alloys for hips and knees, polymeric joint-bearing surfaces for total joint replacements, biomaterials for pacemakers, defibrillators and neurostimulators and mechanical and bioprosthetic heart valves. Part two goes on to investigate advanced and ...

  9. Biotechnology organizations in action

    DEFF Research Database (Denmark)

    Norus, Jesper

    This volume analyzes the dynamics and interactive processes among the players (individuals, institutions, and organizations/firms) that have constituted and legitimized the development of the biotechnology industries. The unit of analysis is small entrepreneurial firms developing biotechnological...

  10. Pelvic Organ Prolapse

    Science.gov (United States)

    ... the Treatment Options for Pelvic Organ Prolapse? After obtaining a detailed medical history and completing a thorough ... Food and Drug Administration 10903 New Hampshire Avenue Silver Spring, MD 20993 1-888-INFO-FDA (1- ...

  11. Biomaterials in Artificial Organs.

    Science.gov (United States)

    Kambic, Helen E.; And Others

    1986-01-01

    Biomaterials are substances or combinations of substances that can be used in a system that treats, augments, or replaces any tissue, organ, or body function. The nature and role of these substances, particularly in the cadiovascular system, are discussed. (JN)

  12. Technologies in organic farming

    DEFF Research Database (Denmark)

    Lassen, Jesper

    2015-01-01

    the nutrient gap by recycling sewage sludge, and in particular the criteria applied when these technologies are assessed, are analysed. This part of the analysis shows how organic consumers base their assessment of alternative strategies and technologies primarily on concerns about environmental risks...... to phase out their use of conventional manure before 2021. This, however, raises a number of questions about consumers’ acceptance of the alternative technologies that have been proposed to close the nutrient gap. Drawing on qualitative interviews with Danish organic consumers, this paper first discusses...... what, from a consumers perspective, characterizes the technologies consumers associate with organic production. This part of the analysis shows that by and large consumers regard organic technologies as the opposite of conventional farming. Second, consumers’ perceptions of solutions suggested to close...

  13. Organic electrochemical transistors

    Science.gov (United States)

    Rivnay, Jonathan; Inal, Sahika; Salleo, Alberto; Owens, Róisín M.; Berggren, Magnus; Malliaras, George G.

    2018-02-01

    Organic electrochemical transistors (OECTs) make effective use of ion injection from an electrolyte to modulate the bulk conductivity of an organic semiconductor channel. The coupling between ionic and electronic charges within the entire volume of the channel endows OECTs with high transconductance compared with that of field-effect transistors, but also limits their response time. The synthetic tunability, facile deposition and biocompatibility of organic materials make OECTs particularly suitable for applications in biological interfacing, printed logic circuitry and neuromorphic devices. In this Review, we discuss the physics and the mechanism of operation of OECTs, focusing on their identifying characteristics. We highlight organic materials that are currently being used in OECTs and survey the history of OECT technology. In addition, form factors, fabrication technologies and applications such as bioelectronics, circuits and memory devices are examined. Finally, we take a critical look at the future of OECT research and development.

  14. ORA: Organization Risk Analyzer

    National Research Council Canada - National Science Library

    Carley, Kathleen M; Reminga, Jeff

    2004-01-01

    .... Measures are also organized by input requirements and by output. ORA generates formatted reports viewable on screen or in log files, and reads and writes networks in multiple data formats to be interoperable...

  15. Concentrations of Indicator Organisms

    Data.gov (United States)

    U.S. Environmental Protection Agency — It is a compilation of organism concentrations of 16 sampling events conducted between July 2015 and February 2016. It also includes statistical analysis such as...

  16. Underfunding in Terrorist Organizations

    Science.gov (United States)

    Shapiro, Jacob N.; Siegel, David A.

    A review of international terrorist activity reveals a pattern of financially strapped operatives working for organizations that seem to have plenty of money. To explain this observation, and to examine when restricting terrorists’ funds will reduce their lethality, we model a hierarchical terror organization in which leaders delegate financial and logistical tasks to middlemen, but cannot perfectly monitor them for security reasons. These middlemen do not always share their leaders’ interests: the temptation exists to skim funds from financial transactions. When middlemen are sufficiently greedy and organizations suffer from sufficiently strong budget constraints, leaders will not fund attacks because the costs of skimming are too great. Using general functional forms, we find important nonlinearities in terrorists’ responses to government counter-terrorism. Restricting terrorists’ funds may be ineffective until a critical threshold is reached, at which point cooperation within terrorist organizations begins to break down and further government actions have a disproportionately large impact.

  17. Feed and organic matter

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Johanne Tang

    2011-01-01

    impact on the receiving water body by reducing dissolved oxygen concentrations and increasing sedimentation. Within aquaculture systems, a high organic load may affect fish health and performance directly (e.g., gill disease) as well as indirectly (proliferation of pathogenic bacteria and parasites......, reduction of dissolved oxygen concentrations, etc.). In recirculating aquaculture systems (RAS), a high organic load caused by limited water exchange may affect biofilter performance by favouring heterotrophic bacteria at the expense of autotrophic, nitrifying bacteria. Organic waste in RAS primarily...... originates from undigested feed, but also metabolic losses, mucus, dead tissue, feed waste and intake water may contribute. The nutrient composition of the feed affects the quantity and composition of the organic (undigested) waste, and including for example plant protein ingredients may affect...

  18. Organic Chemistry in Space

    Science.gov (United States)

    Charnley, Steven

    2009-01-01

    Astronomical observations, theoretical modeling, laboratory simulation and analysis of extraterrestrial material have enhanced our knowledge of the inventory of organic matter in the interstellar medium (ISM) and on small bodies such as comets and asteroids (Ehrenfreund & Charnley 2000). Comets, asteroids and their fragments, meteorites and interplanetary dust particles (IDPs), contributed significant amounts of extraterrestrial organic matter to the young Earth. This material degraded and reacted in a terrestrial prebiotic chemistry to form organic structures that may have served as building blocks for life on the early Earth. In this talk I will summarize our current understanding of the organic composition and chemistry of interstellar clouds. Molecules of astrobiological relevance include the building blocks of our genetic material: nucleic acids, composed of subunits such as N-heterocycles (purines and pyrimidines), sugars and amino acids. Signatures indicative of inheritance of pristine and modified interstellar material in comets and meteorites will also be discussed.

  19. Organic electrochemical transistors

    KAUST Repository

    Rivnay, Jonathan

    2018-01-16

    Organic electrochemical transistors (OECTs) make effective use of ion injection from an electrolyte to modulate the bulk conductivity of an organic semiconductor channel. The coupling between ionic and electronic charges within the entire volume of the channel endows OECTs with high transconductance compared with that of field-effect transistors, but also limits their response time. The synthetic tunability, facile deposition and biocompatibility of organic materials make OECTs particularly suitable for applications in biological interfacing, printed logic circuitry and neuromorphic devices. In this Review, we discuss the physics and the mechanism of operation of OECTs, focusing on their identifying characteristics. We highlight organic materials that are currently being used in OECTs and survey the history of OECT technology. In addition, form factors, fabrication technologies and applications such as bioelectronics, circuits and memory devices are examined. Finally, we take a critical look at the future of OECT research and development.

  20. Organizations, projects and culture

    NARCIS (Netherlands)

    J. van Cleeff; Pieter van Nispen tot Pannerden

    2016-01-01

    Purpose: to explore and demonstrate the effects of organizational culture on projects, in particular project culture and project management style. Methodology/approach: descriptive and explorative; through students’ groups. Findings: the cultural relationship between organizations, their projects

  1. Vertical organic transistors.

    Science.gov (United States)

    Lüssem, Björn; Günther, Alrun; Fischer, Axel; Kasemann, Daniel; Leo, Karl

    2015-11-11

    Organic switching devices such as field effect transistors (OFETs) are a key element of future flexible electronic devices. So far, however, a commercial breakthrough has not been achieved because these devices usually lack in switching speed (e.g. for logic applications) and current density (e.g. for display pixel driving). The limited performance is caused by a combination of comparatively low charge carrier mobilities and the large channel length caused by the need for low-cost structuring. Vertical Organic Transistors are a novel technology that has the potential to overcome these limitations of OFETs. Vertical Organic Transistors allow to scale the channel length of organic transistors into the 100 nm regime without cost intensive structuring techniques. Several different approaches have been proposed in literature, which show high output currents, low operation voltages, and comparatively high speed even without sub-μm structuring technologies. In this review, these different approaches are compared and recent progress is highlighted.

  2. Organic Molecules in Meteorites

    Science.gov (United States)

    Martins, Zita

    2015-08-01

    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (meteorites contain soluble organic molecules with different abundances and distributions, which may reflect the extension of aqueous alteration or thermal metamorphism on the meteorite parent bodies. Extensive aqueous alteration on the meteorite parent body may result on 1) the decomposition of α-amino acids [5, 6]; 2) synthesis of β- and γ-amino acids [2, 6-9]; 3) higher relative abundances of alkylated polycyclic aromatic hydrocarbons (PAHs) [6, 10]; and 4) higher L-enantiomer excess (Lee) value of isovaline [6, 11, 12].The soluble organic content of carbonaceous meteorites may also have a contribution from Fischer-Tropsch/Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502

  3. Is old organic matter simple organic matter?

    Science.gov (United States)

    Nunan, Naoise; Lerch, Thomas; Pouteau, Valérie; Mora, Philippe; Changey, Fréderique; Kätterer, Thomas; Herrmann, Anke

    2016-04-01

    Bare fallow soils that have been deprived of fresh carbon inputs for prolonged periods contain mostly old, stable organic carbon. In order to shed light on the nature of this carbon, the functional diversity profiles (MicroResp™, Biolog™ and enzyme activity spectra) of the microbial communities of long-term barefallow soils were analysed and compared with those of the microbial communities from their cultivated counterparts. The study was based on the idea that microbial communities adapt to their environment and that therefore the catabolic and enzymatic profiles would reflect the type of substrates available to the microbial communities. The catabolic profiles suggested that the microbial communities in the long-term bare-fallow soil were exposed to a less diverse range of substrates and that these substrates tended to be of simpler molecular forms. Both the catabolic and enzyme activity profiles suggested that the microbial communities from the long-term bare-fallow soils were less adapted to using polymers. These results do not fit with the traditional view of old, stable carbon being composed of complex, recalcitrant polymers. An energetics analysis of the substrate use of the microbial communities for the different soils suggested that the microbial communities from the long-term bare-fallow soils were better adapted to using readily oxidizable,although energetically less rewarding, substrates. Microbial communities appear to adapt to the deprivation of fresh organic matter by using substrates that require little investment.

  4. Marketing of human organs?

    Science.gov (United States)

    Bernat, E

    1995-01-01

    This article discusses the highly controversial question whether human organs should be allowed to be the object of a contract aimed at profit. The author comes to the conclusion that--seen from a consequentialist viewpoint--the legislature is not well-advised to allow organ donations for consideration. However, it is admitted that a more deontological approach could come to quite the opposite conclusion.

  5. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laine, Jari; Mugurusi, Godfrey

    Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, procurement organizations constantly have to evolve in order to match these demands. A conceptual model...... and external contingency factors and having a more detailed look at the structural dimensions chosen, beyond the well-known characteristics of centralization, formalization, participation, specialization, standardization and size. From a theoretical perspective, it opens up insights that can be leveraged...

  6. Nanoscale Organic Hybrid Electrolytes

    KAUST Repository

    Nugent, Jennifer L.

    2010-08-20

    Nanoscale organic hybrid electrolytes are composed of organic-inorganic hybrid nanostructures, each with a metal oxide or metallic nanoparticle core densely grafted with an ion-conducting polyethylene glycol corona - doped with lithium salt. These materials form novel solvent-free hybrid electrolytes that are particle-rich, soft glasses at room temperature; yet manifest high ionic conductivity and good electrochemical stability above 5V. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Organizing the Electronic Century

    OpenAIRE

    Richard N. Langlois

    2007-01-01

    This paper's title is an echo of Alfred Chandler's (2001) chronicle of the electronics industry, Inventing the Electronic Century. The paper attempts (A) a general reinterpretation of the pattern of technological advance in (American) electronics over the twentieth century and (B) a somewhat revisionist account of the role of organization and institution in that advance. The paper stresses the complex effects of product architecture and intellectual property regime on industrial organization ...

  8. Organic magnetic field sensor

    Energy Technology Data Exchange (ETDEWEB)

    McCamey, Dane; Boehme, Christoph

    2017-01-24

    An organic, spin-dependent magnetic field sensor (10) includes an active stack (12) having an organic material with a spin-dependence. The sensor (10) also includes a back electrical contact (14) electrically coupled to a back of the active stack (12) and a front electrical contact (16) electrically coupled to a front of the active stack (12). A magnetic field generator (18) is oriented so as to provide an oscillating magnetic field which penetrates the active stack (12).

  9. Nanoscale Organic Hybrid Electrolytes

    KAUST Repository

    Nugent, Jennifer L.; Moganty, Surya S.; Archer, Lynden A.

    2010-01-01

    Nanoscale organic hybrid electrolytes are composed of organic-inorganic hybrid nanostructures, each with a metal oxide or metallic nanoparticle core densely grafted with an ion-conducting polyethylene glycol corona - doped with lithium salt. These materials form novel solvent-free hybrid electrolytes that are particle-rich, soft glasses at room temperature; yet manifest high ionic conductivity and good electrochemical stability above 5V. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Motivation programmes of organizations

    OpenAIRE

    Pízová, Tereza

    2008-01-01

    The Bachelor Thesis "'Motivation Programmes of Organizations" focuses on an extremely important area within personnel management. Employee motivation is crucial to the effective operation of businesses. Motivation programmes assist in increasing and maintaining employee motivation and demonstrate an organization's interest in its employees. This piece is on one hand concerned with theoretical foundations of motivation, describing theories and concepts important to the area of human behaviour ...

  11. Organic Poultry Feeding

    Directory of Open Access Journals (Sweden)

    Arda Yıldırım

    2014-02-01

    Full Text Available Many people have led to the consumption of organic animal products in the event that the increase in sensitivity to a healthy diet in developed countries, and maintaining the safety of food of animal origin. Feeding and breeding in conventional production are emerged some of the negative effects and also it is more in organic production with new restrictions. Organic production is based on animal welfare. On the basis of behaviors such as feather-pecking and cannibalism known to be low in protein level of rations and unbalanced in terms of amino acids or minerals. As of 2015, organic poultry feed provided the appropriate conditions that will be 95% organic certified in Turkey and therefore, to create a balanced ration and feed hygiene in protecting brings serious challenges. Fodder supply of organic poultry feed raw materials that make up the quality, quantity and issue forms a significant effect on the health of the poultry additives permitted. The quality of the feed raw materials that constituent diets, quantity, feed supplying form and permitted feed additives significantly affects the health of poultry. Different physiological stages of the animal's nutritional requirements in order to ensure production of quality poultry products must be met from organically produced and very well-known with the contents of feedstuff digestibility. In this study, the problems encountered in feeding can be eliminated while performing economic production with considering animal welfare, following that balanced and adequate organic ration formulations and issues such as improving the production of feed raw materials are discussed.

  12. LEADING THE LEARNING ORGANIZATION

    OpenAIRE

    Sapna Rijal

    2009-01-01

    Researchers have identified leadership as being one of the most important factors that influence the development of learning organization. They suggest that creating a collective vision of the future, empowering and developing employees so that they are better able to handle environmental challenges, modeling learning behavior and creating a learning environment, are crucial skills for leaders of learning organization. These roles are suitable to a transformational leader. Despite the potenti...

  13. Organic chemistry experiment

    International Nuclear Information System (INIS)

    Mun, Seok Sik

    2005-02-01

    This book deals with organic chemistry experiments, it is divided five chapters, which have introduction, the way to write the experiment report and safety in the laboratory, basic experiment technic like recrystallization and extraction, a lot of organic chemistry experiments such as fischer esterification, ester hydrolysis, electrophilic aromatic substitution, aldol reaction, benzoin condensation, wittig reaction grignard reaction, epoxidation reaction and selective reduction. The last chapter introduces chemistry site on the internet and way to find out reference on chemistry.

  14. Interstellar organic chemistry.

    Science.gov (United States)

    Sagan, C.

    1972-01-01

    Most of the interstellar organic molecules have been found in the large radio source Sagittarius B2 toward the galactic center, and in such regions as W51 and the IR source in the Orion nebula. Questions of the reliability of molecular identifications are discussed together with aspects of organic synthesis in condensing clouds, degradational origin, synthesis on grains, UV natural selection, interstellar biology, and contributions to planetary biology.

  15. Micro-Organ Device

    Science.gov (United States)

    Gonda, Steve R. (Inventor); Chang, Robert C. (Inventor); Starly, Binil (Inventor); Culbertson, Christopher (Inventor); Holtorf, Heidi L. (Inventor); Sun, Wei (Inventor); Leslie, Julia (Inventor)

    2013-01-01

    A method for fabricating a micro-organ device comprises providing a microscale support having one or more microfluidic channels and one or more micro-chambers for housing a micro-organ and printing a micro-organ on the microscale support using a cell suspension in a syringe controlled by a computer-aided tissue engineering system, wherein the cell suspension comprises cells suspended in a solution containing a material that functions as a three-dimensional scaffold. The printing is performed with the computer-aided tissue engineering system according to a particular pattern. The micro-organ device comprises at least one micro-chamber each housing a micro-organ; and at least one microfluidic channel connected to the micro-chamber, wherein the micro-organ comprises cells arranged in a configuration that includes microscale spacing between portions of the cells to facilitate diffusion exchange between the cells and a medium supplied from the at least one microfluidic channel.

  16. Managing mechanistic and organic structure in health care organizations.

    Science.gov (United States)

    Olden, Peter C

    2012-01-01

    Managers at all levels in a health care organization must organize work to achieve the organization's mission and goals. This requires managers to decide the organization structure, which involves dividing the work among jobs and departments and then coordinating them all toward the common purpose. Organization structure, which is reflected in an organization chart, may range on a continuum from very mechanistic to very organic. Managers must decide how mechanistic versus how organic to make the entire organization and each of its departments. To do this, managers should carefully consider 5 factors for the organization and for each individual department: external environment, goals, work production, size, and culture. Some factors may push toward more mechanistic structure, whereas others may push in the opposite direction toward more organic structure. Practical advice can help managers at all levels design appropriate structure for their departments and organization.

  17. Thoracic organ transplantation.

    Science.gov (United States)

    Pierson, Richard N; Barr, Mark L; McCullough, Keith P; Egan, Thomas; Garrity, Edward; Jessup, Mariell; Murray, Susan

    2004-01-01

    This article presents an overview of factors associated with thoracic transplantation outcomes over the past decade and provides valuable information regarding the heart, lung, and heart-lung waiting lists and thoracic organ transplant recipients. Waiting list and post-transplant information is used to assess the importance of patient demographics, risk factors, and primary cardiopulmonary disease on outcomes. The time that the typical listed patient has been waiting for a heart, lung, or heart-lung transplant has markedly increased over the past decade, while the number of transplants performed has declined slightly and survival after transplant has plateaued. Waiting list mortality, however, appears to be declining for each organ and for most diseases and high-severity subgroups, perhaps in response to recent changes in organ allocation algorithms. Based on perceived inequity in organ access and in response to a mandate from Health Resources and Services Administration, the lung transplant community is developing a lung allocation system designed to minimize deaths on the waiting list while maximizing the benefit of transplant by incorporating post-transplant survival and quality of life into the algorithm. Areas where improved data collection could inform evolving organ allocation and candidate selection policies are emphasized.

  18. Modularity and Economic Organization

    DEFF Research Database (Denmark)

    Sanchez, Ron; Mahoney, Joseph T.

    This paper addresses modularity as a basis for organizing economic activity. We first define the key concepts of architecture and of modularity as a special form of architecture. We then suggest how modular systems of all types may exhibit several properties of fundamental importance to the organ......This paper addresses modularity as a basis for organizing economic activity. We first define the key concepts of architecture and of modularity as a special form of architecture. We then suggest how modular systems of all types may exhibit several properties of fundamental importance...... to the organization of economic activities, including greater adaptability and evolvability than systems that lack modular properties. We draw extensively on our original 1996 paper on modularity and subsequent research to suggest broad theoretical implications of modularity for (i) firms' product strategies...... markets. We also discuss an evolutionary perspective on modularity as an emergent phenomenon in firms and industries. We explain how modularity as a relatively new field of strategy and economic research may provide a new theoretical perspective on economic organizing that has significant potential...

  19. Organ Transplants in Kazakhstan.

    Science.gov (United States)

    Baigenzhin, Abay; Doskaliyev, Zhaksylyk; Tuganbekova, Saltanat; Zharikov, Serik; Altynova, Sholpan; Gaipov, Abduzhappar

    2015-11-01

    The Republic of Kazakhstan is one of the fastest developing countries in the world and has a health care system that is unique in Central Asia. Its organ transplant services are also developing rapidly. We aimed to analyze and briefly report on the current status of organ transplant in the Republic of Kazakhstan. We analyzed organ transplant activities in that country for the period 2012 to 2014. All data were collected from the official database of the National Transplant Coordinating Center of the Republic of Kazakhstan. At the end of 2014, the number of transplant centers had increased to 10, three of which could perform multiorgan transplants; during the same period, the number of deceased-donor organ-donating hospitals increased up to 37. By 2013, the transplant activity rate for all centers had reached 9.22 per million population. During the previous 3 years (2012-2014), there was a 3-fold increase in the number of living donors and an 18-fold increase in the number of kidney transplants. Between 2012 and 2014, the number of living-donor liver transplants increased from 17 to 25, and the number of deceased-donor transplants increased from 3 to 7. During the last 3 years (2012-2014), the number of heart transplants increased to 7 cases. During the last 3 years (2012-2014), Kazakhstan achieved a significant improvement in the organization of its transplant services, and a noticeable upward trend in the system continues.

  20. Organization Virtual or Networked?

    Directory of Open Access Journals (Sweden)

    Rūta Tamošiūnaitė

    2013-08-01

    Full Text Available Purpose—to present distinction between “virtual organization” and “networked organization”; giving their definitions.Design/methodology/approach—review of previous researches, systemic analyses of their findings and synthesis of distinctive characteristics of ”virtual organization” and “networked organization.”Findings—the main result of the research is key diverse features separating ”virtual organization” and ”networked organization.” Definitions of “virtual organization” and “networked organization” are presented.Originality/Value—distinction between “virtual organization” and “networked organization” creates possibilities to use all advantages of those types of organizations and gives foundation for deeper researches in this field.Research type: general review.

  1. International organizations as orchestrators

    CERN Document Server

    Abbott, Kenneth W

    2015-01-01

    International Organizations as Orchestrators reveals how IOs leverage their limited authority and resources to increase their effectiveness, power, and autonomy from states. By 'orchestrating' intermediaries - including NGOs - IOs can shape and steer global governance without engaging in hard, direct regulation. This volume is organized around a theoretical model that emphasizes voluntary collaboration and support. An outstanding group of scholars investigate the significance of orchestration across key issue areas, including trade, finance, environment and labor, and in leading organizations, including the GEF, G20, WTO, EU, Kimberley Process, UNEP and ILO. The empirical studies find that orchestration is pervasive. They broadly confirm the theoretical hypotheses while providing important new insights, especially that states often welcome IO orchestration as achieving governance without creating strong institutions. This volume changes our understanding of the relationships among IOs, nonstate actors and sta...

  2. Microtubule-Organizing Centers.

    Science.gov (United States)

    Wu, Jingchao; Akhmanova, Anna

    2017-10-06

    The organization of microtubule networks is crucial for controlling chromosome segregation during cell division, for positioning and transport of different organelles, and for cell polarity and morphogenesis. The geometry of microtubule arrays strongly depends on the localization and activity of the sites where microtubules are nucleated and where their minus ends are anchored. Such sites are often clustered into structures known as microtubule-organizing centers, which include the centrosomes in animals and spindle pole bodies in fungi. In addition, other microtubules, as well as membrane compartments such as the cell nucleus, the Golgi apparatus, and the cell cortex, can nucleate, stabilize, and tether microtubule minus ends. These activities depend on microtubule-nucleating factors, such as γ-tubulin-containing complexes and their activators and receptors, and microtubule minus end-stabilizing proteins with their binding partners. Here, we provide an overview of the current knowledge on how such factors work together to control microtubule organization in different systems.

  3. Artificial organ engineering

    CERN Document Server

    Annesini, Maria Cristina; Piemonte, Vincenzo; Turchetti, Luca

    2017-01-01

    Artificial organs may be considered as small-scale process plants, in which heat, mass and momentum transfer operations and, possibly, chemical transformations are carried out. This book proposes a novel analysis of artificial organs based on the typical bottom-up approach used in process engineering. Starting from a description of the fundamental physico-chemical phenomena involved in the process, the whole system is rebuilt as an interconnected ensemble of elemental unit operations. Each artificial organ is presented with a short introduction provided by expert clinicians. Devices commonly used in clinical practice are reviewed and their performance is assessed and compared by using a mathematical model based approach. Whilst mathematical modelling is a fundamental tool for quantitative descriptions of clinical devices, models are kept simple to remain focused on the essential features of each process. Postgraduate students and researchers in the field of chemical and biomedical engineering will find that t...

  4. The Effective Ambidextrous Organization

    DEFF Research Database (Denmark)

    Andersen, Torben Juul; Nielsen, Bo Bernhard

    the essence of organizational ambidexterity as the means to sustain performance over time when environmental conditions change. This paper incorporates strategic management and organization theoretical rationales in a model that combines elements of integration and experimentation in the strategy making....... Results of structural equation analyses indicate that superior performance in the ambidextrous organizations is associated with efficiencies derived from adherence to centralized strategic planning and effectiveness generated by decentralized innovative behavior through participation and autonomous...... process and thereby extends the evolving literature on the ambidextrous organization. The performance relationships of the ambidextrous integrative strategy making model are investigated on the basis of a cross-sectional sample of 185 business entities operating in different manufacturing industries...

  5. Phytovolatilization of Organic Contaminants.

    Science.gov (United States)

    Limmer, Matt; Burken, Joel

    2016-07-05

    Plants can interact with a variety of organic compounds, and thereby affect the fate and transport of many environmental contaminants. Volatile organic compounds may be volatilized from stems or leaves (direct phytovolatilization) or from soil due to plant root activities (indirect phytovolatilization). Fluxes of contaminants volatilizing from plants are important across scales ranging from local contaminant spills to global fluxes of methane emanating from ecosystems biochemically reducing organic carbon. In this article past studies are reviewed to clearly differentiate between direct- and indirect-phytovolatilization and we discuss the plant physiology driving phytovolatilization in different ecosystems. Current measurement techniques are also described, including common difficulties in experimental design. We also discuss reports of phytovolatilization in the literature, finding that compounds with low octanol-air partitioning coefficients are more likely to be phytovolatilized (log KOA < 5). Reports of direct phytovolatilization at field sites compare favorably to model predictions. Finally, future research needs are presented that could better quantify phytovolatilization fluxes at field scale.

  6. Innovation in Organizations

    Directory of Open Access Journals (Sweden)

    Vladimir-Codrin Ionescu

    2015-05-01

    Full Text Available Innovation is an integrating part of the re-vitalization plan of EU economy and it is one of the seven initiatives comprised in the 2020 Europe Strategy. The European Union supports through active policies the creative-innovative processes, as illustrated by the Cohesion Policy Program for 2007-2013 and by the ”Horizon 2020” Program for Research and Innovation. The present paper presents, from an organizational perspective, relevant aspects related to the question of innovation and innovation management, while pointing out the most important internal and external factors that favour the introduction of innovation into the sphere of processes that are run by organizations, as well as into the sphere of products and services provided by organizations. At the same time, the paper briefly presents the essential attributes of organizations which obtain competitive sustainable advantages through innovation.

  7. Organic chemistry on Titan

    Science.gov (United States)

    Chang, S.; Scattergood, T.; Aronowitz, S.; Flores, J.

    1979-01-01

    Features taken from various models of Titan's atmosphere are combined in a working composite model that provides environmental constraints within which different pathways for organic chemical synthesis are determined. Experimental results and theoretical modeling suggest that the organic chemistry of the satellite is dominated by two processes: photochemistry and energetic particle bombardment. Photochemical reactions of CH4 in the upper atmosphere can account for the presence of C2 hydrocarbons. Reactions initiated at various levels of the atmosphere by cosmic rays, Saturn 'wind', and solar wind particle bombardment of a CH4-N2 atmospheric mixture can account for the UV-visible absorbing stratospheric haze, the reddish appearance of the satellite, and some of the C2 hydrocarbons. In the lower atmosphere photochemical processes will be important if surface temperatures are sufficiently high for gaseous NH3 to exist. It is concluded that the surface of Titan may contain ancient or recent organic matter (or both) produced in the atmosphere.

  8. Organic Chemistry of Meteorites

    Science.gov (United States)

    Chang, S.; Morrison, David (Technical Monitor)

    1994-01-01

    Studies of the molecular structures and C,N,H-isotopic compositions of organic matter in meteorites reveal a complex history beginning in the parent interstellar cloud which spawned the solar system. Incorporation of interstellar dust and gas in the protosolar nebula followed by further thermal and aqueous processing on primordial parent bodies of carbonaceous, meteorites have produced an inventory of diverse organic compounds including classes now utilized in biochemistry. This inventory represents one possible set of reactants for chemical models for the origin of living systems on the early Earth. Evidence bearing on the history of meteoritic organic matter from astronomical observations and laboratory investigations will be reviewed and future research directions discussed.

  9. The geothermal power organization

    Energy Technology Data Exchange (ETDEWEB)

    Scholl, K.L. [National Renewable Energy Lab., Golden, CO (United States)

    1997-12-31

    The Geothermal Power Organization is an industry-led advisory group organized to advance the state-of-the-art in geothermal energy conversion technologies. Its goal is to generate electricity from geothermal fluids in the most cost-effective, safe, and environmentally benign manner possible. The group achieves this goal by determining the Member`s interest in potential solutions to technological problems, advising the research and development community of the needs of the geothermal energy conversion industry, and communicating research and development results among its Members. With the creation and adoption of a new charter, the Geothermal Power Organization will now assist the industry in pursuing cost-shared research and development projects with the DOE`s Office of Geothermal Technologies.

  10. Bioethics of organ transplantation.

    Science.gov (United States)

    Caplan, Arthur

    2014-03-01

    As the ability to transplant organs and tissues has grown, the demand for these procedures has increased as well--to the point at which it far exceeds the available supply creating the core ethical challenge for transplantation--rationing. The gap between supply and demand, although large, is worse than it appears to be. There are two key steps to gaining access to a transplant. First, one must gain access to a transplant center. Then, those waiting need to be selected for a transplant. Many potential recipients do not get admitted to a program. They are deemed too old, not of the right nationality, not appropriate for transplant as a result of severe mental impairment, criminal history, drug abuse, or simply because they do not have access to a competent primary care physician who can refer them to a transplant program. There are also financial obstacles to access to transplant waiting lists in the United States and other nations. In many poor nations, those needing transplants simply die because there is no capacity or a very limited capacity to perform transplants. Although the demand for organs now exceeds the supply, resulting in rationing, the size of waiting lists would quickly expand were there to suddenly be an equally large expansion in the number of organs available for transplantation. Still, even with the reality of unavoidable rationing, saving more lives by increasing organ supply is a moral good. Current public policies for obtaining organs from cadavers are not adequate in that they do not produce the number of organs that public polls of persons in the United States indicate people are willing to donate.

  11. Organic Biochar Based Fertilization

    Science.gov (United States)

    Schmidt, Hans-Peter; Pandit, Bishnu Hari; Cornelissen, Gerard; Kammann, Claudia

    2017-04-01

    Biochar produced in cost-efficient flame curtain kilns (Kon-Tiki) was nutrient enriched either with cow urine or with dissolved mineral (NPK) fertilizer to produce biochar-based fertilizers containing between 60-100 kg N, 5-60 kg P2O5 and 60-100 kg K2O, respectively, per ton of biochar. In 21 field trials nutrient-enriched biochars were applied at rates of 0.5 to 2 t ha-1 into the root zone of 13 different annual and perennial crops. Treatments combining biochar, compost and organic or chemical fertilizer were evaluated; control treatments contained the same amounts of nutrients but without biochar. All nutrient-enriched biochar substrates improved yields compared to their respective no-biochar controls. Biochar enriched with dissolved NPK produced on average 20% ± 5.1% (N=4) higher yields than standard NPK fertilization without biochar. Cow urine-enriched biochar blended with compost resulted on average in 123% ± 76.7% (N=13) higher yields compared to the organic farmer practice with cow urine-blended compost and outcompeted NPK-enriched biochar (same nutrient dose) by 103% ± 12.4% (N=4) on average. 21 field trials robustly revealed that low-dosage root zone application of organic biochar-based fertilizers caused substantial yield increases in rather fertile silt loam soils compared to traditional organic fertilization and to mineral NPK- or NPK-biochar fertilization. This can likely be explained by the nutrient carrier effect of biochar causing a slow nutrient release behavior, more balanced nutrient fluxes and reduced nutrient losses especially when liquid organic nutrients are used for the biochar enrichment. The results promise new pathways for optimizing organic farming and improving on-farm nutrient cycling.

  12. Organizations as Designed Islands

    Directory of Open Access Journals (Sweden)

    Pasquale Gagliardi

    2009-05-01

    Full Text Available The literature and practice of organizational design are mostly based on simplistic conceptions which ignore recent theoretical developments in organizational studies. Conceiving of organizations as ‘designed islands’, it is argued, can contribute to a more solid theoretical foundation to organization theory, viewed as normative science. Relying on the work of Peter Sloterdijk, who describes the forms of life in space in terms of spheres, the heuristic power of the island metaphor is explored. What can be learnt from the art of isolating in order to construct lived organizational environments is then discussed, and the paradoxical relationship between connection and isolation is highlighted.

  13. EDF national emergency organization

    International Nuclear Information System (INIS)

    Laverge, J.

    1992-01-01

    The scope of French nuclear power led Electricite de France (EDF) to design standard products, manufactured in series but adaptable to different sites. Standardization is based on the decision on a single technology: pressurized water reactors (PWR). Thirty-four 900 MW and seventeen 1300 MW units are in operation on seventeen sites. The specific nature of French organization for normal operation and accident management results from equipment standardization and single licensee. This specificity is based on emergency plan standardization and highly structured national organization. Figs

  14. Knowledge management based organizations

    Directory of Open Access Journals (Sweden)

    Manev Gjorgji

    2015-01-01

    Full Text Available Accomplishment of the goals set by a business organization implies implementation of knowledge management. It allows coordination of the working processes with the information technologies, with a view to adapting the organization's operations to the problems encountered. Overcoming these problems involves designing and implementation of complex business systems supported by information technology. This can be achieved by management that will monitor the business processes through clear indicators, with the purpose of accomplishing the preset strategic goals. This managerial staff must be fully devoted and committed to their work, to learning and creation of expertise that will help overcome the competition challenges.

  15. Performance in Public Organizations

    DEFF Research Database (Denmark)

    Andersen, Lotte Bøgh; Boesen, Andreas; Pedersen, Lene Holm

    2016-01-01

    of management and performance are classified. The results illustrate how a systematization of the conceptual space of performance in public organizations can help researchers select what to study and what to leave out with greater accuracy while also bringing greater clarity to public debates about performance.......Performance in public organizations is a key concept that requires clarification. Based on a conceptual review of research published in 10 public administration journals, this article proposes six distinctions to describe the systematic differences in performance criteria: From which stakeholder...

  16. Organizing for Asymmetric Collaboration

    DEFF Research Database (Denmark)

    Nielsen, Jørn Flohr; Sørensen, Henrik B.

      The vision of new organizational forms consists of less-organized networks and alliances between organizations, in which collaborative capabilities are assumed to be crucial (Miles et al., 2005). The path to such new forms may go through fragile cooperative efforts. Despite the good will of many...... complexity to already complex models, we claim that our approach has practical implications: it offers rather simple diagnostic cues to change agents that are coping with the barriers to management and collaboration among loosely coupled units....

  17. Organic separations with membranes

    International Nuclear Information System (INIS)

    Funk, E.W.

    1993-01-01

    This paper presents an overview of present and emerging applications of membrane technology for the separation and purification of organic materials. This technology is highly relevant for programs aimed at minimizing waste in processing and in the treatment of gaseous and liquid effluents. Application of membranes for organic separation is growing rapidly in the petrochemical industry to simplify processing and in the treatment of effluents, and it is expected that this technology will be useful in numerous other industries including the processing of nuclear waste materials

  18. Water purification using organic salts

    Science.gov (United States)

    Currier, Robert P.

    2004-11-23

    Water purification using organic salts. Feed water is mixed with at least one organic salt at a temperature sufficiently low to form organic salt hydrate crystals and brine. The crystals are separated from the brine, rinsed, and melted to form an aqueous solution of organic salt. Some of the water is removed from the aqueous organic salt solution. The purified water is collected, and the remaining more concentrated aqueous organic salt solution is reused.

  19. Organ trade using social networks

    OpenAIRE

    Waleed Alrogy; Dunia Jawdat; Muhannad Alsemari; Abdulrahman Alharbi; Abdullah Alasaad; Ali H Hajeer

    2016-01-01

    Organ transplantation is recognized worldwide as an effective treatment for organ failure. However, due to the increase in the number of patients requiring a transplant, a shortage of suitable organs for transplantation has become a global problem. Human organ trade is an illegal practice of buying or selling organs and is universally sentenced. The aim of this study was to search social network for organ trade and offerings in Saudi Arabia. The study was conducted from June 22, 2015 to Febru...

  20. Microwaves in organic chemistry and organic chemical

    Directory of Open Access Journals (Sweden)

    Mijin Dušan Ž.

    2005-01-01

    Full Text Available The usual way of applying heat to a chemical reaction is the use of a Bunsen burner, an oil or some other type of bath, or an electric heater. In inorganic chemistry, microwave technology has been used since the late 1970s while it has been implemented in organic chemistry since the mid-1980s. Microwave heating has been used in the food industry for almost fifty years. The shorter reaction times and expanded reaction range that is offered by microwave technology are suited to the increased demands in industry. For example, there is a requirement in the pharmaceutical industry for a higher number of a novel chemical entities to be produced, which requires chemists to employ a number of resources to reduce time for the production of compounds. Also, microwaves are used in the food industry, as well as in the pyrolysis of waste materials, sample preparation, the solvent extraction of natural products and the hydrolysis of proteins and peptides.