WorldWideScience

Sample records for pakistani medical universities

  1. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

    Science.gov (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

    2010-01-01

    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  2. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

    Science.gov (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

    2017-10-01

    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  3. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia.

    Science.gov (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali

    2008-06-30

    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  4. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2014-12-01

    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  5. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2011-06-01

    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  6. Pakistani medical students' specialty preference and the influencing factors.

    Science.gov (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

    2011-07-01

    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  7. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

    OpenAIRE

    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

    2013-01-01

    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  8. Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

    Directory of Open Access Journals (Sweden)

    Vaqar Talha

    2008-04-01

    Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

  9. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Science.gov (United States)

    Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad

    2014-01-01

    Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

  10. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

    Science.gov (United States)

    Ali, Zarqa S.

    2014-01-01

    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  11. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi

    2012-09-01

    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  12. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen.

    Science.gov (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes

    2017-01-20

    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  13. Experiences, attitudes and barriers towards research amongst junior faculty of Pakistani medical universities

    Directory of Open Access Journals (Sweden)

    Kauser Samreen

    2009-11-01

    Full Text Available Abstract Background The developing world has had limited quality research and in Pakistan, research is still in its infancy. We conducted a study to assess the proportion of junior faculty involved in research to highlight their attitude towards research, and identify the factors associated with their research involvement. Methods A cross-sectional study was conducted in four medical universities/teaching hospitals in Pakistan, representing private and public sectors. A pre-tested, self-administered questionnaire was used to collect information from 176 junior faculty members of studied universities/hospitals. Logistic regression analysis was used to identify factors related to attitudes and barriers in research among those currently involved in research with those who were not. Results Overall, 41.5% of study subjects were currently involved in research. A highly significant factor associated with current research involvement was research training during the post-graduate period (p Conclusion Less than half of the study participants were currently involved in research. Research output may improve if identified barriers are rectified. Further studies are recommended in this area.

  14. Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

    Directory of Open Access Journals (Sweden)

    Malik Samina

    2010-01-01

    Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

  15. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

    2016-01-01

    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  16. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  17. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  18. PECUNIA EX MACHINA: PAKISTANI ENTREPRENEURS IN THE CITY OF BARCELONA

    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García

    2010-12-01

    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  19. Determinants of Increasing Trend of Self-Medication in a Pakistani ...

    African Journals Online (AJOL)

    Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria. All rights reserved. ... self-medication for rapid relief of indications only when health care ... hospitals, and other healthcare units. Data analysis.

  20. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  1. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2003-01-01

    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  2. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

    Science.gov (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

    2014-01-01

    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  3. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  4. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  5. Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ilyas Mahwish

    2007-09-01

    Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

  6. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements

    Science.gov (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim

    2015-01-01

    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  7. Dietary habits and life style among the students of a private medical university Karachi.

    Science.gov (United States)

    Nisar, Nighat; Qadri, Majid Hafeez; Fatima, Kiran; Perveen, Shakeela

    2009-02-01

    To determine the dietary habits and life style of the students of a private medical university in Karachi. A cross-sectional study was conducted at Baqai Medical University, from August 2005 to September 2005. A total of 384 medical students from the batches of 2002 to 2005 participated in this study. A pre-tested semi structured questionnaire was self administered to the students after taking their consent. The data included sociodemographic characteristics, life style, exercise, dietary habits and family history of diabetes mellitus. The collected data was analyzed by statistical program SPSS version 11. Out of the total participants, 53.4% were male and 46.6% were female students. The mean age was 20 +/- 1.58 years. The average income of the household of students was 50,000 Pakistani rupees per month. Only 7% students were tobacco users. About 33% students had a history of diabetes mellitus among their parents. Nearly ninety-seven percent reported consumption of junk food while 60% reported use of whole grain food in their diet. Seventy percent students walked 30 minutes and 47% exercised daily. According to the body mass index, 58.3% students were of normal weight and 41.7% were overweight. No significant difference was found among male and female students when dietary habits and life style were compared by sex. Junk food and soft-drink consumption was associated with being overweight. Eating whole grain food and doing exercise showed a protective association against overweight. Unhealthy lifestyle and poor dietary habits were highly prevalent in the overweight study population. Type-2 diabetes mellitus was common among parents and grandparents of the students making them prone to this disorder. Our study concluded that dietary and exercise counselling is necessary as a preventive strategy.

  8. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.

    2018-01-01

    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  9. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah

    2005-01-01

    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  10. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

    2012-01-01

    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  11. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  12. Comparative Analysis of the Indian and Pakistani Nuclear Energy Development Programmes

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2015-01-01

    Full Text Available Due to the traditional competition between India and Pakistan, their strategic fields developing are interdependent. Nuclear power development programs are concerned as well. Pakistan falls behind India in this branch, however the specifics of the nuclear infrastructure let the potential of the states be relatively balanced. After Nuclear Suppliers Group granted a waiver to India in 2008 and Russia, France and USA, the new participants, broke into the market, India obtained an opportunity to make a breakthrough in the national nuclear program development, thus violating a status quo in fuel cycle technologies. Such chances stimulated China to violate the NSG guidelines and non-proliferations principles to get involved in Pakistani nuclear program development. The nuclear power Indian-Pakistani competition prospects largely depend on the Chinese position. Despite the international community suspects the Pakistani officials in nuclear black market dealing and the NSG guidelines China obviously supports the Pakistani nuclear field. This may result in preventing of escalation of tensions in the region. 

  13. Stories of pain and health by elderly Pakistani women in Norway.

    Science.gov (United States)

    Sverre, Beate Lie; Solbrække, Kari Nyheim; Eilertsen, Grethe

    2014-11-01

    This ethnographic study investigates the stories of elderly Pakistani women living in Norway. Migration studies indicate that elderly migrant women are passive, ill victims caught in a marginalized position due to age, ethnicity and gender, and thus have little access to opposition and agency. To broaden the picture it is necessary to develop an innovative approach to understand what is implicated in the process of migration. The importance of considering life conditions that surrounds potential health promotion behaviors of immigrants is stressed by several researchers. However, up to now limited research guided by this perspective has been done in Norway. Therefore, this study explored how elderly Pakistani women in Norway promote their health and well-being through some distinct social interactions. The intention is to bring awareness to how health, even by so-called disadvantaged social groups, may take place. These practices are important to take into consideration when developing health-promoting policies for elderly immigrants. An ethnographic study of 15 Pakistani women, aged 53-75, was carried out in a multisided fieldwork in Oslo using participant observation and ethnographic interviews. The analytical approach was inspired by the constructivist theoretical framework of narrative ethnography. The elderly Pakistani women in Norway construct stories of living in-between cultures and experiences of acculturative stress caused by being elderly, immigrants and women. However, this analysis also suggests that through distinct social relationships, primarily in the context of a voluntary organization, elderly Pakistani women do health by the way they interact and construct a repertoire of social identities. The healing practices taking place among elderly Pakistani women may counteract the negative health outcomes associated with age, migration and gender implications for immigrant health-promoting policy in Norway may be to increase the establishment and

  14. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K

    2017-01-01

    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  15. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    OpenAIRE

    Summaira Naz

    2015-01-01

    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  16. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2006-01-01

    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  17. The effective factors on library anxiety of students in Isfahan University of Medical Sciences and Shiraz University of Medical Sciences.

    Science.gov (United States)

    Ashrafi-Rizi, Hasan; Sajad, Maryam Sadat; Rahmani, Sedigheh; Bahrami, Susan; Papi, Ahmad

    2014-01-01

    The efficient use of libraries can be an important factor in determining the educational quality of Universities. Therefore, investigation and identification of factors affecting library anxiety becomes increasingly necessary. The purpose of this research is to determine the factors effecting library anxiety of students in Isfahan University of Medical Sciences and Shiraz University of Medical Sciences. This was an applied survey research using Bostick's Library Anxiety questionnaire as data gathering tool. The statistical population consisted of all students of Isfahan University of Medical Sciences and Shiraz University of Medical Sciences (15011 students) with the sample size of 375 using stratified random sampling. The validity of data gathering tool was confirmed by experts in the library and information science and its reliability was determined by Cronbach's alpha (r = 0.92). Descriptive statistics (frequency, percentage, mean and standard deviation) and inferential statistics (t-test and ANOVA) were used for data analysis using SPSS 18 software. Findings showed that the mean of library anxiety score was 2.68 and 2.66 for students of Isfahan University of Medical Sciences and Shiraz University of Medical Sciences respectively which is above average (2.5). Furthermore, age and gender had no meaningful effect on the library anxiety of students of Isfahan University of Medical Sciences, but gender had a meaningful effect on library anxiety of students of Shiraz University of Medical Sciences while age had no such effect. The results showed that the mean of factors effecting library anxiety in students of Isfahan University of Medical Sciences and students of Shiraz University of Medical Sciences is higher than average and therefore not satisfactory and only factors relating to feeling comfortable in the library is lower than average and somewhat satisfactory.

  18. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2007-01-01

    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  19. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad

    2014-06-01

    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  20. Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

    Science.gov (United States)

    Qureshi, Mustafa; Abbas, Zaigham

    2015-01-01

    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  1. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-

    2006-01-01

    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  2. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA

    2017-07-01

    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  3. LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

    Directory of Open Access Journals (Sweden)

    Muhammad Usman

    2014-12-01

    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  4. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    Directory of Open Access Journals (Sweden)

    Summaira Naz

    2015-03-01

    Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

  5. Access to Power: Governance and Development in the Pakistani Electrical Power Sector

    Science.gov (United States)

    Naqvi, Ijlal

    This dissertation explores governance in Pakistan through a study of the state-run electrical power sector. At both the micro and macro level, the Pakistani power sector provides a lens into the heart of the Pakistani state and its governance institutions. This ethnographic and historical study offers an in-depth look at state operations in a developing country, situates the current Pakistani power crisis in a larger context of continuity through periods of dictatorship and democracy, and suggests how efforts to make state service delivery more responsive to citizens might be reconceived. A historical review of the Pakistani power sector establishes first and foremost that the current crisis is the product of longer-term processes for which the policy solutions currently being proposed (with the support of international donors and multilateral lenders) are inadequate. Depoliticized attempts at power sector reform have little to offer in light of the pervasively informal and negotiated nature of the fragmented Pakistani state. The institutions of power sector governance are mutually constituted by the formal rules and the informal---personal relationships, language, violence, money, and power. These rules of the game are as relevant to relations within and between public sector organizations as they are to the engagement of citizens with their state. The same rules apply at the margins of the state---informal squatter settlements---as at the core, though the resources brought to bear and the resultant outcomes are different. The internal incoherence of this state underscores the limitations of formal rules in determining outcomes, and the poor prospects for reform efforts that focus exclusively on the formal aspects of governance. To proactively engage with the question of political will leads away from top-down policy perspectives and counter to the depoliticizing tendencies that currently shape policy reforms. Instead, an energized and informed local participation

  6. A university-sponsored home health nursing program in Karachi, Pakistan.

    Science.gov (United States)

    Smego, Raymond A; Khan, Mohammad Aslam; Khowaja, Khurshid; Rafique, Rozina; Datoo, Farida

    2005-11-01

    This article describes a university-sponsored home health nursing program in a large urban center in Pakistan and details the essential elements needed in implementing such a program in a developing country. Compared to in-hospital treatment, home healthcare reduced hospital stay from 12.8 days to 3.9 days, and resulted in a net savings of Pakistani rupees (PRs) 5,374,135 (USD 89,569). A cost-effective home treatment program in a resource-limited country can be successfully implemented by using the hospital pharmacy as the central point for the preparation and distribution of medications and specialty nursing services.

  7. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  8. Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

    Science.gov (United States)

    Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

    2015-05-01

    In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

  9. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  10. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  11. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  12. Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Claussen Bjorgulf

    2006-06-01

    Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

  13. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.

    2015-01-01

    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  14. British-Pakistani women's perspectives of diabetes self-management: the role of identity.

    Science.gov (United States)

    Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

    2015-09-01

    To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

  15. Suicidal ideation in Pakistani college students.

    Science.gov (United States)

    Khokher, Sehar; Khan, Murad M

    2005-01-01

    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  16. Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

    Science.gov (United States)

    Mac an Ghaill, Mairtin; Haywood, Chris

    2014-01-01

    This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

  17. Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

    OpenAIRE

    Shakari, Yasmine

    2013-01-01

    Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

  18. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif

    2017-09-01

    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  19. Scientific production of medical sciences universities in north of iran.

    Science.gov (United States)

    Siamian, Hasan; Firooz, Mousa Yamin; Vahedi, Mohammad; Aligolbandi, Kobra

    2013-01-01

    NONE DECLARED. The study of the scientific evidence citation production by famous databases of the world is one of the important indicators to evaluate and rank the universities. The study at investigating the scientific production of Northern Iran Medical Sciences Universities in Scopus from 2005 through 2010. This survey used scientometrics technique. The samples under studies were the scientific products of four northern Iran Medical universities. Viewpoints quantity of the Scientific Products Mazandaran University of Medical Sciences stands first and of Babol University of Medical Sciences ranks the end, but from the viewpoints of quality of scientific products of considering the H-Index and the number of cited papers the Mazandaran University of Medical Sciences is a head from the other universities under study. From the viewpoints of subject of the papers, the highest scientific products belonged to the faculty of Pharmacy affiliated to Mazandaran University of Medial Sciences, but the three other universities for the genetics and biochemistry. Results showed that the Mazandaran University of Medical Sciences as compared to the other understudies universities ranks higher for the number of articles, cited articles, number of hard work authors and H-Index of Scopus database from 2005 through 2010.

  20. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  1. Medical universities educational and research online services: benchmarking universities' website towards e-government.

    Science.gov (United States)

    Farzandipour, Mehrdad; Meidani, Zahra

    2014-06-01

    Websites as one of the initial steps towards an e-government adoption do facilitate delivery of online and customer-oriented services. In this study we intended to investigate the role of the websites of medical universities in providing educational and research services following the E-government maturity model in the Iranian universities. This descriptive and cross- sectional study was conducted through content analysis and benchmarking the websites in 2012. The research population included the entire medical university website (37). Delivery of educational and research services through these university websites including information, interaction, transaction, and Integration were investigated using a checklist. The data were then analyzed by means of descriptive statistics and using SPSS software. Level of educational and research services by websites of the medical universities type I and II was evaluated medium as 1.99 and 1.89, respectively. All the universities gained a mean score of 1 out of 3 in terms of integration of educational and research services. Results of the study indicated that Iranian universities have passed information and interaction stages, but they have not made much progress in transaction and integration stages. Failure to adapt to e-government in Iranian medical universities in which limiting factors such as users' e-literacy, access to the internet and ICT infrastructure are not so crucial as in other organizations, suggest that e-government realization goes beyond technical challenges.

  2. Physicians' Migration: Perceptions of Pakistani Medical Students.

    Science.gov (United States)

    Hossain, Nazli; Shah, Nusrat; Shah, Tahira; Lateef, Sidra Binte

    2016-08-01

    To study the perceptions of medical students about factors responsible for physicians'migration. Cross-sectional survey. Dow Medical College and Civil Hospital, Karachi, from April to May 2015. Aself-administered structured questionnaire was used including demographic details, attitudes about push and pull factors of migration, and reasons for migrating or not migrating abroad. Final year students and interns were included. Likert scale from 1 to 4 (1=strongly disagree to 4=strongly agree) was used to assess attitudes. Data was analyzed by SPSS version 16. Atotal of 240 medical students, mostly females (n=181, 75%) (60% final year and 40% interns), participated in the study. Majority wished to go abroad (n=127; 54%) with United States being the favourite destination (n=80; 66.1%) and internal medicine fields being the preferred choice for specialization (n=126; 54%). The major pull factors were better quality of postgraduate education abroad (n=110; 48.2%) and economic prospects (80; 35.2%); while the push factors were a weak healthcare system (n=219; 94.3%), inadequate salary structure (n=205; 88.3%), insecurity (n=219; 93.9%) and increasing religious intolerance in Pakistan (n=183; 78.5%). This survey highlights the continuing trend of physician migration from Pakistan owing to an interplay of various push and pull factors. Majority of our medical students wish to migrate, mainly due to low salaries, poor job structure, and insecurity. Urgent interventions are required to reverse this trend of medical brain-drain.

  3. [Issues related to national university medical schools: focusing on the low wages of university hospital physicians].

    Science.gov (United States)

    Takamuku, Masatoshi

    2015-01-01

    University hospitals, bringing together the three divisions of education, research, and clinical medicine, could be said to represent the pinnacle of medicine. However, when compared with physicians working at public and private hospitals, physicians working at university hospitals and medical schools face extremely poor conditions. This is because physicians at national university hospitals are considered to be "educators." Meanwhile, even after the privatization of national hospitals, physicians working for these institutions continue to be perceived as "medical practitioners." A situation may arise in which physicians working at university hospitals-performing top-level medical work while also being involved with university and postgraduate education, as well as research-might leave their posts because they are unable to live on their current salaries, especially in comparison with physicians working at national hospitals, who focus solely on medical care. This situation would be a great loss for Japan. This potential loss can be prevented by amending the classification of physicians at national university hospitals from "educators" to "medical practitioners." In order to accomplish this, the Japan Medical Association, upon increasing its membership and achieving growth, should act as a mediator in negotiations between national university hospitals, medical schools, and the government.

  4. Self-Medication Practice with Nonprescription Medication among University Students: a review of the literature

    Directory of Open Access Journals (Sweden)

    Dedy Almasdy

    2011-09-01

    Full Text Available Objective: To review the literature relating to self-medicationpractice with nonprescription medication among universitystudents.Methods: A narrative review of studies on self-medicationpractice with nonprescription medication among universitystudent was performed. An extensive literature search wasundertaken using indexing services available at UniversitiSains Malaysia (USM library. The following keywords wereused for the search: self-care, self-medication, over-thecountermedicine, nonprescription medicine, minor illnesses,minor ailment, university population and communitypharmacy. Electronic databases searched were Science Direct,Medline, ISI Web of Knowledge, Inside Web, JSTOR, SpringerLink, Proquest, Ebsco Host and Google Scholar. Theseelectronic databases were searched for full text paperspublished in English.Results: Eleven studies were identified. In general, the reviewhas shown that self-medication practice with nonprescriptionmedication highly prevalence among university students. Thereasons for self-medication are vary among this populationand the main symptoms leading to self-medication areheadache or minor pain; fever, flu, cough, or cold; anddiarrhoea.The common medication is analgesic, antipyreticproducts, cough and cold remedies, anti allergy andvitamins or minerals. The sources of the medicines arepharmacy, home medicine cabinet, supermarket/shopand other person such as family, friend, neighbours andclassmates. The sources of drug information are familymember, previous experience, pharmacy salesman,doctor or nurse, advertisement and others. The reviewalso has shown that the self-medication practice couldhave many problems.Conclusions: The review provides insights about theself-medication practices among the university students.These practices were highly prevalence among universitystudents. The symptoms leading to self-medication arevary, thus the medication used and the medicationsources. It needs an adequate drug information

  5. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

    OpenAIRE

    Saghir, Sheeba; Hyland, Lynda

    2017-01-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  6. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan

    2014-08-01

    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  7. Using a tailored health information technology- driven intervention to improve health literacy and medication adherence in a Pakistani population with vascular disease (Talking Rx) - study protocol for a randomized controlled trial.

    Science.gov (United States)

    Kamal, Ayeesha Kamran; Muqeet, Abdul; Farhat, Kashfa; Khalid, Wardah; Jamil, Anum; Gowani, Ambreen; Muhammad, Aliya Amin; Zaidi, Fabiha; Khan, Danyal; Elahi, Touseef; Sharif, Shahrukh; Raz, Sibtain; Zafar, Taha; Bokhari, Syedah Saira; Rahman, Nasir; Sultan, Fateh Ali Tipoo; Sayani, Saleem; Virani, Salim S

    2016-03-05

    Vascular disease, manifesting as myocardial infarction and stroke, is a major cause of morbidity and mortality, especially in low- and middle-income countries. Current estimates are that only one in six patients have good adherence to medications and very few have sufficient health literacy. Our aim is to explore the effectiveness and acceptability of Prescription Interactive Voice Response (IVR) Talking Prescriptions (Talking Rx) and SMS reminders in increasing medication adherence and health literacy in Pakistani patients with vascular disease. This is a randomized, controlled, single center trial. Adult participants, with access to a cell phone and a history of vascular disease, taking multiple risk-modifying medications (inclusive of anti-platelets and statins) will be selected from cerebrovascular and cardiovascular clinics. They will be randomized in a 1:1 ratio via a block design to the intervention or the control arm with both groups having access to a helpline number to address their queries in addition to standard of care as per institutional guidelines. Participants in the intervention group will also have access to Interactive Voice Response (IVR) technology tailored to their respective prescriptions in the native language (Urdu) and will have the ability to hear information about their medication dosage, correct use, side effects, mechanism of action and how and why they should use their medication, as many times as they like. Participants in the intervention arm will also receive scheduled SMS messages reminding them to take their medications. The primary outcome measure will be the comparison of the difference in adherence to anti-platelet and statin medication between baseline and at 3-month follow-up in each group measured by the Morisky Medication Adherence Scale. To ascertain the impact of our intervention on health literacy, we will also compare a local content-validated and modified version of Test of Health Literacy in Adults (TOFHLA) between

  8. PAKISTANIS IN ITALY: THE DISENCHANTMENTS OF “LIVING TRANSNATIONALLY”

    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad

    2010-12-01

    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  9. HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Naqi, N.; Ahmed, T.A.; Bashir, M.M.

    2011-01-01

    Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

  10. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  11. Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

    Directory of Open Access Journals (Sweden)

    Abdul Haque

    2011-01-01

    Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

  12. An Artist in the University Medical Center. Review.

    Science.gov (United States)

    James, A. Everette, Jr.

    1991-01-01

    Reviews "An Artist in the University Medical Center" (M. Lesser, New Orleans: Tulane University Press, 1989), in which the artist captures the human side of the complex Tulane Medical Center in New Orleans (Louisiana). The interplay of drawings, etchings, watercolors, and prose conveys traditions of nurturing in the hospital. (SLD)

  13. Different sex ratios of children born to Indian and Pakistani immigrants in Norway

    Directory of Open Access Journals (Sweden)

    Brekke Torkel

    2010-08-01

    Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

  14. Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

    Science.gov (United States)

    Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

    2017-07-01

    Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

  15. A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

    Science.gov (United States)

    Chaudhry, N; Husain, N; Tomenson, B; Creed, F

    2012-06-01

    The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

  16. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    OpenAIRE

    Syeda Bushra Zaidi

    2016-01-01

    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  17. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  18. Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2007-01-01

    Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

  19. Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

    Science.gov (United States)

    Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

    2007-01-01

    Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

  20. The medical collections at the University of Glasgow.

    Science.gov (United States)

    Reilly, Maggie; McDonald, Stuart W

    2009-01-01

    The medical and other collections in the University of Glasgow have at their core the generous bequest of Dr William Hunter (1718 - 1783), a local man who rose to become an internationally renowned anatomist and obstetrician. The University does not have a Medical Museum as such but an Anatomy Museum, a Zoology Museum, a Pathology Collection, medical displays in the main halls of the Hunterian Museum in the Gilbert Scott Building and a rich collection of antiquarian medical books and archives as well as contemporary libraries. The Hunterian Collection, since its inauguration at the University of Glasgow in 1807, has engendered a spirit of diversity and scholarship that embraces many disciplines across the campus. The Hunterian Museum was the first public museum in Scotland and service to the local, national and international communities and response to their academic needs is very much at heart of its function today.

  1. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  2. Motivation of university and non-university stakeholders to change medical education in Vietnam

    Directory of Open Access Journals (Sweden)

    Ruitenberg EJ

    2009-07-01

    Full Text Available Abstract Background Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder. From 1999 to 2006, eight medical schools in Vietnam worked together to change the curriculum and teaching for general medical students to make it more community oriented. This paper describes the factors that motivated the different stakeholders to participate in curriculum change and teaching in Vietnamese medical schools and the activities to address those factors and have sustainable contributions from all relevant stakeholders. Methods Case study analysis of contributions to the change process, using reports, interviews, focus group discussions and surveys and based on Herzberg's Motivation Theory to analyze involvement of different stakeholders. Results Different stakeholders were motivated by selected activities, such as providing opportunities for non-university stakeholders to share their opinions, organizing interactions among university stakeholders, stimulating both bottom-up and top-down inputs, focusing on learning from each other, and emphasizing self-motivation factors. Conclusion The Herzberg Motivation theory helped to identify suitable approaches to ensure that teaching topics, materials and assessment methods more closely reflected the health care needs of the community. Other medical schools undertaking a reform process may learn from this experience.

  3. Motivation of university and non-university stakeholders to change medical education in Vietnam.

    Science.gov (United States)

    Luu, Ngoc Hoat; Nguyen, Lan Viet; van der Wilt, G J; Broerse, J; Ruitenberg, E J; Wright, E P

    2009-07-24

    Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder. From 1999 to 2006, eight medical schools in Vietnam worked together to change the curriculum and teaching for general medical students to make it more community oriented. This paper describes the factors that motivated the different stakeholders to participate in curriculum change and teaching in Vietnamese medical schools and the activities to address those factors and have sustainable contributions from all relevant stakeholders. Case study analysis of contributions to the change process, using reports, interviews, focus group discussions and surveys and based on Herzberg's Motivation Theory to analyze involvement of different stakeholders. Different stakeholders were motivated by selected activities, such as providing opportunities for non-university stakeholders to share their opinions, organizing interactions among university stakeholders, stimulating both bottom-up and top-down inputs, focusing on learning from each other, and emphasizing self-motivation factors. The Herzberg Motivation theory helped to identify suitable approaches to ensure that teaching topics, materials and assessment methods more closely reflected the health care needs of the community. Other medical schools undertaking a reform process may learn from this experience.

  4. Intellectual wellness in medical university teachers: Gender based comparison.

    Science.gov (United States)

    Syed, Sadiqa; Rehman, Rehana; Hussain, Mehwish; Shaikh, Saifullah

    2017-05-01

    A cross section, questionnaire based study was carried out from January 2012 till December 2014 to compare intellectual wellness (IW) awareness on the basis of gender in teachers of basic sciences at medical universities of Karachi, Pakistan. Data was collected from 3 public and 5 private medical universities of Karachi, Pakistan. Questionnaire was tailored from "Wellness Wheel" and responses were aggregated for eight questions in the dimension of IW to obtain aggregate IW score. Reliability of the questionnaire was measured using Cronbach's alpha. The average intellectual score was 24.99 ± 3.93 with a minimum score of 8 and maximum 32.The frequency of keeping informed about research updates was significantly higher in males (p = 0.043) that emphasized significantly better IW awareness of male medical teachers involved in teaching of medical sciences in both public and private medical universities of Pakistan.

  5. Evaluation and comparison of medical records department of Iran university of medical sciences teaching hospitals and medical records department of Kermanshah university of medical sciences teaching hospitals according to the international standards ISO 9001-2000 in 2008

    Directory of Open Access Journals (Sweden)

    maryam ahmadi

    2010-04-01

    Conclusion: The rate of final conformity of medical records system by the criteria of the ISO 9001-2000 standards in hospitals related to Iran university of medical sciences was greater than in hospitals related to Kermanshah university of medical sciences. And total conformity rate of medical records system in Kermanshah hospitals was low. So the regulation of medical records department with ISO quality management standards can help to elevate its quality.

  6. Assessment of Medication Use among University Students in Ethiopia

    Directory of Open Access Journals (Sweden)

    Dessalegn Asmelashe Gelayee

    2017-01-01

    Full Text Available Background. The extent, nature, and determinants of medication use of individuals can be known from drug utilization studies. Objectives. This study intended to determine medication consumption, sharing, storage, and disposal practices of university students in Northwest Ethiopia. Methods. A descriptive cross-sectional study was conducted on 404 university students selected through stratified random sampling technique. Data were collected using self-administered questionnaire and analyzed with SPSS version 20 statistical software. Pearson’s Chi-square test of independence was conducted with P<0.05 taken as statistically significant. Results. At 95.3% response rate, the prevalences of medication consumption and sharing were 35.3% (N=136 and 38.2% (N=147, respectively. One hundred (26% respondents admitted that they often keep leftover medications for future use while the rest (N=285, 74% discard them primarily into toilets (N=126, 44.2%. Evidence of association existed between medication taking and year of study (P=0.048, medication sharing and sex (P=0.003, and medication sharing and year of study (P=0.015. Conclusion. There is a high prevalence of medication consumption, medication sharing, and inappropriate disposal practices which are influenced by sex and educational status of the university students. Thus medication use related educational interventions need to be given to students in general.

  7. Medical Education in Japan and Introduction of Medical Education at Tokyo Women’s Medical University

    Institute of Scientific and Technical Information of China (English)

    Yumiko Okubo

    2014-01-01

    Medical education in Japan changed rapidly in the last decade of the 20th century with the introduction of new education methods and implementation of the core curriculum and common achievement testing such as CBT and OSCE.Recently, there have been other movements in medical education in Japan that have introduced 'outcome(competency) based education(OBE)' and created a system for accreditation of medical education programs. This report provides an overview of current medical education in Japan. Moreover, it introduces medical education at Tokyo Women’s Medical University.

  8. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  9. Self-citation of Medical and Non-medical Universities in Northern Iran.

    Science.gov (United States)

    Jahani, Mohammad Ali; Yaminfirooz, Mousa

    2016-12-01

    Self-citation is one of the main challenges in the evaluation of researchers' scientific output. This study aimed at comparing the institutional self-citation among the universities located in Northern Iran. This study was conducted as a scientometric study. Research population included all scientific productions of 16 Northern Iran Universities with at least 100 indexed documents indexed in the Web of Science (WoS) by 2 June 2015. The citation analysis section of WoS was used for data collection. SPSS was applied for data analysis. Study hypotheses were tested with two independent sample t-test and paired sample t-test. Producing 16,399 papers, northern Iran universities had 5.33% of contribution in Iran's scientific production. They received 84,058 citations with 17% and 12% of self-citations belonged to the non-medical and medical universities, respectively. Testing hypotheses revealed that increase in received citations significantly increases the rate of self-citation and increase in scientific production does not necessarily increase the rate of self-citation. The rate of self-citation in the studied universities was not relatively high. However, investigating into the factors affecting the rate of and motives for self-citation needs further research.

  10. Brand equity in the Pakistani hotel industry

    OpenAIRE

    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

    2014-01-01

    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  11. Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

    Science.gov (United States)

    Mythen, Gabe

    2012-09-01

    Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

  12. Burnout and its Associated Factors in Medical Students of Lahore, Pakistan.

    Science.gov (United States)

    Muzafar, Yumna; Khan, Hibbah H; Ashraf, Huma; Hussain, Waqas; Sajid, Hifsa; Tahir, Marium; Rehman, Abdul; Sohail, Aleena; Waqas, Ahmed; Ahmad, Waqas

    2015-11-29

    Burnout is a widely known phenomenon. It is defined as a state of prolonged physical and psychological exhaustion and is experienced virtually by every medical student due to the highly demanding nature of medical education. This study probes into the prevalence and psychosocial determinants of burnout in Pakistani medical students. A descriptive, cross-sectional study design and convenience (non-probability) sampling technique were employed in undergraduate medical students from years 1-5. A total of 777 medical students from two medical colleges were included in the study from May-August, 2014. An English version of the Copenhagen Burnout Inventory (CBI) and a series of demographic questions, intermixed with questions from other topics, were included in the questionnaire. Data was analysed by using SPSS ver.21. The majority of students were females and enrolled in the third year of MBBS. Of the medical students involved, 30.6% were found to have high/very high levels of burnout (Kristenson's burnout scoring). Although 38.7% of students said that they did not feel burned out after reading the definition of burnout given in the questionnaire, 35.9% out of these students actually had high levels of burnout according to CBI. According to the multiple regression analysis, burnout in medical students was significantly associated with age, gender, doctor parents, no help or no supportive resources (e.g., from colleagues), lack of time off, lack of belief in what you do, fear of big consequences of failure, family responsibilities, and uncertain future. Perception of teachers lacking leadership skills and doing too much study with little balance was associated with low burnout scores. There is a high prevalence of burnout in Pakistani medical students. The present study identifies several factors associated with burnout in Pakistani medical students. Although these factors are a part of daily life of medical students, their identification should prompt the use of

  13. A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-04-11

    Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  14. Journal of the Obafemi Awolowo University Medical Student's ...

    African Journals Online (AJOL)

    Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. Journal Homepage Image. IFEMED Journal is the official publication of Obafemi Awolowo University Medical Students' Association, Ile-Ife , Nigeria . The Journal Club periodically publishes articles on medical and medically related topics ...

  15. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

    International Nuclear Information System (INIS)

    Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

    2010-01-01

    Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

  16. Self-Medication in University Students from the City of Mansoura, Egypt.

    Science.gov (United States)

    Helal, R M; Abou-ElWafa, H S

    2017-01-01

    Background . Self-medication is a common practice in developed and developing countries. Objectives . To explore the prevalence of self-medication practices among university students, probable reasons, symptoms requiring self-medication, and sources of advice. Methods . A descriptive cross-sectional study was carried out in Mansoura University, Egypt, and included 1st and last year students of both medical and nonmedical faculties. Results . Prevalence of self-medication was 62.9%. Younger age, female, medical, and ever-married students and those having home pharmacy tended to self-medicate more than their peers with significant difference between them. Being medical student, being from urban area, having good current health condition, being careless about health, and having drugs stored at home pharmacy were independently associated with the likelihood of self-medicating. Conclusion . Prevalence of self-medication among university students is high which constitutes a health problem that needs intervention.

  17. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

    Science.gov (United States)

    Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

    2006-07-10

    In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

  18. Access to Medication Abortion Among California's Public University Students.

    Science.gov (United States)

    Upadhyay, Ushma D; Cartwright, Alice F; Johns, Nicole E

    2018-06-09

    A proposed California law will require student health centers at public universities to provide medication abortion. To understand its potential impact, we sought to describe current travel time, costs, and wait times to access care at the nearest abortion facilities. We projected total medication abortion use based on campus enrollment figures and age- and state-adjusted abortion rates. We calculated distance and public transit time from campuses to the nearest abortion facility. We contacted existing abortion-providing facilities to determine costs, insurance acceptance, and wait times. We estimate 322 to 519 California public university students seek medication abortions each month. As many as 62% of students at these universities were more than 30 minutes from the closest abortion facility via public transportation. Average cost of medication abortion was $604, and average wait time to the first available appointment was one week. College students face cost, scheduling, and travel barriers to abortion care. Offering medication abortion on campus could reduce these barriers. Copyright © 2018 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  19. Motivation of university and non-university stakeholders to change medical education in Vietnam.

    NARCIS (Netherlands)

    Luu, H.N.; Nguyen, V.L.; van der Wilt, G.J.; Broerse, J.E.W.; Ruitenberg, E.J.; Wright, E.P.

    2009-01-01

    Background. Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder.

  20. Motivation of university and non-university stakeholders to change medical education in Vietnam

    NARCIS (Netherlands)

    Lu, H.; Nguyen, V; van der Wilt, G.J.; Broerse, J.E.W.; Ruitenberg, E.J.; Wright, P.

    2009-01-01

    Background. Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder.

  1. Development of the competency-based medical curriculum for the new Augsburg University Medical School

    Directory of Open Access Journals (Sweden)

    Härtl, Anja

    2017-05-01

    Full Text Available Aim: With the resolution from April 28, 2014, the Bavarian state government in Germany decided to found a new medical school at Augsburg University, thereby requiring the development of a competency-based medical curriculum.Methods: Two interdisciplinary groups developed a spiral curriculum (following Harden employing the model of Thumser-Dauth & Öchsner. The curriculum focuses on specifically defined competencies: medical expertise, independent scientific reasoning, argumentation and scholarship, as well as communication skills.Results: The spiral curriculum was developed as a hybrid curriculum. Its modular structure incorporates the mandatory subjects required by the German regulations for medical licensure (Approbationsordnung into organ- and system-centered blocks which are integrated both horizontally and vertically. Basic preclinical sciences are covered in the blocks “Movement,” “Balance” and “Contact.” The clinical sciences are organized according to six pillars (conservative medicine, surgical medicine, men’s-women’s-children’s medicine, the senses, the nervous system and the mind, and general medicine which students revisit three times each over the course of the program. A longitudinal clinical course incorporates interdisciplinary education. A particular focus is on scientific education encompassing a longitudinal course in the sciences (including interdisciplinary classes with other university departments, block practicums, and two scientific projects.Conclusion: It is not only the degree of integration und intensity of the Augsburg University undergraduate medical degree program, but also its targeted advancement of academic, social and communication skills that have not yet been realized to such an extent elsewhere in Germany. On July 8, 2016, the German Council of Science and Humanities unanimously gave this concept a positive evaluation. Future research will examine and evaluate the Augsburg medical curriculum

  2. Identifying challenges for academic leadership in medical universities in Iran.

    Science.gov (United States)

    Bikmoradi, Ali; Brommels, Mats; Shoghli, Alireza; Khorasani-Zavareh, Davoud; Masiello, Italo

    2010-05-01

    CONTEXT The crucial role of academic leadership in the success of higher education institutions is well documented. Medical education in Iran has been integrated into the health care system through a complex organisational change. This has called into question the current academic leadership, making Iranian medical universities and schools a good case for exploring the challenges of academic leadership. OBJECTIVES This study explores the leadership challenges perceived by academic managers in medical schools and universities in Iran. METHODS A qualitative study using 18 face-to-face, in-depth interviews with academic managers in medical universities and at the Ministry of Health and Medical Education in Iran was performed. All interviews were recorded digitally, transcribed verbatim and analysed by qualitative content analysis. RESULTS The main challenges to academic leadership could be categorised under three themes, each of which included three sub-themes: organisational issues (inefficacy of academic governance; an overly extensive set of missions and responsibilities; concerns about the selection of managers); managerial issues (management styles; mismatch between authority and responsibilities; leadership capabilities), and organisational culture (tendency towards governmental management; a boss-centred culture; low motivation). CONCLUSIONS This study emphasises the need for academic leadership development in Iranian medical schools and universities. The ability of Iranian universities to grow and thrive will depend ultimately upon the application of leadership skills. Thus, it is necessary to better designate authorities, roles of academic staff and leaders at governance.

  3. When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

    OpenAIRE

    Marwah, Ane Frislid Sveinhaug

    2008-01-01

    This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

  4. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.

    2015-01-01

    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  5. Social and cultural construction of obesity among Pakistani Muslim women in North West England.

    Science.gov (United States)

    Ludwig, Alison F; Cox, Peter; Ellahi, Basma

    2011-10-01

    The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

  6. University Offer Rates for Candidates from Different Ethnic Categories

    Science.gov (United States)

    Noden, Philip; Shiner, Michael; Modood, Tariq

    2014-01-01

    Previous research suggested that candidates from some black and minority ethnic groups were less likely to receive an offer of a place from an "old" university. These findings were disputed in a re-analysis carried out for HEFCE which found that only Pakistani candidates were significantly less likely to receive offers (from both…

  7. A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

    Directory of Open Access Journals (Sweden)

    Rebecca Garcia

    2017-04-01

    Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  8. Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

    Science.gov (United States)

    Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

    2011-01-01

    This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

  9. Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

    2017-12-01

    South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

  10. Joint marketing cites excellence: Fairview-University Medical Center advertises cooperatively with University of Minnesota Physicians.

    Science.gov (United States)

    Botvin, Judith D

    2004-01-01

    Fairview-University Medical Center and University of Minnesota Physicians, both in Minneapolis, are enjoying the benefits of a co-branded advertising campaign. It includes print ads, brochures, and other marketing devices.

  11. Knowledge Management within the Medical University.

    Science.gov (United States)

    Rauzina, Svetlana Ye; Tikhonova, Tatiana A; Karpenko, Dmitriy S; Bogopolskiy, Gennady A; Zarubina, Tatiana V

    2015-01-01

    The aim of the work is studying the possibilities of ontological engineering in managing of medical knowledge. And also practical implementation of knowledge management system (KMS) in medical university. The educational process model is established that allows analyzing learning results within time scale. Glossary sub-system has been developed; ontologies of educational disciplines are constructed; environment for setup and solution of situational cases is established; ontological approach to assess competencies is developed. The possibilities of the system for solving situation tasks have been described. The approach to the evaluation of competence has been developed.

  12. Attitude of teaching faculty towards statistics at a medical university in Karachi, Pakistan.

    Science.gov (United States)

    Khan, Nazeer; Mumtaz, Yasmin

    2009-01-01

    Statistics is mainly used in biological research to verify the clinicians and researchers findings and feelings, and gives scientific validity for their inferences. In Pakistan, the educational curriculum is developed in such a way that the students who are interested in entering in the field of biological sciences do not study mathematics after grade 10. Therefore, due to their fragile background of mathematical skills, the Pakistani medical professionals feel that they do not have adequate base to understand the basic concepts of statistical techniques when they try to use it in their research or read a scientific article. The aim of the study was to assess the attitude of medical faculty towards statistics. A questionnaire containing 42 close-ended and 4 open-ended questions, related to the attitude and knowledge of statistics, was distributed among the teaching faculty of Dow University of Health Sciences (DUHS). One hundred and sixty-seven filled questionnaires were returned from 374 faculty members (response rate 44.7%). Forty-three percent of the respondents claimed that they had 'introductive' level of statistics courses, 63% of the respondents strongly agreed that a good researcher must have some training in statistics, 82% of the faculty was in favour (strongly agreed or agreed) that statistics was really useful for research. Only 17% correctly stated that statistics is the science of uncertainty. Half of the respondents accepted that they have problem of writing the statistical section of the article. 64% of the subjects indicated that statistical teaching methods were the main reasons for the impression of its difficulties. 53% of the faculty indicated that the co-authorship of the statistician should depend upon his/her contribution in the study. Gender did not show any significant difference among the responses. However, senior faculty showed higher level of the importance for the use of statistics and difficulties of writing result section of

  13. Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2014-01-01

    The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

  14. Student-Life Stress Level and its Related Factors among Medical Students of Hamadan University of Medical Sciences in 2015

    OpenAIRE

    Roya Nikanjam; Majid Barati; Saeed Bashirian*; Mohammad Babamiri; Ali Fattahi; Alireza Soltanian

    2016-01-01

    Background and Objectives: Student-life stress can lead to various negative consequences such as physical illness, mental disorders or exhaustion. The present study was conducted to evaluate the level of student life stress and its related factors among medical students of Hamadan University of Medical Sciences. Materials and Methods: This cross-sectional study applied multistage random sampling to select 500university students at Hamadan University of Medical Sciences during 2015. The dat...

  15. Scientific Production of Medical Universities in the West of Iran: a Scientometric Analysis.

    Science.gov (United States)

    Rasolabadi, Masoud; Khaledi, Shahnaz; Khayati, Fariba; Kalhor, Marya Maryam; Penjvini, Susan; Gharib, Alireza

    2015-08-01

    This study aimed to compare scientific production by providing quantitative evaluation of science output in five Western Iranian Medical Universities including Hamedan, Ilam, Kermanshah, Kurdistan and Lorestan University of Medical Sciences using scientometrics indicators based on data indexed in Scopus for period between the years 2010 to 2014. In this scientometric study data were collected using Scopus database. Both searching and analyzing features of Scopus were used to data retrieval and analysis. We used Scientometrics indicators including number of publications, number of citations, nationalization index (NI), Internationalization Index (INI), H-index, average number of citations per paper, and growth index. Five Western Iranian Universities produced over 3011 articles from 2010 to 2014. These articles were cited 7158 times with an average rate of 4.2 citations per article. H- Index of under study universities are varying from 14 to 30. Ilam University of Medical Sciences had the highest international collaboration with an INI of 0.33 compared to Hamedan and Kermanshah universities with INI of 0.20 and 0.16 respectively. The lowest international collaboration belonged to Lorestan University of Medical Sciences (0.07). The highest Growth Index belonged to Kurdistan University of Medical Sciences (69.7). Although scientific production of five Western Iranian Medical Universities was increasing, but this trend was not stable. To achieve better performance it is recommended that five Western Iranian Universities stabilize their budgeting and investment policies in research.

  16. Antibiotic Self-Medication among Non-Medical University Students in Punjab, Pakistan: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Ali Hassan Gillani

    2017-09-01

    Full Text Available Background: Antibiotic resistance is a global threat. Scarce knowledge about safe and appropriate antibiotic use is coupled with frequent self-administration, e.g., in China. This repeated self-medication poses potential risk in terms of antibiotic resistance. Low-resource countries are facing an elevated burden of antibiotic self-medication as compared to developed ones. Thus, this study focused on evaluating the pervasiveness of antibiotic self-medication in 3 universities of Southern Punjab, Pakistan. Methods: We conducted a descriptive cross-sectional survey in three government sector universities of Southern Punjab, Pakistan. The study was carried out with self-administered paper-based questionnaires. Data was analyzed using SPSS version 18.0 (IBM, Chicago, IL, USA. Results: Seven hundred twenty-seven students out of 750 (response rate 97% with a mean age ± SD of 23.0 ± 3.4 years agreed to participate in the study. The proportion of females was slightly greater (52% compared with males (48%, and almost one-third of the respondents (36% were in their 2nd year of university. Out of the total, 58.3% practiced self-medication in the preceding six months, and 326 (45% confirmed the use of antibiotics. Metronidazole was the most frequently self-medicated antibiotic (48%. Out of the total, 72% demonstrated awareness regarding the side effects of antibiotics. Diarrhea was the well-known adverse effect (38%. Forty-three percent affirmed having antibiotic resistance knowledge, and 30% knew that the irregular use of antibiotics would lead to increased antibiotic resistance. Conclusion: Despite having ample awareness of the adverse antibiotic reactions, self-medication among the university students was high and antibiotic resistance was a fairly unknown term.

  17. Antibiotic Self-Medication among Non-Medical University Students in Punjab, Pakistan: A Cross-Sectional Survey.

    Science.gov (United States)

    Gillani, Ali Hassan; Ji, Wenjing; Hussain, Waqar; Imran, Ali; Chang, Jie; Yang, Caijun; Fang, Yu

    2017-09-29

    Background : Antibiotic resistance is a global threat. Scarce knowledge about safe and appropriate antibiotic use is coupled with frequent self-administration, e.g., in China. This repeated self-medication poses potential risk in terms of antibiotic resistance. Low-resource countries are facing an elevated burden of antibiotic self-medication as compared to developed ones. Thus, this study focused on evaluating the pervasiveness of antibiotic self-medication in 3 universities of Southern Punjab, Pakistan. Methods : We conducted a descriptive cross-sectional survey in three government sector universities of Southern Punjab, Pakistan. The study was carried out with self-administered paper-based questionnaires. Data was analyzed using SPSS version 18.0 (IBM, Chicago, IL, USA). Results : Seven hundred twenty-seven students out of 750 (response rate 97%) with a mean age ± SD of 23.0 ± 3.4 years agreed to participate in the study. The proportion of females was slightly greater (52%) compared with males (48%), and almost one-third of the respondents (36%) were in their 2nd year of university. Out of the total, 58.3% practiced self-medication in the preceding six months, and 326 (45%) confirmed the use of antibiotics. Metronidazole was the most frequently self-medicated antibiotic (48%). Out of the total, 72% demonstrated awareness regarding the side effects of antibiotics. Diarrhea was the well-known adverse effect (38%). Forty-three percent affirmed having antibiotic resistance knowledge, and 30% knew that the irregular use of antibiotics would lead to increased antibiotic resistance. Conclusion : Despite having ample awareness of the adverse antibiotic reactions, self-medication among the university students was high and antibiotic resistance was a fairly unknown term.

  18. Modernizing and transforming medical education at the Kilimanjaro Christian Medical University College.

    Science.gov (United States)

    Lisasi, Esther; Kulanga, Ahaz; Muiruri, Charles; Killewo, Lucy; Fadhili, Ndimangwa; Mimano, Lucy; Kapanda, Gibson; Tibyampansha, Dativa; Ibrahim, Glory; Nyindo, Mramba; Mteta, Kien; Kessi, Egbert; Ntabaye, Moshi; Bartlett, John

    2014-08-01

    The Kilimanjaro Christian Medical University (KCMU) College and the Medical Education Partnership Initiative (MEPI) are addressing the crisis in Tanzanian health care manpower by modernizing the college's medical education with new tools and techniques. With a $10 million MEPI grant and the participation of its partner, Duke University, KCMU is harnessing the power of information technology (IT) to upgrade tools for students and faculty. Initiatives in eLearning have included bringing fiber-optic connectivity to the campus, offering campus-wide wireless access, opening student and faculty computer laboratories, and providing computer tablets to all incoming medical students. Beyond IT, the college is also offering wet laboratory instruction for hands-on diagnostic skills, team-based learning, and clinical skills workshops. In addition, modern teaching tools and techniques address the challenges posed by increasing numbers of students. To provide incentives for instructors, a performance-based compensation plan and teaching awards have been established. Also for faculty, IT tools and training have been made available, and a medical education course management system is now being widely employed. Student and faculty responses have been favorable, and the rapid uptake of these interventions by students, faculty, and the college's administration suggests that the KCMU College MEPI approach has addressed unmet needs. This enabling environment has transformed the culture of learning and teaching at KCMU College, where a path to sustainability is now being pursued.

  19. [Medical history as an academic subject at the Bamberg University].

    Science.gov (United States)

    Locher, W

    2000-01-01

    A full program of medicine was taught at the Catholic University of Bamberg (founded 1648 as the Academia Ottonia) from 1773 through 1803. Within this period of time, the History of Medicine was taught from 1790 through 1795 by Johann Baptist Dominicus Fin(c)k. This paper elucidates how in this instance protestant universities served as models for catholic universities. Interestingly, it was not the medical faculty itself which developed an interest in teaching medical history. Rather, it was Adalbert Friedrich Marcus (1753-1816), physician-in-waiting of the Prince-Bishop Franz Ludwig von Erthal and medical officer in the principality of Bamberg since June 22, 1790, who was charged by the Prince-Bishop with developing guidelines for medical education. The start of the History of Medicine lectures brought with it a heated dispute about an appropriate textbook. The discussion is evidence of a transition from historiography understood as an account of learned doctors of the past to a study of history in a modern sense.

  20. Promoting smoking cessation in Bangladeshi and Pakistani male adults: design of a pilot cluster randomised controlled trial of trained community smoking cessation workers

    Directory of Open Access Journals (Sweden)

    Gill Paramjit

    2009-08-01

    Full Text Available Abstract Background The prevalence of smoking is higher among Pakistani and Bangladeshi males than among the general population. Smokers who receive behavioural support and medication quadruple their chances of stopping smoking, but evidence suggests that these populations do not use National Health Service run stop smoking clinics as frequently as would be expected given their high prevalence of smoking. This study aims to tackle some of the main barriers to use of stop smoking services and adherence to treatment programmes by redesigning service delivery to be more acceptable to these adult male populations. The study compares the effectiveness of trained Pakistani and Bangladeshi smoking cessation workers operating in an outreach capacity ('clinic + outreach' with standard care ('clinic only' to improve access to and success of National Health Service smoking cessation services. Methods/design This is a pilot cluster randomised controlled trial based in Birmingham, UK. Super output areas of Birmingham will be identified in which more than 10% of the population are of Pakistani and/or Bangladeshi origin. From these areas, 'natural geographical communities' will be identified. Sixteen aggregated agglomerations of super output areas will be identified, separating areas from each other using buffer regions in order to reduce potential contamination. These natural communities will be randomised to 'clinic + outreach' (intervention or 'clinic only' (control arms. The use of stop smoking services and the numbers of people quitting smoking (defined as prolonged self-reported abstinence at four weeks, three months and six months will be assessed in each area. In addition, we will assess the impact of the intervention on adherence to smoking cessation treatments and patient satisfaction. Trial registration Current Controlled Trials ISRCTN 82127540.

  1. Determining the Correlation Between Language Scores Obtained by Medical Students in their University Entrance and Comprehensive Medical Basic Sciences Exams

    Directory of Open Access Journals (Sweden)

    Majid Ahmadi

    2009-06-01

    Full Text Available Background and Purpose: Some professors and educators in the field of English language believe that the high grades attained by medical students in their Comprehensive Medical Basic Sciences Exam (CMBSE are mainly a result of the students prior fluency in the language before entering medical colleges; they are of the opinion that these grades are not necessarily a result of the combined effort of the English teachers and students in language courses at the university. This research aimsat determining the correlation between the level of fluency in English of medical students prior to university entrance and the grades obtained by them in their CMBSE after 3 terms of language courses at the university.Methods: Seven of the major and smaller universities of medical sciences were selected. The language scores of 2426 students admitted to these universities during the three academic years of 1999 to 2002 in both the National University Entrance Examination (NUEE and the Comprehensive Medical Basic Sciences Exam (CMBSE were obtained from their related universities and from the secretariat of the Council of Medical Basic Sciences Education respectively. The language scores of each studentobtained in both NUEE and CMBSE were then matched. The related SPSS software was used to assess the level of correlation between these two groups of language scores for the students of each university, for each academic year and semester and also the overall score for the three years.Results: Overall a positive and moderately significant correlation was found between the NUEE language scores and those of the CMBSE of the students of the universities studied (P<0/001; R=443%. The level of correlation for the various universities studied differed (Max. 69%, min.27%.A comparison of the means of these two groups of scores also confirmed this correlation.Conclusion: students’ grades The NUEE language score was not the only factor affecting the student’s CMBSE score

  2. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    Science.gov (United States)

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

  3. Molecular and clinical studies of X-linked deafness among Pakistani families.

    Science.gov (United States)

    Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

    2011-07-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

  4. Perception of self-medication among university students in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Mustafa S Saeed

    2014-01-01

    Full Text Available The aim of this study is to assess self-medication practice among university students in the Al-Qassim Province of Saudi Arabia. A cross-sectional community-based survey was conducted by distributing a self-administered 18-item questionnaire among university students in the Al-Qassim Province of Saudi Arabia in the period between October and December 2012. The participants were selected using a convenience sampling technique. Data were collected from the questionnaire and analyzed using SPSS version 19. A total of 354 male students with an average age of 21.95 (SD ± 3.43 participated in this study. Our study showed that self-medication among male students was high (86.6% compared to results shown in other studies in the same region. Headache (59.9%, cough/cold (41% and fever (24.6% were the most common symptoms associated with self-medication. Congruent with the medical conditions reported, the most widely used medications without prescriptions were paracetamol (34.7%, followed by antibiotics (31.4% and nonsteroidal anti-inflammatory drugs (28.7%. Our study shows that antibiotics were sometimes irrationally used for self-treatment of cough and fever. Self-medication was highly frequent among the students. Influence of TV advertisements, high accessibility of pharmacies and convenience stores, as well as good buying power were found to be leading factors for self-medication among male university students.

  5. Attitude, Knowledge and Skill of Medical Students Toward E-Learning Kerman University Of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Okhovati M

    2015-04-01

    Full Text Available  Aims: According to the development of e-learning and its high efficiency on the development of Iran’s universities, level of knowledge and the attitude of the students to this modern method of education and indeed students’ skills in using it needed to be assessed to improve the quality and quantity of universities’ education. This study aimed to determine the attitude, knowledge and skill of medical students toward e-learning at Kerman University of Medical Sciences.  Instrument & Methods: In this descriptive cross-sectional study that was performed in 2013, 196 students of Kerman University of Medical Sciences were selected using proportional stratified sampling method. The research instrument was a valid and reliable questionnaire. Data were analyzed using Pearson correlation coefficient, ANOVA and independent T tests by SPSS 19 software.  Findings: The level of knowledge and skill of the students toward e-learning was “moderate” and their attitude was “high”. There were significant relationships between knowledge and skill (p=0.001 r=0.82 and also knowledge and attitude (p=0.001 r=0.37 but there was no significant relationship between skill and attitude (p=0.35 r=0.82. The scores of knowledge and skill were significantly different according to sex, but attitude had no significant difference with sex.  Conclusion: Kerman University of Medical Sciences’ students have a positive attitude to e-learning but according to their moderate knowledge and skills, performing this method of learning is not welcomed in this university.

  6. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

    Science.gov (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

    2015-06-01

    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  7. Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

    Science.gov (United States)

    Uphoff, Eleonora P; Pickett, Kate E; Wright, John

    2016-10-01

    This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

  8. CURRENT STATUS OF RESEARCH PROJECT ACTIVITIES IN MEDICAL UNIVERSITIES IN BULGARIA.

    Directory of Open Access Journals (Sweden)

    Svetoslav Garov

    2013-07-01

    Full Text Available Introduction: In Bulgaria there are five medical universities: in the cities of Sofia, Plovdiv, Varna, Pleven and Stara Zagora. Their main mission is training specialists in the fields of medicine and health care, increasing their qualification by means of postgraduate education and performing research activities. One of medical universities’ top priorities is encouraging research activities mainly aimed at preparation and implementation of research projects. Aim: The purpose of our study is to examine the current status of research project activities in Bulgarian medical universities.Material and methods: In order to define the science competitions related to Bulgarian medical universities we have applied a documentary and sociological approach. Results: Research projects that Bulgarian medical universities can apply for are divided into two groups – national and international. The most significant international projects are European ones since Bulgaria is an EU member state and this allows us to participate in such projects. Conclusion: Universities should strive for establishing even better conditions for encouraging application for research projects aimed at developing competent and experienced staff, even though the majority of them may not obtain approval for financing.The changes in the situation regarding Bulgarian science require the implementation and development of more research staff motivated to improve their knowledge and skills in the relevant dynamically changing competition and project field.

  9. Modernizing and Transforming Medical Education at the Kilimanjaro Christian Medical University College

    Science.gov (United States)

    Lisasi, Esther; Kulanga, Ahaz; Muiruri, Charles; Killewo, Lucy; Fadhili, Ndimangwa; Mimano, Lucy; Kapanda, Gibson; Tibyampansha, Dativa; Ibrahim, Glory; Nyindo, Mramba; Mteta, Kien; Kessi, Egbert; Ntabaye, Moshi; Bartlett, John

    2014-01-01

    The Kilimanjaro Christian Medical University (KCMU) College and the Medical Education Partnership Initiative (MEPI) are addressing the crisis in Tanzanian health care manpower by modernizing the college’s medical education with new tools and techniques. With a $10 million MEPI grant and the participation of its partner, Duke University, KCMU is harnessing the power of information technology (IT) to upgrade tools for students and faculty. Initiatives in eLearning have included bringing fiber-optic connectivity to the campus, offering campus-wide wireless access, opening student and faculty computer laboratories, and providing computer tablets to all incoming medical students. Beyond IT, the college is also offering wet laboratory instruction for hands-on diagnostic skills, team-based learning, and clinical skills workshops. In addition, modern teaching tools and techniques address the challenges posed by increasing numbers of students. To provide incentives for instructors, a performance-based compensation plan and teaching awards have been established. Also for faculty, IT tools and training have been made available, and a medical education course management system is now being widely employed. Student and faculty responses have been favorable, and the rapid uptake of these interventions by students, faculty, and the college’s administration suggests that the KCMU College MEPI approach has addressed unmet needs. This enabling environment has transformed the culture of learning and teaching at KCMU College, where a path to sustainability is now being pursued. PMID:25072581

  10. Non-medical use of methylphenidate among medical students of the University of the Free State

    OpenAIRE

    Jain, Roshini; Chang, Chiech; Koto, Mpho; Geldenhuys, Alden; Nichol, Richard; Joubert, Gina

    2017-01-01

    Background: Faced with demanding training programmes, medical students may be more prone to use methylphenidate for non-medical purposes in order to improve concentration, alertness and academic performance. Aim: The study aimed to investigate the prevalence of the non-medical use of methylphenidate and knowledge of this drug among undergraduate medical students of the University of the Free State. Methods: This was a cross-sectional study. A self-administered, anonymous questionnaire...

  11. A proposed universal medical and public health definition of terrorism.

    Science.gov (United States)

    Arnold, Jeffrey L; Ortenwall, Per; Birnbaum, Marvin L; Sundnes, Knut Ole; Aggrawal, Anil; Anantharaman, V; Al Musleh, Abdul Wahab; Asai, Yasufumi; Burkle, Frederick M; Chung, Jae Myung; Cruz-Vega, Felipe; Debacker, Michel; Della Corte, Francesco; Delooz, Herman; Dickinson, Garth; Hodgetts, Timothy; Holliman, C James; MacFarlane, Campbell; Rodoplu, Ulkumen; Stok, Edita; Tsai, Ming-Che

    2003-01-01

    The lack of a universally applicable definition of terrorism has confounded the understanding of terrorism since the term was first coined in 18th Century France. Although a myriad of definitions of terrorism have been advanced over the years, virtually all of these definitions have been crisis-centered, frequently reflecting the political perspectives of those who seek to define it. In this article, we deconstruct these previously used definitions of terrorism in order to reconstruct a definition of terrorism that is consequence-centered, medically relevant, and universally harmonized. A universal medical and public health definition of terrorism will facilitate clinical and scientific research, education, and communication about terrorism-related events or disasters. We propose the following universal medical and public definition of terrorism: The intentional use of violence--real or threatened--against one or more non-combatants and/or those services essential for or protective of their health, resulting in adverse health effects in those immediately affected and their community, ranging from a loss of well-being or security to injury, illness, or death.

  12. Effect of a regimen of optimal medical therapy on brain natriuretic peptide (BNP) levels in heart failure in the Pakistani population

    International Nuclear Information System (INIS)

    Hussain, S.; Kayani, M.; Munir, R

    2012-01-01

    Objective: To document the effect of optimal medical therapy (OMT) on BNP levels in heart failure in Pakistani population. Methodology: In this Quasi experimental study, 75 consecutive stage C heart failure patients that had not been on OMT were included. These patients had been referred to AFIC-NIHD Heart Transplantation Department for assessment regarding heart transplantation. Initial assessments were carried out in hospital. Patients who were on OMT already were excluded. The prescription (carvedilol, lisinopril, spironolactone) was introduced as in patient as per pre defined protocol after clinical, imaging and lab evaluation. The patients were followed up in clinic and the dose escalation was done at regular intervals in out patients department. Clinical and lab variables were collected included BNP levels before starting treatment and 4 weeks after treatment. Results : Males were 75% and females were 25%. Mean age was 38.69 +- 12.98 years (range 18-70 years). Mean Ejection fraction was 23.9% (range 15 - 34%). At one month clinical status of all patients improved except one. The patients had improved from NYHA class-III to NYHA class-II of dyspnoea. The mean baseline BNP level was 1331 pg/ mL, and the BNP level 4 weeks after the OMT trial was 951.9 pg/mL. This reduction was statistically significant (p=0.016). Conclusion: OMT improves the BNP levels within a span of one month in patients with advanced systolic heart failure. This also correlated with the clinical improvement in the patients, and it was observed that BNP levels helped to monitor patients objectively and adjust OMT. (author)

  13. Prevalence of Burnout in Senior Medical Students of Kashan University of Medical Sciences in 2008

    Directory of Open Access Journals (Sweden)

    Ahmadvand A.

    2010-09-01

    Full Text Available Background and Objectives: Burnout is caused by high-stress jobs and could induce somatic, psychological disorders and negative attitude to professional actives so that this condition causes poor relationship with the patient. This study aimed at investigating burnout in senior medical students of Kashan University of Medical Sciences.Methods: This research was a cross sectional study carried out on all senior medical students (N=56 in 2008. Data were obtained by two questionnaires including demographic questionnaire and Maslach burnout Inventory. They were then analyzed using SPSS software and Chi square Test. Results: The findings showed that the majority of medical students (91.1% had burnout and only 8.9% of them had not burnout. Severe burnout was in 16% of students. There was not any significant relationship between burnout and sex, age, smoking, duration of education, interest in medical course and marital status P<0.05.Conclusion: The results of the study showed that burnout is common problem in senior medical students and need special consideration. Therefore medical students should be encouraged to seek help and adequate facilities by holding workshops of life-skill training and coping with stress. However, burnout should be paid special attention in medical students by counseling centers of University for prevention of consequences.

  14. Vision survey of the Nnamdi Azikiwe University medical students ...

    African Journals Online (AJOL)

    Aim: To determine the ocular problems of 1st‑year preclinical medical students at the Nnamdi Azikiwe University, Nnewi Campus, Nnewi, Nigeria. Materials and Methods: All registered 1st‑year preclinical medical students were examined in October 2008. Ocular investigation included filling out self‑administered ...

  15. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  16. Migraine among medical students in Kuwait University.

    Science.gov (United States)

    Al-Hashel, Jasem Y; Ahmed, Samar Farouk; Alroughani, Raed; Goadsby, Peter J

    2014-05-10

    Medical students routinely have triggers, notably stress and irregular sleep, which are typically associated with migraine. We hypothesized that they may be at higher risk to manifest migraine. We aimed to determine the prevalence of migraine among medical students in Kuwait University. This is cross-sectional, questionnaire-based study. Participants who had two or more headaches in the last 3 months were subjected to two preliminary questions and participants with at least one positive response were asked to perform the validated Identification of Migraine (ID Migraine™) test. Frequency of headache per month and its severity were also reported. Migraine headache was suggested in 27.9% subjects based on ID-Migraine™. Migraine prevalence (35.5% and 44%, versus 31.1%, 25%, 21.1%, 14.8%, 26.5%, p Kuwait University compared to other published studies. The migraine prevalence, frequency and headache severity, all increased in the final two years of education.

  17. POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

    Science.gov (United States)

    Rafique, Rafia; Anjum, Afifa

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  18. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

  19. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  20. Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

    Science.gov (United States)

    Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

    2013-01-01

    Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

  1. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia

    Directory of Open Access Journals (Sweden)

    Haque M

    2016-11-01

    Full Text Available Mainul Haque,1 Nor Azlina A Rahman,2 Md Anwarul Azim Majumder,3 Seraj Zohurul Haque,4 Zubair M Kamal,5 Zakirul Islam,6 ATM Emdadul Haque,7 Nor Iza A Rahman,8 Ahmed Ghazi Alattraqchi8 1Unit of Pharmacology, Faculty of Medicine and Defense Health, National Defense University of Malaysia, Kuala Lumpur, 2Department of Biomedical Science, Kulliyyah of Allied Health Sciences, Kuantan, Malaysia; 3Department of Clinical Sciences, School of Medical Sciences, Faculty of Life Sciences, University of Bradford, Bradford, 4School of Medicine, University of Dundee, Ninewells Hospital & Medical School, Dundee, UK; 5Sleep Research Unit, Toronto Western Hospital, University Health Network, Toronto, ON, Canada; 6Department of Pharmacology and Therapeutics, Eastern Medical College, Comilla, Bangladesh; 7Department of Medical Education, Universiti Kuala Lumpur Royal College of Medicine Perak (UniKL RCMP, Ipoh, 8Faculty of Medicine, Universiti Sultan Zainal Abidin, Kuala Terengganu, Malaysia Background: The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia.Methods: This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center

  2. Die Ärztliche Zentralbibliothek des Universitätsklinikums Hamburg-Eppendorf / The Medical Library of the University Medical Center Hamburg-Eppendorf

    Directory of Open Access Journals (Sweden)

    Kintzel, Melanie

    2009-12-01

    Full Text Available This article introduces the Medical Library of the University Medical Center Hamburg-Eppendorf. Firstly, history, role and status of the library within the University Medical Center are illustrated, followed by a description of the library’s facilities and services. Finally, recent projects are presented as well as a selection of key figures.

  3. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Hussain Akthar

    2006-07-01

    Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

  4. Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2016-01-01

    The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

  5. Understanding the Influence of the Pakistani Government in South Asia

    Science.gov (United States)

    2010-11-01

    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  6. Factors Affecting job satisfaction of employees in Pakistani banking sector

    OpenAIRE

    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

    2010-01-01

    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

  7. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  8. Attitude of University of Nigeria Medical Students to Community ...

    African Journals Online (AJOL)

    Aims: A study was carried out among 136 final year medical students of University of Nigeria Enugu Campus, to verify their attitude to Community Medicine as well as selection of the course for future specialization. Methods: The study was a cross sectional descriptive one involving all final year medical students of the ...

  9. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

    Science.gov (United States)

    Saghir, Sheeba; Hyland, Lynda

    2017-07-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

  10. Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

    Science.gov (United States)

    Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

    2011-08-01

    The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

  11. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  12. Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

    Directory of Open Access Journals (Sweden)

    Jaworek Thomas J

    2012-06-01

    Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

  13. Level of empathy among medical students in Kuwait University, Kuwait.

    Science.gov (United States)

    Hasan, S; Al-Sharqawi, N; Dashti, F; AbdulAziz, M; Abdullah, A; Shukkur, M; Bouhaimed, M; Thalib, L

    2013-01-01

    To evaluate the level of empathy among medical students in Kuwait University Medical School and its association with sociodemographic factors, stress levels and personality. A cross-sectional survey of 264 medical students was conducted in the Faculty of Medicine, Kuwait University. Empathy levels were measured using the Jefferson Scale, personality was assessed using the Zuckerman-Kuhlman Personality Scale and the Perceived Stress Scale was used to measure stress levels. Factors associated with empathy were evaluated using t test/ANOVA for categorical variables and correlation for continuous predictors. Mean empathy score was 104.6 ± 16.3. Empathy scores were significantly associated with gender, year of study, mother's level of education, household income, satisfactory relationship with the mother and stress levels. Male medical students in their clinical years also had significantly lower empathy levels. However, factors such as grade point average, desired specialty, marital status of parents, father's educational level and relationship with father were not significantly (p > 0.05) associated with levels of empathy. Stress scores were significantly and positively associated with empathy (r = 0.13; p = 0.041). Medical students in Kuwait University had low empathy level and this may be a cause for concern; as such we suggest a possible inclusion of emphasis on empathy in the curriculum. Copyright © 2013 S. Karger AG, Basel.

  14. Structured Peer Mentoring: Enhancing Lifelong Learning in Pakistani Universities

    Science.gov (United States)

    Naseem, Nosheen Rachel

    2012-01-01

    Higher Education in developing countries is frequently restricted to students from privileged backgrounds, especially those from private secondary education. In Pakistan, access to Higher Education, while competitive, is more broadly based, with state universities particularly recruiting students from diverse backgrounds. Just as Widening…

  15. Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

    Directory of Open Access Journals (Sweden)

    Syed Muhammad Aamir Shah

    2012-09-01

    Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

  16. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  17. Prevalence of Burnout in Senior Medical Students of Kashan University of Medical Sciences in 2008

    Directory of Open Access Journals (Sweden)

    G Akkasheh

    2012-05-01

    Full Text Available

    Background and Objectives: Burnout is caused by high-stress jobs and could induce somatic, psychological disorders and negative attitude to professional actives so that this condition causes poor relationship with  the patient. This study aimed at investigating burnout in senior medical students of Kashan University of Medical Sciences. Methods: This research was a cross sectional study carried out on all senior medical students (N=56 in 2008. Data were obtained by two questionnaires including demographic questionnaire and Maslach burnout Inventory. They were then analyzed using SPSS software and Chi square Test. Results: The findings showed that the majority of medical students (91.1% had burnout and only 8.9% of them had not burnout. Severe burnout was in 16% of students. There was not any significant relationship between burnout and sex, age, smoking, duration of education, interest in medical course and marital status P<0.05. Conclusion: The results of the study showed that burnout is common problem in senior medical students and need special consideration. Therefore medical students  should be encouraged to seek help and adequate facilities by holding workshops of life-skill training and coping with stress. However, burnout should be paid special attention in medical students by counseling centers of University for prevention of consequences.

     

  18. Pattern of Medical Admissions at Enugu State University of Science ...

    African Journals Online (AJOL)

    Technology Teaching Hospital, Parklane, Enugu, 2Department of Community Medicine, University of Nigeria Teaching. Hospital, Ituku/Ozalla ... A review of medical admissions into the Enugu State University of Science and Technology. Teaching .... Cord lesions, rabies, Guilliane Barré syndrome, motor neuron disease and ...

  19. Perspective for Female Medical Physicists

    International Nuclear Information System (INIS)

    Naqvi, Syed Mansoor; Hasnain, Aziz Fatima

    2009-01-01

    Due to cultural and religious reasons, Pakistani women can be reluctant to seek medical attention for disorders affecting their genitals or breasts. As a result, in the case of cervical and breast cancers, oncological treatment is often not received until the diseases are in the late stages. Once a cancer is classified and the tumor marked, the role of the medical physicist begins. Medical physicists' responsibilities include treatment planning, supervising treatment through radiation, dosimetry, contouring, training, equipment selection, education, research, and supervising radiotherapy facilities. In brachytherapy, isotopes are placed at the tumor site in the form of wires or seeds. There are very few female medical physicists in Pakistan. This leads to further hesitation on the part of many women to seek treatment. To help female patients obtain needed medical care, female physics students should be encouraged to pursue the emerging field of medical physics. This would provide a new professional opportunity for female physics students and give comfort to female patients.

  20. Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

    Science.gov (United States)

    Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

    2018-02-02

    Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

  1. Students of Tehran Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ghezelbash Sima

    2015-07-01

    Full Text Available Introduction: Social anxiety is an important factor in peoples’ mental health. Good mental health while studying in university makes students able to deal effectively with numerous stressors that they experience. The purpose of this study was to determine and compare the social anxiety of nursing students in grades one to four of medical universities in Tehran. Methods: In this analytic cross-sectional study, 400 students from universities of medical sciences in Tehran were recruited by stratified sampling with proportional allocation. Data were collected during the first semester in 2010. Students completed a two-part questionnaire including the Liebowitz social anxiety questionnaire and a demographic information form. Data were analyzed using descriptive statistics methods and an analytical test by SPSS statistical software. Results: There was no statistically significant difference in the total scores of social anxiety of first- to fourth-year students. The mean score of the avoidance of social interaction dimension in fourth-year students was significantly lower than in first year students (p<0.05. Conclusion: In regard to the relationship between social anxiety and interpersonal communication as an associated part of nursing care, decrease of social anxiety of students could play an important role in their mental health. According to the results of this study, it seems that the placement of students in the nursing education system does not produce any changes in their social anxiety.

  2. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

    2013-01-01

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  3. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

    2013-11-29

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  4. The Increasing Trend in Global Ranking of Websites of Iranian Medical Universities during January 2012-2015.

    Science.gov (United States)

    Ramezan Ghorbani, Nahid; Fakour, Yousef; Nojoumi, Seyed Ali

    2017-08-01

    Researchers and academic institutions need assessment and rating to measure their performance. The criteria are designed to evaluate quality and adequacy of research and welcome by most universities as an international process to increase monitoring academic achievements. The study aimed to evaluate the increasing trend in global ranking of Iranian medical universities websites emphasizing on comparative approach. This is a cross-sectional study involving websites of Iranian medical universities. Sampling was conducted by census selecting universities affiliated to the Ministry of Health in webometrics rating system. Web sites of Iranian medical universities were investigated based on the webometrics indicators, global ranking as well as the process of changing their rating. Universities of medical sciences were associated with improved ratings in seven periods from Jan 2012 until Jan 2015. The highest rank was in Jan 2014. Tehran University of Medical Sciences ranked the first in all periods. The highest ratings were about impact factor in universities of medical sciences reflecting the low level of this index in university websites. The least ranking was observed in type 1 universities. Despite the criticisms and weaknesses of these webometrics criteria, they are critical to this equation and should be checked for authenticity and suitability of goals. Therefore, localizing these criteria by the advantages model, ranking systems features, continuous development and medical universities evaluation based on these indicators provide new opportunities for the development of the country especially through online media.

  5. Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

    Directory of Open Access Journals (Sweden)

    Muhammad Arif Soomro

    2016-08-01

    Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

  6. Implementation of an OSCE at Kaohsiung Medical University

    Directory of Open Access Journals (Sweden)

    Yu-Sheng Huang

    2007-04-01

    Full Text Available The Objective Structured Clinical Examination (OSCE, a tool to objectively and fairly assess medical students' clinical competences, has become widely used in medical education worldwide. However, most medical schools in Taiwan have just begun to adopt this assessment method. In 2003, Kaohsiung Medical University (KMU established the first standardized patient (SP program in Taiwan and applied SPs with an OSCE. This study reports the process of the implementation of an OSCE at KMU, which includes collecting information, visiting leading clinical skills centers, consulting medical educators from other countries, holding international conferences, establishing an OSCE committee, writing cases, training SPs, administrating the OSCE, and receiving feedback from medical students. Most students were satisfied with the assessment and appreciated the learning experience. Based on the experience in 2003, the OSCE committee decided to incorporate the OSCE into the medical curriculum as a measure to assess medical students' clinical competences. In addition to assessing medical students' clinical competence, the OSCE can also be applied to other professional health education, such as dentistry, nursing, and pharmacy. We are currently sharing our experience with other colleges at KMU.

  7. Content and technical evaluation of Type III Iranian medical universities\\' websites

    Directory of Open Access Journals (Sweden)

    Khadejeh Shabankareh

    2016-05-01

    Full Text Available Background: Besides the role that universities websites have in reflection of universities’ educational and research activities, they have also significant importance in promotion of universities’ national and international ranking in webometrics ranking of world universities and also in webometric ranking of Islamic world Science Citation and subsequently obtaining national and international credibility and gaining student and funding. So, continuous evaluation of universities websites in different aspects, especially based on considering index of these ranking systems, is important. Therefore, present study aimed to review the situation of Type 3 Iranian medical universities’ websites based on content and technical features effecting on promotion of webometric rank. Materials and Methods : Present study is a survey with descriptive approach which descriptive the present situation of Type 3 Iranian medical universities’ websites. Data were collected using a researcher-made checklist which was consisted of two parts including content criteria effecting on webometric ranking (50 criteria and technical criteria of search engines optimization (52 criteria. Content evaluation of websites was done by researcher direct referring and observing. In order to evaluation of these websites, based on technical criteria of search engines optimization, automatic tools about website evaluation were used. Data were analyzed by SPSS20. Results: The finding of this study showed that, Gonabad, Bushehr & Shahrekord universities of medical sciences have the most accommodation with the research checklist.  Bam, Dezful & Jiroft universities of medical sciences have the least accommodation. According to research findings less than 50 percent of the research community, reached more than 50 percent of the criteria in checklist. Conclusion: Evaluation of studied websites indicated that whole websites are far from ideal situation. So type 3 medical universities

  8. Does Religiosity Reduce Narcissistic Personality Disorder? Examining the Case of Muslim University Students.

    Science.gov (United States)

    Buzdar, Muhammad Ayub; Tariq, Riaz Ul Haq; Jalal, Hina; Nadeem, Mohammad

    2018-04-24

    The purpose of this study was to examine the influences of religiousness on the prevalence of Narcissistic Personality Disorder (NPD) among young adults. Prevalence of three forms of Allportian religious orientation, three forms of quest religious orientation and seven symptoms of NPD were examined through self-reported measures. 618 randomly selected Muslim students from the four public sector Pakistani universities participated in the study. Three research instruments comprising Religious Orientation Scale developed by Gorsuch and McPherson, Quest Scale developed by Batson and Schoenrade and Narcissistic Personality Inventory developed by Raskin and Terry were used to collect the data. All subscales demonstrated more than .70 Cronbach Alpha Coefficients. The findings demonstrate comparatively higher presence of intrinsic, extrinsic personal and extrinsic social religious orientations among the Pakistani Muslim young adults. The presence of NPD symptoms remains higher among the participants too. The study concludes that the religious orientations significantly explain the variances in the prevalence of NPD symptoms among the Muslim university students with the direct effects of intrinsic and extrinsic personal religious orientations and indirect effects of quest religious orientations.

  9. Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

    Directory of Open Access Journals (Sweden)

    Barton Pelham M

    2011-06-01

    Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

  10. Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

    Science.gov (United States)

    Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

    2015-01-01

    The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

  11. Medical Universities Educational and Research Online Services: Benchmarking Universities’ Website Towards E-Government

    Science.gov (United States)

    Farzandipour, Mehrdad; Meidani, Zahra

    2014-01-01

    Background: Websites as one of the initial steps towards an e-government adoption do facilitate delivery of online and customer-oriented services. In this study we intended to investigate the role of the websites of medical universities in providing educational and research services following the E-government maturity model in the Iranian universities. Methods: This descriptive and cross- sectional study was conducted through content analysis and benchmarking the websites in 2012. The research population included the entire medical university website (37). Delivery of educational and research services through these university websites including information, interaction, transaction, and Integration were investigated using a checklist. The data were then analyzed by means of descriptive statistics and using SPSS software. Results: Level of educational and research services by websites of the medical universities type I and II was evaluated medium as 1.99 and 1.89, respectively. All the universities gained a mean score of 1 out of 3 in terms of integration of educational and research services. Conclusions: Results of the study indicated that Iranian universities have passed information and interaction stages, but they have not made much progress in transaction and integration stages. Failure to adapt to e-government in Iranian medical universities in which limiting factors such as users’ e-literacy, access to the internet and ICT infrastructure are not so crucial as in other organizations, suggest that e-government realization goes beyond technical challenges. PMID:25132713

  12. Relationship between Eating Disorders, Stress and Depression in Medical Students of Lorestan University of Medical Sciences & Health Services

    OpenAIRE

    Afarin Ahmadian

    2016-01-01

    Background & Aim: Nowadays eating disorders are considered as one of the main psychological disorders. These types of disorder result in physical and mental health problems and affect the individuals’ quality of life. This study has aimed to survey eating disorders and its relation with depression and stress in medical students of Lorestan University of Medical Sciences. Methodology: In a descriptive study, 340 university students were chosen by the use of simple random sampling and als...

  13. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

    Science.gov (United States)

    Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

    2016-12-09

    There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  14. [Medical manuscripts in the library of the Deontology Department of the Ankara University Medical School].

    Science.gov (United States)

    Arda, B

    1998-01-01

    At every academical platform on medical history and its instruction, lack of Turkish medical historiography is mainly emphasized. There are two main factors determining the situation: 1-There isn't any comprehensive Turkish medical history textbook. 2-There are difficulties in reaching the primary sources in this field. Everybody agrees with the importance of reaching medical manuscripts easily and reading and evaluating them in medical history. For this reason, it is important to know where we can find them. In this article, medical manuscripts which are available in the library of the Deontology Department of Ankara University Medical School are introduced. The manuscripts have been listed in alphabetical order of the authors' name. The bibliographic items, such as the size, writing style, and type of paper used, are mentioned.

  15. Investigating the Medical Study of Overseas Students at Jinan University Medical School

    Science.gov (United States)

    Zhang, Ming-ya; Wang, Guang; Cheng, Xin; Yang, Xuesong

    2017-01-01

    A great number of overseas students have studied medicine at Jinan University Medical School over the past decade. Statistics from the past ten years show that these students' test scores on diagnosis and medicine I & II are lower than those of their classmates from mainland China. To address the underlying causes of this phenomenon, we…

  16. Nutrition in medical education: reflections from an initiative at the University of Cambridge

    Directory of Open Access Journals (Sweden)

    Ball L

    2014-05-01

    Full Text Available Lauren Ball,1 Jennifer Crowley,2 Celia Laur,3 Minha Rajput-Ray,3 Stephen Gillam,4 Sumantra Ray3 1Nutrition and Dietetics, School of Allied Health Sciences, Centre for Health Practice Innovation, Griffith University, Queensland, Brisbane, Australia; 2Faculty of Medical and Health Sciences, University of Auckland, Auckland, New Zealand; 3Need for Nutrition Education/Innovation Programme, Medical Research Council Human Nutrition Research, Cambridge, UK; 4Department of Public Health and Primary Care, Institute of Public Health, University of Cambridge, Cambridge, UK Abstract: Landmark reports have confirmed that it is within the core responsibilities of doctors to address nutrition in patient care. There are ongoing concerns that doctors receive insufficient nutrition education during medical training. This paper provides an overview of a medical nutrition education initiative at the University of Cambridge, School of Clinical Medicine, including 1 the approach to medical nutrition education, 2 evaluation of the medical nutrition education initiative, and 3 areas identified for future improvement. The initiative utilizes a vertical, spiral approach during the clinically focused years of the Cambridge undergraduate and graduate medical degrees. It is facilitated by the Nutrition Education Review Group, a group associated with the UK Need for Nutrition Education/Innovation Programme, and informed by the experiences of their previous nutrition education interventions. Three factors were identified as contributing to the success of the nutrition education initiative including the leadership and advocacy skills of the nutrition academic team, the variety of teaching modes, and the multidisciplinary approach to teaching. Opportunities for continuing improvement to the medical nutrition education initiative included a review of evaluation tools, inclusion of nutrition in assessment items, and further alignment of the Cambridge curriculum with the

  17. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

    OpenAIRE

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-01-01

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  18. Financial Resources Allocation of Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Esmaeil Afiyan

    2015-08-01

    Full Text Available ​ Background and Objectives : According to complexity of resource allocation, issue about how to allocate health care resources in an accurate and fair manner has become the subject of discussions and decisions of related groups. Therefore, in this research we aim to study the methods of financial resource allocation of Tabriz University of Medical Sciences in order to identify its strengths and weaknesses for its promotion. Material and Methods : This study is a descriptive, qualitative sectional research and all comments have been collected by focus group discussions with experts and managers involved in the allocation of financial resources of Tabriz University of Medical Sciences. All factors affecting the process of allocation have been reviewd carefully. Results : Results suggested that except the health sector, none of the other sectors use the formulated  and scientific methods for allocating financial resources and despite the emphasize in the 4th development plan for operating funding, the final cost of the services, has no role in allocating financial resources. Conclusion : Regarding to judgmental and subjective method of financial resources allocation of Tabriz University of Medical Sciences and lack of documented and formulated methods, there is an essential need for developing an appropriate and formulated model for scientific allocation of financial resources in order to improve the efficiency and fairness of the allocation.

  19. Ego defense mechanisms in Pakistani medical students: a cross sectional analysis

    Directory of Open Access Journals (Sweden)

    Khalid Roha

    2010-01-01

    Full Text Available Abstract Background Ego defense mechanisms (or factors, defined by Freud as unconscious resources used by the ego to reduce conflict between the id and superego, are a reflection of how an individual deals with conflict and stress. This study assesses the prevalence of various ego defense mechanisms employed by medical students of Karachi, which is a group with higher stress levels than the general population. Methods A questionnaire based cross-sectional study was conducted on 682 students from five major medical colleges of Karachi over 4 weeks in November 2006. Ego defense mechanisms were assessed using the Defense Style Questionnaire (DSQ-40 individually and as grouped under Mature, Immature, and Neurotic factors. Results Lower mean scores of Immature defense mechanisms (4.78 were identified than those for Neurotic (5.62 and Mature (5.60 mechanisms among medical students of Karachi. Immature mechanisms were more commonly employed by males whereas females employed more Neurotic mechanisms than males. Neurotic and Immature defenses were significantly more prevalent in first and second year students. Mature mechanisms were significantly higher in students enrolled in Government colleges than Private institutions (p Conclusions Immature defense mechanisms were less commonly employed than Neurotic and Mature mechanisms among medical students of Karachi. The greater employment of Neurotic defenses may reflect greater stress levels than the general population. Employment of these mechanisms was associated with female gender, enrollment in a private medical college, and students enrolled in the first 2 years of medical school.

  20. Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

    Directory of Open Access Journals (Sweden)

    Barton Pelham

    2011-08-01

    Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

  1. ON EXPERIENCE OF THE COLLABORATION AND PROJECT MANAGEMENT INFORMATION SYSTEM PODIO IMPLEMENTATION IN THE MEDICAL UNIVERSITY

    Directory of Open Access Journals (Sweden)

    Andrii V. Semenets

    2014-12-01

    Full Text Available The Information Technologies role in the medical university management is analyzed. The importance of the application of the electronic document management in the medical universities is shown. The implementation capabilities of the electronic document management system within a cloud services are shown. A Podio collaboration and project management cloud service features overview is presented. The methodology of the Podio capabilities usage to the medical university task management solving is developed. An approaches to the Podio Workspaces and Applications development for the faculties collaboration and project management in the departments of the medical universities are presented. The examples of the Podio features usage to the work-flow automation of the information-analytical and hardware and software support departments of the Ternopil State Medical University named after I. Ja. Horbachevsky are shown.

  2. Exploring Jahrom Medical University students' attitudes towards the ...

    African Journals Online (AJOL)

    Introduction: Self- evaluation is the process of designing, building and maintaining human behaviors that can lead to maturity and perfection. Therefore, the aim of this study is to examine Jahrom Medical University students' attitudes towards the Islamic self-assessment in 2015. Method: This cross-sectional and descriptive ...

  3. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.

    1992-10-01

    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  4. Factor Analysis of Teacher Professional Development in Chinese Military Medical Universities

    Science.gov (United States)

    Yue, Juan-Juan; Chen, Gang; Wang, Zhen-Wei; Liu, Wei-Dong

    2017-01-01

    Background and purpose: Teacher professional development potentially enhances teachers' professional morale, knowledge, skills and autonomy, which helps improve the quality of education. The military medical university is an important medical education institution in China; however, studies of teacher professional development within military…

  5. Medical humanities and philosophy: is the universe expanding or contracting?

    Science.gov (United States)

    Stempsey, William E

    2007-12-01

    The question of whether the universe is expanding or contracting serves as a model for current questions facing the medical humanities. The medical humanities might aptly be described as a metamedical multiverse encompassing many separate universes of discourse, the most prominent of which is probably bioethics. Bioethics, however, is increasingly developing into a new interdisciplinary discipline, and threatens to engulf the other medical humanities, robbing them of their own distinctive contributions to metamedicine. The philosophy of medicine considered as a distinct field of study has suffered as a result. Indeed, consensus on whether the philosophy of medicine even constitutes a legitimate field of study is lacking. This paper presents an argument for the importance of a broad conception of the philosophy of medicine and the central role it should play in organizing and interpreting the various fields of study that make up the metamedical multiverse.

  6. Information Classification on University Websites

    DEFF Research Database (Denmark)

    Nawaz, Ather; Clemmensen, Torkil; Hertzum, Morten

    2011-01-01

    Websites are increasingly used as a medium for providing information to university students. The quality of a university website depends on how well the students’ information classification fits with the structure of the information on the website. This paper investigates the information classifi......Websites are increasingly used as a medium for providing information to university students. The quality of a university website depends on how well the students’ information classification fits with the structure of the information on the website. This paper investigates the information...... classification of 14 Danish and 14 Pakistani students and compares it with the information classification of their university website. Brainstorming, card sorting, and task exploration activities were used to discover similarities and differences in the participating students’ classification of website...... information and their ability to navigate the websites. The results of the study indicate group differences in user classification and related taskperformance differences. The main implications of the study are that (a) the edit distance appears a useful measure in cross-country HCI research and practice...

  7. Information Classification on University Websites

    DEFF Research Database (Denmark)

    Nawaz, Ather; Clemmensen, Torkil; Hertzum, Morten

    2011-01-01

    Websites are increasingly used as a medium for providing information to university students. The quality of a university website depends on how well the students’ information classification fits with the structure of the information on the website. This paper investigates the information classifi......Websites are increasingly used as a medium for providing information to university students. The quality of a university website depends on how well the students’ information classification fits with the structure of the information on the website. This paper investigates the information...... classification of 14 Danish and 14 Pakistani students and compares it with the information classification of their university website. Brainstorming, card sorting, and task exploration activities were used to discover similarities and differences in the participating students’ classification of website...... information and their ability to navigate the websites. The results of the study indicate group differences in user classification and related task-performance differences. The main implications of the study are that (a) the edit distance appears a useful measure in cross-country HCI research and practice...

  8. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

    Directory of Open Access Journals (Sweden)

    Atta Abbas Naqvi

    2016-12-01

    Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  9. Frequency of different disorders requiring warfarin therapy and its outcome in terms of dosage and inr value in pakistani population

    International Nuclear Information System (INIS)

    Qayyum, A.; Najmi, M.H.

    2014-01-01

    To determine the frequency of different disorders requiring warfarin therapy and to see the target INR and warfarin dose requirement in Pakistani population. Study Design:Descriptive study. Setting and Duration of Study: The study was carried out at Armed Forces Institut e of Cardiology (AFIC) Rawalpindi, Military Hospital Rawalpindi and National Institute of Cardiovascular Diseases (NICVD), Karachi, Pakistan from October 2010 to March 2012. Patients and Methods: Stable patients taking warfarin therapy were recruited after detailed medical history, physical examination and laboratory tests. The demographic and clinical data of individuals were entered in a pre-structured proforma. Patients suffering from hepatic and renal disease, any co-morbid disease or taking any concurrent medication or diet which would have affected warfarin therapy, were excluded. Data was analyzed using PSS version 20.0. Results: A total of 607 stable patients fulfilling the eligibility criteria, participated in the study. There were 297 (48.9%) male and 310 (51.1%) female patients. The mean age was 37.93 +- 12.23 years (range 18-65 years). The most common indication for warfarin therapy was valvular heart diseases (93.4%) followed by atrial fibrillation (2.3%) whereas other indications for warfarin use are less commonly seen in our study population. Patients had mean international normalized ratio (INR) value of 2.3 +9- 0.8 (range 1.5-3.5). Mean daily dose of warfarin calculated in 607 patients was 5.62 and 1.98 mg with the range of 0.36-15 g whereas mean weekly dose was 39.36 +- 13.8 mg with the range of 2.5-105 mg. Conclusion: In Pakistani population the most common indications for warfarin use are valvular heart diseases followed by atrial fibrillation. The mean INR values were within recommended range of 2-3. The mean daily dose observed in long-term therapy is comparable to the empirical dose of 5 mg routinely started in clinical practice. (author)

  10. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2012-12-01

    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  11. Mental health status among Japanese medical students: a cross-sectional survey of 20 universities.

    Science.gov (United States)

    Ohtsu, Tadahiro; Kaneita, Yoshitaka; Osaki, Yoneatsu; Kokaze, Akatsuki; Ochiai, Hirotaka; Shirasawa, Takako; Nanri, Hinako; Ohida, Takashi

    2014-12-01

    The purposes of this study were to evaluate the mental health status of Japanese medical students and to examine differences based on gender, as well as on university type and location, using the results of a nationwide survey. Between December 2006 and March 2007, we conducted a questionnaire survey among fourth-year medical students at 20 randomly selected medical schools in Japan. The data from 1,619 students (response rate: 90.6%; male: 1,074; female: 545) were analyzed. We used the Japanese version of the 12-item General Health Questionnaire (GHQ-12) to measure mental health status. Poor mental health status (GHQ-12 score of 4 points or higher) was observed in 36.6% and 48.8% of the male and female medical students, respectively. The ratio of the age-adjusted prevalence of poor mental health status in female versus male medical students was 1.33 (95% confidence interval: 1.10-1.62). The universities were categorized into two groups based on the university type (national/public: 15 vs. private: 5) or location (in a large city: 7 vs. in a local city: 13 cities). The prevalence of poor mental health status in both men and women differed between these groups, although not significantly. The GHQ-12 scores in men significantly differed between the categorized groups of universities. These results suggest that adequate attention must be paid to the mental health of medical students, especially females, and that a system for providing mental health care for medical students must be established in the context of actual conditions at each university.

  12. The analysis of the medical university students’ health condition and lifestyle

    Directory of Open Access Journals (Sweden)

    OLGA KHURS

    2017-01-01

    Full Text Available Introduction: Significant psychophysiological burdens and unhealthy lifestyle constitute the risk factors leading to students’ health deterioration. Purpose: The purpose of the research was the analysis of students’ health condition and lifestyle in medical university. Material and methods: The objects of the research were 100 third year students of the Faculties of General Medicine and Pediatrics of Grodno State Medical University. For the study of students’ orientation on healthy lifestyle, a special scale-type questionnaire was developed and used. Results: According to the respondents’ opinions it has been detected that the basic factors influencing the state of health are the lifestyle and the living conditions. The students activity is evaluated as very low as well as their rational nutrition. The majority of them smoke and drink alcohol. Conclusions: The peculiarities of studying at a medical university accompanied by imbalanced nutrition might lead to the deterioration of health in the students which are doctors to be. The results ought to lead to the optimization of prophylaxis programs and entire alteration of the students’ lifestyles.

  13. Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

    Science.gov (United States)

    Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

    2015-01-01

    Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

  14. Self-medication practices with antibiotics among Chinese university students.

    Science.gov (United States)

    Zhu, X; Pan, H; Yang, Z; Cui, B; Zhang, D; Ba-Thein, W

    2016-01-01

    Self-medication with antibiotics (SMA) is a serious global health problem. We sought to investigate SMA behaviors and risk factors among Chinese university students, and further explore the association between SMA practices and adverse drug events (ADEs). Cross-sectional study. An online survey was conducted at Jiangsu University (JSU) in eastern China in July 2011 using a pretested questionnaire. Out of 2608 website visitors, 1086 participated in the survey (response rate: 41.6%), 426 respondents were excluded for not being a JSU student or repeat participation, 660 (2.2% of JSU students) were included in analysis, and 316 students (47.9%) had a lifetime history of SMA. Among self-treated students, 43.5% believed that antibiotic was suitable for viral infections, 65.9% had more than one SMA episode in the previous year, 73.5% self-medicated with at least two different antibiotics, 57.1% and 64.4% changed antibiotic dosage and antibiotics during the course, respectively. Female gender, older age, and prior knowledge of antibiotics (PKA) were identified as independent risk factors of SMA. There was no difference between students with and without PKA regarding SMA frequency, use of polyantibiotics, and switching antibiotic dosage or antibiotics. ADEs happened to 13.3% of self-medicated students. Frequent change of dosage and simultaneous use of the same antibiotic with different names were independent risk practices associated with an ADE. Our findings substantiate high SMA prevalence among Chinese university students. Older age and PKA are independent SMA risk factors common to Chinese university students and female gender is exclusive SMA risk factor for JSU students. Poor SMA practices are associated with ADEs. Strict regulations on antibiotic sales and public education reinforced by further health care reform are recommended. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Medication therapy management clinic: perception of healthcare professionals in a University medical center setting

    Directory of Open Access Journals (Sweden)

    Shah M

    2013-09-01

    Full Text Available Objective: To determine the overall perception and utilization of the pharmacist managed medication therapy management (MTM clinic services, by healthcare professionals in a large, urban, university medical care setting.Methods: This was a cross-sectional, anonymous survey sent to 195 healthcare professionals, including physicians, nurses, and pharmacists at The University of Illinois Outpatient Care Center to determine their perception and utilization of the MTM clinic. The survey consisted of 12 questions and was delivered through a secure online application. Results: Sixty-two healthcare professionals (32% completed the survey. 82% were familiar with the MTM clinic, and 63% had referred patients to the clinic. Medication adherence and disease state management was the most common reason for referral. Lack of knowledge on the appropriate referral procedure was the prominent reason for not referring patients to the MTM clinic. Of the providers that were aware of MTM services, 44% rated care as ‘excellent’, 44% as ‘good’, 5% as ‘fair’, and 0% stated ‘poor’. Strengths of MTM clinic identified by healthcare providers included in-depth education to patients, close follow-up, and detailed medication reconciliation provided by MTM clinic pharmacists. Of those familiar with MTM clinic, recommendations included; increase marketing efforts to raise awareness of the MTM clinic service, create collaborative practice agreements between MTM pharmacists and physicians, and ensure that progress notes are more concise.Conclusion: In a large, urban, academic institution MTM clinic is perceived as a valuable resource to optimize patient care by providing patients with in-depth education as it relates to their prescribed medications and disease states. These identified benefits of MTM clinic lead to frequent patient referrals specifically for aid with medication adherence and disease state management.

  16. Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

    Science.gov (United States)

    Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

    2015-01-01

    Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

  17. Effect of Professional Ethics on Reducing Medical Errors from the Viewpoint of Faculty Members in Medical School of Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Fatemeh Donboli Miandoab

    2017-12-01

    Full Text Available Background: Professionalism and adherence to ethics and professional standards are among the most important topics in medical ethics that can play a role in reducing medical errors. This paper examines and evaluates the effect of professional ethics on reducing medical errors from the viewpoint of faculty members in the medical school of the Tabriz University of Medical Sciences. Methods: in this cross-sectional descriptive study, faculty members of the Tabriz University of Medical Sciences were the statistical population from whom 105 participants were randomly selected through simple random sampling. A questionnaire was used, to examine and compare the self-assessed opinions of faculty members in the internal, surgical, pediatric, gynecological, and psychiatric departments. The questionnaires were completed by a self-assessment method and the collected data was analyzed using SPSS 21. Results: Based on physicians’ opinions, professional ethical considerations and its three domains and aspects have a significant role in reducing medical errors and crimes. The mean scores (standard deviations of the managerial, knowledge and communication skills and environmental variables were respectively 46.7 (5.64, 64.6 (8.14 and 16.2 (2.97 from the physicians’ viewpoints. The significant factors with highest scores on the reduction of medical errors and crimes in all three domains were as follows: in the managerial skills variable, trust, physician’s sense of responsibility against the patient and his/her respect for patients’ rights; in the knowledge and communication skills domain, general competence and eligibility as a physician and examination and diagnosis skills; and, last, in the environmental domain, the sufficiency of trainings in ethical issues during education and their satisfaction with basic needs. Conclusion: Based on the findings of this research, attention to the improvement of communication, management and environment skills should

  18. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq

    2012-03-01

    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  19. Sleep pattern of medical students as seen in a Nigerian university ...

    African Journals Online (AJOL)

    Sleep pattern of medical students as seen in a Nigerian university. ... we used a modified self-administered questionnaire adapted from Pittsburg Sleep Quality Index to determine the sleep pattern of students in College of Health Sciences, University of Ilorin, Nigeria. ... Gender had significant influence on their sleep habit.

  20. To determine the level of satisfaction among medical students of a public sector medical university regarding their academic activities

    Directory of Open Access Journals (Sweden)

    Manzar Bushra

    2011-10-01

    Full Text Available Abstract Background An ongoing evaluation system is essential to determine if the academic system in place has worked to produce a better product, hence the objective of our study was to evaluate the satisfaction level among medical students regarding their academic teaching and assessment method and what measures will they suggest for the future to rectify the current situation. This questionnaire based cross sectional study was conducted in a public sector medical university from February to July 2010. A well structured questionnaire was administered to a random sample of 375 final year medical students. However 292 of the students provided informed consent and filled in the questionnaire which included their demographic profile as well as questions in line with the study objective. Data was entered in a Statistical Package for Social Sciences (SPSS version.16 and analyzed using descriptive statistics. Findings The male to female ratio in our study was 1:2. Most of the students (57.2% were dissatisfied with the quality of teaching in the university. Fifty-seven percent of the participants believed that the current standard of their institute were not at par with those of international medical universities. BCQ's were the mode of examination questions preferred by the majority of the students. Most of the students (66.1% wanted the university to conduct career planning seminars to help them plan their career. Conclusions These results suggest that the students of public sector medical universities are unsatisfied from current academic facilities and teaching activities. Students recommend increased emphasis on better lectures and practical training as well as a need to incorporate career planning sessions for the students to help plan them their future career paths.

  1. Integration of Educational and Research Activities of Medical Students (Experience of the Medical Faculty of Saint Petersburg State University).

    Science.gov (United States)

    Balakhonov, Aleksei V; Churilov, Leonid P; Erman, Mikhail V; Shishkin, Aleksandr N; Slepykh, Lyudmila A; Stroev, Yuri I; Utekhin, Vladimir J; Basantsova, Natalia Y

    2017-12-01

    The article is devoted to the role of research activity of the medical students in higher education of physicians. The teaching of physicians in classical universities and specialized medical schools is compared. The history of physicians' training in Russia in imperial, Soviet and post-Soviet periods is reviewed and compared to development of higher medical education in other countries. Article gives the the description of all failed attempts to establish a Medical Faculty within oldest classical university of Russia, crowned by history of last and successful attempt of its establishment. Authors' experience of adjoining education and research in curriculum and extra-curricular life of this Medical Faculty is discussed. The problems of specialization and fundamentalization of medical education are subjected to analysis. Clinical reasoning and reasoning of scholar-experimentalist are compared. The article reviews the role of term and course papers and significance of self-studies and graduation thesis in education of a physician. The paper gives original definition of interactive learning, and discusses the methods and pathways of intermingling the fundamental science and clinical medicine in medical teaching for achievement of admixed competencies of medical doctor and biomedical researcher.

  2. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia

    Science.gov (United States)

    Haque, Mainul; Rahman, Nor Azlina A; Majumder, Md Anwarul Azim; Haque, Seraj Zohurul; Kamal, Zubair M; Islam, Zakirul; Haque, ATM Emdadul; Rahman, Nor Iza A; Alattraqchi, Ahmed Ghazi

    2016-01-01

    Background The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia. Methods This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center for Internet Addiction, USA, was used. One hundred forty-nine medical students of Universiti Sultan Zainal Abidin participated in this study. Data were analyzed using Statistical Package for the Social Sciences software. Results The mean scores were 44.9±14.05 and 41.4±13.05 for male and female participants, respectively, which indicated that both the genders were suffering from mild Internet addiction. Conclusion This study shows almost similar level of Internet usage among medical students irrespective of their socioeconomic background, with no statistically significant (p>0.05) differences, except among the years of study (p=0.007). Overall, from the research data and having worked with this cohort very closely, Universiti Sultan Zainal Abidin medical students can be labeled as wonted and recurring users of the Internet. Nevertheless, it is very difficult to define as Internet addicts or pathological users of the Internet because of small sample size and cross-sectional study. PMID

  3. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia.

    Science.gov (United States)

    Haque, Mainul; Rahman, Nor Azlina A; Majumder, Md Anwarul Azim; Haque, Seraj Zohurul; Kamal, Zubair M; Islam, Zakirul; Haque, Atm Emdadul; Rahman, Nor Iza A; Alattraqchi, Ahmed Ghazi

    2016-01-01

    The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia. This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center for Internet Addiction, USA, was used. One hundred forty-nine medical students of Universiti Sultan Zainal Abidin participated in this study. Data were analyzed using Statistical Package for the Social Sciences software. The mean scores were 44.9±14.05 and 41.4±13.05 for male and female participants, respectively, which indicated that both the genders were suffering from mild Internet addiction. This study shows almost similar level of Internet usage among medical students irrespective of their socioeconomic background, with no statistically significant ( p >0.05) differences, except among the years of study ( p =0.007). Overall, from the research data and having worked with this cohort very closely, Universiti Sultan Zainal Abidin medical students can be labeled as wonted and recurring users of the Internet. Nevertheless, it is very difficult to define as Internet addicts or pathological users of the Internet because of small sample size and cross-sectional study.

  4. Medical students' attitude of their success rate in clerkship period in Birjand University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Hadjyabady

    2002-07-01

    Full Text Available Background With regard to accelerated progresses in the world of science and technology, as well as changes in the needs of the society, medical education should be a developing process. One of the main factors that can promote education from a static to a dynamic and effective state is evaluation. Purpose The purpose of the present survey is to determine the rate of success of medical students passing their clerkship in Birjand University of Medical Sciences from their own views of attaining educational goals of Urology Department. Methods The study is descriptive-analytical and has been performed on 50 medical students in Birjand University of Medical Sciences. Having determined the validity as well as the reliability of the question­naires, we used them to collect the data. Results Participants were 37 men (74% and 13 women (26%. T-test demonstrated a significant statical difference between male and female students in practical management of cases in urology ward (p<0.03. significant. Better practical performance was evident when the students take practical approach, in addition to looking and listening. Also, if students used various methods of teaching and learning, they would better manage cases. Conclusion The rate of medical students' success in their clerkship period for educational goals of urology was good. However, providing required facilities for giving instructions on clinical skills such as educational clinical workshops, clinical skill workshops and clinical skills centre, educational films and bed­ side practice under supervision of professors, will promote the fulfilment of educational goals. Key word educational goals, medical students, urology ward

  5. Frequency and risk factors associated with emergency medical readmissions in Galway University Hospitals.

    LENUS (Irish Health Repository)

    Gorman, J

    2010-06-01

    Unplanned readmissions of medical hospital patients have been increasing in recent years. We examined the frequency and associates of emergency medical readmissions to Galway University Hospitals (GUH).

  6. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    OpenAIRE

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

  7. Comparisonof depression prevalence in medical students between the first and last years of Birjand University of Medical Sciences: Brief Article

    Directory of Open Access Journals (Sweden)

    Nahid Rahmani Bidokhti

    2014-08-01

    Conclusion: Apparently, prevalence of depression in medical students in Birjand university of Medical Sciences is high, although studying medicine is not significantly decisive in the occurrence of the problem.

  8. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences

    OpenAIRE

    Yazdi, Zohreh; Loukzadeh, Ziba; Moghaddam, Parichehr; Jalilolghadr, Shabnam

    2016-01-01

    Introduction: Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. Methods: In this descriptive-correlational study, a total of 285 ...

  9. The Arabian Gulf University College of Medicine and Medical Sciences: a successful model of a multinational medical school.

    Science.gov (United States)

    Hamdy, Hossam; Anderson, M Brownell

    2006-12-01

    In the late 1970s, leaders of the Arabian [corrected] Gulf countries proposed a novel idea of a joint educational and cultural venture: establishing a new regional university based in the Kingdom of Bahrain that would be managed as a multinational consortium of Gulf countries including Saudi Arabia, United Arab Emirates, Kuwait, Oman, Qatar, and Bahrain. It was intended to promote higher education and research in the Gulf region; to serve the development needs of the region; to reflect the unique economic, social, and cultural attributes of the Gulf communities and their environments; and to respond to the health care needs of the member countries. Since its inception in 1982, the College of Medicine and Medical Sciences (CMMS) at Arabian Gulf University (AGU) has adopted the educational philosophy of problem-based learning (PBL) and self-directed, student-centered education. The curriculum is integrated, with early introduction of education to foster clinical skills and professional competencies. The strategic alliance with the health care systems in Bahrain and other Gulf regions has created a successful model of efficient and effective initialization of health care resources in the community. The experience that has accumulated at the AGU-CMMS from introducing innovative medical education has allowed it to take a leadership position in medical education in the Gulf region. The original goals of this unique experiment have been realized along with unanticipated outcomes of spearheading changes in medical education in the Gulf region. Old and new medical schools have adopted several characteristics of the AGU educational program. Several elements contributed to its success: a clear vision of providing quality medical education and realizing and sustaining this vision by a supportive leadership at the university and college levels; an alliance with the regional health care systems; a dedicated faculty who have been able to work as a team while continually

  10. E-LEARNING READINESS AMONG MEDICAL EDUCATORS IN UNIVERSITI SAINS ISLAM MALAYSIA

    OpenAIRE

    Salleha Khalid; Tengku Madeehah Tengku Mohd; Khadijah Hassanah; Suhaila Sanip; Muhammad Shamsir Aris; Khaironi Sharif; Mohd Mokthar

    2014-01-01

    Recent advances in information technology has made e-learning feasible in many fields of education. Medical education is not any different. This survey is conducted among all the medical educators in Universiti Sains Islam Malaysia (USIM) assessing their readiness and attitudes towards e-learning. A cross-sectional questionnaires assessing the IT skills, Internet usage, attitude, perceived benefits and usage of e-learning among USIM medical lecturers were used. Data gained were then analyzed....

  11. Student Deep Learning in Bachelor English Programs within Pakistani Universities

    Science.gov (United States)

    Tahir, Khazima

    2015-01-01

    The purpose of this study was to contrast undergraduate students' descriptions about transformational teaching practices, and student deep learning in bachelor English programs in selected universities within Pakistan. This study utilized a survey to gather responses from five hundred and twenty three students. A paired sample t test was utilized…

  12. Prevalence and predictors of suicidality among medical students in a public university.

    Science.gov (United States)

    Tan, S T; Sherina, M S; Rampal, L; Normala, I

    2015-02-01

    Undergraduate medical students have been the most distressed group among the student population. Depression and anxiety have been found to be more prevalent in this group of students compared to others. This study was conducted to determine the prevalence and predictors of suicidality among undergraduate medical students in a public university. This was an analytical cross-sectional study, conducted in a public university in Selangor, Malaysia. Data were collected using self-administered questionnaires from January to February 2013, and analysed using the Statistical Package for Social Sciences Software (version 21). Out of 625 undergraduate medical students, 537 (85.9%) participated in the study. The prevalence of the suicidality among undergraduate medical students was 7.0%. The significant predictors of suicidality based on multiple logistic regression were the respondent's lifetime suicide attempts (Adjusted Odds Ratio, AOR 10.4, 95% CI 2.7 to 40.9); depression (AOR 5.9, 95% CI 1.5 to 23.0); breaking off a steady love relationship (AOR 5.4, 95% CI 1.3 to 22.4); hopelessness (AOR 4.9, 95% CI 1.1 to 21.6); and something valued being lost or stolen (AOR 4.4, 95% CI 1.2 to 15.9). These findings indicate that mental health care services should be strengthened at university level. The results show a need for an intervention programme to reduce suicidality among the undergraduate medical students.

  13. Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

    Science.gov (United States)

    Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

    2011-01-01

    Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

  14. Emergency radiology curriculum at Medical University - Plovdiv

    International Nuclear Information System (INIS)

    Velkova, K.; Hilendarov, A.; Cvetkova, S.; Stoeva, M.; Petrova, A.; Stefanov, P.; Simova, E.; Georgieva, V.; Sirakov, N.

    2012-01-01

    Full text: Introduction: Recent advances in contemporary radiology turn it into one of the major sources for patient information with improved emergency techniques. Emergency Radiology (EP) focuses on acute diagnosing conditions in ER patients. Objectives: The main objective of this paper is to present the ER curriculum at Medical Imaging Department, Medical University - Plovdiv, aiming to deliver knowledge about the indications, possibilities and diagnostic value of the contemporary imaging methods in ER cases. Material and methods: The curriculum covers various aspects of ER Radiology - diagnostic imaging methods, contrast enhanced examinations, imaging topography, traumatic and acute conditions, physical and technical aspects. It includes 6 lectures and 12 practical classes. Results and discussion: The educational course in Emergency Radiology is available for medical students in their 8-th and 9-th semester. Therapeutic methods under imaging control are also covered by the course. Conclusion: Being one of the most advanced areas of radiology, ER improves the quality of care and treatment of patients and of the emergency medicine as a whole

  15. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  16. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  17. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  18. Experiences of mistreatment among medical students in a University ...

    African Journals Online (AJOL)

    Experiences of mistreatment among medical students in a University in south west Nigeria. ... The commonest forms experienced by the students were being shouted at (92.6%), public humiliation or belittlement (87.4%), negative or disparaging remarks about their academic performance (71.4%), being assigned tasks as ...

  19. Computer-based medical education in Benha University, Egypt: knowledge, attitude, limitations, and suggestions.

    Science.gov (United States)

    Bayomy, Hanaa; El Awadi, Mona; El Araby, Eman; Abed, Hala A

    2016-12-01

    Computer-assisted medical education has been developed to enhance learning and enable high-quality medical care. This study aimed to assess computer knowledge and attitude toward the inclusion of computers in medical education among second-year medical students in Benha Faculty of Medicine, Egypt, to identify limitations, and obtain suggestions for successful computer-based learning. This was a one-group pre-post-test study, which was carried out on second-year students in Benha Faculty of Medicine. A structured self-administered questionnaire was used to compare students' knowledge, attitude, limitations, and suggestions toward computer usage in medical education before and after the computer course to evaluate the change in students' responses. The majority of students were familiar with use of the mouse and keyboard, basic word processing, internet and web searching, and e-mail both before and after the computer course. The proportion of students who were familiar with software programs other than the word processing and trouble-shoot software/hardware was significantly higher after the course (Pcomputer (P=0.008), the inclusion of computer skills course in medical education, downloading lecture handouts, and computer-based exams (Pcomputers limited the inclusion of computer in medical education (Pcomputer labs, lack of Information Technology staff mentoring, large number of students, unclear course outline, and lack of internet access were more frequently reported before the course (Pcomputer labs, inviting Information Technology staff to support computer teaching, and the availability of free Wi-Fi internet access covering several areas in the university campus; all would support computer-assisted medical education. Medical students in Benha University are computer literate, which allows for computer-based medical education. Staff training, provision of computer labs, and internet access are essential requirements for enhancing computer usage in medical

  20. Analysis of toxic metals in branded Pakistani herbal products

    International Nuclear Information System (INIS)

    Saeed, M.; Muhammad, N.; Khan, H.

    2010-01-01

    The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

  1. Clinical education stressors in medical trainees in Shahid Sadoughi University of Medical Sciences, Yazd

    Directory of Open Access Journals (Sweden)

    MAHDIEH MOMAYYEZI

    2016-01-01

    Full Text Available Introduction: Stress is an important factor in the educational process. Teaching and learning are stressful processes. This stress can affect one’s ability and change his/her performance. The purpose of this study was to investigate stressors of clinical education from the perspective of medical students in Yazd University of Medical Sciences. Methods: This descriptive-analytic study was conducted in Yazd University of Medical Science during year 2014-2015. The sample size was 170 medical students who were selected randomly. The data were collected by a questionnaire including four components: interpersonal relationship, educational environment, clinical experience and the unpleasant emotions. A significance level of 0.05 was considered for analysis. The statistical analyses included descriptive statistics, ANOVA and T-tests, using SPSS software, version 14. Results: The results showed that the highest domain score belonged to interpersonal relationship (3.33±0.3 followed by unpleasant emotions domain (3.3±0.3. The lowest domain score of clinical education stressors was educational environment (3.12±0.1. The results showed that the mean score of interpersonal relationship domain was more in women than in men (p<0.05. Conclusion: The relationship between teachers and students is an effective factor in all dimensions of clinical education stressors. So proper measures such as the promotion of scientific awareness of teachers and educational staff about factors that lead to stress and the best way to communicate with students should be taken to reduce the students’ stress.

  2. The Medical Academic Advancement Program at the University of Virginia School of Medicine.

    Science.gov (United States)

    Fang, W L; Woode, M K; Carey, R M; Apprey, M; Schuyler, J M; Atkins-Brady, T L

    1999-04-01

    Since 1984 the University of Virginia School of Medicine has conducted the Medical Academic Advancement Program for minority and disadvantaged students interested in careers in medicine. The program is a six-week residential program for approximately 130 undergraduate and post-baccalaureate students per year. It emphasizes academic course work--biology, chemistry, physics, and essay writing--to prepare the participants for the Medical College Admission Test. Non-graded activities, such as a clinical medicine lecture series, clinical experiences, and a special lecture series, and special workshops are also offered. The participants take two simulated MCAT exams. Between 1984 and 1998, 1,497 students have participated in the program, with complete follow-up information available for 690 (46%). Of the 1,487 participants, 80 (5%) have graduated from the University of Virginia School of Medicine and 174 (12%) from other medical schools; 44 (3%) are attending the medical school now, and 237 (16%) are at other medical schools; 44 (3%) have graduated from other health professions schools, and 54 (3%) are attending such schools. The retention rate for participants at the University of Virginia School of Medicine is 91% (that is, all but seven of the 80 who matriculated have been retained past the first year). The Medical Academic Advancement Program has been successful in increasing the number of underrepresented minority students matriculating into and continuing in medical education. Such programs warrant continued support and encouragement.

  3. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  4. Investigation of science production in Iran’s type I universities of medical sciences, a 6-year assessment

    Directory of Open Access Journals (Sweden)

    M Yadollahi

    2014-07-01

    Full Text Available Introduction: Science production is one of the main dimensions of sustainable development in any country. Thus, universities as the major centers for science production play a key role in development. The present study aimed to assess the trend of science production in Iran’s type I universities of medical sciences from 2007 to 2012. Method: In this study, the universities’ scores of empowering, governance and leadership, science production, student researches, and number of published articles were computed based on the evaluations of universities of medical sciences by the Ministry of Health, Treatment, and Medical Education from 2007 to 2012. Then, the data were analyzed using descriptive statistics and the figures were drawn by Excel software. Results: This study assessed science production in Iran’s type I universities of medical sciences and analyzed each university’s proportion in publication of articles. According to the results, most of the published articles were affiliated to Tehran University of Medical Sciences. However, considering the role of number of faculty members, different results were obtained. With respect to the evaluation raw scores, Isfahan University of Medical Sciences showed a considerable reduction of scores in 2012, while other universities had a constant or ascending trend. Besides, indexed articles followed an ascending trend in all the universities and most of the articles had been published in index 1. Conclusion: Similar to other studies, the findings of this study revealed an increase in science productions in Iran through the recent years. Yet, the highest scores of the studied indexes, except for student researches, were related to Tehran University of Medical Sciences. This great difference between this university and other universities might be due to accumulation of specific potentials and forces in this region. Overall, science productions followed an ascending trend in all type I universities of

  5. Drug use prevalence among students of universities of medical sciences in Tehran

    Directory of Open Access Journals (Sweden)

    Farhad Taremian

    2014-02-01

    Full Text Available Objective: This study was aimed to determine the prevalence of drug use among students of universities of Medical Sciences in Tehran. Method: Four thousands of medical students (both sexes in academic year 1388-89 in different level of education, B.A., M.Sc. and Ph.D. were selected by random stratified sampling method. These students were selected from Iran, Tehran and Shahid Beheshti Universities of Medical Sciences considering their sex and level of education. We used drug use prevalence questionnaire. Findings: The most prevalent drug of abuse in life time period was qalyan (classical pipe, followed by cigarette, and alcohol. The least frequent drug of abuse was Shisheh, followed by heroine krack. As we expected, drugs morphine, ritalin and tramadol were placed in forth, fifth and sixth of prevalent drugs. Use of different substances was significantly more prevalent in male students. Conclusion: Using soft drugs (qalyan, cigarette and alcohol was more prevalent than hard drugs (hashish, taryak, heroine kerack among Universities Medical Sciences of Tehran. Similar to drug use pattern in society, use of all of drugs were more prevalent in male students. We should pay special attention to use of drugs such as tramadol, ritalin, petedin and morphine.

  6. Experience of dietary advice among Pakistani-born persons with type 2 diabetes in Oslo.

    Science.gov (United States)

    Fagerli, Rønnaug Aa; Lien, Marianne E; Wandel, Margareta

    2005-12-01

    Experience and implementation of dietary advice are influenced by various factors including ethnic, cultural and religious background. The aim is to explore how ethnic minority persons with diabetes experience dietary advice given by Norwegian health-workers, which strategies they have in response to the advice and how they explain their actions. In-depth interviews were performed with 15 Pakistani-born persons with type 2 diabetes living in Oslo. The analyses are based on the principles of Giorgi's interpretation of phenomenology. The participants expressed great concern to follow the advice. However, narratives about constraints were numerous. These concerned different life-situational factors, but more importantly they were related to communication problems arising from discontinuities between universalising medical knowledge and lay knowledge, as well as between different types of culturally defined lay knowledge. As a consequence, advice was generally experienced as inadequately based on the participant's food-cultural background, leaving the person with diabetes to do the translation between different levels of knowledge. In general health-workers would benefit from expanding their knowledge of the many positive aspects of their patients' cultural background, and apply their knowledge thereafter, whether it concerns (food)-culture or the impact of religion in everyday life.

  7. ORGANIZATIONAL STRUCTURE OF RESEARCH PROJECT ACTIVITIES PERFORMED AT MEDICAL UNIVERSITIES IN BULGARIA.

    Directory of Open Access Journals (Sweden)

    Svetoslav Garov

    2013-07-01

    Full Text Available Introduction: There are five Bulgarian medical universities in the cities of Sofia, Plovdiv, Varna, Pleven and Stara Zagora. A major priority of medical universities is to encourage research activities mainly aimed at preparation and implementation of research projects. Projects are managed by the participating organizations called “beneficiaries”. Beneficiaries develop projects, apply for finances and if approved they implement those projects.Aim: The purpose of our study is to examine the organizational structure of research project activities on the macro level and on the micro level in Bulgarian medical universities.Material and methods: In order to define the separate elements of the organizational structure and to analyze the relations and interaction between them we have applied a documentary and sociological approach. Results: During the last six years there was a significant increase in the number and the overall annual financial value of the projects performed at medical universities in Bulgaria. The reasons for such increase are: managers realizing the advantages of and benefits from the implementation of research projects ensuring high quality modernization of research units’ equipment and facilities; access to innovative technologies; development of interdisciplinary relations, etc. Benefits arising from improved results motivate us to consider as appropriate some additional investments aimed at increasing the number of team members and further optimization of the currently existing structures (research centers in charge of research with the purpose of achieving even better results in this particular field. Conclusion: The role of research project activities in medical universities’ research field is of vital importance for the educational institutions’ success. Taking into consideration the changed conditions, European possibilities and the highly competitive environment, realizing this aspect will be essential for the

  8. ASSESSMENT OF MEDICAL WASTE MANAGEMENT IN EDUCATIONAL HOSPITALS OF TEHRAN UNIVERSITY MEDICAL SCIENCES

    Directory of Open Access Journals (Sweden)

    M. H. Dehghani, K. Azam, F. Changani, E. Dehghani Fard

    2008-04-01

    Full Text Available The management of medical waste is of great importance due to its potential environmental hazards and public health risks. In the past, medical waste was often mixed with municipal solid waste and disposed in residential waste landfills or improper treatment facilities in Iran. In recent years, many efforts have been made by environmental regulatory agencies and waste generators to better managing the wastes from healthcare facilities. This study was carried in 12 educational hospitals of Tehran University of Medical Sciences. The goals of this study were to characterize solid wastes generated in healthcare hospitals, to report the current status of medical waste management and to provide a framework for the safe management of these wastes at the considered hospitals. The methodology was descriptive, cross-sectional and consisted of the use of surveys and interviews with the authorities of the healthcare facilities and with personnel involved in the management of the wastes. The results showed that medical wastes generated in hospitals were extremely heterogeneous in composition. 42% of wastes were collected in containers and plastic bags. In 75% of hospitals, the stay-time in storage sites was about 12-24h. 92% of medical wastes of hospitals were collected by covered-trucks. In 46% of hospitals, transferring of medical wastes to temporary stations was done manually. The average of waste generation rates in the hospitals was estimated to be 4.42kg/bed/day.

  9. Improvement of the training system of medical and pharmaceutical specialists at medical college of Saratov State Medical University

    Directory of Open Access Journals (Sweden)

    Popkov V.M.

    2015-06-01

    Full Text Available The development of high-technological medical care in Russia has improved the quality of rendering of medical aid to the population, but at the same time the lack of efficient, qualified specialists has been revealed. Today graduates of professional educational institution are characterized by the knowledge in theory and inefficient practical experience, while the employer is interested in the optimal combination of these qualities. All of these facts lead to the necessity of introducing into the educational process technologies of dual training as a tool of approximation theory to practice Saratov. Medical University may share the experience of introduction and organization of elements of the complex educational system in the process of realization of the programs of secondary professional education through the creation of educational-productive cluster on the bases of clinics.

  10. Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

    NARCIS (Netherlands)

    Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

    Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

  11. Integration of Cognitive Skills as a Cross-Cutting Theme Into the Undergraduate Medical Curriculum at Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Akbar Soltani

    2017-02-01

    Full Text Available Nowadays, improvement of thinking skills of students is one of the universally supported aims in the majority of medical schools. This study aims to design longitudinal theme of reasoning, problem-solving and decision-making into the undergraduate medical curriculum at Tehran University of Medical Sciences (TUMS. A participatory approach was applied to design the curriculum during 2009-2011. The project was conducted by the contribution of representatives of both basic and clinical faculty members, students and graduates at Tehran University of Medical Sciences. The first step toward integrating cognitive skills into the curriculum was to assemble a taskforce of different faculty and students, including a wide variety of fields with multidisciplinary expertise using nonprobability sampling and the snowball method. Several meetings with the contribution of experts and some medical students were held to generate the draft of expected outcomes. Subsequently, the taskforce also determined what content would fit best into each phase of the program and what teaching and assessment methods would be more appropriate for each outcome. After a pilot curriculum with a small group of second-year medical students, we implemented this program for all first-year students since 2011 at TUMS. Based on findings, the teaching of four areas, including scientific and critical thinking skills (Basic sciences, problem-solving and reasoning (Pathophysiology, evidence-based medicine (Clerkship, and clinical decision-making (Internship were considered in the form of a longitudinal theme. The results of this study could be utilized as a useful pattern for integration of psycho-social subjects into the medical curriculum.

  12. Factors Associated with Occupational Stress among University Teachers in Pakistan and Finland

    OpenAIRE

    Naima Akhtar Malik; Kaj Björkqvist; Karin Österman (correspondence author)

    2017-01-01

    The study examines the interplay of psychosocial factors and works conditions on occupational stress among 531 university teachers in Pakistan and Finland with the help of a web-based questionnaire. Results from an MANOVA revealed that good working conditions, social support at work, and promotion and development opportunities were rated as significantly better by the Finnish sample. Workplace bullying occurred considerably less often in Finland than in Pakistan. Male Pakistani teachers repor...

  13. Evaluation of self-medication practices in acute diseases among university students in Oman

    Directory of Open Access Journals (Sweden)

    Marwa Al Flaiti

    2014-01-01

    Conclusion: The prevalence of self-medication among university students was very high. There is a need for intensive education and comprehensive awareness campaign to advocate for reduction in the prevalence of self-medication practices among students.

  14. The Early Years of the University of the Witwatersrand Medical ...

    African Journals Online (AJOL)

    1973-01-20

    Jan 20, 1973 ... Witwatersrand Medical School and its Students*. G. R. BEATON, M.B. B.CH. UNIV. .... sion to South African universities, and to travel to. Europe became the .... provement of the residence food at the Queen Victoria. Hospital.

  15. Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

    Science.gov (United States)

    Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

    2010-06-01

    Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

  16. A Survey of Cultural Infrastructure and Performance in Medical Sciences Universities of Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Feizi

    2015-08-01

    Full Text Available ​Background and objectives: Recently, the role of universities in developing and education of culture is considered increasingly but Iranian universities have great distance in achieving the desired objectives in this context. So, this study aimed to survey the cultural infrastructure and performance in medical sciences universities of Iran. Material and Methods: This is a cross-sectional study that was done using researcher-made checklist which its face and content validity were approved by the cultural experts' opinion via statistical indicators. The study was conducted in census method by responses of 25 managers of cultural affairs in medical sciences universities of Iran. The obtained data were analyzed descriptively and results were reported as frequency (percentages for qualitative and mean (standard deviation for quantitative variable. Results: The study results were presented in four areas: “the general status of universities in cultural affairs”, “cultural facilities of the universities”, “the activity of cultural organizations and publications in universities” and “performance of cultural deputies”. The results showed that although there are considerable strengths, the significant weaknesses are evident in all areas. The results of the present study were focused solely on the quantity of functions, and quality evaluation of each activity requires special attention and further investigations and interventions. Conclusion: Researchers hope that the authorities and planners use the results of this study and similar studies especially in quality of cultural practices of universities and move towards improving the status of culture in medical sciences universities in developing Iranian-Islamic culture.

  17. Medical students’ perception of the learning environment at King Saud University Medical College, Saudi Arabia, using DREEM Inventory

    Directory of Open Access Journals (Sweden)

    Soliman MM

    2017-03-01

    Full Text Available Mona M Soliman,1,2 Kamran Sattar,2 Sami Alnassar,3 Faisal Alsaif,4 Khalid Alswat,5 Mohamed Alghonaim,6 Maysoon Alhaizan,7 Nawaf Al-furaih7 1Department of Physiology, 2Department of Medical Education, 3Department of Surgery, College of Medicine, King Saud University, 4Department of Surgery, King Saud University Medical City, 5Department of Internal Medicine, 6Department of Medicine, 7College of Medicine, King Saud University, Riyadh, Saudi Arabia Background: The students’ perception of the learning environment is an important aspect for evaluation and improvement of the educational program. The College of Medicine at King Saud University (KSU reformed its curriculum in 2009 from a traditional to a system-oriented hybrid curriculum.Objective: The objective of the present study was to determine the perception of the second batch (reformed curriculum of medical graduates about the educational environment at the College of Medicine, KSU, using the Dundee Ready Education Environment Measure (DREEM scale.Methods: The fifth year medical students were asked to evaluate the educational program after graduation in May 2014. The questionnaire was distributed to the graduate students electronically. The DREEM questionnaire consisted of 50 items based on Likert’s scale; and five domains, namely, students’ perceptions of learning, perceptions of teachers, academic self-perceptions, perceptions of atmosphere, and social self-perceptions. Data were analyzed using SPSS.Results: A total of 62 students participated in the study. The score for students’ perception of learning among medical students ranged from 2.93 to 3.64 (overall mean score: 40.17. The score for students’ perception of teachers ranged from 2.85 to 4.01 (overall mean score: 33.35. The score for students’ academic self-perceptions ranged from 3.15 to 4.06 (overall mean score: 28.4. The score for students’ perception of atmosphere ranged from 2.27 to 3.91 (overall mean score: 41.32. The

  18. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    Directory of Open Access Journals (Sweden)

    Syeda Bushra Zaidi

    2016-05-01

    Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

  19. Acceptability of GM foods among Pakistani consumers

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-01-01

    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  20. Acceptability of GM foods among Pakistani consumers.

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-04-02

    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  1. Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2013-01-01

    To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

  2. Learning Styles of Medical and Midwifery Students in Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    A Zeraati

    2009-11-01

    Full Text Available Background: Students have individual learning style preferences including visual (V; learning from graphs, charts, and flow diagrams, auditory (A; learning from speech, read-write(R; learning from reading and writing, and kinesthetic (K; learning from touch, hearing, smell, taste, and sight.These preferences can be assessed using the VARK questionnaire.Purpose: We aimed to assess different learning styles of medical students in our collage.Methods: This study was conducted to describe learning styles of 214 Medical and Midwifery students in Mashhad University of medical sciences. By using the English version of the VARK questionnaire, we measured the difference in learning styles of medical students and midwifery students and compared with 57336 global general students who completed the test in VARK website up to Sep 2007.Results: The dominant learning preference of our students was Aural preference (30.8% followed by Read/Write (20.6%, while (7.5% were in Kinesthetic and (5.6% were Visual learners; still most of the students (35.5% represented a multimodal learning preference. No significant difference was found between males and females. The general pattern between medical student and Midwifery student is the same. There was a significant relation between Internship Entrance Exam score and thelearning styles of medical student and who were more Read/Write got higher scores.Conclusion: Knowing that our students have different preferred learning modes will help medical instructors in our faculty develop appropriate learning approaches and explore opportunities so that they will be able to make the educational experience more productive.Key words: MEDICAL EDUCATION, LEARNING MODELS VARK, VISUAL, AUDITORY, READ-WRITE, KINESTHETIC, SSTUDENTS.

  3. Utilization of smart phones related medical applications among medical students at King Abdulaziz University, Jeddah: A cross-sectional study.

    Science.gov (United States)

    Sayedalamin, Zaid; Alshuaibi, Abdulaziz; Almutairi, Osama; Baghaffar, Mariam; Jameel, Tahir; Baig, Mukhtiar

    The present study explored the utility, attitude, and trends regarding Smartphone related Medical Applications (Apps) among medical students of King Abdulaziz University (KAU) Jeddah, Saudi Arabia (SA) and their perceptions of the impact of Medical Apps in their training activities. This survey was conducted at the Faculty of Medicine, Jeddah, and Rabigh campuses, KAU, Jeddah, SA. All participants were medical students of 2nd to 6th year. The data was collected by using an anonymous questionnaire regarding the perception of medical students about Medical Apps on the smart devices and the purpose of installation of the Apps. Additionally examined was the use of different Medical Apps by the students to investigate the impact of Medical Apps on the clinical training/practice. Data was analyzed on SPSS 21. The opinion of 330/460 medical students from all academic years was included in the study with a response rate of 72%. There were 170 (51.5%) males and 160 (48.5%) females with a mean age of 21.26±1.86 years. Almost all participating students 320 (97%) were well aware of Medical Apps for smart devices and 89.1% had installed different applications on their smart devices. The main usage was for either revision of courses (62.4%) or for looking up of medical information (67.3%), followed by preparing for a presentation (34.5%) and getting the medical news (32.1%). Regarding the impact of Medical Apps, most of the students considered these helpful in clinical decision-making, assisting in differential diagnosis, allowing faster access to Evidence-Based Medical practice, saving time and others. The practical use of these Apps was found to be minimal in medical students. Around 73% were occasional users of Medical Apps, and only 27% were using Medical Apps at least once a day. The regular use of Medical Apps on mobile devices is not common among medical students of KAU. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd

  4. Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-06-01

    To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

  5. The situation analysis of the international relations management and inter-university collaboration in Tabriz University of Medical Sciences, Iran, during the years 2005-2010

    Directory of Open Access Journals (Sweden)

    Alireza Farajollahi

    2013-08-01

    Full Text Available BACKGROUND: Nowadays, with the development of science and communication, collaboration with other countriesand universities seems inevitable to universities. The aim of this study was to analyze the situation of internationalrelations management and inter-university collaboration (IRM-IUC in Tabriz University of Medical Sciences (TUMS,Iran, during the years 2005-2010. METHODS: In this descriptive study, one checklist was used for analysis of the inter-university collaboration management and another one for the situation analysis of international relations management which included 4 sections itself. There were a total of 56 questions designed and developed through literature review and the expert panel.RESULTS: The results indicated the poor performance of Tabriz University of Medical Sciences in the international relations management and inter-university collaboration fields. Most of the reviewed items had not been adequatelypaid attention to in the management of international relations and only one out of 14 evaluated items was considered inthe field of inter-university collaboration. CONCLUSIONS: In line with the overall globalization process, education and research have also become globalizedprocesses, and as a result, it is necessary for universities to develop effective ties and relationships with otherorganizations. However, Tabriz University of Medical Sciences has not been doing quite optimally in this regard. Thus,it is suggested that, based on the shortcomings pointed out in this study, new appropriate plans and policies be set todevelop fruitful and effective relations and correspondences with other universities and countries.

  6. Evaluation of information literacy status among medical students at Shiraz University of Medical Sciences.

    Science.gov (United States)

    Bazrafkan, Leila; Hayat, Ali Asghar; Abbasi, Karim; Bazrafkan, Aghdas; Rohalamini, Azadeh; Fardid, Mozhgan

    2017-01-01

    The information literacy status and the use of information technology among students in the globalization age of course plans are very momentous. This study aimed to evaluate the information literacy status and use of information technology among medical students of Shiraz University of Medical Sciences in 2013. This was a descriptive-analytical study with cross-sectional method. The study population consisted of all medical students (physiopathology, externship and internship) studying at Shiraz University of Medical Sciences. The sample size (n=310) was selected by systematic random sampling. The tool of data gathering was LASSI questionnaire (assigned by America research association) with 48 closed items in five-point LIKERT scale. The questionnaire included two distinct parts of demographic questions and the information literacy skills based on the standards of information literacy capacities for academic education. The content validity was acquired by professors' and experts' comments. The reliability was also calculated by Cronbach'salpha (0.85). Data were analyzed in both descriptive (frequency- mean) and analytical level (t-test, analysis of variance) using SPSS 14 software. 60.3% of the participants were females, and the remaining (29.7%) were males. The mean score of information literacy and its five subgroups among the students weren't at a desirable level. The mean scores of information literacy for educational grades from the highest to lowest belonged to the internship, physiopathology and externship. The results showed that the highest average was related to the effective access ability to information among interns (9.27±3.57) and the lowest one was related to the ability of understanding legal and economical cases related with using information among externs (3.11±1.32).The results of ANOVA showed that there wasn't a significant difference between educational grades and information literacy. Finally, the result of independent t-test did not show a

  7. ELECTROCONVULSIVE THERAPY EXPERIENCES AT NARA MEDICAL UNIVERSITY HOSPITAL

    OpenAIRE

    Kishimoto, Toshifumi; Ueda, Atsushi; Noriyama, Yoshinobu; Nagai, Toshiya; Hirayama, Tomohide; Kirita, Ikuhiro; Hata, Kazuya; Ikawa, Genro

    1995-01-01

    We surveyed the clinical electroconvulsive therapy (ECT) treatment expe- riences between 1987 and 1992 at Nara Medical University Hospital. ECT is restrictedly applied to severely ill patients who have no response to other somatic therapies. For 5 years, 43 cases were treated with ECT, of which 27 suffered from depressive disorders, 3 from schizophrenia, 3 from somatoform disorders, and 10 from anxiety disorders. ECT was selected by psychiatrists for severe depressive states after failure of ...

  8. Scientific Productivity of Zahedan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Farahnaz Vatankhah

    2012-08-01

    Full Text Available Background: Nowadays the scientific research outputs indexed in international databases are used in the bibliometric rankings of researchers, departments and universities. Measuring the impact and value of scientific publications is used by policy makers to distribute the research funds in way that support high quality research projects. Materials and Methods: In this scientometric study, SCOPUS citation database was used to evaluate the scientific research productivity of Zahedan University of Medical Sciences (ZAUMS over the period of 1976-2011. We retrieved the number of publications and citations of researchers, academic groups, and university and calculated their h-index scores. The affiliation varieties were used by researchers to address the university and different spellings of authors names were determind.Results: The results showed that scientific productivity of ZAUMS has been improved so that it’s h-index increased from 1 in 2000 to 19 over the period of the study.Conclusion: Total number of 504 publications were indexed in SCOPUS in the forms of original article, review article, conference paper, letter, editorial, and note. Most of the publications were in the form of research article (91.2%. There was a significant coorelation between the number of publications, citation rates and h-index scores. Departments of biochemistry and infectious disease ranked first on the basis of producing the most scientific output of the university.

  9. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  10. Psychometric Properties of Interpersonal Communication skills Questionnaire (ISAQ from the Viewpoint of Students at Tabriz University and Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Firoz Mahmoodi

    2017-06-01

    Full Text Available Background and Objective: One of the skills needed for social life is interpersonal communication skills. Assessing the Interpersonal communication skills due to the growth and development of social networks is very important. This study aimed to validate the Fetro's (2000 interpersonal communication skills questionnaire among students of Tabriz University and Tabriz University of Medical Sciences. Materials and Methods: In this descriptivestudy, 750 students of Tabriz University and Tabriz University of Medical Sciences were selected by simple random sampling. Data collected by Fetro (2000 interpersonal communication skills questionnaire. This questionnaire has 65 items with five degrees based on Likert scale. Data were analyzed using Exploratory Factor Analysis through SPSS 23. Results: In total 750 Students filled questionnaires. 423 from University of Tabriz and 327 from of Tabriz University of Medical Sciences. Based on the results of exploratory factor analysis on original 65 items, 6 factors extracted and 54 items remained. Based on original questionnaire factors and literature extracted factors were labeled. So 45.26% of total variance were explained by these six factors (empathy and intimacy, communication skills, ability to maintain communication, assertiveness, listening and conflict resolution skills. Conclusion: According to the result of factor analysis, new validated questionnaire has less items and more components than the original questionnaire. So it is a suitable instrument for measuring interpersonal communication skills by researchers.

  11. Internationalizing Medical Education: The Special Track Curriculum 'Global Health' at Justus Liebig University Giessen

    Directory of Open Access Journals (Sweden)

    Knipper, Michael

    2015-11-01

    Full Text Available Internationalizing higher education is considered to be a major goal for universities in Germany and many medical students aspire to include international experiences into their academic training. However, the exact meaning of “internationalizing” medical education is still poorly defined, just as is the possible pedagogic impact and effects. Against this background, this article presents the special track curriculum on global health (in German: , short: at Justus Liebig University Giessen, which was established in 2011 as a comprehensive teaching program to integrate international perspectives and activities systematically into the clinical years of the medical curriculum. The report of the structure, content, didactic principles and participants’ evaluations of the SPC is embedded into a larger discussion of the pedagogic value of a broad and interdisciplinary perspective on “global health” in medical education, that explicitly includes attention for health inequities, social determinants of health and the cultural dimensions of medicine and health abroad and “at home” (e.g. in relation to migration. We conclude that if properly defined, the emerging field of “global health” represents a didactically meaningful approach for adding value to medical education through internationalizing the curriculum, especially in regard to themes that despite of their uncontested value are often rather weak within medical education. The concrete curricular structures, however, have always to be developed locally. The “SPC” at Giessen University Medical School is only one possible way of addressing these globally relevant issues in one particular local academic setting.

  12. Internationalizing Medical Education: The Special Track Curriculum 'Global Health' at Justus Liebig University Giessen.

    Science.gov (United States)

    Knipper, Michael; Baumann, Adrian; Hofstetter, Christine; Korte, Rolf; Krawinkel, Michael

    2015-01-01

    Internationalizing higher education is considered to be a major goal for universities in Germany and many medical students aspire to include international experiences into their academic training. However, the exact meaning of "internationalizing" medical education is still poorly defined, just as is the possible pedagogic impact and effects. Against this background, this article presents the special track curriculum on global health (in German: Schwerpunktcurriculum Global Health, short: SPC) at Justus Liebig University Giessen, which was established in 2011 as a comprehensive teaching program to integrate international perspectives and activities systematically into the clinical years of the medical curriculum. The report of the structure, content, didactic principles and participants' evaluations of the SPC is embedded into a larger discussion of the pedagogic value of a broad and interdisciplinary perspective on "global health" in medical education, that explicitly includes attention for health inequities, social determinants of health and the cultural dimensions of medicine and health abroad and "at home" (e.g. in relation to migration). We conclude that if properly defined, the emerging field of "global health" represents a didactically meaningful approach for adding value to medical education through internationalizing the curriculum, especially in regard to themes that despite of their uncontested value are often rather weak within medical education. The concrete curricular structures, however, have always to be developed locally. The "SPC" at Giessen University Medical School is only one possible way of addressing these globally relevant issues in one particular local academic setting.

  13. Non-medical use of methylphenidate among medical students of the University of the Free State

    Directory of Open Access Journals (Sweden)

    Roshini Jain

    2017-01-01

    Full Text Available Background: Faced with demanding training programmes, medical students may be more prone to use methylphenidate for non-medical purposes in order to improve concentration, alertness and academic performance. Aim: The study aimed to investigate the prevalence of the non-medical use of methylphenidate and knowledge of this drug among undergraduate medical students of the University of the Free State. Methods: This was a cross-sectional study. A self-administered, anonymous questionnaire was distributed during lectures to all students in the five year groups of the undergraduate medical programme. Results: Of the 643 undergraduate medical students, 541 completed the questionnaire (response rate: 84.1%. Approximately 11.0% of surveyed students were using methylphenidate at the time of the study, of which the majority (67.9% used it for academic purposes and 70.6% received it from a medical health professional. Less than a third of users had been diagnosed with Attention-Deficit/Hyperactivity Disorder. Methylphenidate users’ median knowledge was greater than non-users, and methylphenidate knowledge increased from first-year and second-year students to third-year to fifth-year students. Median knowledge scores per year group ranged from 52.0% to 60.0%. Conclusion: Methylphenidate is mainly used for non-medical purposes by medical students. Students generally have a low level of knowledge on methylphenidate. Specific information on methylphenidate should be included in lectures on stress management and study methods during the course of the medical curriculum.

  14. [Scientific dissemination of medical dissertations at the University of Lomé (Togo)].

    Science.gov (United States)

    Pitche, Palokinam T; Onipoh, Dodji K; Tchangai-Walla, Kissem L

    2007-01-01

    The medicine dissertation is often the last step of a physician's medical studies. Long considered a rite of passage, it is now regarded as a scientific work deserving attention from the national and international scientific community. The objectives of this study were to document the means by which dissertations at the University of Lomé Medical School are diffused and to determine their impact on the scientific production of medical school faculty. This cross-sectional study included all dissertations in medicine at the University of Lomé from 1993 through 2002. We interviewed dissertation supervisors and co-supervisors (questionnaire-structured interviews) and consulted the Medline and CNRS/PASCAL databases, scientific communication registers and local journals to collect information. During this period, 240 dissertations were defended at the University of Lomé medical school. More than half came from the departments of medicine (n=85, 35.4%), surgery (n=57, 23.7%) and paediatrics (n=51, 22.5%). The majority dealt with epidemiological (47 %) and clinical (35.8 %) themes, and only a small minority concerned topics in microbiology and biochemistry (7.5 %). Ninety-nine dissertations (41 %) were published: 54 (22.5%) in indexed journals and 45 (18.5 %) in non-indexed journals; 130 (54%) were delivered as papers or posters at scientific meetings. The distribution of published dissertations according to department showed that the departments of paediatrics (51.3 %), medicine (21.2 %) and surgery (21 %) had the best rates of publication in indexed journals, compared with obstetrics and gynaecology (4 %) and basic science (13.8 %) departments. During the study period, faculty at the University of Lomé medical school published 264 articles in indexed journals: dissertations accounted for only 20.4 %. Dissertations made up a higher proportion of publications in the paediatrics department (32.2 %) than in surgery (20.7 %), medicine (19.8 %), basis sciences (14 %) or

  15. A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

    NARCIS (Netherlands)

    Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

    2014-01-01

    With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

  16. Organizational intelligence and agility in Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Hamid Taboli

    2017-07-01

    Full Text Available Introduction: Organizational Intelligence is a combination of all skills that organizations need and use; it enables us to make organizational decisions. Organizational Intelligence can increase the effectiveness of the existing informational structures in achieving organizational goals and result in organizational agility. The aim of this study was to investigate the relationship between Organizational Intelligence and organizational agility in Shiraz University of Medical Sciences. Method: This is an applied study in terms of purpose and descriptive in terms of method. The study population consisted of 1200 employees working in Shiraz University of Medical Sciences. The subjects were selected via convenience sampling. Based on Cochran formula, a sample size of 296 was determined with a confidence level of 95%. The measurement tools included the 36-item Organizational Intelligence questionnaire developed by Albrecht (2003 and a researcher-developed organizational agility questionnaire with 30 items. Expert opinion was used to determine the validity of the questionnaires and reliability was confirmed using Cronbach’s alpha coefficient via SPSS, version 19. Results: Tenure employees had the highest frequency among the participants (50%. In terms of education, employees with a bachelor’s degree were the most frequent (58%. Values obtained for all variables showed a significant positive relationship between Organizational Intelligence and Agility. Conclusion: It is recommended that the university officials take measures to include Organizational Intelligence courses in in-service training programs to promote the agility of the university, and improve the service provision process and speed.

  17. The Relationship between Occupational Stress and Job Satisfaction: The Case of Pakistani Universities

    Science.gov (United States)

    Chaudhry, Abdul Qayyum

    2012-01-01

    This paper aims to find out the relationship between occupational stress and job satisfaction based on age, gender, nature of job, cadre, work experience of university teachers, and sector of university. The Pearson correlation indicates: no significant relationship found between job satisfaction and overall occupational stress; inverse…

  18. Relationship Between Cybernetics Management and Organizational Trust Among Librarians of Mazandaran University of Medical Sciences.

    Science.gov (United States)

    Ghiasi, Mitra; Shahrabi, Afsaneh; Siamian, Hasan

    2017-12-01

    Organization must keep current skills, abilities, and in the current field of competition, and move one step ahead of other competitors; for this purpose, must be a high degree of trust inside the organization. Cybernetic management is a new approach in management of organizations that its main task according to internal issues. This study aimed to investigate the relationship between cybernetics management and organizational trust among librarians of Mazandaran University of Medical Sciences. This is applied and analytical survey. which its population included all librarians of Mazandaran University of Medical Sciences, amounting to 42 people which were selected by census and participated in this research. There has no relationship between components of Cybernetics management (participative decision making, commitment, pay equity, Correct flow of information, develop a sense of ownership, online education) with organizational trust amongst librarians of Mazandaran University of Medical Sciences. And there has a significant relationship between flat Structure of cybernetics management and organizational trust. For data analysis was used Kolmogorov-Smirnov test and linear regression. There is no significant relationship between Cybernetic management and organizational trust amongst librarians of Mazandaran University of Medical Sciences.

  19. Developing a Model of Tuition Fee Calculation for Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Seyed Amir Mohsen Ziaee

    2018-01-01

    Full Text Available Background: The aim of our study was to introduce and evaluate a practicable model for tuition fee calculation of each medical field in universities of medical sciences in Iran.Methods: Fifty experts in 11 panels were interviewed to identify variables that affect tuition fee calculation. This led to key points including total budgets, expenses of the universities, different fields’ attractiveness, universities’ attractiveness, and education quality. Tuition fees were calculated for different levels of education, such as post-diploma, Bachelor, Master, and Doctor of Philosophy (Ph.D degrees, Medical specialty, and Fellowship. After tuition fee calculation, the model was tested during 2013-2015. Since then, a questionnaire including 20 questions was prepared. All Universities’ financial and educational managers were asked to respond to the questions regarding the model’s reliability and effectiveness.Results: According to the results, fields’ attractiveness, universities’ attractiveness, zone distinction and education quality were selected as effective variables for tuition fee calculation. In this model, tuition fees per student were calculated for the year 2013, and, therefore, the inflation rate of the same year was used. Testing of the model showed that there is a 92% of satisfaction. This model is used by medical science universities in Iran.Conclusion: Education quality, zone coefficient, fields’ attractiveness, universities’ attractiveness, inflation rate, and portion of each level of education were the most important variables affecting tuition fee calculation.Keywords: TUITION FEES, FIELD’S ATTRACTIVENESS, UNIVERSITIES’ ATTRACTIVENESS, ZONE DISTINCTION, EDUCATION QUALITY

  20. Occupational Radiation Dose for Medical Workers at a University Hospital

    Directory of Open Access Journals (Sweden)

    M.H. Nassef

    2017-11-01

    Full Text Available Occupational radiation doses for medical workers from the departments of diagnostic radiology, nuclear medicine, and radiotherapy at the university hospital of King Abdul-Aziz University (KAU were measured and analysed. A total of 100 medical radiation workers were monitored to determine the status of their average annual effective dose. The analysis and the calibration procedures of this study were carried out at the Center for Radiation Protection and Training-KAU. The monitored workers were classified into subgroups, namely, medical staff/supervisors, technicians, and nurses, according to their responsibilities and specialties. The doses were measured using thermo luminescence dosimeters (TLD-100 (LiF:Mg,Ti placed over the lead apron at the chest level in all types of workers except for those in the cath lab, for whom the TLD was placed at the thyroid protective collar. For nuclear medicine, a hand dosimeter was used to measure the hand dose distribution. The annual average effective doses for diagnostic radiology, nuclear medicine, and radiotherapy workers were found to be 0.66, 1.56, and 0.28 mSv, respectively. The results of the measured annual dose were well below the international recommended dose limit of 20 mSv. Keywords: Occupational radiation dose, radiation workers, TLD, radiation protection

  1. "Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

    Science.gov (United States)

    Ghaffar-Kucher, Ameena

    2015-01-01

    Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

  2. A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

    Science.gov (United States)

    Khurshid, Ayesha

    2012-01-01

    Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

  3. Educational needs of faculty members of Shahid Sadoughi University of Medical Sciences in 2011

    Directory of Open Access Journals (Sweden)

    S. S Mazloomy Mahmoodabad

    2012-11-01

    Full Text Available Introduction: Identifying educational needs is an essential step in planning faculty development programs. It plays an important role in promoting the quality of education. The aim of this study was to determine and prioritize the educational needs of clinical and non clinical faculty members of Faculty of Medicne of Shahid Sadoughi University of Medical Sciences. Methods: A questionnaire was developed for this cross-sectional study using the indices identified by reviewing the literature. The questionnaire was sent to all faculty members of Medical Faculty (n=260. The items were scored from 1 to 20 according to the importance of the educational needs. Data was analyzed by SPSS software. Results: Different areas of educational needs of the clinical faculty members were respectively prioritized as: familiarity with National Medical Universities Ranking Schemeresearch, personal development, administrative and executive activities, education, specialized activities outside the university and health services and health promotion. In the non clinical faculty members: research, familiarity with National Medical Universities Ranking Schemeeducation, personal development, specialized activities outside the university, administrative and executive activities. The first priority of education in the clinical faculty members was design, implementation and analysis of oral exams. In research domain priorities were data analysis skills and the first priority of education in the non clinical faculty members was how to foster critical thinking and reasoning in research and critical appraisal skills. Conclusion: Faculty members need all of the seven studiedmajor areas. It is recommended further research to determine the weight of these seven areas using a standard method.

  4. Source of learning basic clinical skills by medical interns Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Meshkani Z

    2004-07-01

    Full Text Available Background: Effective clinical teaching is a major objective in general practitioner’s education at medical schools. Purpose: To identify the sources of clinical skills learning that medical student experience Methods: In this cross sectional study, interns of Tehran medical university who spent at least 12 months of their internship answered a questionnaire on the sources of clinical skills training. Chi2 test was used to examine the association of source of learning and students,’ specification such as sex, score of pre –internship exam, and marital status. Results: All 250 interns who were eligible participated. Over all 46.60% interns learned their clinical skills from residents or clinical teachers, 29.61% observed others performing the procedures, 16.25 learned the skills from hospital staff or nurses, 7.54% practiced their knowledge when confronted to an emergency situation Conclusion: Our results warrant a more attentive approach to clinical skills (specially procedural skills training Key words: LEARNING RESOURCES

  5. Differences in the pregnancy gestation period and mean birth weights in infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK: a retrospective analysis of routinely collected data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-08-11

    To compare mean birth weights and gestational age at delivery of infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK. Retrospective analysis using routinely recorded secondary data in Ciconia Maternity information System, between 2008 and 2013. Luton, UK. Mothers whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian and living in Luton, aged over 16, who had a live singleton birth over 24 weeks of gestation were included in the analysis (n=14 871). Primary outcome measures were mean birth weight and gestational age at delivery. After controlling for maternal age, smoking, diabetes, gestation age, parity and maternal height and body mass index at booking, a significant difference in infants' mean birth weight was found between white British and Indian, Pakistani and Bangladeshi infants, F(3, 12 287)=300.32, pmothers, compared with Indian mothers (Wald=8.192, df 1, pmothers and preterm delivery, when compared with Pakistani, Bangladeshi and white British women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Pattern of medical admissions at Enugu state university of science ...

    African Journals Online (AJOL)

    Pattern of medical admissions at Enugu state university of science and technology teaching hospital: a 5 year review. ... The diseases encountered most were diabetes mellitus‑735/3,865 (19.1%), hypertension/congestive cardiac failure‑703/3,865 (18.2%), strokes‑614/3,865 (15.9%) and human immunodeficiency virus ...

  7. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  8. Student-Life Stress Level and its Related Factors among Medical Students of Hamadan University of Medical Sciences in 2015

    Directory of Open Access Journals (Sweden)

    Roya Nikanjam

    2016-03-01

    Full Text Available Background and Objectives: Student-life stress can lead to various negative consequences such as physical illness, mental disorders or exhaustion. The present study was conducted to evaluate the level of student life stress and its related factors among medical students of Hamadan University of Medical Sciences. Materials and Methods: This cross-sectional study applied multistage random sampling to select 500university students at Hamadan University of Medical Sciences during 2015. The data collection tool used in this study was a self-report questionnaire containing two parts: a section on subjects' demographic details and another section for Student-Life Stress Inventory (SLSI. Data were analyzed in SPSS20-using descriptive and inferential statistics, such as independent t-test, Pearson’s correlation test and one-way ANOVA. Results: This study revealed that %57of the students had moderate levels of stress. The most important stressors included self-impose and pressure, and also the most important reactions to stressors included cognitive appraisal and emotional reactions, respectively. There was a significant association between exam stressors and branch, educational level, and mother's and father's education level (P< 0.05. Conclusions: According to the high level of stress in students and the recognition of demographic factors, effective educational interventions can be conducted to reduce stress.

  9. [Tobacco smoking amongst students in the Medical Faculty of Wroclaw Medical University].

    Science.gov (United States)

    Kurpas, Donata; Jasińska, Ajicja; Wojtal, Mariola; Sochocka, Lucyna; Seń, Mariola

    2007-01-01

    The main aim of health promotion and diseases profilaxis is a struggle with smoking, which is a well known factor in many disorders, i.e. malignant carcinomas, noncarcinomatous diseases of respiratory system and cardiovascular diseases. The aim of the study was the analysis of the smoking level amongst the students of 6th year of the Medical Faculty of Wroclaw Medical University. Amongst 131 polled women--116 were non-smoking persons (88.5%), 15 smoking (11.5%). Amongst 55 polled men--43 these are non-smoking persons (78%), 12 smoking (22%). Out of smoking women, the most women (6) is smoking from 11 to 15 cigarettes per day, out of smoking men, the most (5 men)--6-10 cigarettes per day. Smoking women began smoking during the secondary school the most often. 8 of men began the smoking in the secondary school. The majority of examined didn't try to limit smoking. Respondents would expect the biggest support from close persons during giving up smoking Only 59% of women and 64% of men disagree definitely to smoking in their presence. In the consequence of above results surprising seems still high percentage of smokers amongst examined, scantiness of taking attempts of giving up smoking and indifference of non-smoking medical students towards smoking in their presence.

  10. Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

    International Nuclear Information System (INIS)

    RIZK, M.A.

    2010-01-01

    This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

  11. Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

    Directory of Open Access Journals (Sweden)

    IRFAN UL HASAN

    Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

  12. Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

    International Nuclear Information System (INIS)

    Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

    2017-01-01

    To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

  13. Analysis of the Status Quo of Humanistic Quality-Oriented Education in Medical Colleges and Universities

    Science.gov (United States)

    Liu, Shulei; Li, Yamin

    2012-01-01

    With transformation of contemporary modern medical educational modes and improvement of requirement upon doctors' humanistic quality, it seems quite important to strengthen humanistic quality-oriented education in medical colleges and universities. Medical humanistic quality-oriented education in China started late, which determines that there are…

  14. Type 2 diabetes in 'the young' | Iro | Abia State University Medical ...

    African Journals Online (AJOL)

    Abia State University Medical Students' Association Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 2, No 1 (2000) >. Log in or Register to get access to full text downloads.

  15. Designing a system of mentorship in Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    MITRA AMINI

    2017-04-01

    Full Text Available As you know, one of the new programs of the medical universities is to familiarize the students to the medical atmosphere with the help of compassionate and experienced university professors. The program is planned and implemented under the title of mentorship, in which an experienced instructor takes the responsibility of orientation, guidance and problem solving of a number of students. The students at the time of admission face some problems, usually due to the young age, unfamiliarity with the university context, the amount of the texts, etc.; therefore, they feel somehow defenseless in this atmosphere. In this program, which was longitudinal and often causes a long-term and friendly relationship between the professor and students during the education years, these problems of students discuss with teachers (Mentor and in this interact somewhat elevated. To do the appropriate implementation of this concept in the university, the university was required to be familiar with the concept of mentorship at the first step (1. So, the Education Development Center of Shiraz University of Medical Sciences (EDC has implemented this issue in a series of educational fellowship workshops for the professors of postgraduate levels. In teaching this concept, the Jowhari model (Joseph Luft and Harry Ingham famous model (2 has attracted the attention of authorities and professors of this period. In educating the concept of mentoring, the development of selfgeneralization window of the professors was considered. Because this section covers the ability of communication and flexibility in the leadership of the individuals, development of the window (area decreases the incidence of conflicts and misunderstandings and struggles between individuals in this regard. To develop this area, there was an attempt in this period that the professors get familiar with the two methods of self-openness and feedback. This educational program was a pilot which was implemented in

  16. Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-10-01

    To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

  17. Prevalence of self-medication among university students in Baghdad: a cross-sectional study from Iraq.

    Science.gov (United States)

    Al-Ameri, Rawa J K; Abd Al-Badri, Husham J; Lafta, Riyadh K

    2017-03-30

    The objective of this study is to find out the prevalence and determinants of self-medication among college students in Baghdad, Iraq. A cross-sectional survey was conducted in Al-Mustansiriyah and Al-Nahrain universities, Baghdad, from January to April 2015. A multistage random sampling technique was adopted to collect data from 1435 college students using a questionnaire form. The mean age of the joining students was 19.8 years. Females form 53% of the sample. Self-medications use was prevalent among 92.4% of students. Antipyretics and antibiotics were the most used medicines. Self-medication was higher among urban residents (OR= 7.99, P resilience to self-medication (OR=0.455, P = 0.001). Despite free access to healthcare institutions, nine out of ten college students from Baghdad universities have practiced self-medication. Education of students about the safe use of medications and supervision of pharmacies are effective ways to control this malpractice.

  18. Important TQM Implementation Contributors in Pakistani Petrochemical Sector

    Directory of Open Access Journals (Sweden)

    Yasir Latif

    2014-10-01

    Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

  19. Cardiopulmonary Resuscitation Training for Medical Students in Anesthesiology Rotation in Ardabil Medical University (Iran

    Directory of Open Access Journals (Sweden)

    Kh Isazadehfar

    2009-11-01

    Full Text Available Background and purpose: Cardiopulmonary resuscitation (CPR training for undergraduate medical students has been noted to be poor in the past. Attempts have been made The aim of this study is to determine effect of CPR training in the anesthetic ward to improve knowledge and practice undergraduate medical student of CPR.Methods: A 12 month Educational experimental study with self control was done on all undergraduate medical student (n=30 at the medical university of Ardabil in 2006-2007. During I month of program allthis students have undergone CPR training including basic life support (BLS , advanced cardiac life support (ACLS and practical skills. Data were collected via questionnaire, demographic, pre/post knowledge and practice.Results: After training the acceptable score (good and very good about knowledge of BLS, ACLS and practical skill significantly increased %6.7 to %50 (p=0.0001 , %13.3 to %53.4 (p=0.001 and %3.3 to %100 (p=0.001 respectively. A significant relationship between knowledge of ACLS and practical skills was shown (p=0.005.Conclusion: The CPR training course in anesthetic ward leads to a significant increased in skills and knowledge. Adding this course to undergraduate curriculum of medical students especially in operaticallywards (e.g. Anesthetic ward is essential.Keywords: CARDIOPULMONARY RESUSCITATION; TRAINING; BASIC LIFE SUPPORT; ADVANCED CARDIAC LIFE SUPPORT

  20. Use of antibiotics among non-medical students in a Nigerian university

    African Journals Online (AJOL)

    Background: Antibiotic misuse is a major contributory factor to treatment failure, antibiotic resistance and high healthcare costs. Objectives: To evaluate level of self-reported antibiotic misuse among non-medical undergraduate students of a Nigerian university. Methods: Respondents' knowledge of antibiotics and disposal ...

  1. Use of antibiotics among non-medical students in a Nigerian university

    African Journals Online (AJOL)

    EB

    Abstract. Background: Antibiotic misuse is a major contributory factor to treatment failure, antibiotic resistance and high healthcare costs. Objectives: To evaluate level of self-reported antibiotic misuse among non-medical undergraduate students of a Nigerian university. Methods: Respondents' knowledge of antibiotics and ...

  2. Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2010-11-01

    To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

  3. Self-medication among healthcare and non-healthcare students at University of Ljubljana, Slovenia.

    Science.gov (United States)

    Klemenc-Ketis, Zalika; Hladnik, Ziga; Kersnik, Janko

    2010-01-01

    To determine the incidence of self-medication among University of Ljubljana students and the effect of the type of curriculum on the pattern of self-medication. The study included a sample of 1,294 students who freely accessed a self-administered web-based questionnaire in the Slovene language that consisted of a preliminary letter introducing the term 'self-treatment' and 2 sections about self-medication. The preliminary letter asked participants to report the practice of self-treatment during the past year. The main outcome measures were percentages of those reporting self-medication during the past year, which were then used to compare healthcare and non-healthcare students. A majority of students (1,195, 92.3%), both healthcare and non-healthcare, reported the use of some sort of self-medication during the study period. More healthcare students in their senior year (353, 94.1%) than those in their junior year (245, 89.4%) used self-medication (p = 0.04). Healthcare students (p = 0.05) thought that self-medication without improvement of the symptoms should last for 1 week or less. They acquired the drugs for self-medication from pharmacies; thought that previous doctors' advice in a similar situation was a more important reason for self-medication; would seek the advice of a physician or pharmacist for different ways of self-treatment, and quite interestingly thought that self-medication was not very safe. On the other hand, non-healthcare students acquired the drugs from healers and friends. The study showed that self-medication was common among all University of Ljubljana students, but that healthcare-related education in students and young adults led to more responsible use of self-medication. Copyright 2010 S. Karger AG, Basel.

  4. Medical curriculum reform in Sun Yat-sen University: implications from the results of GMER evaluation in China.

    Science.gov (United States)

    Xiao, Haipeng; Xian, Liqing; Yu, Xueqing; Wang, Jianping

    2007-09-01

    Created by interlocking economies, a global language, the informatics revolution and rapid travel, globalization has penetrated all aspects of human life including science, environment, public health and medicine. Physicians are now members of a global community. The global physician should possess universal core essential competences required for medical practice throughout the world. The Institute for International Medical Education (IIME), created by the China Medical Board (CMB) of New York, has developed the " global minimal essential requirements" (GMER) that define the knowledge, skills, professional behavior and ethics that all physicians must have regardless of where they received their general medical education and training. The IIME initiated a pilot project in China in October, 2003, to evaluate the graduates of the 7- or 8-year track program of eight leading medical schools, including Medical School of Sun Yat-sen University. The results of GMER evaluation indicated strengths and areas for improvement of our school in relation to international standards, which greatly re-invigorate our enthusiasm on medical curriculum reform on the new 8-year track program in Medical School of Sun Yat-sen University. The modifications of our medical curriculum for the new 8-year track program based on the results of GMER evaluation are discussed in this paper.

  5. Medicalization of global health 4: The universal health coverage campaign and the medicalization of global health.

    Science.gov (United States)

    Clark, Jocalyn

    2014-01-01

    Universal health coverage (UHC) has emerged as the leading and recommended overarching health goal on the post-2015 development agenda, and is promoted with fervour. UHC has the backing of major medical and health institutions, and is designed to provide patients with universal access to needed health services without financial hardship, but is also projected to have 'a transformative effect on poverty, hunger, and disease'. Multiple reports and resolutions support UHC and few offer critical analyses; but among these are concerns with imprecise definitions and the ability to implement UHC at the country level. A medicalization lens enriches these early critiques and identifies concerns that the UHC campaign contributes to the medicalization of global health. UHC conflates health with health care, thus assigning undue importance to (biomedical) health services and downgrading the social and structural determinants of health. There is poor evidence that UHC or health care alone improves population health outcomes, and in fact health care may worsen inequities. UHC is reductionistic because it focuses on preventative and curative actions delivered at the individual level, and ignores the social and political determinants of health and right to health that have been supported by decades of international work and commitments. UHC risks commodifying health care, which threatens the underlying principles of UHC of equity in access and of health care as a collective good.

  6. Universitätsbibliothek der Medizinischen Universität Wien – größte Medizinbibliothek Österreichs: Hybridbibliothek als Zukunftskonzept / University Library of the Medical University Vienna – largest Medical Library of Austria: Hybrid Library as a concept for the future

    Directory of Open Access Journals (Sweden)

    Hartl, Margrit

    2009-12-01

    Full Text Available The today’s Medical University Library was established as Faculty Library of the Vienna University Library in 1986 and serves till now as the largest Medical Library in Austria. The Main Library is located in the Vienna General Hospital (University hospitals. During 1994 and 2003 it became the Austrian Central Library for Medicine. Since 2004 University Library of the newly founded Medical University of Vienna supplies literature and information for 8500 Students, 1800 scientists and 1600 doctors. The article describes the Library’s participation on projects of the Austrian Library Consortium and the Austrian Cooperation for E-media. It specifies the offers and use of the digital library (professional databases, electronic journals, document delivery, e-books but also the website and the “Van Swieten”-Blog which are the information and communication platforms of the University Library. The next part shows the supply of traditional library which consists of the Clinical Library, the Textbook Collection and the Students Reading Room. We report also on the Library for the History of Medicine, their precious medical historical holdings and their current activities connected with the digitalization of the card index. The library’s activities to the “Medizin Curriculum Wien”, trainings and tours are told in the chapter about the Teaching Library but also the Information Retrieval Service and the activities due to training, placement and projects of librarians. Another part speaks about the special activities in international projects like “subito”, “E-books on demand” and a gateway for PDAs. The Medical University Library was the first Austrian library who used the LinkOut function of PubMed. The library works on a project of “Wiedergutmachung” (NS-Provenienzforschung and a very ambitious Weblog for the remembrance of the displaced professors at the medical faculty of the University of Vienna in 1938. The last chapter

  7. Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

    Directory of Open Access Journals (Sweden)

    Dr. Abdul Muhaimin

    2017-02-01

    Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

  8. TEACHING MATHEMATICAL DISCIPLINES AT THE MEDICAL UNIVERSITY

    Directory of Open Access Journals (Sweden)

    V. Ya. Gelman

    2018-01-01

    Full Text Available Introduction.In programs of training of students of medical specialties, Mathematics is a subject of basic education, i.e. non-core discipline. However, studying Mathematics is extremely important for future physicians, as recently there has been an impetuous development of mathematization in the field of health care. Today, a set of the new medical devices, the equipment and high technologies are being developed based on the mathematical modeling, analysis and forecasting. Mathematical methods are widely applied to diagnostics, development of life-support systems and the description of various biological processes both at the molecular level,  and at the level of a whole organism, its systems, bodies and tissues. The solution of many medical tasks in the field of taxonomy, genetics, and organization of medical service is impossible without knowledge of mathematics. Unfortunately, along with the evident importance of mathematical preparation for a medical profession, its need is poorly realized not only by junior students, but even by some teachers of specialized departments of medical schools.The aim of the publication is to discuss the problems that arise in the teaching of mathematical disciplines to students at a medical school and to suggest possible solutions to these problems.Methodology and research methods. The study is based on the use of modeling of the educational process. The methods of analysis, generalization and the method of expert assessments were applied in the course of the research.Results and scientific novelty. The aspects of mathematical preparation at the university are considered on the basis of the application of the multiplicative model of training quality. It is shown that the main students’ learning difficulties in Mathematics are connected with the following factors: the initial level of mathematical preparation of students and their motivation; outdated methods of Mathematics teaching and academic content

  9. E-learning in Type 1 Medical Universities of Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher ROKNI

    2005-07-01

    Full Text Available ABSTRACT Nowadays the Internet is the technological pedestal of organization in the information society and one of the main applications that the Internet offers is the Digital Library (DL. Each society, especially those that claim training of the public, predictably need implementation and endorsement these systems. The time of chalk and board is passed and the globalization and universal village demands a movement targeting to establish an information society. The university is said to be responsible for making "Human". In the era of information explosion, how can a university rely on a physical classroom, a tired teacher and some drowsy students listening to him? Internet "the sweet invention of man" is a bridge, between "slump" and "spurt". It is up to each authority in a university to design, employ, develop and evaluate a system embracing Internet, Multimedia, Network and so on to go parallel in modern era and to introduce the supreme system of E-learning in its program. Of different aspects of E-learning including computer networks, multimedia, search engines, electronic libraries, distance learning, and all that (Piskurich, 2003, most of the type 1 medical universities of Iran exploit, some how or another, all or some of them. These universities including Tehran, Iran, Shahid Beheshti, Mashhad, Isfahan, Tabriz, Shiraz, Ahwaz, and Kerman, at present encompass a powerful link with their audiences regarding digital libraries, search engine and authentic data bases. The present article is going to have a bird's eye view at various capacities of these universities in this regard.

  10. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

    Science.gov (United States)

    Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

    2017-09-01

    Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

  11. The "schola medica salernitana": the forerunner of the modern university medical schools.

    Science.gov (United States)

    de Divitiis, Enrico; Cappabianca, Paolo; de Divitiis, Oreste

    2004-10-01

    The schola medica salernitana is considered the oldest medical school of modern civilization. Salerno's long medical tradition began during the Greco-Roman period in a Greek colony named Elea, where Parmenides decided to found a medical school. The fame of the school became more and more important during the 10th century, and it was best known in the 11th century. In the middle of 12th century, the school was at its apogee, and Salerno provided a notable contribution to the formulation of a medical curriculum for medieval universities. The most famous work of the Salernitan School was the Regimen Sanitatis Saleritanum, a Latin poem of rational, dietetic, and hygienic precepts, many of them still valid today. The school also produced a physician's reference book, with advice on how to treat a patient, a sort of code of conduct to help the physician to respect the patient and his or her relatives. The first science-based surgery appeared on the scene of the discredited medieval practice in Salerno, thanks to Roger of Salerno and his fellows. He wrote a book on surgery, called Rogerina or Post Mundi Fabricam, in which surgery from head to toe is described, with surprising originality. The important contribution to the School of Salerno made by women as female practitioners is outlined, and among them, Trotula de Ruggiero was the most renowned. The period when the School of Salerno, universally recognized as the forerunner of the modern universities, became a government academy was when Frederick II reigned over the Kingdom of the Two Sicilies, as Emperor of the Holy Roman Empire.

  12. Financial and Transactional Bylaw of Universities and Faculties of Medical Sciences: Opportunities and Threats

    Directory of Open Access Journals (Sweden)

    Masoud Abolhallaje

    2013-12-01

    Full Text Available Background and purpose: According to developments related to the relative autonomy of universities and acquired extensive powers by the board of trustees of universities of medical sciences and healthcare services in a twenty-year perspective of country and in the context of the fourth and fifth socio-economic cultural development of country, necessity of developing financial and transactional bylaw of universities of medical sciences has become increasingly clear throughout country. Materials and Methods: Grounded theory is the qualitative methodology used for this study in order to identify the threats and opportunities of new financial tax bylaw of universities and faculties of medical sciences and through the study of documents, surveys of experts and beneficiaries and elites by Delphi method. Results: Releasing potential of public administration in order to control sources and uses, increasing management confidence in documented decision making, establishing organizational concentration on controlling costs, providing conditions of decision-making according to financial reports, independency in firing and hiring manpower by adopting specific provisions and creating independency in method of keeping accounts are among the most important opportunities. While poor organizational structure, lack of knowledge and skills in the existing structure, mental processes caused by reactions and incompatibility of staff, lack of criteria and rules in selection appointment and dismissal of managers and employees, lack of discipline and proper mechanisms in order to pursue the purposes, calculating financial burden and human resources required and finally, passing through traditional thinking and management system are among the most threats. Conclusion: Considering the mentioned threats and opportunities, financial and transactional bylaw of universities and faculties of medical sciences was basically revised and modified in January 2006, and then after

  13. Assessing the impact of faculty development fellowship in Shiraz University of Medical Sciences.

    Science.gov (United States)

    Ebrahimi, Sedigheh; Kojuri, Javad

    2012-02-01

    Changing concepts of education have led many medical schools to design educational programs to enhance teaching skills, as traditional approaches cannot fulfill the current students' needs. The educational development of medical faculty members has recently received impetus in Iran and the Eastern Mediterranean region. The aim of this study was to investigate whether participation in a faculty development program reinforced new teaching skills. A teacher-training program was designed at Shiraz University of Medical Sciences to help medical instructors improve their teaching skills. The program, imparted in workshop format, covered effective teaching methods, feedback, knowledge assessment, and time management. Program sessions lasted four hours, four days each week for one month. Instruction was in the form of lectures, group discussions, case simulations, video presentations, and role-playing. All participants in the study (n = 219) belonged to the academic staff of Shiraz University of Medical Sciences. The participants highly rated the quality of the program. They felt that the educational intervention was appropriate and had a positive impact on their knowledge (P effectiveness of the program in strengthening the participants' teaching ability showed that students noticed significant improvements in the participants' teaching abilities (P effect on medical teachers' competencies, and we suggest that our educational intervention is effective in achieving its aims. Further research should investigate whether this faculty development program actually results in improved teaching performance.

  14. Strategies to Improve Students’ Educational Achievement Motivation at Guilan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Mahdokht Taheri

    2015-12-01

    Full Text Available Introduction: In view of the fact that motivation is linked directly to the learning process and educational achievement, this study endeavored to identify strategies to improve students’ educational achievement motivation at Guilan University of Medical Sciences. Methods: To conduct this descriptive-analytical study, 368 students from Guilan University of Medical Sciences were selected using simple random sampling from 2013-2014. All of the Guilan University of Medical Sciences’ students met the general eligibility criteria except guest students. The questionnaire included five domains of economic, socio-cultural, educational, geo-regional, and personality factors in educational achievement motivation. Through using descriptive and inferential statistics (Kolmogorov-Smirnov, Mann-Whitney U and Kruskal-Wallis tests, the compiled data were analyzed at the significance level of 0.05. Results: Data analysis revealed that socio-cultural factors have the maximum score (64.14 ± 9.92 and geo-regional factors have the minimum score (19.01±3.63 on the participants’ educational achievement motivation. What is more, a significant difference was revealed between educational field and educational effective factors as well as educational level and educational effective factors (p<0.011, p<0.004, respectively. Conclusion: Given that the socio-cultural factors had the maximum score on the students’ educational achievement motivation, it is recommended that university officials take these factors into account, and attempt to plan to provide appropriate strategies to enhance their students’ motivation, specifically their educational achievement motivation.

  15. Journal publications from Zagreb University Medical School in 1995-1999.

    Science.gov (United States)

    Petrak, Jelka; Bozikov, Jadranka

    2003-12-01

    To analyze a five-year publication output of the Zagreb University Medical School in scientific journals, especially in the journals covered by the Current Contents (CC), bibliographic database of the Institute for Scientific Information. Medical School of the Zagreb University is organized in 10 preclinical, 6 public health, and 17 clinical departments, with 359 faculty members. Research activity is important for the academic promotion, with the number of publications (especially in journals covered by CC) and their impact as a key element. Bibliographic data on the published papers by the authors affiliated to the Zagreb University Medical School in the 1995-1999 period were searched in the CC and Biomedicina Croatica databases, according to the official faculty name list. The collected data were classified into three groups according to the source journals: papers published in international journals covered by the CC, Croatian journals covered by the CC, and Croatian journals not covered by the CC. The publication production was measured on individual and departmental levels by using two counting schemes: a) full publication to each author/department; and b) an equal fraction of a publication (1/n) to each author/department. In the 1995-1999 period, the faculty published 578 papers in the journals covered by the CC, 22.6% of them in the subset of Croatian journals. The differences among departments were considerable, with publishing activity per faculty member varying from 0.25 to 6.23 papers in CC journals and from 0.0 to 15.8 in Croatian non-CC journals. Preclinical departments published significantly less in the Croatian journals indexed in the CC then public health and clinical departments. There was a high variance in the number of publications on the individual level, with the 15.4% of the faculty in the professor rank and 45% in the assistant rank who did not publish a single paper in journals covered by the CC in the analyzed period. On the contrary, 10

  16. Barriers and challenges in researches by Iranian students of medical universities.

    Science.gov (United States)

    Anbari, Zohreh; Mohammadbeigi, Abolfazl; Jadidi, Rahmatollah

    2015-01-01

    Health sciences research (HSR) is an essential part of improving health care which plays a critical role in the field of medicine and clinical practice. The aim of the current study was to assess barriers to the research by students of medical sciences as well as to find out effective strategies for management of student researches in Iranian universities. This study utilized a hybrid design with quantitative and qualitative analytical approaches conducted on 627 students in six schools of medical sciences in two universities in Central Province in Iran from April to December, 2012. Questionnaires were distributed among researcher and non-researcher students to find barriers to the research. These barriers were approved and validated by similar studies and strategies using the Delphi technique on 36 students. The most important barriers among researcher students were institutional barriers (3.3 ± 1.3), but in non-researcher students they were individual barriers (3.6 ± 1.7). The majority of barriers to involvement in the research among researcher students appeared to be time, lack of access to electronic resources and prolongation of the process of buying equipment. In addition, the greatest barriers among non-researcher students included the lack of time, scientific writing skills, and access to trained assistants. The results showed the issue of attitudes towards compulsory research as a component of critical scholarship in the curriculum of medical courses. Moreover, employment of the research experts can be helpful for research training in schools of medical sciences.

  17. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

    Science.gov (United States)

    Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

    2012-02-27

    A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

  18. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

    Science.gov (United States)

    Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

    2017-01-01

    Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

  19. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Mir Mohammed

    2012-02-01

    Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

  20. The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

    Science.gov (United States)

    Goodwin, Laura; Hunter, Billie; Jones, Aled

    2018-02-01

    In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  1. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    Energy Technology Data Exchange (ETDEWEB)

    Kamal, N.

    1999-01-01

    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  2. Attitudes toward Psychiatry: A Survey of Medical Students at the University of Nairobi, Kenya

    Science.gov (United States)

    Ndetei, David M.; Khasakhala, Lincoln; Ongecha-Owuor, Francisca; Kuria, Mary; Mutiso, Victoria; Syanda, Judy; Kokonya, Donald

    2008-01-01

    Objectives: The authors aim to determine the attitudes of University of Nairobi, Kenya, medical students toward psychiatry. Methods: The study design was cross-sectional. Self-administered sociodemographic and the Attitudes Toward Psychiatry-30 items (ATP-30) questionnaires were distributed sequentially to every third medical student in his or her…

  3. Attitude of clinical faculty members in Shiraz Medical University towards private practice physicians' participation in ambulatory care education

    Directory of Open Access Journals (Sweden)

    Khatereh Mahori

    2002-04-01

    Full Text Available Background: Improvement of medical education is necessary for meeting health care demands. Participation of private practice physicians in ambulatory care training is an effective method for enhancing medical students' skills. Purpose This study was undertaken to determine clinical professors' views about participation of physicians with private office in ambulatory care training. Methods: Participants composed of 162 Shiraz Medical University faculty members from 12 disciplines. A questionnaire requesting faculty members' views on different aspects of ambulat01y care teaching and interaction of community-based organizations was distributed. Results: Of 120 (74.1% respondents, 64 (54.2% believed that clinical settings of medical university are appropriate for ambulatory care training. Private practice physicians believed more than academic physicians without private office that private offices have wider range of patients, more common cases, and better follow up chance; and is also a better setting for learning ambulatory care compared with medical university clinical centers. Overall, 32 (29.1% respondent’s found the participation of physicians with private practice on medical education positive. Key words medical education, ambulatory medicine, private practice

  4. Pattern of self-medication with analgesics among Iranian University students in central Iran

    Directory of Open Access Journals (Sweden)

    Shadi Sarahroodi

    2012-01-01

    Full Text Available Background: Self-medication is defined as the use of drugs for the treatment of self-diagnosed disorders. It is influenced by factors such as education, family, society, law, availability of drugs and exposure to advertisements. This study was performed to evaluate self-medication with analgesics and its pattern among different groups of Iranian University Students. Materials and Methods: A randomized, cross-sectional, multicenter study was conducted from December 2009 to February 2010. The target population of this study was 564 students out of 10,000 students attending four medical and non-medical science universities in Qom state. Data was analyzed using SPSS version 16, and analysis was conducted with descriptive analysis procedures. Results: 76.6% of the students had used analgesics in self-medication in the previous 3 months. The frequency of analgesic use in the study period was once in 19.2% of the participants, twice in 22.2%, three times in 16.3% and more than three times in 35.5% of the participants, although 6.8% of them were not sure when they were used. Of all the respondents, 49.8% reported headache as the problem. This was the most common problem, after which came Dysmenorrhea,headache and stomach ache. Bone and joint pains were other problems that led to the use of analgesics. The most commonly used source of information for self-medication with analgesics was advice from friends and family (54.7%, previously prescribed medications (30.1%, their medical knowledge (13.3% and recommendation of a pharmacist (1.9%. Conclusion: Self-medication with analgesics is very high among Iranian students in Qom city. This could be an index for other parts of the Iranian community. Because the source of information about analgesics is inappropriate, we would recommend education courses about analgesics and self-medication on the radio and television for the entire population.

  5. Dysmenorrhea among female medical students in King Abdulaziz University: Prevalence, Predictors and outcome

    Science.gov (United States)

    Ibrahim, Nahla Khamis; AlGhamdi, Manar Saleh; Al-Shaibani, Alanoud Nawaf; AlAmri, Fatima Ali; Alharbi, Huda Abdulrahman; Al-Jadani, Arwa Kheder; Alfaidi, Raghad Ahmed

    2015-01-01

    Objective: To determine the prevalence, predictors and outcome of dysmenorrhea among female medical students in King Abdulaziz University (KAU), Jeddah, Saudi Arabia. Methods: A cross-sectional study was conducted among 435 medical students at KAU, Jeddah selected through stratified random sample method. A pre-constructed, validated, self-administered questionnaire was used to collect personal and socio-demographic information. Data about menstrual history, stress, smoking were also collected. The severity of dysmenorrhea was scored by the “Visual Analogue Scale (VAS)”. Descriptive and analytical statistics were conducted. Results: The prevalence of dysmenorrhea was 60.9%. Logistic regression showed that heavy period was the first predictor of dysmenorrhea (aOR=1.94; 95% CI: 1.29- 2.91), followed by stress (aOR=1.90; 95% C.I.: 1.19-3.07). The prevalence of severe dysmenorrhea among the sufferers was 38.6%. Depressed mood was the commonest (80.8%) symptom accompanying dysmenorrhea. Regarding the outcome of dysmenorrhea, 67.5% of the sufferes reported emotional instability, while 28.3% reported absenteeism from the university. Conclusions: A high prevalence of dysmenorrhea was prevalent among medical students in King Abdulaziz University (KAU), Health promotion, screening programs, and stress management courses are recommended. PMID:26870088

  6. Conflict of Interest Policies at Canadian Universities and Medical Schools: Some Lessons from the AMSA PharmFree Scorecard

    Directory of Open Access Journals (Sweden)

    Mathieu, Ghislaine

    2012-07-01

    Full Text Available Launched in 2007, the American Medical Students Association (AMSA PharmFree Scorecard is an annual ranking of conflict of interest (COI policies at American medical centres; it focuses on COIs that may occur when medical education seems likely to be influenced by university-industry relationships, especially those with the pharmaceutical and medical device industries. The PharmFree Scorecard has proven influential in stimulating changes in policy regarding the management of COI at American medical institutions, thus it provides a useful jumping off point for reflection on how and why medical education institutions in other countries – and for our purposes, Canada – should pay more attention to the appropriate identification and management of COI. The PharmFree Scorecard methodology examines a diversity of factors and interests that could influence medical education; as such, it is an interesting approach to analysing the COI policies of medical schools. To test its utility or applicability outside the US, we decided to apply the PharmFree Scorecard to the COI policies of the 16 Canadian universities hosting medical schools. Overall, Canadian institutions rank very poorly, especially in ensuring that education and training tools are provided to staff, students and faculty members to enable the identification and management of COI. However, differences between the US and Canadian medical education contexts, e.g., with regards to the governance and funding of universities, limit to some extent the direct applicability of the AMSA ranking. Canadian medical schools – and their host universities – nonetheless have much to learn from insights provided by the AMSA PharmFree Scorecard ranking, although they can and should go further in developing their own COI policies and procedures.

  7. Determining Knowledge of Students in Tehran University and Tehran University of Medical Sciences About ECSTASY Tablets

    Directory of Open Access Journals (Sweden)

    G. Khoshe Mehri

    2012-10-01

    Full Text Available Objective: Nowadays, addiction is considered one of the greatest social and economical and health problems. Undoubtedly, The Ecstasy have between some juveniles and youths. This study was performed to understand the knowledge about the Ecstasy tablets. Methods: In this descriptive-analytical study 200 students from Tehran universities and universities of medical sciences. Data collecting tool was a structured questionnaire containing 14 questions. Data was analyzed using chi square. Results: It was revealed that only 44 students had high, 55 student had moderate and 101 students had weak knowledge about Ecstasy. There was no significant relationship between knowledge score and variable such as gender, place of residence. Also, there was a significant correlations between age, marriage position , occupation and college about the Ecstasy . Conclusion: That in order to increase the knowledge leveling the students about Ecstasy, mass medias like television, newspapers, radio and university sittings.

  8. A comparison of attitudes toward euthanasia among medical students at two Polish universities.

    Science.gov (United States)

    Leppert, Wojciech; Gottwald, Leszek; Majkowicz, Mikolaj; Kazmierczak-Lukaszewicz, Sylwia; Forycka, Maria; Cialkowska-Rysz, Aleksandra; Kotlinska-Lemieszek, Aleksandra

    2013-06-01

    The aim of the study conducted upon completion of obligatory palliative medicine courses among 588 medical students at two universities was to compare their attitudes toward euthanasia. Four hundred ninety-two (84.97 %) students were Catholics; 69 (11.73 %) declared they would practice euthanasia, 303 (51.53 %) would not, and 216 students (36.73 %) were not sure. The idea of euthanasia legalisation was supported by 174 (29.59 %) respondents, opposed by 277 (47.11 %), and 137 (23.30 %) were undecided. Five hundred fifty-six (94.56 %) students did not change their attitudes toward euthanasia after palliative medicine courses. Students from the two universities were found to have different opinions on practicing euthanasia, euthanasia law and possible abuse which might follow euthanasia legalisation, but they shared similar views on the choice of euthanasia if they themselves were incurably ill and the legalisation of euthanasia. Gender and religion influenced students' answers. Differences observed between medical students at the two universities might be related to gender and cultural differences.

  9. Consultation Needs Assessment in Kermanshah University of Medical Sciences: Viewpoints of Medical Students

    Directory of Open Access Journals (Sweden)

    Cyrus Jalili

    2018-01-01

    Full Text Available Introduction: Consultation can play an effective role in accommodating students to conditions and can be followed by academic achievement. This study was aimed to determine the consultation needs assessment among medical students in Kermanshah University of Medical Sciences (KUMS. Methods: This cross-sectional study was conducted among 300 students from undergraduate basic sciences of medical faculty of KUMS during 2016. Two structured questionnaires were applied for collecting data: demographics and consultation needs assessment. Data were analyzed by SPSS version 16 using bivariate correlations, t-test, and ANOVA test. Results: The age range of participants was 19 to 31 with the average of 22.78±2.30. Gender was associated significantly and statistically with the areas of individual growth and promotion needs, educational needs, employment needs and emotional needs; girls in these areas acquired a higher score compared to boys (P<0.05. Furthermore, the domain of individual growth and promotion needs acquired the highest score. Conclusion: Our findings indicated that most of the students' needs were in the field of individual and educational growth and promotion. Furthermore, the average scores of guidance and consultation needs assessment of the female students was higher, with the necessity of paying more attention to the consultation problems among them.

  10. Home Medication Cabinets and Medication Taking Behavior of the Staffs in a University in China

    Science.gov (United States)

    Xue, Chengbin; Ye, Juan; Dong, Yuzhen; Xu, Chunmei

    2018-01-01

    Background: A growing sum of medicines is stored in home medication cabinets in China, with the behavior of self-medication increasing. Although responsible self-medication can help prevent and treat ailments that do not need professional consultation, it bears the risk of misuse of medicines issued on prescription due to inadequate prescription medicine administration. Objective: The objective of this study was to investigate the condition and safety of medication storage and intended self-medication in a University in China. Method: The study was conducted over 10 month period (May 2015-March 2016) and involved a random sample of households. The questionnaire survey and personal insight into household medicine supplies was performed by a team of trained pharmacy staffs. Interviewees (N = 398, aged 16-88 y) were visited door to door and the home medication cabinets were catalogued after the participants were interviewed. Results: The majority (89.71%) households have home medicine cabinets. The total number of medicine items in the 398 households was 5600, with a median of 14 per household. The most frequently encountered categories of registered medicines were cough and cold medcines (47.8%), antibacterials for systemic use (30.0%), topical products for joint and muscular pain(26.1%), vitamins (23.2%), medication for functional gastrointestinal disorders (23.2%), oral and external forms have not kept separately(55.1%). The most treatment related problems recorded were curative effect not ideal (57.9%). 68% of the sample population would choose doctors as medication consultation object about medicines purchased. Conclusion: Large sum of medicines were found per household, with a high prevalence of cough and cold medcines. Public services in China, mainly government and health organizations, need put more effort on educating people on how to store medicines, as well as finding a way to raise awareness of the public in promoting behavioral change about medication

  11. Utilization of research reactors in universities and their medical applications

    International Nuclear Information System (INIS)

    Kanda, Keiji.

    1983-01-01

    In Japan, five research reactors and a critical assembly are operated by the universities. They are opened to all university researchers, the system of which is financially supported by the Ministry of Education, Culture and Science of the Japanese government. Usually KUR is operated eight cycles per year. One cycle consists of the following four week operation: 1. Mainly for researchers from other universities; 2. Mainly for researchers in the institute; 3. Mainly for beam experiment; 4. Sort time experiment. In the weeks of 1 ∼ 3 the KUR is operated continously from Tuesday morning to Friday evening. The experiment include studies on physics, chemistry, biology, medicine, engineering etc. Recently the medical application of research reactors has become popular in Japan. The new technique of the boron neutron capture thereby has been successfully applied to brain tumors and will be to melanoma (skin cancer) in near future. (author)

  12. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    Energy Technology Data Exchange (ETDEWEB)

    Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

    2011-06-15

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  13. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    International Nuclear Information System (INIS)

    Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

    2011-01-01

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  14. Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

    Science.gov (United States)

    Nauman, Sarwat; Hussain, Nasreen

    2017-01-01

    Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

  15. Understanding constructive feedback: a commitment between teachers and students for academic and professional development.

    Science.gov (United States)

    Hamid, Yasir; Mahmood, Sajid

    2010-03-01

    This review highlights the need in the Pakistani medical education system for teachers and students to be able to: define constructive feedback; provide constructive feedback; identify standards for constructive feedback; identify a suitable model for the provision of constructive feedback and evaluate the use of constructive feedback. For the purpose of literature review we had defined the key word glossary as: feedback, constructive feedback, teaching constructive feedback, models for feedback, models for constructive feedback and giving and receiving feedback. The data bases for the search include: Medline (EBSCO), Web of Knowledge, SCOPUS, TRIP, ScienceDirect, Pubmed, U.K. Pubmed Central, ZETOC, University of Dundee Library catalogue, SCIRUS (Elsevier) and Google Scholar. This article states that the Pakistani medical schools do not reflect on or use the benefits of the constructive feedback process. The discussion about constructive feedback suggests that in the context of Pakistan, constructive feedback will facilitate the teaching and learning activities.

  16. Barriers and challenges in researches by Iranian students of medical universities

    Directory of Open Access Journals (Sweden)

    Zohreh Anbari

    2015-01-01

    Full Text Available Background: Health sciences research (HSR is an essential part of improving health care which plays a critical role in the field of medicine and clinical practice. The aim of the current study was to assess barriers to the research by students of medical sciences as well as to find out effective strategies for management of student researches in Iranian universities. Materials and Methods: This study utilized a hybrid design with quantitative and qualitative analytical approaches conducted on 627 students in six schools of medical sciences in two universities in Central Province in Iran from April to December, 2012. Questionnaires were distributed among researcher and non-researcher students to find barriers to the research. These barriers were approved and validated by similar studies and strategies using the Delphi technique on 36 students. Results: The most important barriers among researcher students were institutional barriers (3.3 ± 1.3, but in non-researcher students they were individual barriers (3.6 ± 1.7. The majority of barriers to involvement in the research among researcher students appeared to be time, lack of access to electronic resources and prolongation of the process of buying equipment. In addition, the greatest barriers among non-researcher students included the lack of time, scientific writing skills, and access to trained assistants. Conclusion: The results showed the issue of attitudes towards compulsory research as a component of critical scholarship in the curriculum of medical courses. Moreover, employment of the research experts can be helpful for research training in schools of medical sciences.

  17. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences.

    Science.gov (United States)

    Yazdi, Zohreh; Loukzadeh, Ziba; Moghaddam, Parichehr; Jalilolghadr, Shabnam

    2016-01-01

    Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. In this descriptive-correlational study, a total of 285 medical students completed a self-administered questionnaire. Demographic data, sleep-wake schedule in weekday and weekend, and sleep duration were collected. Students' sleep quality was assessed by Pittsburg Sleep Quality Index (PSQI). Data were analyzed by SPSS Ver 13. Overall, 164 (57.5) of students had poor sleep quality. Mean global PSQI score and average score of four subscales were significantly higher in male than female. Regression analysis showed that male students (β=-0.85, Psleep hygiene practices slept worse. The findings of this study showed that the prevalence of poor sleep quality in medical students is high. Improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students.

  18. [Patient-centered care. Improvement of communication between university medical centers and general practitioners for patients in neuro-oncology].

    Science.gov (United States)

    Renovanz, M; Keric, N; Richter, C; Gutenberg, A; Giese, A

    2015-12-01

    Communication between university medical centers and general practitioners (GP) is becoming increasingly more important in supportive patient care. A survey among GPs was performed with the primary objective to assess their opinion on current workflow and communication between GPs and the university medical center. The GPs were asked to score (grades 1-6) their opinion on the current interdisciplinary workflow in the care of patients with brain tumors, thereby rating communication between a university medical center in general and the neuro-oncology outpatient center in particular. Questionnaires were sent to1000 GPs and the response rate was 15 %. The mean scored evaluation of the university medical center in general was 2.62 and of the neuro-oncological outpatient clinic 2.28 (range 1-6). The most often mentioned issues to be improved were easier/early telephone information (44 %) and a constantly available contact person (49 %). Interestingly, > 60 % of the GPs indicated they would support web-based tumor boards for interdisciplinary and palliative neuro-oncological care. As interdisciplinary care for neuro-oncology patients is an essential part of therapy, improvement of communication between GPs and university medical centers is indispensable. Integrating currently available electronic platforms under data protection aspects into neuro-oncological palliative care could be an interesting tool in order to establish healthcare networks and could find acceptance with GPs.

  19. Lenses on metacognition: Teachers’ perceptions toward strategies in reading in a Pakistani context

    Directory of Open Access Journals (Sweden)

    Channa, Mansoor A.

    2017-03-01

    Full Text Available The research in the field of metacognition for developing reading is not new; metacognition has been used for many years to identify ways to develop students’ reading comprehension. Most previous research has addressed either primary or secondary level students. However, notably few studies have been conducted at the undergraduate level. This study has attempted to initiate strategies to assist first-year engineering students in developing their reading abilities within a Pakistani context. The primary objective of this research was to identify what strategies first-year engineering students use in developing their reading at Quaid-e-Awam University of engineering science and technology in Pakistan. This study used qualitative instruments that included semi-structured interviews with teachers and classroom observations during read-aloud sessions. The data were organized through NVivo version 8 for obtaining nodes, codes, and main themes for interpreting the results. The results of this study demonstrated that teachers should use metacognitive strategies for developing students’ reading abilities. Findings also revealed that reading strategies, such as text scanning, guesses from contextual clues, drawing on prior knowledge, and using a dictionary, are the most important strategies to use for developing the reading skills and comprehension of engineering students. This study has suggested metacognitive strategies be used for promoting students’ reading abilities and that teachers should design and develop more courses using these strategies to enhance the reading and listening skills of engineering students.

  20. The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

  1. Genetic characterization of different pakistani date palm varieties

    International Nuclear Information System (INIS)

    Akhtar, W.; Rashid, A.; Mahmood, T.

    2014-01-01

    Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

  2. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  3. Medical Training Experience and Expectations Regarding Future Medical Practice of Medical Students at the University of Cape Verde.

    Science.gov (United States)

    Delgado, Antonio Pedro; Soares Martins, Antonieta; Ferrinho, Paulo

    2017-10-31

    Cape Verde is a small insular developing state. Its first experience of undergraduate medical education began in October 2015. The purpose of this paper is to describe and analyze the professional expectations and profile of the first class of medical students at the University of Cape Verde. A piloted, standardized questionnaire, with closed and open-ended questions, was distributed to registered medical students attending classes on the day of the survey. All data were analyzed using SPSS. Students decided to study medicine in their mid-teens with relatives and friends having had significant influence over their decisions. Other major reasons for choosing medical training include "to take care of other people", "fascination for the subject matters of medicine" and "I have always wanted to". The degree of feminization of the student population is extremely high (20/25; 80.0%). Medical students are in general satisfied with the training program, and have expectations that the training received will allow them to be good professionals. Nevertheless, they consider the course too theoretical. Medical students know that this represents an opportunity for them to contribute to public welfare. Nonetheless, their expectations are to combine public sector practice with private work. Medical students come mostly from Santiago Island where the Capital of the Country is located. They still do not know about their future area of specialization. But all of those who want to specialize want to do so abroad. They mostly expect to follow hospital careers rather than health administration or family and community medicine. This study contributes to the growing body of knowledge about medical students' difficulties and expectations regarding medical schools or curriculums in lusophone countries. The decision to invest in the training of local physicians is justified by the need to be less dependent on foreigners. Local postgraduate medical training programs are already

  4. Academic entrepreneurship in a medical university: A system dynamics approach

    Directory of Open Access Journals (Sweden)

    Tofighi Sharam

    2017-01-01

    Full Text Available Academic entrepreneurship is a dynamic field which is growing after the second academic revolution that added entrepreneurial mission as the Third Mission of universities. In this sense, dynamics of this phenomenon is a suitable field of study and provides fruitful insights for both theory and practice. Thus, in this research, system dynamics approach is used to scrutinize academic entrepreneurship. The main question of this research is 'how academic entrepreneurship might evolve in a medical university of a developing country?' Therefore, Cross Impact Analysis method is used to examine the system behavior. In this study, the main attributes are adapted from a recent study by Salamzadeh et al. (2013a. Then, some policy variables are proposed and their effects on the model were shown. Findings show that although entrepreneurial ecosystem is growing in the country, still there are problems to be taken into account in order to improve the entrepreneurship in university.

  5. Statistical Analysis of Pakistani Currency Regime before and after Floatation

    Directory of Open Access Journals (Sweden)

    Shahid ALI

    2011-05-01

    Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

  6. Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

    Science.gov (United States)

    Tahir, Khazima

    2017-01-01

    This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

  7. [Profile and tasks of a medical university polyclinic in the past and present using as example the Medical Polyclinical Institutes of the Karl Marx University of Leipzig].

    Science.gov (United States)

    Hambsch, K; Treutler, H; Pietruschka, W D

    1981-03-15

    After a short survey of the historical development of the Medico-Policlinical Institute of the Karl Marx University Leipzig tasks and developmental tendencies of university medical policlinics are described, evaluating hereby the results of the Vth conference of higher education. They are understood as a university representation of ambulatorily working internists and to a large extent of the specialists for general medicine. Their main tasks consist in education and continued professional training of this group of physicians under integrative description of the whole subject internal medicine, a research oriented to practice as well as a guiding and coordination function for the ambulatory internistic care, taking into particular consideration the early recognition of a disease, in primary and secondary prevention as well as in a scientifically based ambulatory therapy of epidemiologically important diseases.

  8. Josephinische Bibliothek und medizinhistorische Bestände der Universitätsbibliothek der Medizinischen Universität Wien [The Josephinian Library and the medical-historic stock of the University Library of the Medical University of Vienna

    Directory of Open Access Journals (Sweden)

    Albrecht, Harald

    2012-09-01

    Full Text Available [english] The University Library of the Medical University of Vienna, founded in 2004, is the most extensive medical library in Austria. It possesses an outstanding medical-historic stock which is basically stored in its Branch Library of Medical History. This unique stock also is a historical source itself because it represents the development of the supply of the Medical Faculty of Vienna, Viennese hospitals and medical societies with scientific literature and information during the last centuries. The brunch library contains several remarkable special-collections such as the Josephinian Library, the Library of Neurology (Obersteiner-Library, the Library of the Society of Physicians in Vienna or the Library of the Austrian Association of Oral and Maxillofacial Surgery.In order to deal with its own history the University Library runs a provenance-research project to identify expropriated goods transferred to its stock during the Nazi-regime and restores them to their rightful owners. It also runs a weblog-series “Displaced 1938”, which is about displaced members of the Medical Faculty of Vienna during World . Currently it establishes a bio-bibliographical online-portal about exponents of the so called “Vienna Medical School(s” between 1750 and 1950 as well as an online bookplate database.To improve the access to large parts of the stock the ancient card indexes got digitalized (including OCR-reading and have been online since 2010. Supplementary the University Library of the Medical University of Vienna engages in the European cooperation on E-books on Demand (EOD.[german] Die Universitätsbibliothek der 2004 errichteten Medizinischen Universität Wien ist die größte medizinische Fachbibliothek in Österreich. Sie verfügt auch über bedeutende medizinhistorische Bestände, die überwiegend in der Zweigbibliothek für Geschichte der Medizin untergebracht sind und auch eine Quelle für die Entwicklung der Literatur- und

  9. Subjective experience of depressed mood among medical students at the University of Pretoria

    Directory of Open Access Journals (Sweden)

    L van Niekerk

    2008-03-01

    Full Text Available Introduction. Following the suicide of a 4th-year medicalstudent, questions were raised as to whether medicalstudents are more vulnerable to depression and suicide thantheir counterparts studying other courses at the University ofPretoria. A literature search revealed that medical students anddoctors run a higher risk for suicide than other students andprofessions. Method. A questionnaire was devised and distributed tomedical students and a control group of other students, askingabout feelings of despair/hopelessness, suicide ideation andprevious attempts, knowledge regarding support structuresprovided by the university, and willingness to use thesestructures. Results. Both groups of students responded similarly to allquestions. Frequency of diagnosed psychiatric illness, use ofmedication, and suicidal thoughts and attempts did not differsignificantly. Both groups of students were unaware of supportservices offered by the university, and both were unwilling toutilise such services. The students seemed to have high ratesof depression in comparison with prevalence data from othercountries. Conclusion. Attempts to improve support for medical studentsshould address students’ awareness of available supportstructures and their willingness to utilise them.

  10. PROBLEMS OF IT DEPARTMENT IN A MEDICAL UNIVERSITY

    Directory of Open Access Journals (Sweden)

    V. Ya Gelman

    2017-01-01

    Full Text Available The aim of the study is the analysis of the problems faced by heads and staff of IT departments in medical universities. Methodology and research methods. The methods involve expert estimation, analysis and generalization of practical work experience of IT departments. Results and scientific novelty. The main aspects and specifics of professional activity of IT departments of modern medical schools are designated. The approaches to the definition of the hierarchy of goals in the professional activities of the department, as well as quantitative and qualitative indicators that assess the effectiveness of their achievements are analyzed. The contradictions arising between long-term and short-term goals of the IT department are highlighted. The main challenges which heads of IT departments can deal with in the course of day-to-day management work planning are described. The problems arising in educational, educational-methodical and scientific work of department, in its economic activity, solution of personnel affairs, and aspects of material support are considered. The possible solutions to these problems are proposed. Practical significance. The results of the analysis, proposed approaches and practical recommendations will enable to better organize the work of the IT department in a medical school. The advantage of the proposed approaches consists in their versatility: with some adjustment, they can be used by other departments, regardless of the specifics and the type of educational institution.

  11. [Projects to accelerate the practical use of innovative medical devices to collaborate with TWIns, Center for Advanced Biomedical Sciences, Waseda University and School of Engineering, The University of Tokyo].

    Science.gov (United States)

    Niimi, Shingo; Umezu, Mitsuo; Iseki, Hiroshi; Harada, Hiroshi Kasanuki Noboru; Mitsuishi, Mamoru; Kitamori, Takehiko; Tei, Yuichi; Nakaoka, Ryusuke; Haishima, Yuji

    2014-01-01

    Division of Medical Devices has been conducting the projects to accelerate the practical use of innovative medical devices to collaborate with TWIns, Center for Advanced Biomedical Sciences, Waseda University and School of Engineering, The University of Tokyo. The TWIns has been studying to aim at establishment of preclinical evaluation methods by "Engineering Based Medicine", and established Regulatory Science Institute for Medical Devices. School of Engineering, The University of Tokyo has been studying to aim at establishment of assessment methodology for innovative minimally invasive therapeutic devices, materials, and nanobio diagnostic devices. This report reviews the exchanges of personnel, the implement systems and the research progress of these projects.

  12. Current issues regarding radiation risk education in Medical Universities of Japan

    International Nuclear Information System (INIS)

    Tsuzuki, Teruhisa; Hosoi, Yoshio; Matsuda, Naoki; Kanda, Reiko; Hosoya, Noriko; Miyagawa, Kiyoshi; Awai, Kazuo; Kondo, Takashi

    2017-01-01

    The main purpose of radiation research is to understand the biological effects of radiation exposure to humans, the molecular mechanisms of biological response m organisms, and its sale application for medical and industrial use. In order to know the current state or education on fundamentals of radiology including radiation biology, a nation-wide questionnaire survey had been performed at medical schools and different co-medical courses in Japanese universities, during the period of 2004 and 2005. The survey results showed: (1) Difference in teaching hours for education on radiation between medical schools with and without department or division of radiation biology or radiation-related field. (2) Teaching hours for education on radiation in nursing course were very limited among the co-medical courses. Although, some improvement have been found about the state of education on radiation risk at medical schools, after the disaster of nuclear accident at Fukushima No.1 Nuclear Power Plant of TEPCO in March 2011. However, still much more effort t is needed to improve basic education on radiation. Science Council of Japan issued the recommendation on September 4, 2014 'Making radiation health risk education compulsory in medical education'. The working group for this purpose was set up under the Council of Head of National Medical Schools of Japan, on January 28, 2015. Here, we describe the details and current issues regarding radiation risk education in medical schools of Japan, as well as the efforts required for its betterment. (author)

  13. Assessment of basic behavioural risks concerning health of students attending Medical University

    Directory of Open Access Journals (Sweden)

    T.N. Govyazina

    2017-03-01

    Full Text Available We chose students from all the six years attending Medical and Prevention Faculty of Perm State Medical University named after academician E.A. Vagner as our research object. Our research goal was to examine and to assess basic behavioral risks which could cause health risks for students attending medical higher educational establishment. We applied a set of techniques in our work: information-bibliographic one (15 literature sources were studied, both periodicals and monographs, sociological one (467 students of Medical and Prevention Faculty were included into a one-time questioning, them all being an entire assembly, statistic one (we calculated relative values and mean values, as well as correlation coefficients. The research was performed in two steps; the first one was based on analyzing subjective evidence, namely, sociologic questioning results; in our second step we focused on examining pathologic damages as per medical examinations data as well as data on morbidity obtained from register of visits to a students' polyclinic.

  14. Conference '48-annual Science-Practical Conference of Medical University, dedicated to tenth anniversary of Independence of the Republic of Tajikistan'. Proceedings

    International Nuclear Information System (INIS)

    2001-01-01

    In this collection bring together scientific articles, which was presented on 48-annual Science-Practical Conference of Medical University, dedicated to tenth anniversary of Independence of the Republic of Tajikistan. Those articles dedicated to different directions of medicine and progress of Tajik State Medical University in medical science

  15. Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Eivind Andersen

    2011-08-01

    Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

  16. E-Books an Medizinbibliotheken – „Gekommen um zu bleiben“. Ein Erfahrungsbericht der Universitätsbibliothek der Medizinischen Universität Wien / E-Books at medical libraries: They came to stay. A report from the university library at the Medical University Vienna

    Directory of Open Access Journals (Sweden)

    Bauer, Bruno

    2011-12-01

    Full Text Available Many university libraries and in particular medical libraries have built up a considerable collection of electronic books. These E-Books are already highly accepted by patrons despite unsolved questions on technical standards and license models which have to be tackled by publishers and libraries. A short introduction on advandages and disadvantages of E-Books is followed by a presentation of E-Book collections and E-Book catalogues found on the websites of medical libraries in Berlin, Mainz, Münster and Zürich. A more detailed report is given on the E-Book situation at the library of the Medical University Vienna including problems with usage data. Results of a recent library online survey are discussed in regard to E-Books. So far the experience with E-Books at the library of the Medical University Vienna and the positive feedback by patrons suggests that E-Books came to stay in medical libraries.

  17. Self-medication among non-healthcare students of the University of Sharjah, United Arab Emirates

    Directory of Open Access Journals (Sweden)

    Suleiman Ibrahim Sharif

    2014-01-01

    Full Text Available Objectives: The objective of the following study is to estimate the prevalence of self-medication among university students and evaluate factors associated with the practice. Materials and Methods: This study was conducted during May, 2012 using a pre-validated questionnaire distributed to 250 students of the 4 years of study at the college of business administration. Data were analyzed using PASW Statistics for Windows, Version 18.0. Chicago: SPSS Inc and results are expressed as counts and percentages. Chi-square test was used to evaluate significant association among the study variables and P < 0.05 were considered to be statistically significant. Results: The response rate was 80% and all respondents were Arabs with 114 (57% females and 86 (43% males. Self-medication was practiced by 118 (59% students and most (88.1% of them obtained medications from pharmacies. About 21 (11% respondents self-medicated with antibiotics. Only 34 (17% and 16 (8% of respondents were aware of bacterial resistance and rational drug use respectively. The most common reasons for self-medication were seeking quick relief (134, 67%, physician′s advice of self-management (100, 50%, illness is minor (91, 45.5%. Common reasons against self-medication include risk of misdiagnosis of illness (160, 80%, risk of using the wrong medication (154, 77%, risk of adverse effects (140, 70%. Self-medication was practiced for headache or mild pain, eye and ear symptoms, gastric problems, cold, fever and allergy. Conclusion: Self-medication among non-healthcare students is common with high prevalence. Knowledge of students of reasons for and against self-medication was adequate, but awareness of respondents of rational drug use and risk of bacterial resistance in response to misuse was poor. Orientation courses/workshops directed to university students would be beneficial.

  18. Absenteeism among medical and health science undergraduate students at Hawassa University, Ethiopia.

    Science.gov (United States)

    Desalegn, Anteneh Assefa; Berhan, Asres; Berhan, Yifru

    2014-04-14

    Student absenteeism is a major concern for university education worldwide. This study was conducted to determine the prevalence and causes of absenteeism among undergraduate medical and health sciences students at Hawassa University. We conducted a cross-sectional study using a pretested self-administered structured questionnaire from May-June 2013. The primary outcome indicator was self-reported absenteeism from lectures in the semester preceding the study period. The study included all regular undergraduate students who were enrolled in the University for at least one semester. The data was entered and analyzed using SPSS version 20. The association between class absenteeism and socio-demographic and behavioral correlates of absenteeism was determined by bivariate and multivariate analyses. Results were reported as crude odds ratios (COR), adjusted odds ratios (AOR) and 95% confidence intervals (CI). 1200 students consented and filled the questionnaire. Of these students, 43.7% had missed three or more lectures and 14.1% (95% CI = 12.2-16.2) missed more than 8 lectures in the preceding semester. There was a significant association between missing more than 8 lectures and age of students, chosen discipline (medicine), and social drug use. The main reasons reported for missing lectures were preparing for another examination, lack of interest, lecturer's teaching style, and availability of lecture material. At Hawassa University College of Medicine and Health Science student habits and teacher performance play a role in absenteeism from lectures. A university culture that promotes discipline and integrity especially among medical and older students discourages social drug use will likely improve motivation and attendance. Training in teaching methodologies to improve the quality and delivery of lectures should also help increase attendance.

  19. Association of Ego Defense Mechanisms with Academic Performance, Anxiety and Depression in Medical Students: A Mixed Methods Study.

    Science.gov (United States)

    Waqas, Ahmed; Rehman, Abdul; Malik, Aamenah; Muhammad, Umer; Khan, Sarah; Mahmood, Nadia

    2015-09-30

     Ego defense mechanisms are unconscious psychological processes that help an individual to prevent anxiety when exposed to a stressful situation. These mechanisms are important in psychiatric practice to assess an individual's personality dynamics, psychopathologies, and modes of coping with stressful situations, and hence, to design appropriate individualized treatment. Our study delineates the relationship of ego defense mechanisms with anxiety, depression, and academic performance of Pakistani medical students.  This cross-sectional study was done at CMH Lahore Medical College and Fatima Memorial Hospital Medical and Dental College, both in Lahore, Pakistan, from December 1, 2014 to January 15, 2015. Convenience sampling was used and only students who agreed to take part in this study were included. The questionnaire consisted of three sections: 1) Demographics, documenting demographic data and academic scores on participants' most recent exams; 2) Hospital Anxiety and Depression Scale (HADS); and 3) Defense Style Questionnaire-40 (DSQ-40). The data were analyzed with SPSS v. 20. Mean scores and frequencies were calculated for demographic variables and ego defense mechanisms. Bivariate correlations, one-way ANOVA, and multiple linear regression were used to identify associations between academic scores, demographics, ego defense mechanisms, anxiety, and depression.  A total of 409 medical students participated, of whom 286 (70%) were females and 123 (30%) were males. Mean percentage score on the most recent exams was 75.6% in medical students. Bivariate correlation revealed a direct association between mature and neurotic ego defense mechanisms and academic performance, and an indirect association between immature mechanisms and academic performance. One-way ANOVA showed that moderate levels of anxiety (P academic performance.  There was a significant association between academic performance and ego defense mechanisms, anxiety, and depression levels in our

  20. Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

    International Nuclear Information System (INIS)

    Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

    2017-01-01

    Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

  1. Rigid Basement and the Evolution of the Pakistani Convergent Margin

    Science.gov (United States)

    Haq, S. S.; Davis, D. M.

    2007-12-01

    In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

  2. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

    Science.gov (United States)

    Islam, Kazi Md Mukitul; Asadullah, M Niaz

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

  3. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

    Science.gov (United States)

    Islam, Kazi Md. Mukitul

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

  4. PREVALENCE OF UPPER CROSS SYNDROME AMONG THE MEDICAL STUDENTS OF UNIVERSITY OF LAHORE

    Directory of Open Access Journals (Sweden)

    Iqra Mubeen

    2016-06-01

    Full Text Available Background: Upper cross syndrome is becoming more prevalent in today’s population. The syndrome is expressed as a postural disorder presenting with over active pectoralis musculature and upper trapezius musculature. Also there is inhibition of lower and middle trapezius musculature, which results in winging of scapula, elevated and abducted scapula. This scapulardyskinesia there by resulted inrounding of shoulders. The syndrome is often associated with bad posture in routine life oroccupation of a person.The purpose of the study is to determine the prevalence of upper cross syndrome in medical students of Lahore. Methods: A convenience sample of 384 medical students was selected from university of Lahore, based on inclusion and exclusion criteria. Medical students of age between 17 to 2 years with sound physical and mental state were included. Students with any trauma, recent injury, recent fracture or surgery and any serious underlying pathology that may interfere with mobility of upper limb were excluded from the study. The research was a cross sectional observational study and self-administered questionnaires were circulated among participants and the data was analyzed using SPSS version 21. Reed-co scale was used to analyze the proper alignment of head, neck and shoulder; where as wall push test was used to assess the abnormal protrusion of scapula. Results: The study have revealed that48.7% population of the students haveneck pain;and the results have concluded that high prevalence of upper cross syndrome in medical students of university of Lahore and a 66.8% of population was found to have poor studying posture. Conclusion: In this study relation between upper cross syndrome and bad posture were seen and it was found that the individuals suffering with upper cross syndrome were somehow related to bad posture or indulge in activities which make individual to adopt a posture of high physiologic cost there by leading to muscular imbalance

  5. Description and Pathology of Research Development in Tabriz Medical University

    Directory of Open Access Journals (Sweden)

    Alireza Farajollahi

    2009-02-01

    Full Text Available Background and purpose: Research in medical science, as in all other fields of science, is necessary in order to maintain and improve the public health. This is achievable only by researchers and faculty members. This study is attempt o identify intra-organizational factors that influence research planning and related interventions in Tabriz Medical University.Methods: In this descriptive cross-sectional study, the study group included all faculty members and masters of science (equivalent to faculties in Tabriz Medical University, of which 121 persons wereselected randomly. Lickert style questionnaires were developed to evaluate and compare the attitudes toward project approval process, knowledge about research facilities, departmental cooperationsin research, and researchers’ capabilities in project execution. Data analysis was performed using SPSS software.Results: During a 3 year period, each faculty member had, on average, supervised 5.17 dissertations, conducted 1.15 approved research projects, and had 3.4 presentations in domestic and 0.36 presentations in international conferences. Lack of time was the main problem in conducting research.Comparing faculties with and without research experience, there was significant differences in regard of access to research facilities (pthe level of research knowledge (pmotivations, job satisfaction, departmental cooperation, and expecting benefits from conductingresearch.Conclusion: According to the faculties’ views, intra-organizational problems are less important than personal factors in performing research projects; i.e. the main obstacles for research were lack of time, and lack of competence in research methodology and problem-finding. Intra-organizational factors such as delay in project approval and lack of knowledge about research priorities are classified in the next levels.Keywords: FACULTY MEMBERS, RESEARCH PROBLEMS, INTRA-ORGANIZATIONAL FACTORS

  6. Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Hempler NF

    2015-02-01

    Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

  7. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  8. Incidence of academic failure and its underlying factors in Lorestan university of medical sciences

    Directory of Open Access Journals (Sweden)

    Farzad Ebrahimzadeh

    2016-02-01

    Full Text Available Background: Academic failure, conceived of as lack of success in one’s education, is of paramount importance for students of medical sciences and it might lead to more acute problems. The present study set out to investigate the prevalence and underlying reasons of academic failure in Lorestan University of medical sciences.  Materials and Methods: In this cohort study, academic records of all students of Lorestan University of Medical Sciences during the academic years of 2006-2011 were collected from education and student affair center and also, demographic and educational records were entered into a checklist. Inappropriate grade point average, being a provisional student, prolonged graduation, expulsion and dropout were taken into account as academic failure. To model the related effective factors, logistic regression was adopted and significance level was set at 0.05. Results: The cumulative incidence of academic failure was about 25.1%. Factors such as department, being self-funded or government-funded student, academic grade students are pursuing, the elapsed time between academic grades, gender and location of residence were related to academic failure (P<0.05. It is worth mentioning that no relationship was observed between the academic failure and being accepted based on quota system. Conclusion: The most important at risk groups were students of department of medicine and health, associate or medical doctoral students, self-funded students, students with a considerable time elapsed between their academic grades, male students and students living in dormitory. It is suggested that these students refer to consulting centers of university or educational supervisors and receive particular attention.

  9. Comparison and Evaluation of Motivation and Attitude of Medical Students at Basic Sciences and Internship phase on Cheating in Exams at Shahid Beheshti University of Medical Sciences in 2012

    Directory of Open Access Journals (Sweden)

    Aliasghar Jame-Bozorgi

    2016-05-01

    Full Text Available Background and Purpose: There is much evidence that the prevalence of academic misbehaviors is increasing in universities. This study examined the motivation and attitudes of medical students of Shahid Beheshti University of Medical Sciences on cheating and its frequency.Methods: The study is a survey of medical students’ of Shahid Beheshti University of Medical Sciences attitudes on cheating and Data was analyzed using Chi-square and McNemar's test.Results: One hundred and sixty medical students participated in this study. The mean and standard deviation of students’ age was 22.69±2.29 years. Basic Sciences and internship students’ attitudes on three cheating behaviors, including cheating from others (P=0.028, helping other students to copy answers during exams (P=0.001, and recording false reports deliberately to facilitate assignments were significantly different (P=0.0001. The students' highest motivation for cheating was fear of failing in the exam (79.3% and difficulty of the course (77.5%.Conclusions: The results showed that there were a higher number of interns than basic sciences students considered two behaviors of helping others to cheat and copying from one’s hand as cheating. It seems that policy-making in universities must be in a way that the problems of educational program, attitude and environment get more attention. In this regard, medical ethics education, reduced stress and pressure associated with medical education, fair and decisive punishment for dishonest people and appropriate resource allocation should be carried out for exam’s environment control.Keywords: Motivation, Attitude, Medical Students, Cheating

  10. Pediatric сlinic of Odessa National Medical University: the quality of emergency medical care for children

    Directory of Open Access Journals (Sweden)

    E.A. Starets

    2017-04-01

    Full Text Available Background. The purpose of the article is to discuss the issue of improving the quality of emergency care for children with the most common diseases. Materials and methods. The quality of medical care includes 6 characteristics: 1 effectiveness — evidencebased health care results in improved health outcomes; 2 relevancy: health care is delivered in a manner that maximizes resource use and avoids wasting and provided in a setting where skills and resources are appropriate to medical need; 3 accessibility: health care is provided timely, reasonable and affordable; 4 acceptability/patient-centered: health care provided takes into account the preferences and aspirations of individual service users; 5 equity: health care provided does not vary in quality because of personal characteristics or socioeconomic status; 6 safety: health care provided minimizes risks and harm to service users and providers. Results. The Intensive Care Unit (ICU started working in the Pediatric Clinic of the Odessa National Medical University on February 1, 2017. The main task of ICU is the treatment of children with emergency conditions (who needs monitoring of breathing and cardiac activity, oxygen therapy, large-volume rehydration therapy, etc. The patients admit to the ICU according the results of triage. Triage is the process of rapidly screening of sick children soon after their addmission to hospital and in ICU, in order to identify those with emergency signs — obstruc-ted breathing or severe respiratory distress; central cyanosis; signs of shock; signs of severe dehydration; those with priority signs — very high temperature, severe pallor, respiratory distress etc. The local guidelines for the most common diseases in children have been developed in the Pediatric Clinic. These local guidelines are based on: 1 modern national guidelines; 2 WHO: Pocket book of hospital care for children: guidelines for the management of common childhood illnesses (2013; clinical

  11. Depression in Nursing Students of Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    F Rafati

    2004-02-01

    Full Text Available Background: University students are important parts of all educational systems. They are susceptible to different psychiatric disturbances, which in turn may cause considerable problems with their course programs. Depression is among the most important indices for investigation on human mental health status. This research was planed to study the prevalence and characteristics of depression and its consequences (suicidality, hopelessness, etc. in nursing students at Shiraz University of Medical Sciences. Methods: All undergraduate nursing students at Fatemeh College of Nursing and Midwifery were tested with Beck Depression Inventory (BDI. Results: This research revealed that 60% of students were depressed, 34% of them had mild depression, 18.4% moderate, 6% relatively severe and 1.6% severe depression. Mean score of BDI was not significantly different between female and male subjects (13.8 ± 9 in females vs. 15.2 ± 10 in males; total 14.1 ± 11 Conclusions: This research shows that there is still a high proportion of University students having depression, which necessitates considerable attention to their problems. Keywords: Nursing Students, Beck Depression Inventory, Depression.

  12. Older medical students' performances at McGill University.

    Science.gov (United States)

    Feil, D; Kristian, M; Mitchell, N

    1998-01-01

    To compare admission data and academic performances of medical students younger and older than 25, and to qualify older students' experiences and perceptions in medical school. The authors reviewed 1988-1991 data for applications to the McGill University Faculty of Medicine. Data included GPAs and MCAT scores, as well as ratings for reference letters, autobiographical statements, and interviews. For those same years, the authors measured students' academic performances in the preclinical and clinical years. The authors compared the data by students' age: "younger" students, aged 17 to 24; and "older" students, aged 25 and above. All enrolled students took the Derogatis Stress Profile, and the older students participated in focus groups. The older applicants had lower GPAs and MCAT scores, but higher interview and reference letter ratings. For older accepted students, basic science course scores were lower than those of younger students, but clinical scores did not differ significantly between the groups. The two groups had similar stress levels, although older students tested lower in driven behavior, relaxation potential, attitude posture, and hostility. In focus groups, the older students spoke of learning style differences, loss of social support, and loss of professional identity. Different scores in admission criteria suggest that McGill uses different standards to select older medical students. Older students admitted under different criteria, however, do just as well as do younger students by their clinical years. A broad-based study of admission criteria and outcomes for the older student population is warranted.

  13. Scientific production of Vice Chancellors for Research in Peruvian universities with a medical school.

    Science.gov (United States)

    Herrera-Añazco, Percy; Valenzuela-Rodríguez, Germán; Pacheco-Mendoza, Josmel; Málaga, Germán

    2017-10-19

    To determine the scientific production of Research Vice-chancellors at Peruvian universities that have medical schools, as well as their academic degrees as an indirect way to evaluate their suitability for the position they hold. We searched all Peruvian universities that register medical schools. Of these, the scientific production of the universities registered in SCOPUS was identified in September of the 2016. The scientific production of the vice chancellors of investigation of these faculties of medicine was determined through the search of its scientific publications registered in SCOPUS and those reported in the National Registry of Researchers in Science and Technology. Academic degrees were obtained from the database of the National Superintendence of Higher University Education. The sample included 28 research vice chancellors. Only 4/28 had any publications. The average number of articles published by the vice chancellors of research was 1.71, the number of citations 23.1 on average and the H index 0.64. Besides, 22 Vice-chancellors of research had the degree of doctor, four had the degree of bachelor and two the degree of master. The scientific production of research vice chancellors is poor. The required academic grade requirement for the position is not met in all cases. It is likely that, having no research experience, his leadership in directing a university's research policies may be questioned.

  14. Confirmatory Factor Analysis of the Universiti Sains Malaysia Emotional Quotient Inventory Among Medical Students in Malaysia

    Directory of Open Access Journals (Sweden)

    Wan Nor Arifin

    2016-05-01

    Full Text Available The Universiti Sains Malaysia Emotional Quotient Inventory (USMEQ-i is a Malay-language emotional intelligence (EI inventory that was based on a mixed-model approach of EI. It was specifically developed and validated for use among medical course applicants. However, evidence to support its use among medical students is inadequate. This study aims to provide further construct validity evidence for the USMEQ-i among medical students through confirmatory factor analysis (CFA. A cross-sectional study was carried out on a sample of 479 medical students in Universiti Sains Malaysia (USM. After a preliminary analysis, data from only 317 respondents were found suitable for inclusion in CFA. CFA was performed using the maximum likelihood estimation method with bootstrapping due to the nonnormality of items at the multivariate level. The results of the analysis support the two-factor model of the EI component and the one-factor model of the faking component. However, the USMEQ-i should be administered with caution until further cross-validation studies are conducted among students in other medical schools in Malaysia.

  15. Factors Affecting the Use of Indigenous Publications by Medical and Dental Students in Nigerian Universities

    Directory of Open Access Journals (Sweden)

    Ahiaoma Ibegwam

    2012-06-01

    Full Text Available This study examined the indigenous medical publications used by medical and dental students in Nigeria with a view to discovering factors that affects their usage. Data was gathered through a questionnaire survey. The population of the study was 1,264 undergraduate medical and dental students from ten universities in all the geopolitical zones of Nigeria. Data gathered was analysed using SPSS to obtain the summaries of the variables in form of frequency distribution and other descriptive statistics. The findings reveal several factors affecting the usage of indigenous medical publications. In spite of all the inhibitors, 88.2% of the respondents indicated that they need indigenous medical publications for a well-rounded medical education.

  16. Diversity leadership: the Rush University Medical Center experience.

    Science.gov (United States)

    Clapp, J R

    2010-01-01

    Meeting the challenges of diversity is crucial, and within healthcare organizations a particularly strong case exists for a diversity strategy. Rush University Medical Center in 2006 was at an important juncture. Since its founding, the organization had made notable progress toward advancing diversity and inclusiveness. On the other hand, many diversity-related problems continued. Rush convened a committee to review the work of the institution in this area. The committee's report called for changes, and a Diversity Leadership Group (DLG) model was established. This article documents the progress made since 2006 through implementation of the DLG model. The changes prescribed for Rush are presented as recommendations and challenges that other healthcare organizations may find applicable to their own institutions.

  17. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  18. Developing eLearning Technologies to Implement Competency Based Medical Education: Experiences from Muhimbili University of Health and Allied Sciences

    Science.gov (United States)

    Nagunwa, Thomas; Lwoga, Edda

    2012-01-01

    This paper provides the practical experience of developing an eLearning technology as a tool to implement Competency-based Medical Education (CBME) in Tanzania medical universities, with a specific focus on Muhimbili University of Health and Allied Sciences. The paper provides a background to eLearning and the early attempt to adopt it in 2006 at…

  19. [Department of Otorhinolaryngology of the I.P. Pavlov Saint-Peterburg First State Medical University].

    Science.gov (United States)

    Karpishchenko, S A

    This article is designed to report the results of the analysis ofacademic, scientific, and clinical activities of the Department of Otorhinolaryngology of the I.P. Pavlov Saint-Peterburg First State Medical University.

  20. Factors Affecting the Use of Indigenous Publications by Medical and Dental Students in Nigerian Universities

    OpenAIRE

    Ahiaoma Ibegwam; Oshiotse Andrew Okwilagwe

    2012-01-01

    This study examined the indigenous medical publications used by medical and dental students in Nigeria with a view to discovering factors that affects their usage. Data was gathered through a questionnaire survey. The population of the study was 1,264 undergraduate medical and dental students from ten universities in all the geopolitical zones of Nigeria. Data gathered was analysed using SPSS to obtain the summaries of the variables in form of frequency distribution and other descriptive stat...

  1. Job Satisfaction in Basic and Clinical Faculty Members in Shiraz University of Medical Sciences, Iran

    Directory of Open Access Journals (Sweden)

    Mehdi Saberi-Firoozi

    2009-02-01

    Full Text Available Background and Purpose: Shiraz University of Medical Sciences as one of the oldest and largest universities of medicine in Iran with 50 years history has more than 450 faculty members and 5000 students. This study is an attempt to find out the level of job satisfaction among Shiraz University ofMedical Sciences’ faculty members.Methods: In midterm of 2003-2004, data on job satisfaction level among 404 faculty members from all schools of Shiraz University of Medical Sciences were collected. The translation of Spector’s job satisfaction score was used including 34 questions in 9 items of job satisfaction and each one based on Likert’s Scale with score an of 1-5. A question related to overall job satisfaction of faculty members was added.Results: Of all faculties,, 252 responded to the questionnaire and 70.1% expressed satisfaction in response the added question. The mean scores of job satisfaction in items of coworkers, work nature, supervision, management methods, academic relations, promotion, salary and suitable benefits were3.771, 3.265, 2.557, 2.454, 2.395, and 2.376 out of 5 respectively (F=223.8, p=0.0001. In the promotion item, the satisfaction of female faculty was lower than male subjects. The level of job satisfaction was not different between clinical faculty members of Medical School with or without private activity. The results of linear regression analysis between the items of job satisfaction revealed that reimbursement and fringe benefits could predict the overall job satisfaction (r2=0.70, p<0.01.Conclusion: As a whole, the faculty members of the university were satisfied with their jobs, but a correction in reimbursement, benefits and promotion regulations especially in lower academic ranks is needed to improve the level of job satisfaction in this group.Key words: JOB SATISFACTION, FACULTY MEMBER, BASIC AND CLINICAL DEPARTMENTS, FULLTIME, PART-TIME

  2. Association of academic stress with sleeping difficulties in medical students of a Pakistani medical school: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2015-03-01

    Full Text Available Introduction. Medicine is one of the most stressful fields of education because of its highly demanding professional and academic requirements. Psychological stress, anxiety, depression and sleep disturbances are highly prevalent in medical students.Methods. This cross-sectional study was undertaken at the Combined Military Hospital Lahore Medical College and the Institute of Dentistry in Lahore (CMH LMC, Pakistan. Students enrolled in all yearly courses for the Bachelor of Medicine and Bachelor of Surgery (MBBS degree were included. The questionnaire consisted of four sections: (1 demographics (2 a table listing 34 potential stressors, (3 the 14-item Perceived Stress Scale (PSS-14, and (4 the Pittsburgh Quality of Sleep Index (PSQI. Logistic regression was run to identify associations between group of stressors, gender, year of study, student’s background, stress and quality of sleep.Results. Total response rate was 93.9% (263/280 respondents returned the questionnaire. The mean (SD PSS-14 score was 30 (6.97. Logistic regression analysis showed that cases of high-level stress were associated with year of study and academic-related stressors only. Univariate analysis identified 157 cases with high stress levels (59.7%. The mean (SD PSQI score was 8.1 (3.12. According to PSQI score, 203/263 respondents (77% were poor sleepers. Logistic regression showed that mean PSS-14 score was a significant predictor of PSQI score (OR 1.99, P < 0.05.Conclusion. We found a very high prevalence of academic stress and poor sleep quality among medical students. Many medical students reported using sedatives more than once a week. Academic stressors contributed significantly to stress and sleep disorders in medical students.

  3. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Zohreh Yazdi

    2016-01-01

    Full Text Available Introduction: Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. Methods: In this descriptive-correlational study, a total of 285 medical students completed a self-administered questionnaire. Demographic data, sleep-wake schedule in weekday and weekend, and sleep duration were collected. Students' sleep quality was assessed by Pittsburg Sleep Quality Index (PSQI. Data were analyzed by SPSS Ver 13. Results: Overall, 164 (57.5 of students had poor sleep quality. Mean global PSQI score and average score of four subscales were significantly higher in male than female. Regression analysis showed that male students (β=-0.85, P<0.05, students at senior level (β=-0.81, P<0.05, married students (β=-0.45, P<0.05, and those with improper sleep hygiene practices slept worse. Conclusion: The findings of this study showed that the prevalence of poor sleep quality in medical students is high. Improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students.

  4. Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

    2013-06-01

    breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

  5. Determination of medical education environment in Punjab private and public medical colleges affiliated with University of Health Sciences, Lahore-Pakistan.

    Science.gov (United States)

    Khan, Junaid Sarfraz; Tabasum, Saima; Yousafzai, Usman Khalil

    2009-01-01

    The main purpose of this study was to identify differences, if any, in the Medical Education Climate between the Private and Public Medical Colleges in the Province of Punjab affiliated with the University of Health Sciences, Lahore and to gather recommendations from students on measures that need to be taken to improve the environment. This Mixed Quantitative and Qualitative Prospective Study was conducted in 2008. The population of the study consisted of 1612 MBBS Final Year Medical Students of both Private and Public Medical Colleges. Stratified Random Sampling was done to ensure representation of both Sectors. Dundee Ready Education Environment Measure (DREEM) was used to assimilate Quantitative Data and a Questionnaire consisting of 10 items was used to accumulate Qualitative Data. To analyse Quantitative Data, t-test and Chi-square tests were used. Common themes were identified in the Qualitative Data. All the SIX Research Hypotheses were rejected and Null Hypotheses were upheld. Analysis of Qualitative Data indicated a number of Examination, Curriculum, Teaching Methodology, Teacher and Peer related Stressors without discrimination in students of both Private and Public Sectors. Solutions by students focused on improving co-ordination between Institutions and University of Health Sciences as well as developing and delivering Clinically-Centred, Community-Oriented and Problem-Based Education through development of appropriate Teaching Methodologies. Even though there is no difference in the Medical Education Climate between the Private and Public Medical Education Sectors, the Environment is less than Ideal. However, this can be improved through shifting the onus of Education from Teacher-Centred Didactic Approach to a more Student-Centred Self-Learning Strategy. In this paradigm shift the UHS, Lahore needs to play a pivotal role in order to effectively train the Trainers and standardise this change throughout Punjab.

  6. Medical clerks in a national university hospital: improving the quality of medical care with a focus on spinal surgery.

    Science.gov (United States)

    Kobayashi, Kazuyoshi; Ando, Kei; Noda, Makiko; Ishiguro, Naoki; Imagama, Shiro

    2018-02-01

    In our institution, which is a national university hospital, medical clerks were introduced in 2009 to improve the doctor's working environment. Seventeen clerks were assigned to 9 separate departments and the work content differed greatly among departments, but sufficient professional work was not done efficiently. The purpose of this study is to investigate the effects of the work of medical clerks on improvement of medical quality in recent years. In 2011, we established a central clerk desk on our outpatient floor to improve efficiency and centralize the clerk work. Since 2013, periodic education of clerks on spine disease has been provided by spine doctors, and this has facilitated sharing of information on spinal surgery from diagnosis to surgical treatment. This has allowed medical clerks to ask patients questions, leading to more efficient medical treatment and a potential reduction of doctors' work. In 2016, a revision of the insurance system by the Ministry of Health, Labour and Welfare of Japan increased the amount of medical work that clerks can perform, and it became possible to increase the number of medical clerks. Currently, we have 30 medical clerks, and this has allowed establishment of new clerk desks in other departments to handle patients. A training curriculum will be developed to reduce the burden on doctors further and to improve the quality of medical treatment.

  7. Assessment of knowledge regarding tuberculosis among non-medical university students in Bangladesh: a cross-sectional study.

    Science.gov (United States)

    Rana, Masud; Sayem, Abu; Karim, Reazul; Islam, Nurul; Islam, Rafiqul; Zaman, Tunku Kamarul; Hossain, Golam

    2015-07-28

    Tuberculosis (TB) is the second leading cause of human death and TB is one of the major public health problems in Bangladesh. The aim of the present study was to assess the Knowledge about TB among non-medical university students in Bangladesh. A cross-sectional survey was performed on 839 non-medical university students. Data were collected from University of Rajshahi from March to August 2013 using a standard semi-structured questionnaire. Chi-square test was utilized to find the factors which are associated with students' knowledge about TB. Among 839 students, male and female were 68.2 % and 31.8 % respectively. Most of the students (94.4 %) were informed about the term TB, among them 50 % got information from electronic media. More than 50 % students believed that TB is a communicable disease, 42.8 % students agreed that bacteria is an agent for TB, most of the subjects (93 %) had the knowledge about the vaccination against TB and 97.6 % students believed that TB is curable. However, students had poor knowledge about latent TB (13.7 %) and DOTs program (28.5 %). χ (2)-test demonstrated that gender, residence, type of family and parents education were associated with students' knowledge of TB. In the present study demonstrated that the level of general knowledge about TB was insufficient among non-medical university students. Consequently, health education program is needed to improve the knowledge among university students regarding TB.

  8. Education at the Dittrick Museum of Medical History, Case Western Reserve University, Cleveland, Ohio, USA.

    Science.gov (United States)

    Edmonson, James M

    2009-01-01

    The Dittrick Museum of Medical History pursues an educational mission as being part of a major research university. While the Dittrick dates to 1899 as a historical committee of the Cleveland Medical Library Association, it first affiliated with Case Western Reserve University in 1966, and became a department of the College of Arts and Sciences of CWRU in 1998. The Dittrick maintains a museum exhibition gallery that is open to the public free of charge, and museum staff provide guided tours on appointment. Much of the teaching and instruction at the Dittrick is conducted by university professors; their classes meet in the museum and use museum resources in the form of artifacts, images, archives, and rare books. Class projects using Dittrick collections may take the form of research papers, exhibitions, and online presentations. Dittrick staff assist in these classes and are available to help researchers use museum resources.

  9. IMPLEMENTATION OF SPECIAL COURSE AS CONDITION OF FORMATION OF MEDICAL UNIVERSITY STUDENTS’ PROGNOSTIC COMPETENCE

    Directory of Open Access Journals (Sweden)

    Svetlana Tarasova

    2015-09-01

    Full Text Available The pedagogical aspects of making and teaching a special course «Statistical methods of prognostication in medicine» are discussed on the basis of the analysis of the application of various pedagogical tools, shows the significance of implementing a predictive function in the training of medical students. The efficiency of formation of medical university students’ prognostic competence in the process of studying a special course is estimated.

  10. Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

    Directory of Open Access Journals (Sweden)

    Shahid Ubeera

    2011-09-01

    Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

  11. Collaboration between the University of Michigan Taubman Health Sciences library and the University of Michigan Medical School Office of Research.

    Science.gov (United States)

    Black, Christine; Harris, Bethany; Mahraj, Katy; Schnitzer, Anna Ercoli; Rosenzweig, Merle

    2013-01-01

    Librarians have traditionally facilitated research development resulting in grants through performing biomedical literature searches for researchers. The librarians at the Taubman Health Sciences Library of the University of Michigan have taken additional steps forward by instituting a proactive approach to assisting investigators. To accomplish this, the librarians have taken part in a collaborative effort with the University of Michigan Medical School Office of Research. Through this partnership, both units have created and adopted various techniques intended to facilitate the submission of grants, thus allowing researchers more time to conduct their primary activities.

  12. Job dissatisfaction in lecturers in School of Medical Sciences Universiti Sains Malaysia and Faculty of Medicine Universiti Kebangsaan Malaysia.

    Science.gov (United States)

    Huda, B Z; Rusli, B N; Naing, L; Tengku, M A; Winn, T; Rampal, K G

    2004-06-01

    Job dissatisfaction in doctors and teachers is known to have direct consequences on the quality of service and teaching for patients and students respectively. A cross-sectional study to assess dissatisfaction in lecturers of School of Medical Sciences, Universiti Sains Malaysia (USM) and Faculty of Medicine, Universiti Kebangsaan Malaysia (UKM) was undertaken between August 2001 and May 2002. The original English version of the Job Content Questionnaire (CQ) version 1.7 (revised 1997) by Robert Karasek was self-administered to 73 (response rate 58.4%) and 80 (response rate 41.7%) lecturers in the medical faculties of USM and UKM, respectively. The prevalence of job dissatisfaction in USM and UKM lecturers were 42.6% and 42.9%, respectively; the difference was not significant (p>0.05). Risk factors of job dissatisfaction in USM lecturers were decision authority (pjob demand (pjob dissatisfaction in UKM lecturers were skill discretion (pjob demand (pjob demand was a risk factor of job dissatisfaction in both USM and UKM lecturers; in USM, decision authority was protective, while in UKM, skill discretion was protective against job dissatisfaction.

  13. Academic procrastination and related factors in students of Guilan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    MM Chehrzad

    2017-03-01

    Full Text Available Introduction: One of the challenges that students faced during their education is academic procrastination. It means “delay in performing a task”. Since academic procrastination could effect on various aspects of students' personal and social life, by identifying related factors it may be limited. This study aimed to determined academic procrastination and related factors in Students of Guilan University of Medical Sciences in 2015. Methods:  In this cross-sectional study, 459 students of all major programs of Guilan University of Medical Sciences were selected by stratified random sampling method. Data collection scales included three parts of demographic information, academic information and Procrastination Assessment Scale for Students (PASS by Solomon and Rothblum. Data was analyzed with T- Test, ANOVA, multiple regressions by SPSS V. 20.  Result: Most of students were female (72.7%, single (86% and undergraduate (66.6%. Mean score of academic procrastination was 63.3±9.1 and most students (69.5% had moderate procrastination. Academic procrastination had significant difference with gender (p=0.002 and academic level (p=0.03. Also in multiple regression models, gender, program of study  and academic level were main predictors of procrastination.  Females, dental students and postgraduate students had higher level of academic procrastination. Conclusion: There is a moderate academic procrastination in students of Guilan University of Medical Sciences and its relationship with gender, program of study and academic level was observed.  Investigation on causes and appropriate strategies to reduce this behavior is recommended.

  14. Perceptions of Ghanaian medical students completing a clinical elective at the University of Michigan Medical School.

    Science.gov (United States)

    Abedini, Nauzley C; Danso-Bamfo, Sandra; Moyer, Cheryl A; Danso, Kwabena A; Mäkiharju, Heather; Donkor, Peter; Johnson, Timothy R B; Kolars, Joseph C

    2014-07-01

    International medical electives typically represent a unidirectional flow of students from economically advantaged countries in the global "North" to resource-poor nations in the global "South." Little is known about the impact of bilateral exchanges on students from less affluent nations. Since 2007, students from the University of Michigan Medical School (UMMS) and medical schools in Ghana have engaged in a bilateral clinical exchange program. A 45-item online survey was distributed to all 73 Ghanaian medical students who had rotated at UMMS from 2008 to 2010 to assess perspectives on the value and impact of their participation. Incoming Ghanaian students outnumbered outgoing UMMS students 73 to 33 during the study period. Of eligible Ghanaian students, 70% (51/73) participated in the survey, with 40 of 51 providing valid data on at least 50% of questions. Ninety-seven percent (37/38) reported that the UMMS rotation was valuable to their medical training, 90% (35/39) reported changes in how they approach patient care, and 77% (24/31) reported feeling better equipped to serve patients in their home community. Eighty-five percent of students (28/33) felt more inclined to pursue training opportunities outside of their home country after their rotation at UMMS. More studies are needed to determine the feasibility of bidirectional exchanges as well as the short-term and long-term impact of rotations on students from underresourced settings and their hosts in more resource-rich environments.

  15. Application of medical cases in general genetics teaching in universities.

    Science.gov (United States)

    He, Zhumei; Bie, Linsai; Li, Wei

    2018-01-20

    General genetics is a core course in life sciences, medicine, agriculture and other related fields. As one of the most fast-developing disciplines of life sciences in the 21th century, the influence of the genetics knowledge on daily life is expanding, especially on human health and reproduction. In order to make it easier for students to understand the profound principles of genetics and to better apply the theories to daily life, we have introduced appropriate medical cases in general genetics teaching and further extended them combined with theoretical basis of genetics. This approach will be beneficial to enhance students' abilities of genetic analysis and promote their enthusiasm to learn and master practical skills. In this paper, we enumerate medical cases related to the modern genetics teaching system to provide a reference for genetics teaching in general and normal universities.

  16. Performance management of nuclear medical apparatuses in Osaka University Hospital

    International Nuclear Information System (INIS)

    Ikehara, Katsuhiro; Kusumi, Yoshimi; Hayashi, Makoto; Miharu, Tomoyoshi; Masuda, Kazutaka

    1975-01-01

    Nuclear medical out side-body measuring equipments in Osaka University Hospital consist of scinticamera, scintiscanner and movement-measuring equipment as measuring equipments, and central processing equipment, CRT attached with Polaroid camera, data typewriter, X-Y recorder, and high speed tape reader as data processing equipments. Daily and monthly management items are set up to maintain the best function of these equipments. The data processing room is air-conditioned to keep temperature at 25 0 C and humidity at 60% constantly, and they are confirmed with a temperature and humidity self-recorder. Computer system is used for the homogeneity control and the correction to counting failure of the scinticamera. As the repair of nuclear medical apparatuses needs long period and because of the special circumstances of radioactive drugs, very close cooperation among technicians, doctors and equipment makers is required. (Kobatake, H.)

  17. [Marcel Labbe's (1870-1937) conferences in Istanbul University Medical School].

    Science.gov (United States)

    Ozaydin, Z

    1998-01-01

    Marcel Labbe, a French physician, who was famous with his studies on nutrition and diabetes, visited Istanbul three times, in 1908, 1922 and 1930. During his second visit in 1922, he gave seven lectures at Istanbul University Medical School about diabetes mellitus, hyperglysemia of diabetics, acidosis, nefrotic diseases, liver insufficiency, endocrin diseases and anaphylactia. These lectures were translated and published in Turkish. During his third visit he lectured on paradiabetes and visited historical places and cities of Istanbul, and also visited Yalova thermal springs and Brusa. Labbe respected Turkish physicians with whom he had established close relations with in Paris, where he also met Ord. Prof. Dr. Suheyl Unver (1898-1986) who was a very famous professor and researcher in medical history. In return, he was respected by Turkish physicians, as well. Labbe's research was translated into Turkish and published in Turkish journals.

  18. OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

    Directory of Open Access Journals (Sweden)

    Khan Shoaib

    2016-07-01

    Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

  19. Knowledge, Attitudes and Practices towards Medication Use among Health Care Students in King Saud University

    Directory of Open Access Journals (Sweden)

    Abdullah T. Eissa

    2013-11-01

    Full Text Available Background: Health sciences students are expected to have appropriate knowledge and attitudes toward medication use. However, literary evidence of such expertise among health sciences students of King Saud University is unknown. This study was completed to assess the knowledge about medicines and behavior of health science students towards safe use of medications. It also aims to assess the health knowledge, attitude and practices of the students. Methods: This cross-sectional study used a questionnaire consisting of 24 questions. This was administered by the researcher between October and December 2009 in the colleges of medicine, dentistry, pharmacy, applied medical science and nursing of the King Saud University. The survey consisted of three parts: Ten questions assessed the students’ knowledge on drug safety (Part 1. Four questions assessed student attitude toward medication consultations by the pharmacist (Part 2 and ten questions involved medication use practices and consultation with pharmacists (Part 3. A stratified sampling method was used to select participants. Results: Pharmacy students had better medication knowledge compared to other health sciences students especially regarding antihypertensive drugs, antibiotics, paracetamol and antacids (p<0.05. Pharmacy students showed a positive attitude regarding the trustworthiness of a pharmacist to give a consultation. Nearly all other health science students showed a negative attitude about dispensing and consultation concerning nutritional supplements by a pharmacist. All health sciences students had a similar perception toward medication use and practice. Conclusion Pharmacy students had better knowledge about medication practice compared to other health sciences students. All other health sciences students lacked the appropriate attitude and practice related to the safe use of medications.

  20. Using Mind Maps to Improve Medical Student Performance in a Pharmacology Course at Kunming Medical University.

    Science.gov (United States)

    Ying, Guo; Jianping, Xie; Haiyun, Luo; Xia, Li; Jianyu, Yang; Qun, Xuan; Jianyun, Yu

    2017-07-01

    To determine whether students using mind maps would improve their performance in a final examination at the end of lecture-based pharmacology course. Aquasi-experimental study. Kunming Medical University, from September 2014 to January 2015. One hundred and twenty-two (122) third year undergraduate medical students, starting a 48-hour lecturebased pharmacology course, volunteered to use mind maps as one of their study strategies (intervention group), while the remaining 100 students in the class continued to use their usual study strategies (control group) over the duration of the course. The performance of both groups in the final course examination was compared. Students in the intervention group also completed a questionnaire on the usefulness of mind maps during the course and in preparation for the final examination. The students' performance of intervention group was superior to performance of the control group in all parts of a multi-modal final examination. For the multiple choice questions and comprehensive scores, average marks of 45.97 ±7.22 and 68.07 ±12.77, respectively were acquired by the control group, and 51.77 ±4.95 (pcontrol group, and were all significantly higher at 8.00 (4.00) (p=0.024), 10.00 (2.00) (pmind maps helped them to prepare more efficiently for the final exam; 90.91% believed that mind maps helped them to better understand all of pharmacology. Ninety-one percent also thought that mind maps would help them to better understand other disciplines, and 86.36% students would like the lecturers to utilize mind mapping as an alternative to conventional teaching formats, such as the use of Power Point. The addition of mind maps to students' study of pharmacology at Kunming Medical University improved their performance in all aspects of a multi-modal final examination.

  1. 75 FR 15439 - Food and Drug Administration/Xavier University Global Medical Device Conference

    Science.gov (United States)

    2010-03-29

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2010-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  2. 78 FR 15957 - Food and Drug Administration/Xavier University Global Medical Device Conference

    Science.gov (United States)

    2013-03-13

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  3. 77 FR 10537 - Food and Drug Administration/Xavier University Global Medical Device Conference

    Science.gov (United States)

    2012-02-22

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  4. Perspectives of UK Pakistani women on their behaviour change to prevent type 2 diabetes: qualitative study using the theory domain framework.

    Science.gov (United States)

    Penn, Linda; Dombrowski, Stephan U; Sniehotta, Falko F; White, Martin

    2014-07-08

    Type 2 diabetes (T2D) is a debilitating disease, highly prevalent in UK South Asians, and preventable by lifestyle intervention. The 'New life, New you' (NLNY) physical activity (PA) and dietary intervention for T2D prevention was culturally adapted to better engage minority ethnic populations and tested for feasibility. To investigate Pakistani female participants' perspectives of their behaviour change and of salient intervention features. A community-based 8-week programme of group delivered PA sessions with behavioural counselling and dietary advice, culturally adapted for ethnic minority populations, in an area of socioeconomic deprivation. Participants to NLNY were recruited through screening events in community venues across the town. Interviews were conducted with 20 Pakistani female NLNY participants, aged 26-45 (mean 33.5) years, from different parts of town. Within the a priori Theoretical Domains Framework (intentions and goals, reinforcement, knowledge, nature of the activity, social role and identity, social influences, capabilities and skills, regulation and decision, emotion and environment), we identified the importance of social factors relating to participants' own PA and dietary behaviour change. We also identified cross-cutting themes as collateral benefits of the intervention including participants' 'psychological health'; 'responsibility' (for others' health, especially family members included in the new PA and diet regimes) and 'inclusion' (an ethos of accommodating differences). Our findings suggest that culturally adapted interventions for Pakistani women at risk of T2D, delivered via group PA sessions with counselling and dietary advice, may encourage their PA and dietary behaviour change, and have collateral health and social benefits. The NLNY intervention appeared to be acceptable. We plan to evaluate recruitment, retention and likely effect of the intervention on participant behaviour prior to definitive evaluation. Published by the

  5. The need for reviewing log books in Birjand University of Medical Sciences clinical wards: Letter to Editor

    Directory of Open Access Journals (Sweden)

    Zoya Tahergorabi

    2017-08-01

    Furthermore, due to the pervasive use of electronic log books in recent years in medical universities across the country that are in line with developments and innovations in medical education, it is recommended that the log books at this university too, should be presented and evaluated electronically. Electronic log books with ongoing record of activities and clinical techniques based on educational objectives, in addition to learning consolidation, determine unavailable measures to achieve clinical objectives and, thus, cause regular monitoring and evaluation on the part of students.

  6. HVDC Transmission an Outlook and Significance for Pakistani Power Sector

    Science.gov (United States)

    Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

    2018-04-01

    Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

  7. Interdisciplinary Medication Adherence Program: The Example of a University Community Pharmacy in Switzerland.

    Science.gov (United States)

    Lelubre, Mélanie; Kamal, Susan; Genre, Noëllie; Celio, Jennifer; Gorgerat, Séverine; Hugentobler Hampai, Denise; Bourdin, Aline; Berger, Jerôme; Bugnon, Olivier; Schneider, Marie

    2015-01-01

    The Community Pharmacy of the Department of Ambulatory Care and Community Medicine (Policlinique Médicale Universitaire, PMU), University of Lausanne, developed and implemented an interdisciplinary medication adherence program. The program aims to support and reinforce medication adherence through a multifactorial and interdisciplinary intervention. Motivational interviewing is combined with medication adherence electronic monitors (MEMS, Aardex MWV) and a report to patient, physician, nurse, and other pharmacists. This program has become a routine activity and was extended for use with all chronic diseases. From 2004 to 2014, there were 819 patient inclusions, and 268 patients were in follow-up in 2014. This paper aims to present the organization and program's context, statistical data, published research, and future perspectives.

  8. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    International Nuclear Information System (INIS)

    Bhatti, S.M.; Dhakam, S.; Khan, M.A.

    2009-01-01

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  9. On the scene: American University of Beirut Medical Center, Beirut, Lebanon.

    Science.gov (United States)

    Mouro, Gladys; Tashjian, Hera; Daaboul, Tania; Kozman, Katia; Alwan, Farah; Shamoun, Anthony

    2011-01-01

    American University of Beirut Medical Center is the first Magnet hospital in the Middle East. In this article, authors reflect back on the journey to excellence, specifically in establishing shared governance in a challenging cultural and organizational milieu. Perspectives from nurses at different levels are included to highlight their experiences throughout the journey. Evolution of the organization's shared governance model is described and initiatives of the councils are illustrated.

  10. Effects of the Islamic Revolution in Iran on Medical Education: The Shiraz University School of Medicine.

    Science.gov (United States)

    Ronaghy, Hossain A.; And Others

    1983-01-01

    Of 173 full-time faculty employed in 1978 at Shiraz University School of Medicine, 108 had left the university by December 1982, and 81 of these had left the country, aggravating the chronic shortage of medical personnel in Iran. Iranian authorities have not been able to counteract these trends. (GC)

  11. Medical students perception of undergraduate ophthalmology training in Nnamdi Azikiwe University Nnewi Campus.

    Science.gov (United States)

    Onyekwe, L O; Nwosu, S N N

    2006-12-01

    To determine the perception and aspiration of medical students towards ophthalmology. Information for the study was obtained through forced-choice questionnaire set to 102 medical students in 2000/2001 graduating class in Nnamdi Azikiwe University. One hundred questionnaires were completed. As a specialty of choice ophthalmology ranked fourth {16.0%} as a first choice; second {21.0%} as a second choice and first {26.0%} as a third choice. Ninety-five of respondents found ophthalmology training useful. This cohort of medical students considered ophthalmic training in this institution essential and adequate. Undergraduate ophthalmic course should ensure an understanding of the basic principles of ophthalmology and should be designed to motivate the interest and confidence of the medical students in the specialty. Training period should be at least 4 weeks. With appropriate training ophthalmology can attract reasonable interest as a choice for specification.

  12. Integrating bioethics into postgraduate medical education: the University of Toronto model.

    Science.gov (United States)

    Howard, Frazer; McKneally, Martin F; Levin, Alex V

    2010-06-01

    Bioethics training is a vital component of postgraduate medical education and required by accreditation organizations in Canada and the United States. Residency program ethics curricula should ensure trainees develop core knowledge, skills, and competencies, and should encourage lifelong learning and teaching of bioethics. Many physician-teachers, however, feel unprepared to teach bioethics and face challenges in developing and implementing specialty-specific bioethics curricula. The authors present, as one model, the innovative strategies employed by the University of Toronto Joint Centre for Bioethics. They postulate that centralized support is a key component to ensure the success of specialty-specific bioethics teaching, to reinforce the importance of ethics in medical training, and to ensure it is not overshadowed by other educational concerns.

  13. A Dual Hesitant Fuzzy Multigranulation Rough Set over Two-Universe Model for Medical Diagnoses

    Science.gov (United States)

    Zhang, Chao; Li, Deyu; Yan, Yan

    2015-01-01

    In medical science, disease diagnosis is one of the difficult tasks for medical experts who are confronted with challenges in dealing with a lot of uncertain medical information. And different medical experts might express their own thought about the medical knowledge base which slightly differs from other medical experts. Thus, to solve the problems of uncertain data analysis and group decision making in disease diagnoses, we propose a new rough set model called dual hesitant fuzzy multigranulation rough set over two universes by combining the dual hesitant fuzzy set and multigranulation rough set theories. In the framework of our study, both the definition and some basic properties of the proposed model are presented. Finally, we give a general approach which is applied to a decision making problem in disease diagnoses, and the effectiveness of the approach is demonstrated by a numerical example. PMID:26858772

  14. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  15. Attitudes to Organ Donation and Knowledge of Donation and Transplantation among University of Auckland Medical Students

    Directory of Open Access Journals (Sweden)

    Lindsey Harbour

    2015-01-01

    Full Text Available Aims • To explore organ donation and transplantation knowledge and attitudes among medical students at the University of Auckland. • To understand students' perception of the extent of training received prior to and during the medical program. Method A validated web-based questionnaire consisting of 42 questions in five categories was anonymously administered to all enrolled medical students at the Faculty of Medical and Health Sciences, University of Auckland, in September 2012. Results In all, 419 out of 989 (42% Year 2–6 students responded. A total of 99.3% of medical students supported organ donation, but knowledge was limited (mean score 7.54/15±2.26. A total of 38% of students reported having participated in organ donation learning. A total of 96% of students believed that organ donation information should be available in primary care settings. A total of 69% of students reported that if a patient asked a question about organ donation that they did not know the answer to, they also would not know where to source the correct information from. Conclusion This study demonstrates that although medical students support organ donation, they lack the knowledge required to facilitate informative discussions with patients. Enhanced organ donation education in medical programs may enable students to develop skills and knowledge allowing them to better discuss donation with patients.

  16. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.

    2016-01-01

    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  17. STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

    Directory of Open Access Journals (Sweden)

    Abdul RAZIQ

    2014-10-01

    Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

  18. The State of Mental Health of Students of Tehran Medical Sciences University in The Academic Year 2010-2011

    Directory of Open Access Journals (Sweden)

    Monavar Moradian Sorkhkalaee

    2012-10-01

    Full Text Available Background and objective: Students are the most dynamic people in the society and their health is to a great extent a prerequisite for the health of most individuals in the society. This study was conducted to investigate the state of mental health and factors which influence it in the students of Tehran University of Medical Sciences and Health Services.Materials and Methods: This descriptive-analytic study was conducted on 400 students of Tehran Medical Sciences University in the academic year 2010-2011. The number of studied subjects was determined according to the student population of each faculty and questionnaires were randomly distributed among them. The data collection tool in this study was the standard GHQ28 questionnaire. After collecting the data, analysis was done using SPSS.18 software, Chi-square test, T-test, and Regression Logestic.Results: 25.52% of the attendants were healthy and 75.47% had suspected mental disorders. Also, regarding depression, 75.53% of people suffered from mental disorders and 25.46% were healthy.Conclusion: According to the achieved results, it seems that studying at university, facing educational problems and the existing conditions at university cause an increase in the rate of mental disorder among the students of Medical Sciences University.

  19. Attitudes of Cairo University medical students toward smoking: the need for tobacco control programs in medical education.

    Science.gov (United States)

    Khan, Adeel A M; Dey, Subhojit; Taha, Alaa H; Huq, Farhan S; Moussawi, Ahmad H; Omar, Omar S; Soliman, Amr S

    2012-04-01

    Tobacco smoking rates are increasing in developing countries and so are tobacco-related chronic diseases. Reported figures from the WHO show rates of smoking in Egypt as high as 20% but limited information is available about smoking specifically among physicians and medical students. Final-year medical students of Cairo University were surveyed regarding their tobacco behavior and attitudes using a modified Global Health Professions Student Survey. We approached 220 students by randomly selecting clinical units into which they were assigned and requested completion of the survey. Ever users of some form of tobacco comprised 46.7% of students sampled, current users of cigarettes comprised 17.4%, and current users of water pipe 'sheesha' comprised 17.6%. The vast majority (87.7%) of students believed that smoking is a public health problem in Cairo and supported restriction of tobacco. Yet, only 58.5% stated that they were taught it is important for physicians to provide tobacco education materials to patients. Among ever users of cigarettes, 54.4% believed health professionals do not serve as health role models for patients, and only a small percentage of all students (34.2%) stated that they had received some form of training on smoking cessation in their medical curriculum to be able to instruct patients. A high rate of smoking was revealed among medical students in Cairo. Overall, approximately 23.4% of students were currently smoking cigarettes and/or sheesha, and 46.7% were ever users of some form of tobacco. A formal antitobacco program for medical students should be incorporated into their medical curriculum to change the attitudes of medical students and overcome the anticipated increase in chronic diseases in Egypt.

  20. Jewish Medical Students and Graduates at the Universities of Padua and Leiden: 1617–1740

    Directory of Open Access Journals (Sweden)

    Kenneth Collins

    2013-01-01

    Full Text Available The first Jewish medical graduates at the University of Padua qualified in the fifteenth century. Indeed, Padua was the only medical school in Europe for most of the medieval period where Jewish students could study freely. Though Jewish students came to Padua from many parts of Europe the main geographical sources of its Jewish students were the Venetian lands. However, the virtual Padua monopoly on Jewish medical education came to an end during the seventeenth century as the reputation of the Dutch medical school in Leiden grew. For aspiring medieval Jewish physicians Padua was, for around three hundred years, the first, simplest, and usually the only choice.

  1. Opfer des NS-Bücherraubes – 10 Fälle aus medizinischen Bibliotheken in Wien: Provenienzforschungsprojekt an der Universitätsbibliothek der Medizinischen Universität Wien / Victims of book expropriation during nazi regime – 10 examples from medical libraries in Vienna: provenance research project at the university library at the Medical University Vienna

    Directory of Open Access Journals (Sweden)

    Bauer, Bruno

    2008-01-01

    Full Text Available Since 2007 the university library at the Medical University Vienna runs a provenance research project. Books, stolen between 1938 and 1945, were acquired by at that time discrete libraries at institutions and clinics of the former medical faculty at Vienna University. A systematic survey of the now centralised book collection should bring to light these misgotten book acquisitions. Aim of the project is to document such cases and to restitute books to their lawful owners or their legal successors. Until Novemver 2008 about 80,000 volumes were scrutinised directly at the shelves by so-called autopsy. So far about 200 definitely stolen books and approximately 1800 suspicious books were dedected. This paper describes the initial position, method and hitherto existing results of the provenance research project. Ten cases of such book theft, recorded in the now centralised collection of the university library of the Medical University Vienna (former medical faculty, should depict victims of book expropiation during nazi regime. These cases include second-hand bookshops (Alois Fantl, Hans Peter Kraus, an university professor from the former medical faculty at Vienna University (Markus Hajek, general practitioners not associated with the former medical faculty (Adolf Kronfeld, Richard Löwi, private persons (Lily Fuchs, Raoul Fernand Jellinek-Mercedes and books from public and private libraries (Akademischer Verein jüdischer Mediziner, Bibliothek Sassenbach, Ortskrankenkasse Dresden.

  2. Interdisciplinary Medication Adherence Program: The Example of a University Community Pharmacy in Switzerland

    Directory of Open Access Journals (Sweden)

    Mélanie Lelubre

    2015-01-01

    Full Text Available The Community Pharmacy of the Department of Ambulatory Care and Community Medicine (Policlinique Médicale Universitaire, PMU, University of Lausanne, developed and implemented an interdisciplinary medication adherence program. The program aims to support and reinforce medication adherence through a multifactorial and interdisciplinary intervention. Motivational interviewing is combined with medication adherence electronic monitors (MEMS, Aardex MWV and a report to patient, physician, nurse, and other pharmacists. This program has become a routine activity and was extended for use with all chronic diseases. From 2004 to 2014, there were 819 patient inclusions, and 268 patients were in follow-up in 2014. This paper aims to present the organization and program’s context, statistical data, published research, and future perspectives.

  3. Designing and conducting MD/MPH dual degree program in the Medical School of Shiraz University of Medical Sciences.

    Science.gov (United States)

    Salehi, Alireza; Hashemi, Neda; Saber, Mahboobeh; Imanieh, Mohammad Hadi

    2015-07-01

    Many studies have focused on the need of health systems to educated physicians in the clinical prevention, research methodology, epidemiology and health care management and emphasize the important role of this training in the public health promotion. On this basis, Shiraz University of Medical Sciences (SUMS) has established MD/MPH dual degree program since the year 2012. In the current study, Delphi technique was used. Both qualitative and quantitative methods were applied in the Delphi process. The Delphi team members including experts with extensive experience in teaching, research and administration in the field of educational management and health/medical education reached consensus in almost 86% of the questionnaire items through three Delphi rounds. MD/MPH program for SUMS was designed based on the items agreed and thematic analysis used in these rounds. The goals, values, mission and program requirements including the period, the entrance condition, and the number of units, and certification were determined. Accordingly, the courses of the program are presented in parallel with the MD education period. MPH courses consist of 35 units including 16 obligatory and 15 voluntary ones. Designing MD/MPH program in SUMS based on the existent models in the universities in different countries, compatible with educational program of this university and needs of national health system in Iran, can be a beneficial measure towards promoting the students' knowledge and theoretical/practical skills in both individual and social level. Performing some additional research to assess the MD/MPH program and some cohort studies to evaluate the effect of this program on the students' future professional life is recommended.

  4. Analysis of Multiple Choice Tests Designed by Faculty Members of Kermanshah University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Reza Pourmirza Kalhori

    2013-12-01

    Full Text Available Dear Editor Multiple choice tests are the most common objective tests in medical education which are used to assess the ind-ividual knowledge, recall, recognition and problem solving abilities. One of the testing components is the post-test analysis. This component includes; first, qualitative analysis of the taxonomy of questions based on the Bloom’s educational objectives and percentage of the questions with no structural problems; and second, the quantitative analysis of the reliability (KR-20 and indices of difficulty and differentiation (1. This descriptive-analytical study was aimed to qualitatively and quan-titatively investigate the multiple-choice tests of the faculty members at Kermanshah University of Medical Sciences in 2009-2010. The sample size comprised of 156 tests. Data were analyzed by SPSS-16 software using t-test, chi-squared test, ANOVA and Tukey multiple comparison tests. The mean of reliability (KR-20, difficulty index, and discrimination index were 0.68 (± 0.31, 0.56 (± 0.15 and 0.21 (± 0.15, respectively, which were acceptable. The analysis of the tests at Mashad University of Medical Sciences indicated that the mean for the reliability of the tests was 0.72, and 52.2% of the tests had inappropriate difficulty index and 49.2% of the tests did not have acceptable differentiation index (2. Comparison of the tests at Kermanshah University of Medical Sciences for the fields of anatomy, physiology, biochemistry, genetics, statistics and behavioral sciences courses at Malaysia Faculty of Medicine (3 and tests at Argentina Faculty of Medicine (4 showed that while difficulty index was acceptable in all three universities, but differentiation indices in Malaysia and Argentina Medical Faculties were higher than that in Kermanshah University of Medical Sciences. The mean for the questions with no structural flaws in all tests, taxonomy I, taxonomy II, and taxonomy III were 73.88% (± 14.88, 34.65% (± 15.78, 41.34% (± 13

  5. Sexism and anatomy, as discerned in textbooks and as perceived by medical students at Cardiff University and University of Paris Descartes.

    Science.gov (United States)

    Morgan, Susan; Plaisant, Odile; Lignier, Baptiste; Moxham, Bernard J

    2014-03-01

    Contemporary textbooks of anatomy and surface anatomy were evaluated to ascertain whether they were gender-neutral. The evidence of this, and previous studies, suggests that, both in terms of imagery and text, many textbooks lack neutrality. To further investigate such matters, we provided second-year medical students studying at Cardiff University (n = 293) and at the Paris Descartes University (n = 142) during the 2011-2012 academic year with a questionnaire inviting them to address the possibility that social/gender factors hinder the dispassionate representation of anatomy. Ethical approval was obtained from both Cardiff and Paris universities. Eighty-six percent of the students at Cardiff and 39% at Paris Descartes responded and provided data for analysis. The hypothesis tested is that medical students perceive a gender bias that is reflected in the books they read and the tuition they receive. Our findings suggest that, while students recognise the importance of gender issues and do not wish to associate with sexism, most are unaware of the possible negative aspects of sexism within anatomy. In this respect, the findings do not support our hypothesis. Nevertheless, we recommended that teachers of anatomy and authors of anatomy textbooks should be aware of the possibility of adverse effects on professional matters relating to equality and diversity issues. © 2013 Anatomical Society.

  6. The relationship between knowledge of ergonomic science and the occupational health among nursing staff affiliated to Golestan University of Medical Sciences

    OpenAIRE

    Juibari, Leila; Sanagu, Akram; Farrokhi, Nafiseh

    2010-01-01

    BACKGROUND: Occupational hazards are much higher for nurses than many other jobs and neglecting this fact may reduce the quality of nursing services. The aim of this study was to investigate the relationship between knowledge of ergonomics and occupational health among the nursing staff affiliated to Golestan University of Medical Sciences. METHODS: It was a cross-sectional analytical study on 423 nursing staff working in various medical centers affiliated to Golestan University of Medical Sc...

  7. Master's Level Graduate Training in Medical Physics at the University of Colorado Health Sciences Center.

    Science.gov (United States)

    Ibbott, Geoffrey S.; Hendee, William R.

    1980-01-01

    Describes the master's degree program in medical physics developed at the University of Colorado Health Sciences Center. Required courses for the program, and requirements for admission are included in the appendices. (HM)

  8. Evaluation of the quality of the college library websites in Iranian medical Universities based on the Stover model.

    Science.gov (United States)

    Nasajpour, Mohammad Reza; Ashrafi-Rizi, Hasan; Soleymani, Mohammad Reza; Shahrzadi, Leila; Hassanzadeh, Akbar

    2014-01-01

    Today, the websites of college and university libraries play an important role in providing the necessary services for clients. These websites not only allow the users to access different collections of library resources, but also provide them with the necessary guidance in order to use the information. The goal of this study is the quality evaluation of the college library websites in Iranian Medical Universities based on the Stover model. This study uses an analytical survey method and is an applied study. The data gathering tool is the standard checklist provided by Stover, which was modified by the researchers for this study. The statistical population is the college library websites of the Iranian Medical Universities (146 websites) and census method was used for investigation. The data gathering method was a direct access to each website and filling of the checklist was based on the researchers' observations. Descriptive and analytical statistics (Analysis of Variance (ANOVA)) were used for data analysis with the help of the SPSS software. The findings showed that in the dimension of the quality of contents, the highest average belonged to type one universities (46.2%) and the lowest average belonged to type three universities (24.8%). In the search and research capabilities, the highest average belonged to type one universities (48.2%) and the lowest average belonged to type three universities. In the dimension of facilities provided for the users, type one universities again had the highest average (37.2%), while type three universities had the lowest average (15%). In general the library websites of type one universities had the highest quality (44.2%), while type three universities had the lowest quality (21.1%). Also the library websites of the College of Rehabilitation and the College of Paramedics, of the Shiraz University of Medical Science, had the highest quality scores. The results showed that there was a meaningful difference between the quality

  9. Reform in medical and health sciences educational system: a Delphi study of faculty members' views at Shiraz University of Medical Sciences.

    Science.gov (United States)

    Salehi, A; Harris, N; Lotfi, F; Hashemi, N; Kojouri, J; Amini, M

    2014-04-03

    Despite the strengths in the Iranian medical and health sciences educational system, areas in need of improvement have been noted. The purpose of this study was to understand the views of faculty members at Shiraz University of Medical Sciences about current and future needs for medical and health sciences education, with the goal of improving the quality of the educational system. The data were collected using a Delphi consensus method. Analysis of the findings identified the following key themes among the factors likely to contribute to medical and health sciences education and training: adding and/or increasing student numbers in higher degrees in preference to associate degrees; providing more interactive, student-centred teaching methods; improving the educational content with more practical and research-based courses tailored to society's needs; and an emphasis on outcome-based student evaluation techniques. These changes aim to respond to health trends in society and enhance the close relationship between medical education and the needs of the Iranian society.

  10. [Medical surveillance in university: organizational difficulties, legal problems, scientific e technical specificities. Experience of University of Milan Bicocca].

    Science.gov (United States)

    D'Orso, M I; Giuliani, C; Assini, R; Riva, M A; Cesana, G

    2012-01-01

    Our research describes activities of Occupational Health carried out during last year in University of Milan Bicocca by Occupational Doctors. We describe results of medical surveillance in 1153 employees or students exposed to occupational risks for health and safety. We report results obtained, technical difficulties, organizational problems, and preventive actions decided to improve functionality of our activity. Students seem to be less protected and consequently seem to have higher professional safety and health risks.

  11. Evaluation of self-medication amongst university students in Abbottabad, Pakistan; prevalence, attitude and causes.

    Science.gov (United States)

    Ullah, Hanif; Khan, Shujaat A; Ali, Sayyad; Karim, Sabiha; Baseer, Abdul; Chohan, Ossam; Hassan, Syed M F; Khan, Kashif M; Murtaza, Ghulam

    2013-01-01

    Self-medication is a serious issue in most parts of the world. This study aims to evaluate self-medication among university students of Abbottabad, Pakistan. This cross-sectional survey study was carried out in COMSATS Institute of Information Technology, Abbottabad during December 1 - December 31,2011. A sample of 275 students was selected for the study using convenience method of sampling. Data were managed and analyzed via SPSS version 16.0. Inferences were drawn using Z-test Out of 268 respondents (male = 61.6%, female = 38.6%), 138 were non-health professional students whereas 130 were health professional students. The prevalence of self-medication was 95.5%. Most common factor (45.7%) responsible for self-medication was "low severity of disease". Most common symptom (50.8%) that caused self-medication and stocking of medicines was "storage of medicines for multi purposes". Some respondents (22.7%) got addicted due to self-medication. Most of the students trust in allopathic medicines system. High prevalence of self-medication can be controlled through regulatory authorities, mass education and availability of health facilities.

  12. Migraine attacks among medical students in Soochow University, Southeast China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Gu X

    2018-04-01

    Full Text Available Xiao Gu,1,2 Yaojie Xie1 1School of Nursing, The Hong Kong Polytechnic University, Hong Kong; 2Intensive Care Unit, Suzhou Municipal Hospital, Suzhou, China Purpose: Migraine is one of the most common primary headache disorders and is burdensome to both the individual and society, influencing the academic performance and quality of daily lives of medical students worldwide. This study aimed to investigate the migraine prevalence in a sample of university medical students in China and to examine the features and typical trigger factors of migraine among these students. Patients and methods: From May 2016 to August 2016, a total of 1,060 medical students who were enrolled in Soochow University in Jiangsu Province in China were chosen through stratified random sampling. A self-administered questionnaire that included the ID MigraineTM for screening of migraine cases was used to collect data. The frequency, severity, duration of migraine attacks, and relevant trigger factors were measured for migraine cases. In total, 986 students completed the questionnaire. Results: The overall migraine prevalence among students was 7.91%, with 4.64% in male and 9.84% in female students. Junior-grade students had a higher migraine prevalence than senior students (prevalence of migraine of year 1 to year 5 undergraduates: 10.83%, 8.9% vs. 6.25%, 4.42%, 5.33%, P<0.05; prevalence of migraine of year 1 to year 3 graduates: 9.68%, 9.71% vs. 6.38%, P<0.05. Students with a positive family history were more likely to suffer migraine than those without (OR=8.48, 95% CI: 4.33–16.59. Stress (n=73, 93.59%, lack of sleep (n=72, 92.31%, and change of sleeping time (n=68, 87.18% were the top three trigger factors among the students. Conclusion: Migraine was common among medical students from a university in China, and especially higher in female and junior-grade students, and those with a family history of migraine. Reducing stress and improving sleep quality might be effective

  13. Cooperation between National Defense Medical College and Fukushima Medical University in thyroid ultrasound examination after the Fukushima Daiichi nuclear power plant disaster

    International Nuclear Information System (INIS)

    Yamamoto, Yoritsuna; Fujita, Masanori; Tachibana, Shoich; Morita, Koji; Hamano, Kunihisa; Hamada, Koji; Uchida, Kosuke; Tanaka, Yuji

    2013-01-01

    Fukushima Daiichi Nuclear Power Plant was utterly destroyed by The Great East Japan Earthquake which happened on March 11, 2011, and followed by radioactive contamination to the surrounding areas. Based on the known radioactive iodine ("1"3"1I) which led to thyroid cancer in children after the Chernobyl nuclear power plant disaster in 1986, children living in Fukushima should be carefully observed for the development of thyroid cancer. Fukushima Prefecture and Fukushima Medical University started ''Fukushima Health Management Survey'' in May 2011, which includes screening for thyroid cancer by ultrasonography (Thyroid Ultrasound Examination). Thyroid Ultrasound Examination would cover roughly 360,000 residents aged 0 to 18 years of age at the time of the nuclear disaster. The initial screening is to be performed within the first three years after the accident, followed by complete thyroid examinations from 2014 onwards, and the residents will be monitored regularly thereafter. As Thyroid Ultrasound Examination is being mainly performed by medical staff at Fukushima Medical University, there is insufficient manpower to handle the large number of potential examinees. Thus, specialists of thyroid diseases from all over Japan have begun to support this examination. Six endocrinologists including the authors belonging to the National Defense Medical College are cooperating in part of this examination. This paper briefly reports the outline of Thyroid Ultrasound Examination and our cooperation. (author)

  14. Social and psychological factors affecting eating habits among university students in a Malaysian medical school: a cross-sectional study

    OpenAIRE

    Ganasegeran, Kurubaran; Al-Dubai, Sami AR; Qureshi, Ahmad M; Al-abed, Al-abed AA; AM, Rizal; Aljunid, Syed M

    2012-01-01

    Abstract Background Eating habits have been a major concern among university students as a determinant of health status. The aim of this study was to assess the pattern of eating habits and its associated social and psychological factors among medical students. Methods A cross sectional study was conducted among 132 medical students of pre-clinical phase at a Malaysian university. A self-administered questionnaire was used which included questions on socio-demography, anthropometry, eating ha...

  15. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    OpenAIRE

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2012-01-01

    Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

  16. [Prospective assessment of medication errors in critically ill patients in a university hospital].

    Science.gov (United States)

    Salazar L, Nicole; Jirón A, Marcela; Escobar O, Leslie; Tobar, Eduardo; Romero, Carlos

    2011-11-01

    Critically ill patients are especially vulnerable to medication errors (ME) due to their severe clinical situation and the complexities of their management. To determine the frequency and characteristics of ME and identify shortcomings in the processes of medication management in an Intensive Care Unit. During a 3 months period, an observational prospective and randomized study was carried out in the ICU of a university hospital. Every step of patient's medication management (prescription, transcription, dispensation, preparation and administration) was evaluated by an external trained professional. Steps with higher frequency of ME and their therapeutic groups involved were identified. Medications errors were classified according to the National Coordinating Council for Medication Error Reporting and Prevention. In 52 of 124 patients evaluated, 66 ME were found in 194 drugs prescribed. In 34% of prescribed drugs, there was at least 1 ME during its use. Half of ME occurred during medication administration, mainly due to problems in infusion rates and schedule times. Antibacterial drugs had the highest rate of ME. We found a 34% rate of ME per drug prescribed, which is in concordance with international reports. The identification of those steps more prone to ME in the ICU, will allow the implementation of an intervention program to improve the quality and security of medication management.

  17. Knowledge, attitudes and practices concerning self-medication with antibiotics among university students in western China.

    Science.gov (United States)

    Lv, Bing; Zhou, Zhongliang; Xu, Guiping; Yang, Dingkun; Wu, Lina; Shen, Qian; Jiang, Minghuan; Wang, Xiao; Zhao, Guilan; Yang, Shimin; Fang, Yu

    2014-07-01

    To evaluate the knowledge, attitude and behaviours of university students on the use of antibiotics. A knowledge-attitude-practice questionnaire was developed and distributed to undergraduate students of Xi'an Jiaotong University, comprising 18 schools/colleges in Shaanxi Province, western China. Chi-square test and logistic regression analysis were applied to identify risk factors associated with self-medication with antibiotics. Of the 731 respondents (response rate = 73.1%), 294 (40.2%) had self-medicated with antibiotics in the past 6 months. Most of the antibiotics (59.2%) for self-medication were purchased without prescription in retail pharmacies. The median score of students' knowledge about antibiotics was 4 (IQR: 3-6) of a maximum possible score of 10. Students had moderately accurate beliefs towards antibiotics. More than half of the students (56.5%) were storing antibiotics frequently. During self-medication, 16.7% of students claimed to have experienced adverse reactions, and 30.6% had used antibiotics to prevent common colds. The majority preferred to use broad-spectrum antibiotics, and nearly half preferred intravenous antibiotics. Over 44% of students had changed antibiotic dosage, and 36.5% had switched to another antibiotic during the treatment course. Logistic regression analysis identified college and home town as independent risk factors for self-medication with antibiotics (P students had inadequate knowledge, moderately accurate beliefs and inappropriate practices concerning antibiotics, and a high rate of self-medication. This highlights the need for focused educational intervention and stricter governmental regulation concerning antibiotic use and sale in retail pharmacies. © 2014 John Wiley & Sons Ltd.

  18. Occupational status of Shaheed Beheshti University of Medical Sciences Graduates in 1993-7

    Directory of Open Access Journals (Sweden)

    Davood Yadegarinia

    2009-02-01

    Full Text Available Background and purpose: Job Satisfaction of the physicians and factors influencing it, are the issues receiving special attention by the health systems of every country. The present study aimed at revealing the current status of the employment and academic achievements of our physician and their attitude toward their job, in order to provide required information for the relevant authorities.Methods: In this descriptive cross-sectional study, an 8-item questionnaire was developed including 7 closed as well as 1 open question. The list of the physicians who were graduated from the Medical School of Shaheed Beheshti University of Medical Sciences and Health Services (SBMU from 1993 to 1997, was obtained from the Education Deputy of the University and Islamic Republic of Iran Medical Council. The questionnaires were then posted to the target group of physicians. The returned questionnaires were controlled and the related data was entered into the SPSS software.Results: Of all respondents, 356(67.3% were male and others were female; 363(68.4% were married; 260 (50.8% had completed the military service, and others were exempted. One hundred ninety(55.1% of the men and 103 (62% of the women had entered the university using open quota. Ninety four (61% of the single participants were dissatisfied with their jobs. This was 174 (49.2% in the married group. The most dissatisfied (162, 57.4% were among open quota group. More than half of the men and half of the women were dissatisfied with their jobs Conclusion: Physician’s workforce are among the most expensive human resources. A general dissatisfaction which has been shown in this study should be viewed as warning for policymakers and authorities to take measures to safeguard this expensive human capitals.Key word: JOB SATISFACTION, PHYSICIAN OCCUPATION

  19. Burnout and study engagement among medical students at Sun Yat-sen University, China

    Science.gov (United States)

    Liu, Hongchun; Yansane, Alfa Ibrahim; Zhang, Yurong; Fu, Haijun; Hong, Nanrui; Kalenderian, Elsbeth

    2018-01-01

    Abstract This study aims to investigate burnout and study engagement among medical students at Sun Yat-sen University, China. A cross-sectional survey was conducted among undergraduate medical students of Sun Yat-sen University, China. A total of 453 undergraduate students completed a self-administered, structured questionnaire between January and February, 2016. Burnout and study engagement were measured using the Maslach Burnout Inventory-Student Survey (MBI-SS) and the UTRECHT Work Engagement Scale-Students (UWES-S), respectively. Subjects who scored high in emotional exhaustion subscale, high in cynicism subscale, and low in professional efficacy subscale simultaneously were graded as having high risk of burnout. Independent sample t tests and chi-square tests were used to compare the differences in burnout and work engagement between genders, majors, and grade levels. The means (standard deviations) of the MBI-SS subscales were 3.42 (1.45) for emotional exhaustion, 2.34 (1.64) for cynicism, and 3.04 (1.30) for professional efficacy. The means (standard deviations) of the UWES-S subscales were 3.13 (1.49) for vigor, 3.44 (1.47) for dedication and 3.00 (1.51) for absorption. Approximately 1 in 11 students experienced a high risk of burnout. There were no statistically significant gender differences in burnout and study engagement. There were also no statistically significant differences in burnout and study engagement subscales according to student major. Students in higher grades displayed increased burnout risk, higher mean burnout subscale score of cynicism, lower mean burnout subscale score of professional efficacy, and decreased mean study engagement subscale scores of dedication and absorption. There were strong correlations within study engagement subscales. Chinese medical students in this university experience a high level of burnout. Students at higher-grade level experience more burnout and decreased study engagement compared with students in lower

  20. How Medical Statistics has been established at the University of Freiburg: a historical perspective

    Directory of Open Access Journals (Sweden)

    Schumacher, Martin

    2005-06-01

    Full Text Available This contribution gives an outline on the reasons why the Faculty of Medicine at the University of Freiburg established an Institute of Medical Statistics and Documentation about fourty years ago as one of the first in Germany. It will be shown that the Professor of Medical Microbiology and Hygiene at that time initiated and promoted this development being himself motivated by the successful implementation of a vaccine against poliomyelitis through rigorous design, conduct and statistical analysis of a large scale field trial.

  1. Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

    Directory of Open Access Journals (Sweden)

    Habib Hussain Khan

    2017-06-01

    Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

  2. Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

    Science.gov (United States)

    Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

    2013-01-01

    Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

  3. Organizational behavior of employees of Tehran University of Medical Sciences.

    Science.gov (United States)

    Dargahi, Hossein

    2012-01-01

    Organizational behaviors are commonly acknowledged as fundamentals of organizational life that strongly influence both formal and informal organizational processes, interpersonal relationships, work environments, and pay and promotion policies. The current study aims to investigate political behavior tendencies among employees of Tehran University of Medical Sciences (TUMS). This cross-sectional, descriptive and analytical study was conducted on 810 TUMS employees at the headquarters of the Tehran University of Medical Sciences, Iran during 2010-2011. The research tool for data collection was a researcher-tailored questionnaire on political behaviors. The validity of the questionnaire was confirmed by seven management professors, and its reliability was tested by a pilot study using test-retest method which yielded a Cronbach's alpha coefficient of 0.71. The respondents were asked to fill the questionnaire and express their perceptions and tendencies to engage in organizational behaviors. The collected data was read to and analyzed by IBM SPSS environment and correlation analytical methods. Overall, 729 respondents filled and returned the questionnaire yielding a response rate of 90%. Most of the respondents indicated that they had no tendency to engage in political behavior. Moreover, we found that there was a significant correlation between sex, higher education degrees, tenure and the employees' tendency to engage in political behavior. The participants were not overtly political because of their personal belief, ethical values, and personal characters. Non-political and overtly political employees are both prejudicial for all organizations. Therefore, it seems that the medium rate of good political behavior is vital and prevalent in Iranian organizations.

  4. "What is this genetics, anyway?" Understandings of genetics, illness causality and inheritance among British Pakistani users of genetic services.

    Science.gov (United States)

    Shaw, Alison; Hurst, Jane A

    2008-08-01

    Misconceptions about basic genetic concepts and inheritance patterns may be widespread in the general population. This paper investigates understandings of genetics, illness causality and inheritance among British Pakistanis referred to a UK genetics clinic. During participant observation of genetics clinic consultations and semi-structured interviews in Urdu or English in respondents' homes, we identified an array of environmental, behavioral and spiritual understandings of the causes of medical and intellectual problems. Misconceptions about the location of genetic information in the body and of genetic mechanisms of inheritance were common, reflected the range of everyday theories observed for White British patients and included the belief that a child receives more genetic material from the father than the mother. Despite some participants' conversational use of genetic terminology, some patients had assimilated genetic information in ways that conflict with genetic theory with potentially serious clinical consequences. Additionally, skepticism of genetic theories of illness reflected a rejection of a dominant discourse of genetic risk that stigmatizes cousin marriages. Patients referred to genetics clinics may not easily surrender their lay or personal theories about the causes of their own or their child's condition and their understandings of genetic risk. Genetic counselors may need to identify, work with and at times challenge patients' understandings of illness causality and inheritance.

  5. Study the relationship between medical sciences students’ self-esteem and academic achievement of Guilan university of medical sciences

    Science.gov (United States)

    Jirdehi, Maryam Mirzaee; Asgari, Fariba; Tabari, Rasool; Leyli, Ehsan Kazemnejad

    2018-01-01

    BACKGROUND: Achievement of productivity and improvement of quality in the educational system is the effective, influential factors for countries development. Academic achievement is the main objective of the training program and the most important concerns of teachers, education officials, and university Student's families. Self-esteem is one of the factors affecting student academic achievement. This study is aimed to investigate the relationship between self-esteem and academic achievement in Medical Sciences students of in 2014–2015. SUBJECTS AND METHODS: This is a descriptive–correlational study. In this study, 537 university students were selected using random stratified sampling method from Guilan University of Medical Sciences in 2014–2015. Data were collected using the standard self-esteem questionnaire of Cooper Smith consisting of four elements (general, social, familial, and educational) and a demographic questionnaire. Data were analyzed using SPSS software version 21 and descriptive statistics such as Spearman correlation and Logistic Regression. RESULTS: The results indicated a significant relationship between grade point average and educational self-esteem (P = 0.002, r = 0.135) and global self-esteem (P = 0.02, r = 0.102). There was also a significant relationship between composite Index educational status and general self-esteem (P = 0.019, r = 0.102) and academic achievement (P = 0.007, r = 0.116) and global self-esteem (P = 0.020, r = 0.102). CONCLUSIONS: According to the results, the highest mean score of self-esteem was related to the familial element, and the lowest average was in terms of social self-esteem, therefore, given the importance and necessity of self-esteem in academic achievement, strengthening of all aspects of self-esteem is suggested. PMID:29693033

  6. Study the relationship between medical sciences students' self-esteem and academic achievement of Guilan university of medical sciences.

    Science.gov (United States)

    Jirdehi, Maryam Mirzaee; Asgari, Fariba; Tabari, Rasool; Leyli, Ehsan Kazemnejad

    2018-01-01

    Achievement of productivity and improvement of quality in the educational system is the effective, influential factors for countries development. Academic achievement is the main objective of the training program and the most important concerns of teachers, education officials, and university Student's families. Self-esteem is one of the factors affecting student academic achievement. This study is aimed to investigate the relationship between self-esteem and academic achievement in Medical Sciences students of in 2014-2015. This is a descriptive-correlational study. In this study, 537 university students were selected using random stratified sampling method from Guilan University of Medical Sciences in 2014-2015. Data were collected using the standard self-esteem questionnaire of Cooper Smith consisting of four elements (general, social, familial, and educational) and a demographic questionnaire. Data were analyzed using SPSS software version 21 and descriptive statistics such as Spearman correlation and Logistic Regression. The results indicated a significant relationship between grade point average and educational self-esteem ( P = 0.002, r = 0.135) and global self-esteem ( P = 0.02, r = 0.102). There was also a significant relationship between composite Index educational status and general self-esteem ( P = 0.019, r = 0.102) and academic achievement ( P = 0.007, r = 0.116) and global self-esteem ( P = 0.020, r = 0.102). According to the results, the highest mean score of self-esteem was related to the familial element, and the lowest average was in terms of social self-esteem, therefore, given the importance and necessity of self-esteem in academic achievement, strengthening of all aspects of self-esteem is suggested.

  7. Predictors of self-reported academic performance among undergraduate medical students of Hawassa University, Ethiopia

    Directory of Open Access Journals (Sweden)

    Gedefaw A

    2015-04-01

    Full Text Available Abel Gedefaw,1 Birkneh Tilahun,2 Anteneh Asefa3 1Department of Gynecology and Obstetrics, 2Department of Pediatrics and Child Health, 3School of Public and Environmental Health, College of Medicine and Health Sciences, Hawassa University, Hawassa, Ethiopia Background: This study was conducted to identify predictors of self-reported academic performance in undergraduate medical students at Hawassa University. Methods: An analytical cross-sectional study involving 592 undergraduate medical students was conducted in November 2012. The academic performance of the study subjects was measured by self-reported cumulative grade point average (GPA using a self-administered questionnaire. Data were entered and analyzed using Statistical Package for the Social Sciences version 16 software. Pearson's bivariate correlations, multiple linear regression, and multiple logistic regression were used to identify predictors of academic performance. Results: The self-reported academic performance of students had been decreasing as the academic years progressed, with the highest and lowest performance being in the premedicine (mean GPA 3.47 and clinical I (mean GPA 2.71 years, respectively. One hundred and fifty-eight (26.7% of the participants had ever been delayed, 37 (6.2% had ever re-sat for examination, and two (0.3% had ever been warned due to academic failure. The overall variation in self-reported academic performance of the students was 32.8%. Participant age alone explained 21.9% of the variation. On the other hand, university entrance examination results, substance use at university, and medicine as first choice by students were identified as predictors of variation in self-reported academic performance, accounting for 6.9%, 2.7%, and <1% of the variation, respectively. Students who had never used tobacco, alcohol, or khat after starting university were twice as likely to score a self-reported cumulative GPA above 3.0 (adjusted odds ratio 1.95, 95

  8. Comparison on information-seeking behavior of postgraduated students in Isfahan University of Medical Sciences and University of Isfahan in writing dissertation based on Kuhlthau model of information search process.

    Science.gov (United States)

    Abedi, Mahnaz; Ashrafi-Rizi, Hasan; Zare-Farashbandi, Firoozeh; Nouri, Rasoul; Hassanzadeh, Akbar

    2014-01-01

    Information-seeking behaviors have been one of the main focuses of researchers in order to identify and solve the problems users face in information recovery. The aim of this research is Comparative on Information-Seeking Behavior of the Postgraduate Students in Isfahan University of Medical Sciences and Isfahan University in Writing Dissertation based on Kuhlthau Model of Information Search Process in 2012. The research method followed is survey and the data collection tool is Narmenji questionnaire. Statistical population was all postgraduate students in Isfahan University of Medical Sciences and Isfahan University. The sample size was 196 people and sampling was stratified randomly. The type of statistical analyses were descriptive (mean and frequency) and inferential (independent t test and Pearson's correlation) and the software used was SPSS20. The findings showed that Isfahan Medical Sciences University followed 20% of the order steps of this model and Isfahan University did not follow this model. In the first stage (Initiation) and sixth (Presentation) of feelings aspects and in actions (total stages) significant difference was found between students from the two universities. Between gender and fourth stage (Formulation) and the total score of feelings the Kuhlthau model there has a significant relationship. Also there was a significant and inverse relationship between the third stage (Exploration) of feelings and age of the students. The results showed that in writing dissertation there were some major differences in following up the Kuhlthau model between students of the two Universities. There are significant differences between some of the stages of feelings and actions of students' information-seeking behavior from the two universities. There is a significant relationship between the fourth stage (Formulation) of feelings in the Kuhlthau Model with gender and third stage of the Feelings (Exploration) with age.

  9. Visual representation of gender in flood coverage of Pakistani print media

    Directory of Open Access Journals (Sweden)

    Zarqa S. Ali

    2014-08-01

    Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

  10. Psychological Type and Undergraduate Student Achievement in Pharmacy Course in Military Medical University

    Science.gov (United States)

    Shi, Ru; Shan, Shou-qin; Tian, Jian-quan

    2007-01-01

    The Myers-Briggs Type Indicator (MBTI) was given to 264 students in an undergraduate Pharmacy course at a military medical university. Selected MBTI personality types were compared for achievement in the course using a t-test to compare total points earned. High grades were earned by students stronger in the traits of introversion (I) and judgment…

  11. Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

    2014-01-01

    Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

  12. Evaluation of Randomly Selected Completed Medical Records Sheets in Teaching Hospitals of Jahrom University of Medical Sciences, 2009

    Directory of Open Access Journals (Sweden)

    Mohammad Parsa Mahjob

    2011-06-01

    Full Text Available Background and objective: Medical record documentation, often use to protect the patients legal rights, also providing information for medical researchers, general studies, education of health care staff and qualitative surveys is used. There is a need to control the amount of data entered in the medical record sheets of patients, considering the completion of these sheets is often carried out after completion of service delivery to the patients. Therefore, in this study the prevalence of completeness of medical history, operation reports, and physician order sheets by different documentaries in Jahrom teaching hospitals during year 2009 was analyzed. Methods and Materials: In this descriptive / retrospective study, the 400 medical record sheets of the patients from two teaching hospitals affiliated to Jahrom medical university was randomly selected. The tool of data collection was a checklist based on the content of medical history sheet, operation report and physician order sheets. The data were analyzed by SPSS (Version10 software and Microsoft Office Excel 2003. Results: Average of personal (Demography data entered in medical history, physician order and operation report sheets which is done by department's secretaries were 32.9, 35.8 and 40.18 percent. Average of clinical data entered by physician in medical history sheet is 38 percent. Surgical data entered by the surgeon in operation report sheet was 94.77 percent. Average of data entered by operation room's nurse in operation report sheet was 36.78 percent; Average of physician order data in physician order sheet entered by physician was 99.3 percent. Conclusion: According to this study, the rate of completed record papers reviewed by documentary in Jahrom teaching hospitals were not desirable and in some cases were very weak and incomplete. This deficiency was due to different reason such as medical record documentaries negligence, lack of adequate education for documentaries, High work

  13. Contraceptive behavior as risk factor for reproductive health of junior students attending a medical university

    Directory of Open Access Journals (Sweden)

    T.N. Govyazina

    2017-06-01

    Full Text Available 1–3 year students attending medical and preventive faculty of a medical university were our research object. Our research had many stages, and at the first one our goal was to examine and to assess basic behavioral risks for reproductive health of students attending medical and preventive faculty of a medical university. We conducted a sociological examination via questioning. 428 students were questioned as per materials collecting program which included 74 parameters; they accounted for 91.6 % out of the overall official number of students, 45.0 % male students and 40.0 % female students combined work and studies. We detected that, as per questioning results, the specific weight of students who took care of their health amounted to 79.2 % boys and 95.2 % girls. However, the students tended to have bad habits, i.e. constant alcohol intake or smoking. And although information on diseases prevention and on how to pursue healthy lifestyle was perfectly available to them, students didn't try to use it and preserve their health. All the respondents said they were against abortion. Girls were likely to adopt a complex approach when choosing a contraceptive, they resorted to hormonal agents, and, with their partners' consent, to condoms. But they often took hormonal agents without any consultations with a gynecologist or an endocrinologist. Contraceptives were rather rarely applied, and students appeared to have no knowledge on risk factors causing reproductive health deterioration. They also tended to be negligent and too self-confident when it came to reproductive health protection. A risk of abortions was very high for girls who didn't use contraceptives, and also all students ran rather high risk of catching sexual diseases. Sexual education is needed to correct contraceptive behavior; medical workers are a main source of information on reproductive health of young people in 7–10 % cases only. We need to create interactive educational programs

  14. [Designing and Operating a Comprehensive Mental Health Management System to Support Faculty at a University That Contains a Medical School and University Hospital].

    Science.gov (United States)

    Kawanishi, Chiaki

    2016-01-01

    In Japan, healthcare professionals and healthcare workers typically practice a culture of self-assessment when it comes to managing their own health. Even where this background leads to instances of mental health disorders or other serious problems within a given organization, such cases are customarily addressed by the psychiatrists or psychiatric departments of the facilities affected. Organized occupational mental health initiatives for professionals and workers within the healthcare system are extremely rare across Japan, and there is little recognition of the need for such initiatives even among those most directly affected. The author has some experience designing and operating a comprehensive health management system to support students and faculty at a university in the Tokyo Metropolitan Area that contains a medical school and university hospital. At this university, various mental health-related problems were routinely being allowed to develop into serious cases, while the fundamental reforms required by the health management center and the mental health management scheme organized through the center had come to represent a challenge for the entire university. From this initial situation, we undertook several successive initiatives, including raising the number of staff in the health management center and its affiliated organizations, revising and drafting new health management rules and regulations, launching an employment support and management system, implementing screenings to identify people with mental ill-health, revamping and expanding a counselling response system, instituting regular collaboration meetings with academic affairs staff, and launching educational and awareness-raising activities. This resulted in the possibility of intervention in all cases of mental health crisis, such as suicidal ideation. We counted more than 2,400 consultations (cumulative total number; more than half of consultations was from the medical school, postgraduate

  15. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  16. Perceptions of students in different phases of medical education of the educational environment: Universiti Sultan Zainal Abidin

    Directory of Open Access Journals (Sweden)

    Rahman NIA

    2015-03-01

    Full Text Available Nor Iza A Rahman, Aniza Abd Aziz, Zainal Zulkifli, Muhammad Arshad Haj, Farah Hanani Binti Mohd Nasir, Sharvina Pergalathan, Muhammad Ismail Hamidi, Salwani Ismail, Nordin Bin Simbak, Mainul Haque Faculty of Medicine, Universiti Sultan Zainal Abidin, Kuala Terengganu, Terengganu, Malaysia Background: The Dundee Ready Education Environment Measure (DREEM was planned and designed to quantify the educational environment precisely for medical schools and health-related professional schools. DREEM is now considered a valid and reliable tool, which is globally accepted for measuring the medical educational environment. The educational environment encountered by students has an impact on satisfaction with the course of study, perceived sense of well-being, aspirations, and academic achievement. In addition to being measurable, the educational environment can also be changed, thus enhancing the quality of medical education and the environment, and the medical education process. The objective of this study was to assess the educational environment of the Universiti Sultan Zainal Abidin (UniSZA undergraduate medical program from the students’ perspective. The study expected to explore UniSZA medical students’ overall perceptions, perceptions of learning, teachers, atmosphere, academic self-perception, and social self-perception using the DREEM questionnaire. Methods: A cross-sectional survey was conducted to study the perceptions of the students toward the educational environment of UniSZA as a new medical school, using the DREEM questionnaire. All medical students of UniSZA from Years I–V enrolled in the Bachelor of Medicine and Bachelor of Surgery programs were the target population (n=270. Therefore, the universal sampling technique was used. The data were analyzed using the SPSS 20 software. This study obtained ethical clearance from the Faculty of Medicine and Health Sciences, UniSZA. Results: A total of 195 out of 270 students responded

  17. Relationship of thyroid-stimulating hormone with metabolic syndrome in a sample of euthyroid Pakistani population

    International Nuclear Information System (INIS)

    Saleem, M.S.; Khan, K.A.

    2011-01-01

    Metabolic Syndrome is a group of factors that predispose to cardiovascular diseases. The prevalence of metabolic syndrome is rising rapidly. Recently, a few studies have suggested that lower thyroid function in the reference range may be associated with metabolic syndrome, but the issue remains unsettled. We aimed to elucidate the relationship between thyroid function and components of metabolic syndrome in a sample of euthyroid Pakistani population. Methods: This analytical, cross-sectional study was conducted at the Department of Physiology, University of Health Sciences, Lahore, Pakistan, and extended over a period of 12 months. It included 100 subjects with metabolic syndrome in the study group and thirty subjects without metabolic syndrome in the control group with age ranging 45-55 years. Both groups had normal thyroid function. After a detailed history and clinical examination, fasting blood was analysed for glucose, triglycerides, high density lipoprotein-cholesterol along with thyroid-stimulating hormone (TSH) and free thyroxine. Results: Serum TSH was significantly higher in study group than in control group (p=0.040). Serum free thyroxine values of study group were slightly but not significantly lower than those of control group. Serum TSH correlated significantly and positively with serum triglycerides in all subjects and with waist circumference and diastolic blood pressure in men. Serum TSH showed a positive and linear relationship with the number of components of metabolic syndrome (p=0.016) in all subjects. Conclusion: High-normal TSH is associated with metabolic syndrome and its components. There may be increased risk of cardiovascular diseases with high-normal TSH levels. (author)

  18. Macro and Micro-Nutrients Intake, Food Groups Consumption and Dietary Habits among Female Students in Isfahan University of Medical Sciences

    OpenAIRE

    Azadbakht, L; Esmaillzadeh, A

    2012-01-01

    Background Improving the dietary intake among different groups and population is important for improving the health status. This study determines the nutrients and food group intake as well as dietary habits among female students in Isfahan University of Medical Sciences. Methods Two hundreds and eighty nine healthy female youths who were randomly selected among students of Isfahan University of Medical Sciences in Isfahan, Iran were enrolled. A validated semi quantitative food frequency ques...

  19. Evaluation of Board Performance in Iran’s Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Haniye Sajadi

    2014-10-01

    Full Text Available Background The critical role that the board plays in governance of universities clarifies the necessity of evaluating its performance. This study was aimed to evaluate the performance of the boards of medical universities and provide solutions to enhance its performance. Methods The first phase of present study was a qualitative research in which data were collected through face-to-face semi-structured interviews. Data were analyzed by thematic approach. The second phase was a mixed qualitative and quantitative study, with quantitative part in cross-sectional format and qualitative part in content analysis format. In the quantitative part, data were collected through Ministry of Health and Medical Education (MoHME. In the qualitative part, the content of 2,148 resolutions that were selected by using stratified sampling method were analyzed. Results Participants believed that the boards had no acceptable performance for a long time. Results also indicated the increasing number of meetings and resolutions of the boards in these 21 years. The boards’ resolutions were mostly operational in domain and administrative in nature. The share of specific resolutions was more than the general ones. Conclusion Given the current pace of change and development and the need to timely respond them, it is recommended to accelerate the slow pace of improvement process of the boards. It appears that more delegation and strengthening the position of the boards are the effective strategies to speed up this process.

  20. Acceptability of Male Circumcision among College Students in Medical Universities in Western China: A Cross-Sectional Study.

    Directory of Open Access Journals (Sweden)

    Junjun Jiang

    Full Text Available Male circumcision (MC has been shown to reduce the risk of female to male transmission of HIV. The goal of this survey was to explore MC's acceptability and the factors associated with MC among college students in medical universities in western China.A cross-sectional study was carried out in three provinces in western China (Guangxi, Chongqing and Xinjiang to assess the acceptability of MC as well as to discover factors associated with the acceptability among college students in medical universities. A total of 1,790 uncircumcised male students from three medical universities were enrolled in this study. In addition, 150 students who had undergone MC were also enrolled in the survey, and they participated in in-depth interviews.Of all the uncircumcised participants (n = 1,790, 55.2% (n = 988 were willing to accept MC. Among those who accepted MC, 67.3% thought that MC could improve their sexual partners' hygiene, 46.3% believed that HIV and sexually transmitted diseases (STDs could be partially prevented by MC. The multivariable logistic regression indicates that MC's acceptability was associated with three factors: the redundant foreskin (OR = 10.171, 95% CI = 7.629-13.559, knowing the hazard of having a redundant foreskin (OR = 1.597, 95% CI = 1.097-2.323, and enhancing sexual pleasure (OR = 1.628, 95% CI = 1.312-2.021. The in-depth interviews for subjects who had undergone MC showed that the major reason for having MC was the redundant foreskin (87.3%, followed by the benefits and the fewer complications of having MC done. In addition, most of these participants (65.3% said that the MC could enhance sexual satisfaction.MC's acceptance among college students in medical universities is higher than it is among other populations in western China. An implementation of an MC programme among this population is feasible in the future.

  1. The relationship between cultural intelligence and social compatibility in Isfahan University of Medical Sciences dormitories resident students.

    Science.gov (United States)

    Keyvanara, Mahmoud; Yarmohammadian, Mohammad Hossein; Soltani, Batoul

    2014-01-01

    Cultural intelligence and social compatibility are two acquired processes that their education and reinforcement between dormitory's students who have inter cultural interactions with each other can conclude with results that tension diminution, inter cultural contrast and conflict, social divisions and consequently healthy and peaceful relationships and governance and finally mental peace, and health are of its most important. Hence, the research has been occurring in order to the determination of cultural intelligence relationship with the social compatibility of Isfahan University of Medical Sciences dormitories resident students in 2012. The research method is descriptive-correlation, and its population is composed of all Isfahan University of Medical Sciences dormitories resident students in 2012 that were totally 2500 persons. The two steps sampling method have been used, group sampling and random sampling has been occurring at first and second steps and totally 447 persons were selected. Research data were collected via Earley and Ang cultural intelligence questionnaire with 0.76 Cronbach's alpha Coefficient and California social compatibility standard questionnaire with higher than 0.70 Cronbach's alpha factor. Questionnaire data have been analyzed with the SPSS software and results have been presented in the shape of descriptions and statistics. Results showed that there is a direct significant relationship (P intelligence and the social adjustment in students living in Isfahan University of Medical Sciences dormitories and also there is a direct significant relationship in the level of (P intelligence; however, there is no significant relationship between cognitive and behavioral dimensions of cultural intelligence and social adjustment (P > 0.05). Cultural intelligence and cognitive and motivational addition in dimensions of students living in Isfahan University of Medical Sciences dormitories increase their social integration, therefore, cultural

  2. Students' attitudes towards impact of the health department website on their health literacy in Semnan University of Medical Sciences.

    Science.gov (United States)

    Mahdizadeh, Jamileh; Valinejadi, Ali; Pooyesh, Behnoosh; Jafari, Fatemeh; Kahouei, Mehdi

    2018-01-01

    Health literacy has been of interest to policymakers because of its impact on health decision-making as one of the important issues for promoting community health and improving the quality of health care delivery. Therefore, it seems necessary to examine the status of the website of the health sector of the University of Medical Sciences in promoting health literacy from the viewpoint of the students. This cross-sectional study was performed on 529 medical and allied students in schools affiliated to Semnan University of Medical Sciences, Semnan, Iran between 2016 and 2017. In this study, a valid and reliable adult health literacy questionnaire designed by Montazeri et al. was used. The questionnaire was distributed among students in medical and allied health schools and they were asked to complete the questionnaire. Independent-samples t-test, one-way ANOVA, and Pearson product-moment correlation were used to analyze data by SPSS 19. Mean scores of the participants' attitudes towards reading of health information was 3.14 and towards decision and usage of health information was 2.53. Relationship between the study subjects' demographic characteristics and their attitudes was significant (pwebsite. Hence, the results of this study showed that the website of the health department needs to be redesigned, and this design would allow a better link between the University of Medical Sciences and its audience to promote health literacy.

  3. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

    Science.gov (United States)

    Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

    2012-01-01

    The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

  4. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-04-01

    Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

  5. Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ali Shoeibi

    2013-03-01

    Full Text Available     Human T-cell lymphotropic virus (HTLV types 1 and 2 belong to the Oncorna group of retroviridae, a large family of viruses, grouped initially by pathogenic features, but later revised on the basis of genome structure and nucleotide sequence. HTLV-I was the first discovered human retrovirus to be associated with a malignancy in 1980. The malignancy, first described by Uchiyama and co-workers in southwestern Japan, was named Adult T-cell Leukemia/Lymphoma (ATL and characterized with cutaneous and respiratory involvement, hepatosplenomegaly, lymphadenopathy and various metabolic abnormalities such as hypercalcemia. The HTLV-I has been known to be endemic to certain parts of Iran like the province of Khorasan in the northeast since 1990, with a 2.3% prevalence rate of infection. The main manifestations of HTLV-I infection are neurologic and hematologic (such as ATL disorders, but it has also other manifestations such as uveitis, arthritis, dermatitis, vitiligo and lymphocytic alveolitis. Its main neurologic manifestation is a chronic progressive myelopathy that is referred to HTLV-I Associated Myelopathy (HAM in Japan and Tropical Spastic Paraparesis (TSP in Caribbean. But other disorders such as peripheral neuropathy, polyradiculoneuropathy, myopathy, peripheral facial paresis, and so on have been reported too. In this review we wish to give some brief information on the different aspects (including epidemiology, pathogenesis and pathology, clinical findings, and treatment of HTLV-I infection according to our twenty-year researches. The department of neurology of Mashhad University of Medical Sciences has been a pioneer in researches on HTLV-I in the last twenty years.  

  6. [Systematic Readability Analysis of Medical Texts on Websites of German University Clinics for General and Abdominal Surgery].

    Science.gov (United States)

    Esfahani, B Janghorban; Faron, A; Roth, K S; Grimminger, P P; Luers, J C

    2016-12-01

    Background: Besides the function as one of the main contact points, websites of hospitals serve as medical information portals. As medical information texts should be understood by any patients independent of the literacy skills and educational level, online texts should have an appropriate structure to ease understandability. Materials and Methods: Patient information texts on websites of clinics for general surgery at German university hospitals (n = 36) were systematically analysed. For 9 different surgical topics representative medical information texts were extracted from each website. Using common readability tools and 5 different readability indices the texts were analysed concerning their readability and structure. The analysis was furthermore stratified in relation to geographical regions in Germany. Results: For the definite analysis the texts of 196 internet websites could be used. On average the texts consisted of 25 sentences and 368 words. The reading analysis tools congruously showed that all texts showed a rather low readability demanding a high literacy level from the readers. Conclusion: Patient information texts on German university hospital websites are difficult to understand for most patients. To fulfill the ambition of informing the general population in an adequate way about medical issues, a revision of most medical texts on websites of German surgical hospitals is recommended. Georg Thieme Verlag KG Stuttgart · New York.

  7. The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

    Science.gov (United States)

    Williams, Lisa; Ralphs, Rob; Gray, Paul

    2017-03-21

    The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

  8. Advanced medical students' experiences and views on professionalism at Kuwait University.

    Science.gov (United States)

    Al-Abdulrazzaq, Dalia; Al-Fadhli, Amani; Arshad, Andleeb

    2014-07-23

    Professionalism is a core competency in the medical profession worldwide. Numerous studies investigate how this competency is taught and learned. However, there are few reports on the students' views and experiences with professionalism especially in the Arab world. Our aim was to explore the experiences and views of Kuwait final-year medical students on professionalism. This was a questionnaire study of final-year medical students at Kuwait University (n = 95). Open- and close-ended questions were used to determine the students' experiences and views on: definition, teaching, learning, and assessment of professionalism. Eighty-five of the students completed the questionnaire (89.5%). A total of 252 attributes defining professionalism were listed by our respondents. The majority (98.0%) of these attributes were categorized under the CanMEDS theme describing professionalism as commitment to patients, profession, and society through ethical practice. The most helpful methods in learning about professionalism for the students were contact with positive role models, patients and families, and with their own families, relatives and peers. The students' rating of the quality and quantity of teaching professionalism in the institution was quite variable. Despite this, 68.2% of the students felt very or somewhat comfortable explaining the meaning of medical professionalism to junior medical students. Almost half of the students felt that their education had always or sometimes helped them deal with professionally-challenging situations. Majority (77.6%) of the students thought that their academic assessments should include assessment of professionalism and should be used as a selection criterion in their future academic careers (62.3%). Most of the students discussed and sought advice regarding professionally-challenging situations from their fellow medical students and colleagues. Seventy-five (88.2%) students did not know which organizational body in the institution

  9. Determination of rate of customer focus in educational programs at Isfahan University of Medical Sciences1 based on students’ viewpoints

    Science.gov (United States)

    Shams, Assadollah; Yarmohammadian, Mohammad Hosein; Abbarik, Hadi Hayati

    2012-01-01

    Background: Today, the challenges of quality improvement and customer focus as well as systems development are important and inevitable matters in higher education institutes. There are some highly competitive challenges among educational institutes, including accountability to social needs, increasing costs of education, diversity in educational methods and centers and their consequent increasing competition, and the need for adaptation of new information and knowledge to focus on students as the main customers. Hence, the purpose of this study was to determine the rate of costumer focus based on Isfahan University of Medical Sciences students’ viewpoints and to suggest solutions to improve this rate. Materials and Methods: This was a cross-sectional study carried out in 2011. The statistical population included all the students of seven faculties of Isfahan University of Medical Sciences. According to statistical formulae, the sample size consisted of 384 subjects. Data collection tools included researcher-made questionnaire whose reliability was found to be 87% by Cronbach's alpha coefficient. Finally, using the SPSS statistical software and statistical methods of independent t-test and one-way analysis of variance (ANOVA), Likert scale based data were analyzed. Results: The mean of overall score for customer focus (student-centered) of Isfahan University of Medical Sciences was 46.54. Finally, there was a relation between the mean of overall score for customer focus and gender, educational levels, and students’ faculties. Researcher suggest more investigation between Medical University and others. Conclusion: It is a difference between medical sciences universities and others regarding the customer focus area, since students’ gender must be considered as an effective factor in giving healthcare services quality. In order to improve the customer focus, it is essential to take facilities, field of study, faculties, and syllabus into consideration. PMID

  10. Determination of rate of customer focus in educational programs at Isfahan University of Medical Sciences(1) based on students' viewpoints.

    Science.gov (United States)

    Shams, Assadollah; Yarmohammadian, Mohammad Hosein; Abbarik, Hadi Hayati

    2012-01-01

    Today, the challenges of quality improvement and customer focus as well as systems development are important and inevitable matters in higher education institutes. There are some highly competitive challenges among educational institutes, including accountability to social needs, increasing costs of education, diversity in educational methods and centers and their consequent increasing competition, and the need for adaptation of new information and knowledge to focus on students as the main customers. Hence, the purpose of this study was to determine the rate of costumer focus based on Isfahan University of Medical Sciences students' viewpoints and to suggest solutions to improve this rate. This was a cross-sectional study carried out in 2011. The statistical population included all the students of seven faculties of Isfahan University of Medical Sciences. According to statistical formulae, the sample size consisted of 384 subjects. Data collection tools included researcher-made questionnaire whose reliability was found to be 87% by Cronbach's alpha coefficient. Finally, using the SPSS statistical software and statistical methods of independent t-test and one-way analysis of variance (ANOVA), Likert scale based data were analyzed. The mean of overall score for customer focus (student-centered) of Isfahan University of Medical Sciences was 46.54. Finally, there was a relation between the mean of overall score for customer focus and gender, educational levels, and students' faculties. Researcher suggest more investigation between Medical University and others. It is a difference between medical sciences universities and others regarding the customer focus area, since students' gender must be considered as an effective factor in giving healthcare services quality. In order to improve the customer focus, it is essential to take facilities, field of study, faculties, and syllabus into consideration.

  11. A 5-year scientometric analysis of research centers affiliated to Tehran University of Medical Sciences

    Science.gov (United States)

    Yazdani, Kamran; Rahimi-Movaghar, Afarin; Nedjat, Saharnaz; Ghalichi, Leila; Khalili, Malahat

    2015-01-01

    Background: Since Tehran University of Medical Sciences (TUMS) has the oldest and highest number of research centers among all Iranian medical universities, this study was conducted to evaluate scientific output of research centers affiliated to Tehran University of Medical Sciences (TUMS) using scientometric indices and the affecting factors. Moreover, a number of scientometric indicators were introduced. Methods: This cross-sectional study was performed to evaluate a 5-year scientific performance of research centers of TUMS. Data were collected through questionnaires, annual evaluation reports of the Ministry of Health, and also from Scopus database. We used appropriate measures of central tendency and variation for descriptive analyses. Moreover, uni-and multi-variable linear regression were used to evaluate the effect of independent factors on the scientific output of the centers. Results: The medians of the numbers of papers and books during a 5-year period were 150.5 and 2.5 respectively. The median of the "articles per researcher" was 19.1. Based on multiple linear regression, younger age centers (p=0.001), having a separate budget line (p=0.016), and number of research personnel (p<0.001) had a direct significant correlation with the number of articles while real properties had a reverse significant correlation with it (p=0.004). Conclusion: The results can help policy makers and research managers to allocate sufficient resources to improve current situation of the centers. Newly adopted and effective scientometric indices are is suggested to be used to evaluate scientific outputs and functions of these centers. PMID:26157724

  12. [Reliability and validity of assessment of educational outcomes obtained by students of Medical Rescue at Medical University of Warsaw].

    Science.gov (United States)

    Panczyk, Mariusz; Stachacz, Grzegorz; Gałązkowski, Robert; Gotlib, Joanna

    2016-01-01

    In the interest of preservation of high degree of objectivity of information about students' educational outcomes, a system of assessment needs to meet criteria of appropriate reliability and validity. Analysis of reliability and validity of the system of assessment of students' educational outcomes for courses followed by an examination and covered by a curriculum in Medical Rescue at Medical University of Warsaw (MU W). A retrospective study enrolling a group of 421 students of eight subsequent full education cycles. Detailed data concerning grades for fourteen courses followed by an examination in the entire course of studies were collected. Reliability (Cronbach's alpha coefficient) and criteria validity (Spearman's rank correlation) were assessed. Internal consistency was estimated using a multiple regression model. The levels of assessment reliability for the general university, pre-clinical, and clinical scopes amounted to alpha: 0.42, 0.53, and 0.70, respectively. The strongest positive correlations between the results of pre-clinical and clinical trainings were found for the Anatomy course (r ≈ 0.30). Only in the case of the Pharmacology course it was found that students' achievements in this field were significantly correlated with all other courses of clinical training. The influence of educational outcomes in particular areas of clinical training on the final grade for the entire course of studies was diverse (β regression between 0.04 and 0.11). While the Pharmacology course had the strongest impact on final results, the Surgery course had the least influence on students' final grades (β = 0.04). 1. Sufficient reliability of the system of assessment of educational outcomes in Medical Rescue showed good precision and repeatability of assessment. 2. A low level of validity was caused by a failure to keep the appropriateness of the assessment of educational outcomes in several clinical courses. 3. Prognostic and diagnostic validity of methods used for

  13. Coronary anomalies in Pakistani children with tetralogy of fallot

    International Nuclear Information System (INIS)

    Hussain, I.; Patel, N.

    2010-01-01

    To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

  14. The relationship between emotional intelligence with administrators’ performance at Mashhad University of Medical Sciences

    Science.gov (United States)

    Sadeghi, Tooraj; Saeidi, Masumeh; Moghaddam, Habibolah Taghizade; Ghodsi, Mohammad Jafari; Hoseini, Rasoul

    2018-01-01

    Background The leadership of an organization requires specific features to adapt to changes and to survive and grow in new environments, and emotional intelligence is one of the most important attributes that can help leaders and managers respond to these changes. Objective This study aimed to determine the relationship between emotional intelligence with administrators’ performance at Mashhad University of Medical Sciences, Mashhad, Iran. Methods This cross-sectional study was conducted on 100 basic and middle managers of Mashhad University of Medical Sciences, Mashhad, Iran who were selected by census method in 2016. The instrument of data collecting was the “Inventory Shrinkage”, and the “Organizational performance evaluation forms”. The data were analyzed by SPSS version 16 using descriptive statistics and Spearman correlation. Results The results showed there was a significant negative correlation between emotional intelligence and organizational performance in administrators (r=−0.214, p=0.032). The findings also showed that among the components of emotional intelligence and administrators’ performance, only components of empathy, was there a significant negative correlation (r=−0.199, p=0.047). Also, there was no statistically significant relationship between emotional intelligence and demographic variables such as work experience, age, marital status and education level (p>0.05). There was no significant relationship between organizational performance and demographic variables, either (p>0.05). But between the components of emotional intelligence, only for social skills and work place of administrators, a significant positive correlation was confirmed (r=0.203, p=0.043). Conclusions The results of this study showed that there was a negative and significant correlation between the components of emotional intelligence and administrators’ performance of Mashhad University of Medical Sciences administrators, only in the empathy component. PMID

  15. Predictors of self-reported academic performance among undergraduate medical students of Hawassa University, Ethiopia.

    Science.gov (United States)

    Gedefaw, Abel; Tilahun, Birkneh; Asefa, Anteneh

    2015-01-01

    This study was conducted to identify predictors of self-reported academic performance in undergraduate medical students at Hawassa University. An analytical cross-sectional study involving 592 undergraduate medical students was conducted in November 2012. The academic performance of the study subjects was measured by self-reported cumulative grade point average (GPA) using a self-administered questionnaire. Data were entered and analyzed using Statistical Package for the Social Sciences version 16 software. Pearson's bivariate correlations, multiple linear regression, and multiple logistic regression were used to identify predictors of academic performance. The self-reported academic performance of students had been decreasing as the academic years progressed, with the highest and lowest performance being in the premedicine (mean GPA 3.47) and clinical I (mean GPA 2.71) years, respectively. One hundred and fifty-eight (26.7%) of the participants had ever been delayed, 37 (6.2%) had ever re-sat for examination, and two (0.3%) had ever been warned due to academic failure. The overall variation in self-reported academic performance of the students was 32.8%. Participant age alone explained 21.9% of the variation. On the other hand, university entrance examination results, substance use at university, and medicine as first choice by students were identified as predictors of variation in self-reported academic performance, accounting for 6.9%, 2.7%, and academic performance was explained by the studied variables. Hence, efficacious mechanisms should be designed to combat the intervenable determinants of self-reported academic performance, like substance use and a low medical school entrance examination result. Further studies should also be undertaken to gain a better understanding of other unstudied determinants, like personality, learning style, cognitive ability, and the system used for academic evaluation.

  16. Development and evaluation of a community immersion program during preclinical medical studies: a 15-year experience at the University of Geneva Medical School

    Directory of Open Access Journals (Sweden)

    Chastonay P

    2013-04-01

    Full Text Available P Chastonay,1,2 V Zesiger,1 A Klohn,1 L Soguel,3 E K Mpinga,1,4 NV Vu,2 L Bernheim5 1Institute of Social and Preventive Medicine, 2Unit of Development and Research in Medical Education, University of Geneva, Faculty of Medicine, Geneva, 3Nutrition and Dietetics Department, University of Applied Sciences, Geneva, 4Swiss School of Public Health, Zurich, 5Department of Neurosciences, University of Geneva, Faculty of Medicine, Geneva, Switzerland Background: Significant changes in medical education have occurred in recent decades because of new challenges in the health sector and new learning theories and practices. This might have contributed to the decision of medical schools throughout the world to adopt community-based learning activities. The community-based learning approach has been promoted and supported by the World Health Organization and has emerged as an efficient learning strategy. The aim of the present paper is to describe the characteristics of a community immersion clerkship for third-year undergraduate medical students, its evolution over 15 years, and an evaluation of its outcomes. Methods: A review of the literature and consensus meetings with a multidisciplinary group of health professionals were used to define learning objectives and an educational approach when developing the program. Evaluation of the program addressed students' perception, achievement of learning objectives, interactions between students and the community, and educational innovations over the years. Results: The program and the main learning objectives were defined by consensus meetings among teaching staff and community health workers, which strengthened the community immersion clerkship. Satisfaction, as monitored by a self-administered questionnaire in successive cohorts of students, showed a mean of 4.4 on a five-point scale. Students also mentioned community immersion clerkship as a unique community experience. The learning objectives were reached by a

  17. The performance of select universities of medical sciences based on the components affecting medical education [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Mehdi Tayebi Arasteh

    2018-03-01

    Full Text Available Background: Every educational institution requires an evaluation system in order to find out about the quality and desirability of its activities, especially if it is a complex and dynamic environment. The present study was conducted to evaluate the educational performance of schools affiliated to Alborz University of Medical Sciences to help improve their performance. Methods: This descriptive analytical study was conducted in six schools affiliated to Alborz University of Medical Sciences in April 2016-October 2016 and October 2016-April 2017. The evaluation was carried out in two stages: self-assessment by service executives across schools, and external assessment in person by the university’s expert staff. The study tools included the components, criteria and desirable standards of educational performance in ten categories. Data were analyzed in SPSS. Results: The results obtained showed that, in April-October 2016, the highest performance evaluation scores pertained to the "secure testing" and "rules and regulations" components and the lowest to the "packages for reform and innovation in education" and "the school action plan" components. In October 2016-April 2017, the highest scores pertained to "workforce empowerment" and "secure testing" and the lowest to "faculty affairs" and "electronic education management system". Conclusions: Offering a balanced portrayal of the actual performance of schools using the right performance indicators in two consecutive periods can help further motivate the superior schools and encourage the weaker schools to strive harder. Competition among schools to get a higher score in the components affecting medical education helps mobilize them to move toward reform and improvement.

  18. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  19. Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

    DEFF Research Database (Denmark)

    Andersen, Rikke; Brot, Christine; Mejborn, Heddie

    2009-01-01

    Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

  20. Physiotherapy and pharmacy students perception of educational environment in a medical university from Pakistan.

    Science.gov (United States)

    Memon, Aamir Raoof; Ali, Bahadur; Kiyani, Mubin Mustafa; Ahmed, Imran; Memon, Attiq-Ur-Rehman; Feroz, Jam

    2018-01-01

    To assess and compare the perceptions of the educational environment between physiotherapy and pharmacy students in a public-sector medical university. This cross-sectional study was conducted at the Peoples University of Medical and Health Sciences for Women, Nawabshah, Pakistan, and comprised undergraduate physiotherapy and pharmacy students. The Dundee Ready Educational Environment Measure questionnaire was used to assess the perceptions of students about their educational environment. Global and subscale scores were computed and compared between the respondents. Pphysiotherapy students, the mean global score was 124.9±14.0 while it was 131.7±18.9 for pharmacy students (p=0.16). The domain scores were comparable for both specialties (p>0.05). There was no significance difference in the global and domain scores for preclinical and clinical years in the students (p>0.05). However, in the physiotherapy students, the global and domain scores for Dundee Ready Educational Environment Measure were significantly lower in clinical than preclinical students (pstudents' social self-perception (p>0.05). Students were overall positive about their educational environment.

  1. New open source medical imaging tools released by CERN and University of Bath collaboration

    CERN Multimedia

    Anaïs Rassat, KT group

    2016-01-01

    New toolbox has applications in medical imaging and cancer diagnosis.   3D X-ray imaging of a patient’s lungs and thorax. The TIGRE toolbox provides a high resolution image with only 1/30th of the radiation for the patient. (Image: Ander Biguri) CERN and the University of Bath have released a new toolbox for fast, accurate 3D X-ray image reconstruction with applications in medical imaging and cancer diagnosis. The software offers a very simple and affordable way to improve imaging and potentially reduce radiation doses for patients. The toolbox is based on Cone Beam Computed Tomography (CBCT), a type of scanning process that takes a series of 2D X-ray pictures and that then processes them into a 3D image. As part of the collaborative project between CERN and the University of Bath, Ander Biguri, a PhD student at Bath, has reviewed a broad range of published CBCT algorithms and adapted them to be faster. Ander Biguri modified the algorithms to run on a laptop fitted with a GPU &ndash...

  2. Self-medication practices and rational drug use habits among university students: a cross-sectional study from Kahramanmaraş, Turkey

    Directory of Open Access Journals (Sweden)

    Ramazan Azim Okyay

    2017-11-01

    Full Text Available Background Self-medication refers to the use of medicines to treat self-diagnosed diseases without consulting any healthcare professionals. Irrational drug use and self-medication have serious negative consequences both on health and economy. Therefore, the aim of this study is to assess the habits related to rational use of drugs (RUD and to estimate the prevalence of self-medication practices among university students. Methods This cross-sectional study was conducted on university students in Kahramanmaraş. From May 2017 to June 2017 a total of 960 students filled a “Rational Use of Drugs Questionnaire”. Results The prevalence of practicing self-medication in students was 63.4%. The most common medicines that the students had consumed without prescription were analgesics by 39.5%, antibiotics by 36.9% and cold remedies by 24.0%. The rate of students who declared that they were familiar with RUD and “rational use of antibiotics” (RUA was 45.9%. Reading/checking the instructions in the prospectus (OR = 1.529, 95% CI [1.176–1.990], understanding the context of the prospectus (OR = 1.893, 95% CI [1.387–2.584], compliance with the duration of antibiotic treatment (OR = 1.597, 95% CI [1.231–2.071] and consulting a physician in case of a side effect (OR = 1.350, 95% CI [1.037–1.757] were significantly higher among students who were familiar with RUD as compared to who were not. Discussion Since the awareness of RUD among university students was found to be inadequate, it has critical importance to hold educational activities with the cooperation of physicians, health organizations, universities, non-governmental organizations and media to avoid negative consequences of irrational drug use and self-medication.

  3. Designing a model for critical thinking development in AJA University of Medical Sciences

    Science.gov (United States)

    MAFAKHERI LALEH, MAHYAR; MOHAMMADIMEHR, MOJGAN; ZARGAR BALAYE JAME, SANAZ

    2016-01-01

    Introduction: In the new concept of medical education, creativity development is an important goal. The aim of this research was to identify a model for developing critical thinking among students with the special focus on learning environment and learning style. Methods: This applied and cross-sectional study was conducted among all students studying in undergraduate and professional doctorate programs in Fall Semester 2013-2014 in AJA University of Medical Sciences (N=777). The sample consisted of 257 students selected based on the proportional stratified random sampling method. To collect data, three questionnaires including Critical Thinking, Perception of Learning Environment and Learning Style were employed. The data were analyzed using Pearson's correlation statistical test, and one-sample t-test. The Structural Equation Model (SEM) was used to test the research model. SPSS software, version 14 and the LISREL software were used for data analysis. Results: The results showed that students had significantly assessed the teaching-learning environment and two components of "perception of teachers" and "perception of emotional-psychological climate" at the desirable level (pcritical thinking among students in terms of components of "commitment", "creativity" and "cognitive maturity" was at the relatively desirable level (pcritical thinking through learning style. Conclusion: One of the factors which can significantly impact the quality improvement of the teaching and learning process in AJA University of Medical Sciences is to develop critical thinking among learners. This issue requires providing the proper situation for teaching and learning critical thinking in the educational environment. PMID:27795968

  4. Students’ attitudes towards impact of the health department website on their health literacy in Semnan University of Medical Sciences

    Science.gov (United States)

    Mahdizadeh, Jamileh; Valinejadi, Ali; Pooyesh, Behnoosh; Jafari, Fatemeh

    2018-01-01

    Background and aim Health literacy has been of interest to policymakers because of its impact on health decision-making as one of the important issues for promoting community health and improving the quality of health care delivery. Therefore, it seems necessary to examine the status of the website of the health sector of the University of Medical Sciences in promoting health literacy from the viewpoint of the students. Methods This cross-sectional study was performed on 529 medical and allied students in schools affiliated to Semnan University of Medical Sciences, Semnan, Iran between 2016 and 2017. In this study, a valid and reliable adult health literacy questionnaire designed by Montazeri et al. was used. The questionnaire was distributed among students in medical and allied health schools and they were asked to complete the questionnaire. Independent-samples t-test, one-way ANOVA, and Pearson product-moment correlation were used to analyze data by SPSS 19. Results Mean scores of the participants’ attitudes towards reading of health information was 3.14 and towards decision and usage of health information was 2.53. Relationship between the study subjects’ demographic characteristics and their attitudes was significant (pwebsite. Hence, the results of this study showed that the website of the health department needs to be redesigned, and this design would allow a better link between the University of Medical Sciences and its audience to promote health literacy. PMID:29588815

  5. Prevalence of ADHD among the Students Residing in Dormitory of Ardabil University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Fariba Sadeghi Movahed

    2012-11-01

    Full Text Available Background & Objective: Attention Deficit-Hyperactivity Disorder (ADHD is a heredity and psychological disorder that often continues to adulthood and causes great number of emotional, social, educational and occupational problem for college students. The aim of this study is to determine the prevalence of ADHD among students residing in the dormitory of Ardabil University of Medical Sciences.   Methods: In this cross sectional study, all students in the dormitory of Ardabil University of Medical Sciences were included. They filled the Self reporting Conner’s ADHD questionnaires. Data were extracted and analyzed with SPSS.   Results: During this study, the prevalence of ADHD was 8.6 percent. The males show more involvement rate than females. The students with ADHD showed more incidences of smoking and psychotropic drug consumption.   Conclusion: Due to the high prevalence of ADHD among the college students, early diagnosis and treatment of ADHD seems to be necessary.

  6. Study on attitudes of students of Islamic Azad University Tehran Medical Branch toward food safety, 2016.

    Science.gov (United States)

    Miri, Ali; Poursadeghiyan, Mohsen; Baneshi, Mohammad Mehdi; Biglari, Hamed; Yari, Ahmad Reza; Khammar, Alireza

    2017-05-01

    Given the importance of high-quality healthy food for humans, contamination control is the most important concern for healthy staff. To determine the attitudes of students at Islamic Azad University (Tehran Medical Branch) toward food safety. This cross-sectional and analytic-descriptive study was conducted on 326 students of Azad University of Medical Sciences in 2016. A self-made questionnaire consisting of 40 questions was used. The reliability of the questionnaire was confirmed using internal consistency method (Cronbach's alpha coefficient of 0.80). After collecting data, we use descriptive statistical indexes (mean and standard deviation) among demographic variables and the level of knowledge to describe and analyze the data. The participants' attitudes and operation are measured by Spearman tests, and the analytical results are given using SPSS version 20. According to the findings, 55.3, 30 and 14.7 percent of students had high, moderate and low attitude scores toward food safety, respectively. In addition, male and female students had equal attitudes toward food safety, and no significant relationship between sex and attitude was observed a significant difference (p>0.05), but between educational levels (p=0.008) and ages (p=0.001) of students significance was a positive correlation. Due to the low attitudes score of about half of the students of Islamic Azad University Tehran Medical Branch toward food safety, it can be claimed, food safety training in this community is required.

  7. Factors associated to labour absenteeism due to medical cause in an university institution

    Directory of Open Access Journals (Sweden)

    Juan F. Saldarriaga

    2007-02-01

    Full Text Available Labor absenteeism due to medical cause has unfavorable implications for everybody. The employee suffers with the disease, the company loses productivity and society suffers delays in its economical and social growth. The study of this problem is obviously necessary in order to achieve an appropriate prevention and control of it. Objective: to explore the behavior of absenteeism by medical causes and its associated factors among the affiliates to the health program in the University of Antioquia, Colombia. Methods: frequency, duration, costs and causes of absenteeism are studied in relation to sex, age and physical activity as a regular behavior. Relative risk and its 95% confidence intervals are estimated. Results: respiratory diseases are the first cause of labor medical handicap. Absenteeism is higher in women. RR 1.65 (CI 95% 1.53-1.77. It has a close relationship to age RR 1.25 (CI 95% 1.12-1.38 and to sedentariness RR 2.17 (IC 95% 1.72-2.73.

  8. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

    Science.gov (United States)

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-04-23

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

  9. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  10. Research priorities in medical education at Shiraz University of Medical Sciences: categories and subcategories in the Iranian context

    Directory of Open Access Journals (Sweden)

    PARISA NABEIEI

    2016-01-01

    Full Text Available Introduction: Research in education is a globally significant issue without a long history. Due to the importance of the issue in Health System Development programs, this study intended to determine research priorities in medical education, considering their details and functions. By determining barriers existing in research in education progress, it is tried to make research priorities more functional by recommending acceptable strategies. Methods: This is a qualitative-descriptive study in two descriptive phases. The goal of these phases was to determine research priorities subcategories in medical education by Nominal Group Technique (NGT and two rounds of Delphi method. Through the first phase, subcategories of research priorities were determined, using Nominal Group Technique under medical education experts’ supervision. Through two rounds of Delphi, a questionnaire was constructed based on the subcategories. Eventually, research priorities were determined based on their highest score (scores more than 7 out of 10. Results: In the first phase (NGT, 35 priorities in 5 major fields of medical education were presented. In the second phase, priorities were scored, using Delphi method. Medical Ethics and professionalism gained the highest scores (7.63±1.26 and educational evaluation the lowest (7.28±1.52. In this stage, 7 items were omitted but 2 of them were added again after experts’ revision in the third round of Delphi. Conclusion: According to the results of the present study and based on previous studies, it really seems that the fields of “Learning and Teaching Approaches” and “Medical Ethics and Professionalism” were more important. Because of financial and resource limitations in our country and the importance of research priorities, it is recommended to frequently study “research priorities determination program” at universities.

  11. Assessment of dietary intake of trace elements through Pakistani integrated diets

    International Nuclear Information System (INIS)

    Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

    1994-01-01

    A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

  12. Prevalence and risk factors of helicobacter pylori infection among Pakistani population

    International Nuclear Information System (INIS)

    Rasheed, F.; Ahmad, T.; Bilal, B.

    2012-01-01

    Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

  13. A survey of birth order status of students studying for medical degree at the University of Sheffield.

    Science.gov (United States)

    Clayton, Sarah; Apperley, Elizabeth; Hannon, Fergus; Karia, Anika; Baxter, Victoria; Julious, Steven A

    2014-09-01

    It is hypothesised that firstborn children and only children are more intelligent with higher intelligence scores having been observed in firstborn or only children. Evidence of the increased intelligence has been suggested by the fact that 21/23 (91%) of US astronauts, 23/43 (53%) of US presidents and between 75 and 80% of students at Harvard are firstborn or only children. It is of interest to investigate, therefore, whether a high achieving career such as medicine has a disproportionate number of firstborn or only children. A survey of medical students. The University of Sheffield Medical School. All students studying medicine in the academic year 2011-2012. The proportion of firstborn or only children. THERE WAS A DISPROPORTIONATE NUMBER OF STUDENTS WHO WERE FIRSTBORN OR ONLY CHILDREN: 53% (95% CI 49 to 58%). The expected percentage is 39.8% and therefore we can reject the null hypothesis. The results were consistent across all phases of study. There is a higher than expected proportion of medical students at the University of Sheffield who are firstborn or only children. The data though highlight the issue of comparing populations. Here we are comparing a population of medical students with a general population. A comparison which may not be appropriate as medical students may be drawn from a subsample of the general population.

  14. Assessing the Oldness and Capacity of Radiography and Ultrasound Equipments in Tehran University of Medical Sciences

    International Nuclear Information System (INIS)

    Salamati, Payman; Ghanaati, Hossein; Ghasemzadeh, Shahram; Jalali, Amir Hossein

    2013-01-01

    Maintenance of imaging equipment is a very important part of the management of all medical imaging centers. To assess the oldness and capacity of radiography and ultrasound equipment in Tehran University of Medical Sciences. The study was performed in 16 hospitals, 4 faculties and three healthcare centers of Tehran University of Medical Sciences. We evaluated all the X-ray equipment (including the simple plain and dental, panorex, mammography, fluoroscopy and C-arm X-Ray devices) and also simple and Doppler ultrasound machines in terms of the type and usage of the device, production year, quantity of utilization, location, brand and current condition. Among fixed X-ray systems, 15 were currently in use, two were junk, two were damaged, and one was not utilized. The mean (SD) of the usage of these was 2151 (2230) cliché/month, and the mean (SD) of the oldness was 16.9 (13.6) years. The oldness of radiography equipment in our study was more than 20 years in 16, between 11 and 20 in 46, and less than 10 years in 76 devices. The mean (SD) usage (patients/month) of simple and color Doppler devices were 234.1 (365.2) and 597.5 (505.3), respectively. The oldness of ultrasonography equipment in our study was more than 11 years in 12 and less than 10 years in 55 devices. We found that 22 (15.9%) of the radiography systems and two (3%) of the ultrasonography systems had been used for more than 20 years. Radiology equipment in Tehran University of Medical Sciences have potential capacity, but they need repair, and better maintenance and management and application of standards for the imaging system needs organized supervisory mechanisms

  15. Medical engineering at Cardiff University. Part 2: Postgraduate programmes of study.

    Science.gov (United States)

    Theobald, P; O'Doherty, D M; Holt, C A; Evans, S L; Jones, M D

    2009-05-01

    The Medical Engineering team within the School of Engineering, Cardiff University, delivers two postgraduate programmes of study. Established over 10 years ago, the part-time MSc programmes in Orthopaedic Engineering and Clinical Engineering offer the opportunity of further study while remaining within full-time employment. Both programmes deliver 120 taught credits over two academic years via a series of residential weekends, with successful completion enabling the student to undertake and then defend a 60-credit research dissertation. Fulfilling a specific role on the career pathway for both student cohorts, the strength of each programme is indicated by the consistent number of applicants.

  16. A survey on the quality of Master of Medical Education e-learning Course at Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    M nobakht

    2017-03-01

    Full Text Available Introduction:Universities and educational institutes provide a great variety of e-learning programs to accommodate the increasing demands for higher education. However, some specialists believe that many of these courses fail to meet the required standards of e-learning, thus cannot achieve the goals of implemented programs. Therefore, regular quality assessment of e-learning programs should be carried out by education providers. This study aimed to assess the quality of medical education e-learning course at Mashhad University of Medical Science. Methods:In the first step, most important components of e-learning standards were extracted through a comprehensive literature review of previous studies and a rating scale consisting of nine elements and 173 items were designed. Content validity of the scale was assured by consulting with ten different instructional design experts using Lawshe's Content Validity Ratio. Reliability of this scale is also investigated by inter-rater reliability coefficient which was 88% . In the next step we provided three instructional design experts with the above mentioned scale to collect required information for each sample lesson. Data was analyzed through SPSS Ver 16.0 software. Result: The elements associated with ‘quality of contents’ and ‘accessibility’ were satisfactory, elements related to ‘instructional design’, ’learning management system’, ’multimedia’ and ‘student assessment’ were relatively satisfactory, and elements associated with ‘interaction’, ‘feedback’ and ‘student support’ were unsatisfactory. Overall, we evaluated the quality of the medical education e-learning course as relatively satisfactory. Conclusion: Although the quality of the assessed e-learning course was relatively satisfactory, it is still necessary for corresponding administrators to reassess those items with an average of less than 1.66 (satisfactory level and pay their special attentions to

  17. Meaning of 9/11 for two Pakistani communities: from external intruders to the internalisation of a negative self-image.

    Science.gov (United States)

    Rousseau, Cécile; Jamil, Uzma

    2008-12-01

    Since September 11, the increase in international tensions and the subsequent wars in Afghanistan and Iraq have created turmoil and fears in immigrant communities, fanned by the media in the context of the war against terrorism. This paper aims to compare the meaning systems evoked around 9/11 within two Pakistani groups-an immigrant community in Montreal and a group in Karachi. It also intends to examine the representation of themselves and of the 'Other' within these two groups. Results suggest that both Karachi and Montreal Pakistani respondents favour a conspiracy scenario which protects the Muslim community from the responsibility of 9/11 events. They refer to an argumentation process based on 'proofs', thus mirroring the political rhetoric used by the US government and its allies to justify the military intervention in Iraq. In the Montreal group, the pervasive feeling of fear and the bleak image that the community has of itself support the hypothesis of an immigrant internalisation of the negative representations of Muslim and South Asian identities in the North American context. The negative self-image observed in these minority groups indicates that more effort than ever should be dedicated to understanding the impact of the present international context on minority-majority relations in multi-ethnic societies. It is as if America is sitting right here in the living room with us … We have to ask them permission to breathe. (Parveen, Karachi).

  18. The University of Maryland Medical System invests in its community's minorities.

    Science.gov (United States)

    Schimpff, S C; Rapoport, M I; O'Keefe, S L; Grote, D A; Snow, L K

    1996-06-01

    As a private, non-state-owned teaching hospital adjacent to a predominately low income African American community in Baltimore, the University of Maryland Medical System (hereafter called the Medical System) in partnership with the state's medical school has historically provided excellent medical care to the community's residents regardless of their ability to pay. Nevertheless, executive leadership recognized that the Medical System needed to be even more socially and economically responsible to the minority community by investing more of the system's resources in that community. Doing so would improve the