
Sample records for pakistani medical universities

  1. Experiences, attitudes and barriers towards research amongst junior faculty of Pakistani medical universities

    Directory of Open Access Journals (Sweden)

    Kauser Samreen


    Full Text Available Abstract Background The developing world has had limited quality research and in Pakistan, research is still in its infancy. We conducted a study to assess the proportion of junior faculty involved in research to highlight their attitude towards research, and identify the factors associated with their research involvement. Methods A cross-sectional study was conducted in four medical universities/teaching hospitals in Pakistan, representing private and public sectors. A pre-tested, self-administered questionnaire was used to collect information from 176 junior faculty members of studied universities/hospitals. Logistic regression analysis was used to identify factors related to attitudes and barriers in research among those currently involved in research with those who were not. Results Overall, 41.5% of study subjects were currently involved in research. A highly significant factor associated with current research involvement was research training during the post-graduate period (p Conclusion Less than half of the study participants were currently involved in research. Research output may improve if identified barriers are rectified. Further studies are recommended in this area.

  2. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.


    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  3. Physicians' Migration: Perceptions of Pakistani Medical Students. (United States)

    Hossain, Nazli; Shah, Nusrat; Shah, Tahira; Lateef, Sidra Binte


    To study the perceptions of medical students about factors responsible for physicians'migration. Cross-sectional survey. Dow Medical College and Civil Hospital, Karachi, from April to May 2015. Aself-administered structured questionnaire was used including demographic details, attitudes about push and pull factors of migration, and reasons for migrating or not migrating abroad. Final year students and interns were included. Likert scale from 1 to 4 (1=strongly disagree to 4=strongly agree) was used to assess attitudes. Data was analyzed by SPSS version 16. Atotal of 240 medical students, mostly females (n=181, 75%) (60% final year and 40% interns), participated in the study. Majority wished to go abroad (n=127; 54%) with United States being the favourite destination (n=80; 66.1%) and internal medicine fields being the preferred choice for specialization (n=126; 54%). The major pull factors were better quality of postgraduate education abroad (n=110; 48.2%) and economic prospects (80; 35.2%); while the push factors were a weak healthcare system (n=219; 94.3%), inadequate salary structure (n=205; 88.3%), insecurity (n=219; 93.9%) and increasing religious intolerance in Pakistan (n=183; 78.5%). This survey highlights the continuing trend of physician migration from Pakistan owing to an interplay of various push and pull factors. Majority of our medical students wish to migrate, mainly due to low salaries, poor job structure, and insecurity. Urgent interventions are required to reverse this trend of medical brain-drain.

  4. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia. (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali


    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  5. Pakistani medical students' specialty preference and the influencing factors. (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina


    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  6. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi


    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  7. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas


    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  8. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach. (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen


    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  9. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book


    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman


    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  10. Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

    Directory of Open Access Journals (Sweden)

    Vaqar Talha


    Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

  11. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey (United States)

    Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad


    Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

  12. Structured Peer Mentoring: Enhancing Lifelong Learning in Pakistani Universities (United States)

    Naseem, Nosheen Rachel


    Higher Education in developing countries is frequently restricted to students from privileged backgrounds, especially those from private secondary education. In Pakistan, access to Higher Education, while competitive, is more broadly based, with state universities particularly recruiting students from diverse backgrounds. Just as Widening…

  13. Student Deep Learning in Bachelor English Programs within Pakistani Universities (United States)

    Tahir, Khazima


    The purpose of this study was to contrast undergraduate students' descriptions about transformational teaching practices, and student deep learning in bachelor English programs in selected universities within Pakistan. This study utilized a survey to gather responses from five hundred and twenty three students. A paired sample t test was utilized…

  14. Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

    Directory of Open Access Journals (Sweden)

    Malik Samina


    Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

  15. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif


    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  16. Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ilyas Mahwish


    Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

  17. Determinants of Increasing Trend of Self-Medication in a Pakistani ...

    African Journals Online (AJOL)

    Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria. All rights reserved. ... self-medication for rapid relief of indications only when health care ... hospitals, and other healthcare units. Data analysis.

  18. The Relationship between Occupational Stress and Job Satisfaction: The Case of Pakistani Universities (United States)

    Chaudhry, Abdul Qayyum


    This paper aims to find out the relationship between occupational stress and job satisfaction based on age, gender, nature of job, cadre, work experience of university teachers, and sector of university. The Pearson correlation indicates: no significant relationship found between job satisfaction and overall occupational stress; inverse…

  19. Ego defense mechanisms in Pakistani medical students: a cross sectional analysis

    Directory of Open Access Journals (Sweden)

    Khalid Roha


    Full Text Available Abstract Background Ego defense mechanisms (or factors, defined by Freud as unconscious resources used by the ego to reduce conflict between the id and superego, are a reflection of how an individual deals with conflict and stress. This study assesses the prevalence of various ego defense mechanisms employed by medical students of Karachi, which is a group with higher stress levels than the general population. Methods A questionnaire based cross-sectional study was conducted on 682 students from five major medical colleges of Karachi over 4 weeks in November 2006. Ego defense mechanisms were assessed using the Defense Style Questionnaire (DSQ-40 individually and as grouped under Mature, Immature, and Neurotic factors. Results Lower mean scores of Immature defense mechanisms (4.78 were identified than those for Neurotic (5.62 and Mature (5.60 mechanisms among medical students of Karachi. Immature mechanisms were more commonly employed by males whereas females employed more Neurotic mechanisms than males. Neurotic and Immature defenses were significantly more prevalent in first and second year students. Mature mechanisms were significantly higher in students enrolled in Government colleges than Private institutions (p Conclusions Immature defense mechanisms were less commonly employed than Neurotic and Mature mechanisms among medical students of Karachi. The greater employment of Neurotic defenses may reflect greater stress levels than the general population. Employment of these mechanisms was associated with female gender, enrollment in a private medical college, and students enrolled in the first 2 years of medical school.

  20. Perceptions of Pakistani medical students about drugs and alcohol: a questionnaire-based survey. (United States)

    Shafiq, Majid; Shah, Zaman; Saleem, Ayesha; Siddiqi, Maham T; Shaikh, Kashif S; Salahuddin, Farah F; Siwani, Rizwan; Naqvi, Haider


    Drug abuse is hazardous and known to be prevalent among young adults, warranting efforts to increase awareness about harmful effects and to change attitudes. This study was conducted to assess the perceptions of a group of medical students from Pakistan, a predominantly Muslim country, regarding four drugs namely heroin, charas, benzodiazepines and alcohol. In total, 174 self-reported questionnaires were received (87% response rate). The most commonly cited reasons for why some students take these drugs were peer pressure (96%), academic stress (90%) and curiosity (88%). The most commonly cited justifiable reason was to go to sleep (34%). According to 77%, living in the college male hostel predisposed one to using these drugs. Sixty percent of students said that the drugs did not improve exam performance, while 54% said they alleviated stress. Seventy-eight percent said they did not intend to ever take drugs in the future. Females and day-scholars were more willing to discourage a friend who took drugs. Morality (78%), religion (76%) and harmful effects of drugs (57%) were the most common deterrents against drug intake. Five suggestions to decrease drug abuse included better counseling facilities (78%) and more recreational facilities (60%). Efforts need to be made to increase student awareness regarding effects and side effects of drugs. Our findings suggest that educating students about the adverse effects as well as the moral and religious implications of drug abuse is more likely to have a positive impact than increased policing. Proper student-counseling facilities and healthier avenues for recreation are also required.

  1. Perceptions of Pakistani medical students about drugs and alcohol: a questionnaire-based survey

    Directory of Open Access Journals (Sweden)

    Salahuddin Farah F


    Full Text Available Abstract Background Drug abuse is hazardous and known to be prevalent among young adults, warranting efforts to increase awareness about harmful effects and to change attitudes. This study was conducted to assess the perceptions of a group of medical students from Pakistan, a predominantly Muslim country, regarding four drugs namely heroin, charas, benzodiazepines and alcohol. Results In total, 174 self-reported questionnaires were received (87% response rate. The most commonly cited reasons for why some students take these drugs were peer pressure (96%, academic stress (90% and curiosity (88%. The most commonly cited justifiable reason was to go to sleep (34%. According to 77%, living in the college male hostel predisposed one to using these drugs. Sixty percent of students said that the drugs did not improve exam performance, while 54% said they alleviated stress. Seventy-eight percent said they did not intend to ever take drugs in the future. Females and day-scholars were more willing to discourage a friend who took drugs. Morality (78%, religion (76% and harmful effects of drugs (57% were the most common deterrents against drug intake. Five suggestions to decrease drug abuse included better counseling facilities (78% and more recreational facilities (60%. Conclusion Efforts need to be made to increase student awareness regarding effects and side effects of drugs. Our findings suggest that educating students about the adverse effects as well as the moral and religious implications of drug abuse is more likely to have a positive impact than increased policing. Proper student-counseling facilities and healthier avenues for recreation are also required.

  2. Association of academic stress with sleeping difficulties in medical students of a Pakistani medical school: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas


    Full Text Available Introduction. Medicine is one of the most stressful fields of education because of its highly demanding professional and academic requirements. Psychological stress, anxiety, depression and sleep disturbances are highly prevalent in medical students.Methods. This cross-sectional study was undertaken at the Combined Military Hospital Lahore Medical College and the Institute of Dentistry in Lahore (CMH LMC, Pakistan. Students enrolled in all yearly courses for the Bachelor of Medicine and Bachelor of Surgery (MBBS degree were included. The questionnaire consisted of four sections: (1 demographics (2 a table listing 34 potential stressors, (3 the 14-item Perceived Stress Scale (PSS-14, and (4 the Pittsburgh Quality of Sleep Index (PSQI. Logistic regression was run to identify associations between group of stressors, gender, year of study, student’s background, stress and quality of sleep.Results. Total response rate was 93.9% (263/280 respondents returned the questionnaire. The mean (SD PSS-14 score was 30 (6.97. Logistic regression analysis showed that cases of high-level stress were associated with year of study and academic-related stressors only. Univariate analysis identified 157 cases with high stress levels (59.7%. The mean (SD PSQI score was 8.1 (3.12. According to PSQI score, 203/263 respondents (77% were poor sleepers. Logistic regression showed that mean PSS-14 score was a significant predictor of PSQI score (OR 1.99, P < 0.05.Conclusion. We found a very high prevalence of academic stress and poor sleep quality among medical students. Many medical students reported using sedatives more than once a week. Academic stressors contributed significantly to stress and sleep disorders in medical students.

  3. Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ali Shoeibi


    Full Text Available     Human T-cell lymphotropic virus (HTLV types 1 and 2 belong to the Oncorna group of retroviridae, a large family of viruses, grouped initially by pathogenic features, but later revised on the basis of genome structure and nucleotide sequence. HTLV-I was the first discovered human retrovirus to be associated with a malignancy in 1980. The malignancy, first described by Uchiyama and co-workers in southwestern Japan, was named Adult T-cell Leukemia/Lymphoma (ATL and characterized with cutaneous and respiratory involvement, hepatosplenomegaly, lymphadenopathy and various metabolic abnormalities such as hypercalcemia. The HTLV-I has been known to be endemic to certain parts of Iran like the province of Khorasan in the northeast since 1990, with a 2.3% prevalence rate of infection. The main manifestations of HTLV-I infection are neurologic and hematologic (such as ATL disorders, but it has also other manifestations such as uveitis, arthritis, dermatitis, vitiligo and lymphocytic alveolitis. Its main neurologic manifestation is a chronic progressive myelopathy that is referred to HTLV-I Associated Myelopathy (HAM in Japan and Tropical Spastic Paraparesis (TSP in Caribbean. But other disorders such as peripheral neuropathy, polyradiculoneuropathy, myopathy, peripheral facial paresis, and so on have been reported too. In this review we wish to give some brief information on the different aspects (including epidemiology, pathogenesis and pathology, clinical findings, and treatment of HTLV-I infection according to our twenty-year researches. The department of neurology of Mashhad University of Medical Sciences has been a pioneer in researches on HTLV-I in the last twenty years.  

  4. Analysing Institutional Influences on Teaching-Learning Practices of English as Second Language Programme in a Pakistani University (United States)

    Rind, Irfan Ahmed; Kadiwal, Laila


    This paper examines the institutional influences on the teaching-learning practices within English as Second Language (ESL) programme in the University of Sindh (UoS), Pakistan. The study uses qualitative case study approach, basing its findings on documentary review, observations, and responses of teachers and students. The analysis of the data…

  5. University Teachers' Job Dissatisfaction: Application of Two-Factor Theory--A Case of Pakistani Education System (United States)

    Mir, Imran Anwar


    This qualitative case study presents the reasons of teachers' job dissatisfaction in the government educational institutes in Pakistan. This case study is based on the two factor theory of Herzberg. The results of this case study reveal four core factors that cause job dissatisfaction among teachers in the public sector universities in developing…

  6. Gender Identities and Female Students' Learning Experiences in Studying English as Second Language at a Pakistani University (United States)

    Rind, Irfan Ahmed


    This paper attempts to examine how female students' roles as learners are influenced by their socially constructed gender identities and gender roles in studying English as Second Language (ESL) at a public sector university of Pakistan. The aim is to understand how female students' gender identities and gender roles affect their learning. With an…

  7. Effect of a regimen of optimal medical therapy on brain natriuretic peptide (BNP) levels in heart failure in the Pakistani population

    International Nuclear Information System (INIS)

    Hussain, S.; Kayani, M.; Munir, R


    Objective: To document the effect of optimal medical therapy (OMT) on BNP levels in heart failure in Pakistani population. Methodology: In this Quasi experimental study, 75 consecutive stage C heart failure patients that had not been on OMT were included. These patients had been referred to AFIC-NIHD Heart Transplantation Department for assessment regarding heart transplantation. Initial assessments were carried out in hospital. Patients who were on OMT already were excluded. The prescription (carvedilol, lisinopril, spironolactone) was introduced as in patient as per pre defined protocol after clinical, imaging and lab evaluation. The patients were followed up in clinic and the dose escalation was done at regular intervals in out patients department. Clinical and lab variables were collected included BNP levels before starting treatment and 4 weeks after treatment. Results : Males were 75% and females were 25%. Mean age was 38.69 +- 12.98 years (range 18-70 years). Mean Ejection fraction was 23.9% (range 15 - 34%). At one month clinical status of all patients improved except one. The patients had improved from NYHA class-III to NYHA class-II of dyspnoea. The mean baseline BNP level was 1331 pg/ mL, and the BNP level 4 weeks after the OMT trial was 951.9 pg/mL. This reduction was statistically significant (p=0.016). Conclusion: OMT improves the BNP levels within a span of one month in patients with advanced systolic heart failure. This also correlated with the clinical improvement in the patients, and it was observed that BNP levels helped to monitor patients objectively and adjust OMT. (author)

  8. Analysing institutional influences on teaching–learning practices of English as second language programme in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Irfan Ahmed Rind


    Full Text Available This paper examines the institutional influences on the teaching–learning practices within English as Second Language (ESL programme in the University of Sindh (UoS, Pakistan. The study uses qualitative case study approach, basing its findings on documentary review, observations, and responses of teachers and students. The analysis of the data is informed by Bourdieusian notions of habitus, field and capital. The study found that UoS’s institutional policies and practices are shaped by its position in the field of higher education, which shape ESL teaching–learning practices. Specifically, UoS defines its capital as “higher education for all”, which in practice translates as admitting students from disadvantage groups. To meet English language needs of these students, UoS offers the ESL programme. However, teaching–learning practices of ESL are significantly influenced by UoS’s policies related to faculty hiring and development, ESL teachers and administration relationships, teacher-student ratio, assessment, quality assurance, and learning support resources.

  9. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.


    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  10. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities (United States)

    Ali, Zarqa S.


    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  11. Knowledge Management within the Medical University. (United States)

    Rauzina, Svetlana Ye; Tikhonova, Tatiana A; Karpenko, Dmitriy S; Bogopolskiy, Gennady A; Zarubina, Tatiana V


    The aim of the work is studying the possibilities of ontological engineering in managing of medical knowledge. And also practical implementation of knowledge management system (KMS) in medical university. The educational process model is established that allows analyzing learning results within time scale. Glossary sub-system has been developed; ontologies of educational disciplines are constructed; environment for setup and solution of situational cases is established; ontological approach to assess competencies is developed. The possibilities of the system for solving situation tasks have been described. The approach to the evaluation of competence has been developed.

  12. Migraine among medical students in Kuwait University. (United States)

    Al-Hashel, Jasem Y; Ahmed, Samar Farouk; Alroughani, Raed; Goadsby, Peter J


    Medical students routinely have triggers, notably stress and irregular sleep, which are typically associated with migraine. We hypothesized that they may be at higher risk to manifest migraine. We aimed to determine the prevalence of migraine among medical students in Kuwait University. This is cross-sectional, questionnaire-based study. Participants who had two or more headaches in the last 3 months were subjected to two preliminary questions and participants with at least one positive response were asked to perform the validated Identification of Migraine (ID Migraine™) test. Frequency of headache per month and its severity were also reported. Migraine headache was suggested in 27.9% subjects based on ID-Migraine™. Migraine prevalence (35.5% and 44%, versus 31.1%, 25%, 21.1%, 14.8%, 26.5%, p Kuwait University compared to other published studies. The migraine prevalence, frequency and headache severity, all increased in the final two years of education.

  13. Students of Tehran Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ghezelbash Sima


    Full Text Available Introduction: Social anxiety is an important factor in peoples’ mental health. Good mental health while studying in university makes students able to deal effectively with numerous stressors that they experience. The purpose of this study was to determine and compare the social anxiety of nursing students in grades one to four of medical universities in Tehran. Methods: In this analytic cross-sectional study, 400 students from universities of medical sciences in Tehran were recruited by stratified sampling with proportional allocation. Data were collected during the first semester in 2010. Students completed a two-part questionnaire including the Liebowitz social anxiety questionnaire and a demographic information form. Data were analyzed using descriptive statistics methods and an analytical test by SPSS statistical software. Results: There was no statistically significant difference in the total scores of social anxiety of first- to fourth-year students. The mean score of the avoidance of social interaction dimension in fourth-year students was significantly lower than in first year students (p<0.05. Conclusion: In regard to the relationship between social anxiety and interpersonal communication as an associated part of nursing care, decrease of social anxiety of students could play an important role in their mental health. According to the results of this study, it seems that the placement of students in the nursing education system does not produce any changes in their social anxiety.


    Directory of Open Access Journals (Sweden)

    V. Ya. Gelman


    Full Text Available Introduction.In programs of training of students of medical specialties, Mathematics is a subject of basic education, i.e. non-core discipline. However, studying Mathematics is extremely important for future physicians, as recently there has been an impetuous development of mathematization in the field of health care. Today, a set of the new medical devices, the equipment and high technologies are being developed based on the mathematical modeling, analysis and forecasting. Mathematical methods are widely applied to diagnostics, development of life-support systems and the description of various biological processes both at the molecular level,  and at the level of a whole organism, its systems, bodies and tissues. The solution of many medical tasks in the field of taxonomy, genetics, and organization of medical service is impossible without knowledge of mathematics. Unfortunately, along with the evident importance of mathematical preparation for a medical profession, its need is poorly realized not only by junior students, but even by some teachers of specialized departments of medical schools.The aim of the publication is to discuss the problems that arise in the teaching of mathematical disciplines to students at a medical school and to suggest possible solutions to these problems.Methodology and research methods. The study is based on the use of modeling of the educational process. The methods of analysis, generalization and the method of expert assessments were applied in the course of the research.Results and scientific novelty. The aspects of mathematical preparation at the university are considered on the basis of the application of the multiplicative model of training quality. It is shown that the main students’ learning difficulties in Mathematics are connected with the following factors: the initial level of mathematical preparation of students and their motivation; outdated methods of Mathematics teaching and academic content

  15. Medical Education in Japan and Introduction of Medical Education at Tokyo Women’s Medical University

    Institute of Scientific and Technical Information of China (English)

    Yumiko Okubo


    Medical education in Japan changed rapidly in the last decade of the 20th century with the introduction of new education methods and implementation of the core curriculum and common achievement testing such as CBT and OSCE.Recently, there have been other movements in medical education in Japan that have introduced 'outcome(competency) based education(OBE)' and created a system for accreditation of medical education programs. This report provides an overview of current medical education in Japan. Moreover, it introduces medical education at Tokyo Women’s Medical University.

  16. Emergency radiology curriculum at Medical University - Plovdiv

    International Nuclear Information System (INIS)

    Velkova, K.; Hilendarov, A.; Cvetkova, S.; Stoeva, M.; Petrova, A.; Stefanov, P.; Simova, E.; Georgieva, V.; Sirakov, N.


    Full text: Introduction: Recent advances in contemporary radiology turn it into one of the major sources for patient information with improved emergency techniques. Emergency Radiology (EP) focuses on acute diagnosing conditions in ER patients. Objectives: The main objective of this paper is to present the ER curriculum at Medical Imaging Department, Medical University - Plovdiv, aiming to deliver knowledge about the indications, possibilities and diagnostic value of the contemporary imaging methods in ER cases. Material and methods: The curriculum covers various aspects of ER Radiology - diagnostic imaging methods, contrast enhanced examinations, imaging topography, traumatic and acute conditions, physical and technical aspects. It includes 6 lectures and 12 practical classes. Results and discussion: The educational course in Emergency Radiology is available for medical students in their 8-th and 9-th semester. Therapeutic methods under imaging control are also covered by the course. Conclusion: Being one of the most advanced areas of radiology, ER improves the quality of care and treatment of patients and of the emergency medicine as a whole

  17. Dietary habits and life style among the students of a private medical university Karachi. (United States)

    Nisar, Nighat; Qadri, Majid Hafeez; Fatima, Kiran; Perveen, Shakeela


    To determine the dietary habits and life style of the students of a private medical university in Karachi. A cross-sectional study was conducted at Baqai Medical University, from August 2005 to September 2005. A total of 384 medical students from the batches of 2002 to 2005 participated in this study. A pre-tested semi structured questionnaire was self administered to the students after taking their consent. The data included sociodemographic characteristics, life style, exercise, dietary habits and family history of diabetes mellitus. The collected data was analyzed by statistical program SPSS version 11. Out of the total participants, 53.4% were male and 46.6% were female students. The mean age was 20 +/- 1.58 years. The average income of the household of students was 50,000 Pakistani rupees per month. Only 7% students were tobacco users. About 33% students had a history of diabetes mellitus among their parents. Nearly ninety-seven percent reported consumption of junk food while 60% reported use of whole grain food in their diet. Seventy percent students walked 30 minutes and 47% exercised daily. According to the body mass index, 58.3% students were of normal weight and 41.7% were overweight. No significant difference was found among male and female students when dietary habits and life style were compared by sex. Junk food and soft-drink consumption was associated with being overweight. Eating whole grain food and doing exercise showed a protective association against overweight. Unhealthy lifestyle and poor dietary habits were highly prevalent in the overweight study population. Type-2 diabetes mellitus was common among parents and grandparents of the students making them prone to this disorder. Our study concluded that dietary and exercise counselling is necessary as a preventive strategy.

  18. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen. (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes


    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  19. Using a tailored health information technology- driven intervention to improve health literacy and medication adherence in a Pakistani population with vascular disease (Talking Rx) - study protocol for a randomized controlled trial. (United States)

    Kamal, Ayeesha Kamran; Muqeet, Abdul; Farhat, Kashfa; Khalid, Wardah; Jamil, Anum; Gowani, Ambreen; Muhammad, Aliya Amin; Zaidi, Fabiha; Khan, Danyal; Elahi, Touseef; Sharif, Shahrukh; Raz, Sibtain; Zafar, Taha; Bokhari, Syedah Saira; Rahman, Nasir; Sultan, Fateh Ali Tipoo; Sayani, Saleem; Virani, Salim S


    Vascular disease, manifesting as myocardial infarction and stroke, is a major cause of morbidity and mortality, especially in low- and middle-income countries. Current estimates are that only one in six patients have good adherence to medications and very few have sufficient health literacy. Our aim is to explore the effectiveness and acceptability of Prescription Interactive Voice Response (IVR) Talking Prescriptions (Talking Rx) and SMS reminders in increasing medication adherence and health literacy in Pakistani patients with vascular disease. This is a randomized, controlled, single center trial. Adult participants, with access to a cell phone and a history of vascular disease, taking multiple risk-modifying medications (inclusive of anti-platelets and statins) will be selected from cerebrovascular and cardiovascular clinics. They will be randomized in a 1:1 ratio via a block design to the intervention or the control arm with both groups having access to a helpline number to address their queries in addition to standard of care as per institutional guidelines. Participants in the intervention group will also have access to Interactive Voice Response (IVR) technology tailored to their respective prescriptions in the native language (Urdu) and will have the ability to hear information about their medication dosage, correct use, side effects, mechanism of action and how and why they should use their medication, as many times as they like. Participants in the intervention arm will also receive scheduled SMS messages reminding them to take their medications. The primary outcome measure will be the comparison of the difference in adherence to anti-platelet and statin medication between baseline and at 3-month follow-up in each group measured by the Morisky Medication Adherence Scale. To ascertain the impact of our intervention on health literacy, we will also compare a local content-validated and modified version of Test of Health Literacy in Adults (TOFHLA) between

  20. Scientific production of medical sciences universities in north of iran. (United States)

    Siamian, Hasan; Firooz, Mousa Yamin; Vahedi, Mohammad; Aligolbandi, Kobra


    NONE DECLARED. The study of the scientific evidence citation production by famous databases of the world is one of the important indicators to evaluate and rank the universities. The study at investigating the scientific production of Northern Iran Medical Sciences Universities in Scopus from 2005 through 2010. This survey used scientometrics technique. The samples under studies were the scientific products of four northern Iran Medical universities. Viewpoints quantity of the Scientific Products Mazandaran University of Medical Sciences stands first and of Babol University of Medical Sciences ranks the end, but from the viewpoints of quality of scientific products of considering the H-Index and the number of cited papers the Mazandaran University of Medical Sciences is a head from the other universities under study. From the viewpoints of subject of the papers, the highest scientific products belonged to the faculty of Pharmacy affiliated to Mazandaran University of Medial Sciences, but the three other universities for the genetics and biochemistry. Results showed that the Mazandaran University of Medical Sciences as compared to the other understudies universities ranks higher for the number of articles, cited articles, number of hard work authors and H-Index of Scopus database from 2005 through 2010.

  1. An Artist in the University Medical Center. Review. (United States)

    James, A. Everette, Jr.


    Reviews "An Artist in the University Medical Center" (M. Lesser, New Orleans: Tulane University Press, 1989), in which the artist captures the human side of the complex Tulane Medical Center in New Orleans (Louisiana). The interplay of drawings, etchings, watercolors, and prose conveys traditions of nurturing in the hospital. (SLD)

  2. Journal of the Obafemi Awolowo University Medical Student's ...

    African Journals Online (AJOL)

    Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. Journal Homepage Image. IFEMED Journal is the official publication of Obafemi Awolowo University Medical Students' Association, Ile-Ife , Nigeria . The Journal Club periodically publishes articles on medical and medically related topics ...

  3. The effective factors on library anxiety of students in Isfahan University of Medical Sciences and Shiraz University of Medical Sciences. (United States)

    Ashrafi-Rizi, Hasan; Sajad, Maryam Sadat; Rahmani, Sedigheh; Bahrami, Susan; Papi, Ahmad


    The efficient use of libraries can be an important factor in determining the educational quality of Universities. Therefore, investigation and identification of factors affecting library anxiety becomes increasingly necessary. The purpose of this research is to determine the factors effecting library anxiety of students in Isfahan University of Medical Sciences and Shiraz University of Medical Sciences. This was an applied survey research using Bostick's Library Anxiety questionnaire as data gathering tool. The statistical population consisted of all students of Isfahan University of Medical Sciences and Shiraz University of Medical Sciences (15011 students) with the sample size of 375 using stratified random sampling. The validity of data gathering tool was confirmed by experts in the library and information science and its reliability was determined by Cronbach's alpha (r = 0.92). Descriptive statistics (frequency, percentage, mean and standard deviation) and inferential statistics (t-test and ANOVA) were used for data analysis using SPSS 18 software. Findings showed that the mean of library anxiety score was 2.68 and 2.66 for students of Isfahan University of Medical Sciences and Shiraz University of Medical Sciences respectively which is above average (2.5). Furthermore, age and gender had no meaningful effect on the library anxiety of students of Isfahan University of Medical Sciences, but gender had a meaningful effect on library anxiety of students of Shiraz University of Medical Sciences while age had no such effect. The results showed that the mean of factors effecting library anxiety in students of Isfahan University of Medical Sciences and students of Shiraz University of Medical Sciences is higher than average and therefore not satisfactory and only factors relating to feeling comfortable in the library is lower than average and somewhat satisfactory.

  4. Joint marketing cites excellence: Fairview-University Medical Center advertises cooperatively with University of Minnesota Physicians. (United States)

    Botvin, Judith D


    Fairview-University Medical Center and University of Minnesota Physicians, both in Minneapolis, are enjoying the benefits of a co-branded advertising campaign. It includes print ads, brochures, and other marketing devices.

  5. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.


    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  6. Intellectual wellness in medical university teachers: Gender based comparison. (United States)

    Syed, Sadiqa; Rehman, Rehana; Hussain, Mehwish; Shaikh, Saifullah


    A cross section, questionnaire based study was carried out from January 2012 till December 2014 to compare intellectual wellness (IW) awareness on the basis of gender in teachers of basic sciences at medical universities of Karachi, Pakistan. Data was collected from 3 public and 5 private medical universities of Karachi, Pakistan. Questionnaire was tailored from "Wellness Wheel" and responses were aggregated for eight questions in the dimension of IW to obtain aggregate IW score. Reliability of the questionnaire was measured using Cronbach's alpha. The average intellectual score was 24.99 ± 3.93 with a minimum score of 8 and maximum 32.The frequency of keeping informed about research updates was significantly higher in males (p = 0.043) that emphasized significantly better IW awareness of male medical teachers involved in teaching of medical sciences in both public and private medical universities of Pakistan.

  7. Assessment of Medication Use among University Students in Ethiopia

    Directory of Open Access Journals (Sweden)

    Dessalegn Asmelashe Gelayee


    Full Text Available Background. The extent, nature, and determinants of medication use of individuals can be known from drug utilization studies. Objectives. This study intended to determine medication consumption, sharing, storage, and disposal practices of university students in Northwest Ethiopia. Methods. A descriptive cross-sectional study was conducted on 404 university students selected through stratified random sampling technique. Data were collected using self-administered questionnaire and analyzed with SPSS version 20 statistical software. Pearson’s Chi-square test of independence was conducted with P<0.05 taken as statistically significant. Results. At 95.3% response rate, the prevalences of medication consumption and sharing were 35.3% (N=136 and 38.2% (N=147, respectively. One hundred (26% respondents admitted that they often keep leftover medications for future use while the rest (N=285, 74% discard them primarily into toilets (N=126, 44.2%. Evidence of association existed between medication taking and year of study (P=0.048, medication sharing and sex (P=0.003, and medication sharing and year of study (P=0.015. Conclusion. There is a high prevalence of medication consumption, medication sharing, and inappropriate disposal practices which are influenced by sex and educational status of the university students. Thus medication use related educational interventions need to be given to students in general.

  8. Attitude of University of Nigeria Medical Students to Community ...

    African Journals Online (AJOL)

    Aims: A study was carried out among 136 final year medical students of University of Nigeria Enugu Campus, to verify their attitude to Community Medicine as well as selection of the course for future specialization. Methods: The study was a cross sectional descriptive one involving all final year medical students of the ...

  9. Vision survey of the Nnamdi Azikiwe University medical students ...

    African Journals Online (AJOL)

    Aim: To determine the ocular problems of 1st‑year preclinical medical students at the Nnamdi Azikiwe University, Nnewi Campus, Nnewi, Nigeria. Materials and Methods: All registered 1st‑year preclinical medical students were examined in October 2008. Ocular investigation included filling out self‑administered ...

  10. Pattern of Medical Admissions at Enugu State University of Science ...

    African Journals Online (AJOL)

    Technology Teaching Hospital, Parklane, Enugu, 2Department of Community Medicine, University of Nigeria Teaching. Hospital, Ituku/Ozalla ... A review of medical admissions into the Enugu State University of Science and Technology. Teaching .... Cord lesions, rabies, Guilliane Barré syndrome, motor neuron disease and ...

  11. [Issues related to national university medical schools: focusing on the low wages of university hospital physicians]. (United States)

    Takamuku, Masatoshi


    University hospitals, bringing together the three divisions of education, research, and clinical medicine, could be said to represent the pinnacle of medicine. However, when compared with physicians working at public and private hospitals, physicians working at university hospitals and medical schools face extremely poor conditions. This is because physicians at national university hospitals are considered to be "educators." Meanwhile, even after the privatization of national hospitals, physicians working for these institutions continue to be perceived as "medical practitioners." A situation may arise in which physicians working at university hospitals-performing top-level medical work while also being involved with university and postgraduate education, as well as research-might leave their posts because they are unable to live on their current salaries, especially in comparison with physicians working at national hospitals, who focus solely on medical care. This situation would be a great loss for Japan. This potential loss can be prevented by amending the classification of physicians at national university hospitals from "educators" to "medical practitioners." In order to accomplish this, the Japan Medical Association, upon increasing its membership and achieving growth, should act as a mediator in negotiations between national university hospitals, medical schools, and the government.

  12. A questionnaire based survey study for the evaluation of knowledge of Pakistani University teachers regarding their awareness about ibuprofen as an over the counter analgesic. (United States)

    Chen, Jianxian; Murtaza, Ghulam; Nadeem, Nida; Shao, Xiaokuai; Siddiqi, Bushra G; Shafique, Zainab; Ahmad, Saeed; Amjad, Seyyeda T; Haroon, Saima; Tanoli, Mamoona; Zhou, Mei


    In recent time, due to convenient availability of number of over the counter (OTC) drugs, patients are able to treat minor ailments by themselves. The self-medicated regimen has lead to certain health problems in all age groups irrespective of their professions. People are usually unaware about the safe use of NSAIDs (non-steroidal anti-inflammatory drugs) and currently there is no study carried out in COMSATS Institute of Information Technology (CIIT), Abbottabad, regarding the choice of faculty members for NSAIDs to relieve pain and their knowledge about its safety and use. A questionnaire based survey was carried out to collectdata about the choice of CIIT faculty for a specific NSAID and their cognition related to ibuprofen. Two hundred fifty faculty members (comprising of 53 pharmacy faculty members and 197 faculty members who belonged to other departments) of which 87 were females, took part in this study. Average age of participants was 34.86 +/- 9.02 years. Ibuprofen was the drug of choice NSAID among the participants. Four percent participants experienced pain almost every day. Analgesia was the well known indication for ibuprofen (31%) by both the groups and in general more educated and younger participants showed better apprehension related to indications. Sixty one percent participants comprising of non-pharmacy faculty were unaware of any undesirable effects and 79% (comprising of 72% pharmacists and 5% non-pharmacists) were affirmative that ibuprofen had no adverse effects. Fifteen percent participants of department other than pharmacy were not aware of any interactions of ibuprofen. 34% of participants (comprising of 32% non-pharmacists and 2% pharmacists) entrusted their physician for an analgesic. Regardless that many participants suffered from pain almost every day and their drug of choice would be ibuprofen, they had inadequate information related to the safety and use of ibuprofen.

  13. Identifying challenges for academic leadership in medical universities in Iran. (United States)

    Bikmoradi, Ali; Brommels, Mats; Shoghli, Alireza; Khorasani-Zavareh, Davoud; Masiello, Italo


    CONTEXT The crucial role of academic leadership in the success of higher education institutions is well documented. Medical education in Iran has been integrated into the health care system through a complex organisational change. This has called into question the current academic leadership, making Iranian medical universities and schools a good case for exploring the challenges of academic leadership. OBJECTIVES This study explores the leadership challenges perceived by academic managers in medical schools and universities in Iran. METHODS A qualitative study using 18 face-to-face, in-depth interviews with academic managers in medical universities and at the Ministry of Health and Medical Education in Iran was performed. All interviews were recorded digitally, transcribed verbatim and analysed by qualitative content analysis. RESULTS The main challenges to academic leadership could be categorised under three themes, each of which included three sub-themes: organisational issues (inefficacy of academic governance; an overly extensive set of missions and responsibilities; concerns about the selection of managers); managerial issues (management styles; mismatch between authority and responsibilities; leadership capabilities), and organisational culture (tendency towards governmental management; a boss-centred culture; low motivation). CONCLUSIONS This study emphasises the need for academic leadership development in Iranian medical schools and universities. The ability of Iranian universities to grow and thrive will depend ultimately upon the application of leadership skills. Thus, it is necessary to better designate authorities, roles of academic staff and leaders at governance.

  14. The medical collections at the University of Glasgow. (United States)

    Reilly, Maggie; McDonald, Stuart W


    The medical and other collections in the University of Glasgow have at their core the generous bequest of Dr William Hunter (1718 - 1783), a local man who rose to become an internationally renowned anatomist and obstetrician. The University does not have a Medical Museum as such but an Anatomy Museum, a Zoology Museum, a Pathology Collection, medical displays in the main halls of the Hunterian Museum in the Gilbert Scott Building and a rich collection of antiquarian medical books and archives as well as contemporary libraries. The Hunterian Collection, since its inauguration at the University of Glasgow in 1807, has engendered a spirit of diversity and scholarship that embraces many disciplines across the campus. The Hunterian Museum was the first public museum in Scotland and service to the local, national and international communities and response to their academic needs is very much at heart of its function today.

  15. Non-medical use of methylphenidate among medical students of the University of the Free State


    Jain, Roshini; Chang, Chiech; Koto, Mpho; Geldenhuys, Alden; Nichol, Richard; Joubert, Gina


    Background: Faced with demanding training programmes, medical students may be more prone to use methylphenidate for non-medical purposes in order to improve concentration, alertness and academic performance. Aim: The study aimed to investigate the prevalence of the non-medical use of methylphenidate and knowledge of this drug among undergraduate medical students of the University of the Free State. Methods: This was a cross-sectional study. A self-administered, anonymous questionnaire...

  16. The psychometric characteristics of the revised depression attitude questionnaire (R-DAQ) in Pakistani medical practitioners: a cross-sectional study of doctors in Lahore. (United States)

    Haddad, Mark; Waqas, Ahmed; Sukhera, Ahmed Bashir; Tarar, Asad Zaman


    Depression is common mental health problem and leading contributor to the global burden of disease. The attitudes and beliefs of the public and of health professionals influence social acceptance and affect the esteem and help-seeking of people experiencing mental health problems. The attitudes of clinicians are particularly relevant to their role in accurately recognising and providing appropriate support and management of depression. This study examines the characteristics of the revised depression attitude questionnaire (R-DAQ) with doctors working in healthcare settings in Lahore, Pakistan. A cross-sectional survey was conducted in 2015 using the revised depression attitude questionnaire (R-DAQ). A convenience sample of 700 medical practitioners based in six hospitals in Lahore was approached to participate in the survey. The R-DAQ structure was examined using Parallel Analysis from polychoric correlations. Unweighted least squares analysis (ULSA) was used for factor extraction. Model fit was estimated using goodness-of-fit indices and the root mean square of standardized residuals (RMSR), and internal consistency reliability for the overall scale and subscales was assessed using reliability estimates based on Mislevy and Bock (BILOG 3 Item analysis and test scoring with binary logistic models. Mooresville: Scientific Software, 55) and the McDonald's Omega statistic. Findings using this approach were compared with principal axis factor analysis based on Pearson correlation matrix. 601 (86%) of the doctors approached consented to participate in the study. Exploratory factor analysis of R-DAQ scale responses demonstrated the same 3-factor structure as in the UK development study, though analyses indicated removal of 7 of the 22 items because of weak loading or poor model fit. The 3 factor solution accounted for 49.8% of the common variance. Scale reliability and internal consistency were adequate: total scale standardised alpha was 0.694; subscale reliability for

  17. The attitudes and beliefs of Pakistani medical practitioners about depression: a cross-sectional study in Lahore using the Revised Depression Attitude Questionnaire (R-DAQ

    Directory of Open Access Journals (Sweden)

    Mark Haddad


    Full Text Available Abstract Background Mental disorders such as depression are common and rank as major contributors to the global burden of disease. Condition recognition and subsequent management of depression is variable and influenced by the attitudes and beliefs of clinicians as well as those of patients. Most studies examining health professionals’ attitudes have been conducted in Western nations; this study explores beliefs and attitudes about depression among doctors working in Lahore, Pakistan. Methods A cross-sectional survey conducted in 2015 used a questionnaire concerning demographics, education in psychiatry, beliefs about depression causes, and attitudes about depression using the Revised Depression Attitude Questionnaire (R-DAQ. A convenience sample of 700 non-psychiatrist medical practitioners based in six hospitals in Lahore was approached to participate in the survey. Results Six hundred and one (86 % of the doctors approached consented to participate; almost all respondents (99 % endorsed one of various biopsychosocial causes of depression (38 to 79 % for particular causes, and 37 % (between 13 and 19 % for particular causes noted that supernatural forces could be responsible. Supernatural causes were more commonly held by female doctors, those working in rural settings, and those with greater psychiatry specialist education. Attitudes to depression were mostly less confident or optimistic and less inclined to a generalist perspective than those of clinicians in the UK or European nations, and deterministic perspectives that depression is a natural part of aging or due to personal failings were particularly common. However, there was substantial confidence in the efficacy of antidepressants and psychological therapy. More confident and therapeutically optimistic views and a more generalist perspective about depression management were associated with a rejection of supernatural explanations of the origin of depression. Conclusions Non

  18. The attitudes and beliefs of Pakistani medical practitioners about depression: a cross-sectional study in Lahore using the Revised Depression Attitude Questionnaire (R-DAQ). (United States)

    Haddad, Mark; Waqas, Ahmed; Qayyum, Wahhaj; Shams, Maryam; Malik, Saad


    Mental disorders such as depression are common and rank as major contributors to the global burden of disease. Condition recognition and subsequent management of depression is variable and influenced by the attitudes and beliefs of clinicians as well as those of patients. Most studies examining health professionals' attitudes have been conducted in Western nations; this study explores beliefs and attitudes about depression among doctors working in Lahore, Pakistan. A cross-sectional survey conducted in 2015 used a questionnaire concerning demographics, education in psychiatry, beliefs about depression causes, and attitudes about depression using the Revised Depression Attitude Questionnaire (R-DAQ). A convenience sample of 700 non-psychiatrist medical practitioners based in six hospitals in Lahore was approached to participate in the survey. Six hundred and one (86 %) of the doctors approached consented to participate; almost all respondents (99 %) endorsed one of various biopsychosocial causes of depression (38 to 79 % for particular causes), and 37 % (between 13 and 19 % for particular causes) noted that supernatural forces could be responsible. Supernatural causes were more commonly held by female doctors, those working in rural settings, and those with greater psychiatry specialist education. Attitudes to depression were mostly less confident or optimistic and less inclined to a generalist perspective than those of clinicians in the UK or European nations, and deterministic perspectives that depression is a natural part of aging or due to personal failings were particularly common. However, there was substantial confidence in the efficacy of antidepressants and psychological therapy. More confident and therapeutically optimistic views and a more generalist perspective about depression management were associated with a rejection of supernatural explanations of the origin of depression. Non-psychiatrist medical practitioners in Pakistan hold a range of views

  19. Attitude of teaching faculty towards statistics at a medical university in Karachi, Pakistan. (United States)

    Khan, Nazeer; Mumtaz, Yasmin


    Statistics is mainly used in biological research to verify the clinicians and researchers findings and feelings, and gives scientific validity for their inferences. In Pakistan, the educational curriculum is developed in such a way that the students who are interested in entering in the field of biological sciences do not study mathematics after grade 10. Therefore, due to their fragile background of mathematical skills, the Pakistani medical professionals feel that they do not have adequate base to understand the basic concepts of statistical techniques when they try to use it in their research or read a scientific article. The aim of the study was to assess the attitude of medical faculty towards statistics. A questionnaire containing 42 close-ended and 4 open-ended questions, related to the attitude and knowledge of statistics, was distributed among the teaching faculty of Dow University of Health Sciences (DUHS). One hundred and sixty-seven filled questionnaires were returned from 374 faculty members (response rate 44.7%). Forty-three percent of the respondents claimed that they had 'introductive' level of statistics courses, 63% of the respondents strongly agreed that a good researcher must have some training in statistics, 82% of the faculty was in favour (strongly agreed or agreed) that statistics was really useful for research. Only 17% correctly stated that statistics is the science of uncertainty. Half of the respondents accepted that they have problem of writing the statistical section of the article. 64% of the subjects indicated that statistical teaching methods were the main reasons for the impression of its difficulties. 53% of the faculty indicated that the co-authorship of the statistician should depend upon his/her contribution in the study. Gender did not show any significant difference among the responses. However, senior faculty showed higher level of the importance for the use of statistics and difficulties of writing result section of

  20. Motivation of university and non-university stakeholders to change medical education in Vietnam.

    NARCIS (Netherlands)

    Luu, H.N.; Nguyen, V.L.; van der Wilt, G.J.; Broerse, J.E.W.; Ruitenberg, E.J.; Wright, E.P.


    Background. Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder.

  1. Motivation of university and non-university stakeholders to change medical education in Vietnam

    NARCIS (Netherlands)

    Lu, H.; Nguyen, V; van der Wilt, G.J.; Broerse, J.E.W.; Ruitenberg, E.J.; Wright, P.


    Background. Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder.

  2. Medical universities educational and research online services: benchmarking universities' website towards e-government. (United States)

    Farzandipour, Mehrdad; Meidani, Zahra


    Websites as one of the initial steps towards an e-government adoption do facilitate delivery of online and customer-oriented services. In this study we intended to investigate the role of the websites of medical universities in providing educational and research services following the E-government maturity model in the Iranian universities. This descriptive and cross- sectional study was conducted through content analysis and benchmarking the websites in 2012. The research population included the entire medical university website (37). Delivery of educational and research services through these university websites including information, interaction, transaction, and Integration were investigated using a checklist. The data were then analyzed by means of descriptive statistics and using SPSS software. Level of educational and research services by websites of the medical universities type I and II was evaluated medium as 1.99 and 1.89, respectively. All the universities gained a mean score of 1 out of 3 in terms of integration of educational and research services. Results of the study indicated that Iranian universities have passed information and interaction stages, but they have not made much progress in transaction and integration stages. Failure to adapt to e-government in Iranian medical universities in which limiting factors such as users' e-literacy, access to the internet and ICT infrastructure are not so crucial as in other organizations, suggest that e-government realization goes beyond technical challenges.

  3. Self-Medication Practice with Nonprescription Medication among University Students: a review of the literature

    Directory of Open Access Journals (Sweden)

    Dedy Almasdy


    Full Text Available Objective: To review the literature relating to self-medicationpractice with nonprescription medication among universitystudents.Methods: A narrative review of studies on self-medicationpractice with nonprescription medication among universitystudent was performed. An extensive literature search wasundertaken using indexing services available at UniversitiSains Malaysia (USM library. The following keywords wereused for the search: self-care, self-medication, over-thecountermedicine, nonprescription medicine, minor illnesses,minor ailment, university population and communitypharmacy. Electronic databases searched were Science Direct,Medline, ISI Web of Knowledge, Inside Web, JSTOR, SpringerLink, Proquest, Ebsco Host and Google Scholar. Theseelectronic databases were searched for full text paperspublished in English.Results: Eleven studies were identified. In general, the reviewhas shown that self-medication practice with nonprescriptionmedication highly prevalence among university students. Thereasons for self-medication are vary among this populationand the main symptoms leading to self-medication areheadache or minor pain; fever, flu, cough, or cold; anddiarrhoea.The common medication is analgesic, antipyreticproducts, cough and cold remedies, anti allergy andvitamins or minerals. The sources of the medicines arepharmacy, home medicine cabinet, supermarket/shopand other person such as family, friend, neighbours andclassmates. The sources of drug information are familymember, previous experience, pharmacy salesman,doctor or nurse, advertisement and others. The reviewalso has shown that the self-medication practice couldhave many problems.Conclusions: The review provides insights about theself-medication practices among the university students.These practices were highly prevalence among universitystudents. The symptoms leading to self-medication arevary, thus the medication used and the medicationsources. It needs an adequate drug information

  4. Implementation of an OSCE at Kaohsiung Medical University

    Directory of Open Access Journals (Sweden)

    Yu-Sheng Huang


    Full Text Available The Objective Structured Clinical Examination (OSCE, a tool to objectively and fairly assess medical students' clinical competences, has become widely used in medical education worldwide. However, most medical schools in Taiwan have just begun to adopt this assessment method. In 2003, Kaohsiung Medical University (KMU established the first standardized patient (SP program in Taiwan and applied SPs with an OSCE. This study reports the process of the implementation of an OSCE at KMU, which includes collecting information, visiting leading clinical skills centers, consulting medical educators from other countries, holding international conferences, establishing an OSCE committee, writing cases, training SPs, administrating the OSCE, and receiving feedback from medical students. Most students were satisfied with the assessment and appreciated the learning experience. Based on the experience in 2003, the OSCE committee decided to incorporate the OSCE into the medical curriculum as a measure to assess medical students' clinical competences. In addition to assessing medical students' clinical competence, the OSCE can also be applied to other professional health education, such as dentistry, nursing, and pharmacy. We are currently sharing our experience with other colleges at KMU.

  5. Exploring Jahrom Medical University students' attitudes towards the ...

    African Journals Online (AJOL)

    Introduction: Self- evaluation is the process of designing, building and maintaining human behaviors that can lead to maturity and perfection. Therefore, the aim of this study is to examine Jahrom Medical University students' attitudes towards the Islamic self-assessment in 2015. Method: This cross-sectional and descriptive ...

  6. The Early Years of the University of the Witwatersrand Medical ...

    African Journals Online (AJOL)


    Jan 20, 1973 ... Witwatersrand Medical School and its Students*. G. R. BEATON, M.B. B.CH. UNIV. .... sion to South African universities, and to travel to. Europe became the .... provement of the residence food at the Queen Victoria. Hospital.

  7. Experiences of mistreatment among medical students in a University ...

    African Journals Online (AJOL)

    Experiences of mistreatment among medical students in a University in south west Nigeria. ... The commonest forms experienced by the students were being shouted at (92.6%), public humiliation or belittlement (87.4%), negative or disparaging remarks about their academic performance (71.4%), being assigned tasks as ...

  8. Pattern of medical admissions at Enugu state university of science ...

    African Journals Online (AJOL)

    Pattern of medical admissions at Enugu state university of science and technology teaching hospital: a 5 year review. ... The diseases encountered most were diabetes mellitus‑735/3,865 (19.1%), hypertension/congestive cardiac failure‑703/3,865 (18.2%), strokes‑614/3,865 (15.9%) and human immunodeficiency virus ...

  9. Level of empathy among medical students in Kuwait University, Kuwait. (United States)

    Hasan, S; Al-Sharqawi, N; Dashti, F; AbdulAziz, M; Abdullah, A; Shukkur, M; Bouhaimed, M; Thalib, L


    To evaluate the level of empathy among medical students in Kuwait University Medical School and its association with sociodemographic factors, stress levels and personality. A cross-sectional survey of 264 medical students was conducted in the Faculty of Medicine, Kuwait University. Empathy levels were measured using the Jefferson Scale, personality was assessed using the Zuckerman-Kuhlman Personality Scale and the Perceived Stress Scale was used to measure stress levels. Factors associated with empathy were evaluated using t test/ANOVA for categorical variables and correlation for continuous predictors. Mean empathy score was 104.6 ± 16.3. Empathy scores were significantly associated with gender, year of study, mother's level of education, household income, satisfactory relationship with the mother and stress levels. Male medical students in their clinical years also had significantly lower empathy levels. However, factors such as grade point average, desired specialty, marital status of parents, father's educational level and relationship with father were not significantly (p > 0.05) associated with levels of empathy. Stress scores were significantly and positively associated with empathy (r = 0.13; p = 0.041). Medical students in Kuwait University had low empathy level and this may be a cause for concern; as such we suggest a possible inclusion of emphasis on empathy in the curriculum. Copyright © 2013 S. Karger AG, Basel.

  10. Access to Medication Abortion Among California's Public University Students. (United States)

    Upadhyay, Ushma D; Cartwright, Alice F; Johns, Nicole E


    A proposed California law will require student health centers at public universities to provide medication abortion. To understand its potential impact, we sought to describe current travel time, costs, and wait times to access care at the nearest abortion facilities. We projected total medication abortion use based on campus enrollment figures and age- and state-adjusted abortion rates. We calculated distance and public transit time from campuses to the nearest abortion facility. We contacted existing abortion-providing facilities to determine costs, insurance acceptance, and wait times. We estimate 322 to 519 California public university students seek medication abortions each month. As many as 62% of students at these universities were more than 30 minutes from the closest abortion facility via public transportation. Average cost of medication abortion was $604, and average wait time to the first available appointment was one week. College students face cost, scheduling, and travel barriers to abortion care. Offering medication abortion on campus could reduce these barriers. Copyright © 2018 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  11. Medical humanities and philosophy: is the universe expanding or contracting? (United States)

    Stempsey, William E


    The question of whether the universe is expanding or contracting serves as a model for current questions facing the medical humanities. The medical humanities might aptly be described as a metamedical multiverse encompassing many separate universes of discourse, the most prominent of which is probably bioethics. Bioethics, however, is increasingly developing into a new interdisciplinary discipline, and threatens to engulf the other medical humanities, robbing them of their own distinctive contributions to metamedicine. The philosophy of medicine considered as a distinct field of study has suffered as a result. Indeed, consensus on whether the philosophy of medicine even constitutes a legitimate field of study is lacking. This paper presents an argument for the importance of a broad conception of the philosophy of medicine and the central role it should play in organizing and interpreting the various fields of study that make up the metamedical multiverse.

  12. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin


    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  13. [Medical manuscripts in the library of the Deontology Department of the Ankara University Medical School]. (United States)

    Arda, B


    At every academical platform on medical history and its instruction, lack of Turkish medical historiography is mainly emphasized. There are two main factors determining the situation: 1-There isn't any comprehensive Turkish medical history textbook. 2-There are difficulties in reaching the primary sources in this field. Everybody agrees with the importance of reaching medical manuscripts easily and reading and evaluating them in medical history. For this reason, it is important to know where we can find them. In this article, medical manuscripts which are available in the library of the Deontology Department of Ankara University Medical School are introduced. The manuscripts have been listed in alphabetical order of the authors' name. The bibliographic items, such as the size, writing style, and type of paper used, are mentioned.

  14. [Medical history as an academic subject at the Bamberg University]. (United States)

    Locher, W


    A full program of medicine was taught at the Catholic University of Bamberg (founded 1648 as the Academia Ottonia) from 1773 through 1803. Within this period of time, the History of Medicine was taught from 1790 through 1795 by Johann Baptist Dominicus Fin(c)k. This paper elucidates how in this instance protestant universities served as models for catholic universities. Interestingly, it was not the medical faculty itself which developed an interest in teaching medical history. Rather, it was Adalbert Friedrich Marcus (1753-1816), physician-in-waiting of the Prince-Bishop Franz Ludwig von Erthal and medical officer in the principality of Bamberg since June 22, 1790, who was charged by the Prince-Bishop with developing guidelines for medical education. The start of the History of Medicine lectures brought with it a heated dispute about an appropriate textbook. The discussion is evidence of a transition from historiography understood as an account of learned doctors of the past to a study of history in a modern sense.

  15. A proposed universal medical and public health definition of terrorism. (United States)

    Arnold, Jeffrey L; Ortenwall, Per; Birnbaum, Marvin L; Sundnes, Knut Ole; Aggrawal, Anil; Anantharaman, V; Al Musleh, Abdul Wahab; Asai, Yasufumi; Burkle, Frederick M; Chung, Jae Myung; Cruz-Vega, Felipe; Debacker, Michel; Della Corte, Francesco; Delooz, Herman; Dickinson, Garth; Hodgetts, Timothy; Holliman, C James; MacFarlane, Campbell; Rodoplu, Ulkumen; Stok, Edita; Tsai, Ming-Che


    The lack of a universally applicable definition of terrorism has confounded the understanding of terrorism since the term was first coined in 18th Century France. Although a myriad of definitions of terrorism have been advanced over the years, virtually all of these definitions have been crisis-centered, frequently reflecting the political perspectives of those who seek to define it. In this article, we deconstruct these previously used definitions of terrorism in order to reconstruct a definition of terrorism that is consequence-centered, medically relevant, and universally harmonized. A universal medical and public health definition of terrorism will facilitate clinical and scientific research, education, and communication about terrorism-related events or disasters. We propose the following universal medical and public definition of terrorism: The intentional use of violence--real or threatened--against one or more non-combatants and/or those services essential for or protective of their health, resulting in adverse health effects in those immediately affected and their community, ranging from a loss of well-being or security to injury, illness, or death.

  16. Motivation of university and non-university stakeholders to change medical education in Vietnam

    Directory of Open Access Journals (Sweden)

    Ruitenberg EJ


    Full Text Available Abstract Background Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder. From 1999 to 2006, eight medical schools in Vietnam worked together to change the curriculum and teaching for general medical students to make it more community oriented. This paper describes the factors that motivated the different stakeholders to participate in curriculum change and teaching in Vietnamese medical schools and the activities to address those factors and have sustainable contributions from all relevant stakeholders. Methods Case study analysis of contributions to the change process, using reports, interviews, focus group discussions and surveys and based on Herzberg's Motivation Theory to analyze involvement of different stakeholders. Results Different stakeholders were motivated by selected activities, such as providing opportunities for non-university stakeholders to share their opinions, organizing interactions among university stakeholders, stimulating both bottom-up and top-down inputs, focusing on learning from each other, and emphasizing self-motivation factors. Conclusion The Herzberg Motivation theory helped to identify suitable approaches to ensure that teaching topics, materials and assessment methods more closely reflected the health care needs of the community. Other medical schools undertaking a reform process may learn from this experience.

  17. Motivation of university and non-university stakeholders to change medical education in Vietnam. (United States)

    Luu, Ngoc Hoat; Nguyen, Lan Viet; van der Wilt, G J; Broerse, J; Ruitenberg, E J; Wright, E P


    Both university and non-university stakeholders should be involved in the process of curriculum development in medical schools, because all are concerned with the competencies of the graduates. That may be difficult unless appropriate strategies are used to motivate each stakeholder. From 1999 to 2006, eight medical schools in Vietnam worked together to change the curriculum and teaching for general medical students to make it more community oriented. This paper describes the factors that motivated the different stakeholders to participate in curriculum change and teaching in Vietnamese medical schools and the activities to address those factors and have sustainable contributions from all relevant stakeholders. Case study analysis of contributions to the change process, using reports, interviews, focus group discussions and surveys and based on Herzberg's Motivation Theory to analyze involvement of different stakeholders. Different stakeholders were motivated by selected activities, such as providing opportunities for non-university stakeholders to share their opinions, organizing interactions among university stakeholders, stimulating both bottom-up and top-down inputs, focusing on learning from each other, and emphasizing self-motivation factors. The Herzberg Motivation theory helped to identify suitable approaches to ensure that teaching topics, materials and assessment methods more closely reflected the health care needs of the community. Other medical schools undertaking a reform process may learn from this experience.

  18. E-learning in Type 1 Medical Universities of Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher ROKNI


    Full Text Available ABSTRACT Nowadays the Internet is the technological pedestal of organization in the information society and one of the main applications that the Internet offers is the Digital Library (DL. Each society, especially those that claim training of the public, predictably need implementation and endorsement these systems. The time of chalk and board is passed and the globalization and universal village demands a movement targeting to establish an information society. The university is said to be responsible for making "Human". In the era of information explosion, how can a university rely on a physical classroom, a tired teacher and some drowsy students listening to him? Internet "the sweet invention of man" is a bridge, between "slump" and "spurt". It is up to each authority in a university to design, employ, develop and evaluate a system embracing Internet, Multimedia, Network and so on to go parallel in modern era and to introduce the supreme system of E-learning in its program. Of different aspects of E-learning including computer networks, multimedia, search engines, electronic libraries, distance learning, and all that (Piskurich, 2003, most of the type 1 medical universities of Iran exploit, some how or another, all or some of them. These universities including Tehran, Iran, Shahid Beheshti, Mashhad, Isfahan, Tabriz, Shiraz, Ahwaz, and Kerman, at present encompass a powerful link with their audiences regarding digital libraries, search engine and authentic data bases. The present article is going to have a bird's eye view at various capacities of these universities in this regard.



    Kishimoto, Toshifumi; Ueda, Atsushi; Noriyama, Yoshinobu; Nagai, Toshiya; Hirayama, Tomohide; Kirita, Ikuhiro; Hata, Kazuya; Ikawa, Genro


    We surveyed the clinical electroconvulsive therapy (ECT) treatment expe- riences between 1987 and 1992 at Nara Medical University Hospital. ECT is restrictedly applied to severely ill patients who have no response to other somatic therapies. For 5 years, 43 cases were treated with ECT, of which 27 suffered from depressive disorders, 3 from schizophrenia, 3 from somatoform disorders, and 10 from anxiety disorders. ECT was selected by psychiatrists for severe depressive states after failure of ...

  20. Financial Resources Allocation of Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Esmaeil Afiyan


    Full Text Available ​ Background and Objectives : According to complexity of resource allocation, issue about how to allocate health care resources in an accurate and fair manner has become the subject of discussions and decisions of related groups. Therefore, in this research we aim to study the methods of financial resource allocation of Tabriz University of Medical Sciences in order to identify its strengths and weaknesses for its promotion. Material and Methods : This study is a descriptive, qualitative sectional research and all comments have been collected by focus group discussions with experts and managers involved in the allocation of financial resources of Tabriz University of Medical Sciences. All factors affecting the process of allocation have been reviewd carefully. Results : Results suggested that except the health sector, none of the other sectors use the formulated  and scientific methods for allocating financial resources and despite the emphasize in the 4th development plan for operating funding, the final cost of the services, has no role in allocating financial resources. Conclusion : Regarding to judgmental and subjective method of financial resources allocation of Tabriz University of Medical Sciences and lack of documented and formulated methods, there is an essential need for developing an appropriate and formulated model for scientific allocation of financial resources in order to improve the efficiency and fairness of the allocation.

  1. Prevalence of Burnout in Senior Medical Students of Kashan University of Medical Sciences in 2008

    Directory of Open Access Journals (Sweden)

    Ahmadvand A.


    Full Text Available Background and Objectives: Burnout is caused by high-stress jobs and could induce somatic, psychological disorders and negative attitude to professional actives so that this condition causes poor relationship with the patient. This study aimed at investigating burnout in senior medical students of Kashan University of Medical Sciences.Methods: This research was a cross sectional study carried out on all senior medical students (N=56 in 2008. Data were obtained by two questionnaires including demographic questionnaire and Maslach burnout Inventory. They were then analyzed using SPSS software and Chi square Test. Results: The findings showed that the majority of medical students (91.1% had burnout and only 8.9% of them had not burnout. Severe burnout was in 16% of students. There was not any significant relationship between burnout and sex, age, smoking, duration of education, interest in medical course and marital status P<0.05.Conclusion: The results of the study showed that burnout is common problem in senior medical students and need special consideration. Therefore medical students should be encouraged to seek help and adequate facilities by holding workshops of life-skill training and coping with stress. However, burnout should be paid special attention in medical students by counseling centers of University for prevention of consequences.

  2. Prevalence of Burnout in Senior Medical Students of Kashan University of Medical Sciences in 2008

    Directory of Open Access Journals (Sweden)

    G Akkasheh


    Full Text Available

    Background and Objectives: Burnout is caused by high-stress jobs and could induce somatic, psychological disorders and negative attitude to professional actives so that this condition causes poor relationship with  the patient. This study aimed at investigating burnout in senior medical students of Kashan University of Medical Sciences. Methods: This research was a cross sectional study carried out on all senior medical students (N=56 in 2008. Data were obtained by two questionnaires including demographic questionnaire and Maslach burnout Inventory. They were then analyzed using SPSS software and Chi square Test. Results: The findings showed that the majority of medical students (91.1% had burnout and only 8.9% of them had not burnout. Severe burnout was in 16% of students. There was not any significant relationship between burnout and sex, age, smoking, duration of education, interest in medical course and marital status P<0.05. Conclusion: The results of the study showed that burnout is common problem in senior medical students and need special consideration. Therefore medical students  should be encouraged to seek help and adequate facilities by holding workshops of life-skill training and coping with stress. However, burnout should be paid special attention in medical students by counseling centers of University for prevention of consequences.


  3. Utilization of research reactors in universities and their medical applications

    International Nuclear Information System (INIS)

    Kanda, Keiji.


    In Japan, five research reactors and a critical assembly are operated by the universities. They are opened to all university researchers, the system of which is financially supported by the Ministry of Education, Culture and Science of the Japanese government. Usually KUR is operated eight cycles per year. One cycle consists of the following four week operation: 1. Mainly for researchers from other universities; 2. Mainly for researchers in the institute; 3. Mainly for beam experiment; 4. Sort time experiment. In the weeks of 1 ∼ 3 the KUR is operated continously from Tuesday morning to Friday evening. The experiment include studies on physics, chemistry, biology, medicine, engineering etc. Recently the medical application of research reactors has become popular in Japan. The new technique of the boron neutron capture thereby has been successfully applied to brain tumors and will be to melanoma (skin cancer) in near future. (author)

  4. Academic entrepreneurship in a medical university: A system dynamics approach

    Directory of Open Access Journals (Sweden)

    Tofighi Sharam


    Full Text Available Academic entrepreneurship is a dynamic field which is growing after the second academic revolution that added entrepreneurial mission as the Third Mission of universities. In this sense, dynamics of this phenomenon is a suitable field of study and provides fruitful insights for both theory and practice. Thus, in this research, system dynamics approach is used to scrutinize academic entrepreneurship. The main question of this research is 'how academic entrepreneurship might evolve in a medical university of a developing country?' Therefore, Cross Impact Analysis method is used to examine the system behavior. In this study, the main attributes are adapted from a recent study by Salamzadeh et al. (2013a. Then, some policy variables are proposed and their effects on the model were shown. Findings show that although entrepreneurial ecosystem is growing in the country, still there are problems to be taken into account in order to improve the entrepreneurship in university.

  5. Organizational intelligence and agility in Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Hamid Taboli


    Full Text Available Introduction: Organizational Intelligence is a combination of all skills that organizations need and use; it enables us to make organizational decisions. Organizational Intelligence can increase the effectiveness of the existing informational structures in achieving organizational goals and result in organizational agility. The aim of this study was to investigate the relationship between Organizational Intelligence and organizational agility in Shiraz University of Medical Sciences. Method: This is an applied study in terms of purpose and descriptive in terms of method. The study population consisted of 1200 employees working in Shiraz University of Medical Sciences. The subjects were selected via convenience sampling. Based on Cochran formula, a sample size of 296 was determined with a confidence level of 95%. The measurement tools included the 36-item Organizational Intelligence questionnaire developed by Albrecht (2003 and a researcher-developed organizational agility questionnaire with 30 items. Expert opinion was used to determine the validity of the questionnaires and reliability was confirmed using Cronbach’s alpha coefficient via SPSS, version 19. Results: Tenure employees had the highest frequency among the participants (50%. In terms of education, employees with a bachelor’s degree were the most frequent (58%. Values obtained for all variables showed a significant positive relationship between Organizational Intelligence and Agility. Conclusion: It is recommended that the university officials take measures to include Organizational Intelligence courses in in-service training programs to promote the agility of the university, and improve the service provision process and speed.

  6. Evaluation and comparison of medical records department of Iran university of medical sciences teaching hospitals and medical records department of Kermanshah university of medical sciences teaching hospitals according to the international standards ISO 9001-2000 in 2008

    Directory of Open Access Journals (Sweden)

    maryam ahmadi


    Conclusion: The rate of final conformity of medical records system by the criteria of the ISO 9001-2000 standards in hospitals related to Iran university of medical sciences was greater than in hospitals related to Kermanshah university of medical sciences. And total conformity rate of medical records system in Kermanshah hospitals was low. So the regulation of medical records department with ISO quality management standards can help to elevate its quality.

  7. Self-medication practices with antibiotics among Chinese university students. (United States)

    Zhu, X; Pan, H; Yang, Z; Cui, B; Zhang, D; Ba-Thein, W


    Self-medication with antibiotics (SMA) is a serious global health problem. We sought to investigate SMA behaviors and risk factors among Chinese university students, and further explore the association between SMA practices and adverse drug events (ADEs). Cross-sectional study. An online survey was conducted at Jiangsu University (JSU) in eastern China in July 2011 using a pretested questionnaire. Out of 2608 website visitors, 1086 participated in the survey (response rate: 41.6%), 426 respondents were excluded for not being a JSU student or repeat participation, 660 (2.2% of JSU students) were included in analysis, and 316 students (47.9%) had a lifetime history of SMA. Among self-treated students, 43.5% believed that antibiotic was suitable for viral infections, 65.9% had more than one SMA episode in the previous year, 73.5% self-medicated with at least two different antibiotics, 57.1% and 64.4% changed antibiotic dosage and antibiotics during the course, respectively. Female gender, older age, and prior knowledge of antibiotics (PKA) were identified as independent risk factors of SMA. There was no difference between students with and without PKA regarding SMA frequency, use of polyantibiotics, and switching antibiotic dosage or antibiotics. ADEs happened to 13.3% of self-medicated students. Frequent change of dosage and simultaneous use of the same antibiotic with different names were independent risk practices associated with an ADE. Our findings substantiate high SMA prevalence among Chinese university students. Older age and PKA are independent SMA risk factors common to Chinese university students and female gender is exclusive SMA risk factor for JSU students. Poor SMA practices are associated with ADEs. Strict regulations on antibiotic sales and public education reinforced by further health care reform are recommended. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah


    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  9. Development of the competency-based medical curriculum for the new Augsburg University Medical School

    Directory of Open Access Journals (Sweden)

    Härtl, Anja


    Full Text Available Aim: With the resolution from April 28, 2014, the Bavarian state government in Germany decided to found a new medical school at Augsburg University, thereby requiring the development of a competency-based medical curriculum.Methods: Two interdisciplinary groups developed a spiral curriculum (following Harden employing the model of Thumser-Dauth & Öchsner. The curriculum focuses on specifically defined competencies: medical expertise, independent scientific reasoning, argumentation and scholarship, as well as communication skills.Results: The spiral curriculum was developed as a hybrid curriculum. Its modular structure incorporates the mandatory subjects required by the German regulations for medical licensure (Approbationsordnung into organ- and system-centered blocks which are integrated both horizontally and vertically. Basic preclinical sciences are covered in the blocks “Movement,” “Balance” and “Contact.” The clinical sciences are organized according to six pillars (conservative medicine, surgical medicine, men’s-women’s-children’s medicine, the senses, the nervous system and the mind, and general medicine which students revisit three times each over the course of the program. A longitudinal clinical course incorporates interdisciplinary education. A particular focus is on scientific education encompassing a longitudinal course in the sciences (including interdisciplinary classes with other university departments, block practicums, and two scientific projects.Conclusion: It is not only the degree of integration und intensity of the Augsburg University undergraduate medical degree program, but also its targeted advancement of academic, social and communication skills that have not yet been realized to such an extent elsewhere in Germany. On July 8, 2016, the German Council of Science and Humanities unanimously gave this concept a positive evaluation. Future research will examine and evaluate the Augsburg medical curriculum

  10. Scientific Productivity of Zahedan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Farahnaz Vatankhah


    Full Text Available Background: Nowadays the scientific research outputs indexed in international databases are used in the bibliometric rankings of researchers, departments and universities. Measuring the impact and value of scientific publications is used by policy makers to distribute the research funds in way that support high quality research projects. Materials and Methods: In this scientometric study, SCOPUS citation database was used to evaluate the scientific research productivity of Zahedan University of Medical Sciences (ZAUMS over the period of 1976-2011. We retrieved the number of publications and citations of researchers, academic groups, and university and calculated their h-index scores. The affiliation varieties were used by researchers to address the university and different spellings of authors names were determind.Results: The results showed that scientific productivity of ZAUMS has been improved so that it’s h-index increased from 1 in 2000 to 19 over the period of the study.Conclusion: Total number of 504 publications were indexed in SCOPUS in the forms of original article, review article, conference paper, letter, editorial, and note. Most of the publications were in the form of research article (91.2%. There was a significant coorelation between the number of publications, citation rates and h-index scores. Departments of biochemistry and infectious disease ranked first on the basis of producing the most scientific output of the university.

  11. Frequency and risk factors associated with emergency medical readmissions in Galway University Hospitals.

    LENUS (Irish Health Repository)

    Gorman, J


    Unplanned readmissions of medical hospital patients have been increasing in recent years. We examined the frequency and associates of emergency medical readmissions to Galway University Hospitals (GUH).

  12. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman


    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  13. Investigating the Medical Study of Overseas Students at Jinan University Medical School (United States)

    Zhang, Ming-ya; Wang, Guang; Cheng, Xin; Yang, Xuesong


    A great number of overseas students have studied medicine at Jinan University Medical School over the past decade. Statistics from the past ten years show that these students' test scores on diagnosis and medicine I & II are lower than those of their classmates from mainland China. To address the underlying causes of this phenomenon, we…

  14. Occupational Radiation Dose for Medical Workers at a University Hospital

    Directory of Open Access Journals (Sweden)

    M.H. Nassef


    Full Text Available Occupational radiation doses for medical workers from the departments of diagnostic radiology, nuclear medicine, and radiotherapy at the university hospital of King Abdul-Aziz University (KAU were measured and analysed. A total of 100 medical radiation workers were monitored to determine the status of their average annual effective dose. The analysis and the calibration procedures of this study were carried out at the Center for Radiation Protection and Training-KAU. The monitored workers were classified into subgroups, namely, medical staff/supervisors, technicians, and nurses, according to their responsibilities and specialties. The doses were measured using thermo luminescence dosimeters (TLD-100 (LiF:Mg,Ti placed over the lead apron at the chest level in all types of workers except for those in the cath lab, for whom the TLD was placed at the thyroid protective collar. For nuclear medicine, a hand dosimeter was used to measure the hand dose distribution. The annual average effective doses for diagnostic radiology, nuclear medicine, and radiotherapy workers were found to be 0.66, 1.56, and 0.28 mSv, respectively. The results of the measured annual dose were well below the international recommended dose limit of 20 mSv. Keywords: Occupational radiation dose, radiation workers, TLD, radiation protection

  15. Application of medical cases in general genetics teaching in universities. (United States)

    He, Zhumei; Bie, Linsai; Li, Wei


    General genetics is a core course in life sciences, medicine, agriculture and other related fields. As one of the most fast-developing disciplines of life sciences in the 21th century, the influence of the genetics knowledge on daily life is expanding, especially on human health and reproduction. In order to make it easier for students to understand the profound principles of genetics and to better apply the theories to daily life, we have introduced appropriate medical cases in general genetics teaching and further extended them combined with theoretical basis of genetics. This approach will be beneficial to enhance students' abilities of genetic analysis and promote their enthusiasm to learn and master practical skills. In this paper, we enumerate medical cases related to the modern genetics teaching system to provide a reference for genetics teaching in general and normal universities.

  16. Performance management of nuclear medical apparatuses in Osaka University Hospital

    International Nuclear Information System (INIS)

    Ikehara, Katsuhiro; Kusumi, Yoshimi; Hayashi, Makoto; Miharu, Tomoyoshi; Masuda, Kazutaka


    Nuclear medical out side-body measuring equipments in Osaka University Hospital consist of scinticamera, scintiscanner and movement-measuring equipment as measuring equipments, and central processing equipment, CRT attached with Polaroid camera, data typewriter, X-Y recorder, and high speed tape reader as data processing equipments. Daily and monthly management items are set up to maintain the best function of these equipments. The data processing room is air-conditioned to keep temperature at 25 0 C and humidity at 60% constantly, and they are confirmed with a temperature and humidity self-recorder. Computer system is used for the homogeneity control and the correction to counting failure of the scinticamera. As the repair of nuclear medical apparatuses needs long period and because of the special circumstances of radioactive drugs, very close cooperation among technicians, doctors and equipment makers is required. (Kobatake, H.)

  17. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  18. Attitude, Knowledge and Skill of Medical Students Toward E-Learning Kerman University Of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Okhovati M


    Full Text Available  Aims: According to the development of e-learning and its high efficiency on the development of Iran’s universities, level of knowledge and the attitude of the students to this modern method of education and indeed students’ skills in using it needed to be assessed to improve the quality and quantity of universities’ education. This study aimed to determine the attitude, knowledge and skill of medical students toward e-learning at Kerman University of Medical Sciences.  Instrument & Methods: In this descriptive cross-sectional study that was performed in 2013, 196 students of Kerman University of Medical Sciences were selected using proportional stratified sampling method. The research instrument was a valid and reliable questionnaire. Data were analyzed using Pearson correlation coefficient, ANOVA and independent T tests by SPSS 19 software.  Findings: The level of knowledge and skill of the students toward e-learning was “moderate” and their attitude was “high”. There were significant relationships between knowledge and skill (p=0.001 r=0.82 and also knowledge and attitude (p=0.001 r=0.37 but there was no significant relationship between skill and attitude (p=0.35 r=0.82. The scores of knowledge and skill were significantly different according to sex, but attitude had no significant difference with sex.  Conclusion: Kerman University of Medical Sciences’ students have a positive attitude to e-learning but according to their moderate knowledge and skills, performing this method of learning is not welcomed in this university.

  19. Determining Knowledge of Students in Tehran University and Tehran University of Medical Sciences About ECSTASY Tablets

    Directory of Open Access Journals (Sweden)

    G. Khoshe Mehri


    Full Text Available Objective: Nowadays, addiction is considered one of the greatest social and economical and health problems. Undoubtedly, The Ecstasy have between some juveniles and youths. This study was performed to understand the knowledge about the Ecstasy tablets. Methods: In this descriptive-analytical study 200 students from Tehran universities and universities of medical sciences. Data collecting tool was a structured questionnaire containing 14 questions. Data was analyzed using chi square. Results: It was revealed that only 44 students had high, 55 student had moderate and 101 students had weak knowledge about Ecstasy. There was no significant relationship between knowledge score and variable such as gender, place of residence. Also, there was a significant correlations between age, marriage position , occupation and college about the Ecstasy . Conclusion: That in order to increase the knowledge leveling the students about Ecstasy, mass medias like television, newspapers, radio and university sittings.

  20. Modernizing and transforming medical education at the Kilimanjaro Christian Medical University College. (United States)

    Lisasi, Esther; Kulanga, Ahaz; Muiruri, Charles; Killewo, Lucy; Fadhili, Ndimangwa; Mimano, Lucy; Kapanda, Gibson; Tibyampansha, Dativa; Ibrahim, Glory; Nyindo, Mramba; Mteta, Kien; Kessi, Egbert; Ntabaye, Moshi; Bartlett, John


    The Kilimanjaro Christian Medical University (KCMU) College and the Medical Education Partnership Initiative (MEPI) are addressing the crisis in Tanzanian health care manpower by modernizing the college's medical education with new tools and techniques. With a $10 million MEPI grant and the participation of its partner, Duke University, KCMU is harnessing the power of information technology (IT) to upgrade tools for students and faculty. Initiatives in eLearning have included bringing fiber-optic connectivity to the campus, offering campus-wide wireless access, opening student and faculty computer laboratories, and providing computer tablets to all incoming medical students. Beyond IT, the college is also offering wet laboratory instruction for hands-on diagnostic skills, team-based learning, and clinical skills workshops. In addition, modern teaching tools and techniques address the challenges posed by increasing numbers of students. To provide incentives for instructors, a performance-based compensation plan and teaching awards have been established. Also for faculty, IT tools and training have been made available, and a medical education course management system is now being widely employed. Student and faculty responses have been favorable, and the rapid uptake of these interventions by students, faculty, and the college's administration suggests that the KCMU College MEPI approach has addressed unmet needs. This enabling environment has transformed the culture of learning and teaching at KCMU College, where a path to sustainability is now being pursued.

  1. Modernizing and Transforming Medical Education at the Kilimanjaro Christian Medical University College (United States)

    Lisasi, Esther; Kulanga, Ahaz; Muiruri, Charles; Killewo, Lucy; Fadhili, Ndimangwa; Mimano, Lucy; Kapanda, Gibson; Tibyampansha, Dativa; Ibrahim, Glory; Nyindo, Mramba; Mteta, Kien; Kessi, Egbert; Ntabaye, Moshi; Bartlett, John


    The Kilimanjaro Christian Medical University (KCMU) College and the Medical Education Partnership Initiative (MEPI) are addressing the crisis in Tanzanian health care manpower by modernizing the college’s medical education with new tools and techniques. With a $10 million MEPI grant and the participation of its partner, Duke University, KCMU is harnessing the power of information technology (IT) to upgrade tools for students and faculty. Initiatives in eLearning have included bringing fiber-optic connectivity to the campus, offering campus-wide wireless access, opening student and faculty computer laboratories, and providing computer tablets to all incoming medical students. Beyond IT, the college is also offering wet laboratory instruction for hands-on diagnostic skills, team-based learning, and clinical skills workshops. In addition, modern teaching tools and techniques address the challenges posed by increasing numbers of students. To provide incentives for instructors, a performance-based compensation plan and teaching awards have been established. Also for faculty, IT tools and training have been made available, and a medical education course management system is now being widely employed. Student and faculty responses have been favorable, and the rapid uptake of these interventions by students, faculty, and the college’s administration suggests that the KCMU College MEPI approach has addressed unmet needs. This enabling environment has transformed the culture of learning and teaching at KCMU College, where a path to sustainability is now being pursued. PMID:25072581

  2. Self-citation of Medical and Non-medical Universities in Northern Iran. (United States)

    Jahani, Mohammad Ali; Yaminfirooz, Mousa


    Self-citation is one of the main challenges in the evaluation of researchers' scientific output. This study aimed at comparing the institutional self-citation among the universities located in Northern Iran. This study was conducted as a scientometric study. Research population included all scientific productions of 16 Northern Iran Universities with at least 100 indexed documents indexed in the Web of Science (WoS) by 2 June 2015. The citation analysis section of WoS was used for data collection. SPSS was applied for data analysis. Study hypotheses were tested with two independent sample t-test and paired sample t-test. Producing 16,399 papers, northern Iran universities had 5.33% of contribution in Iran's scientific production. They received 84,058 citations with 17% and 12% of self-citations belonged to the non-medical and medical universities, respectively. Testing hypotheses revealed that increase in received citations significantly increases the rate of self-citation and increase in scientific production does not necessarily increase the rate of self-citation. The rate of self-citation in the studied universities was not relatively high. However, investigating into the factors affecting the rate of and motives for self-citation needs further research.


    Directory of Open Access Journals (Sweden)

    M. H. Dehghani, K. Azam, F. Changani, E. Dehghani Fard


    Full Text Available The management of medical waste is of great importance due to its potential environmental hazards and public health risks. In the past, medical waste was often mixed with municipal solid waste and disposed in residential waste landfills or improper treatment facilities in Iran. In recent years, many efforts have been made by environmental regulatory agencies and waste generators to better managing the wastes from healthcare facilities. This study was carried in 12 educational hospitals of Tehran University of Medical Sciences. The goals of this study were to characterize solid wastes generated in healthcare hospitals, to report the current status of medical waste management and to provide a framework for the safe management of these wastes at the considered hospitals. The methodology was descriptive, cross-sectional and consisted of the use of surveys and interviews with the authorities of the healthcare facilities and with personnel involved in the management of the wastes. The results showed that medical wastes generated in hospitals were extremely heterogeneous in composition. 42% of wastes were collected in containers and plastic bags. In 75% of hospitals, the stay-time in storage sites was about 12-24h. 92% of medical wastes of hospitals were collected by covered-trucks. In 46% of hospitals, transferring of medical wastes to temporary stations was done manually. The average of waste generation rates in the hospitals was estimated to be 4.42kg/bed/day.

  4. Non-medical use of methylphenidate among medical students of the University of the Free State

    Directory of Open Access Journals (Sweden)

    Roshini Jain


    Full Text Available Background: Faced with demanding training programmes, medical students may be more prone to use methylphenidate for non-medical purposes in order to improve concentration, alertness and academic performance. Aim: The study aimed to investigate the prevalence of the non-medical use of methylphenidate and knowledge of this drug among undergraduate medical students of the University of the Free State. Methods: This was a cross-sectional study. A self-administered, anonymous questionnaire was distributed during lectures to all students in the five year groups of the undergraduate medical programme. Results: Of the 643 undergraduate medical students, 541 completed the questionnaire (response rate: 84.1%. Approximately 11.0% of surveyed students were using methylphenidate at the time of the study, of which the majority (67.9% used it for academic purposes and 70.6% received it from a medical health professional. Less than a third of users had been diagnosed with Attention-Deficit/Hyperactivity Disorder. Methylphenidate users’ median knowledge was greater than non-users, and methylphenidate knowledge increased from first-year and second-year students to third-year to fifth-year students. Median knowledge scores per year group ranged from 52.0% to 60.0%. Conclusion: Methylphenidate is mainly used for non-medical purposes by medical students. Students generally have a low level of knowledge on methylphenidate. Specific information on methylphenidate should be included in lectures on stress management and study methods during the course of the medical curriculum.

  5. Student-Life Stress Level and its Related Factors among Medical Students of Hamadan University of Medical Sciences in 2015


    Roya Nikanjam; Majid Barati; Saeed Bashirian*; Mohammad Babamiri; Ali Fattahi; Alireza Soltanian


    Background and Objectives: Student-life stress can lead to various negative consequences such as physical illness, mental disorders or exhaustion. The present study was conducted to evaluate the level of student life stress and its related factors among medical students of Hamadan University of Medical Sciences. Materials and Methods: This cross-sectional study applied multistage random sampling to select 500university students at Hamadan University of Medical Sciences during 2015. The dat...

  6. Comparisonof depression prevalence in medical students between the first and last years of Birjand University of Medical Sciences: Brief Article

    Directory of Open Access Journals (Sweden)

    Nahid Rahmani Bidokhti


    Conclusion: Apparently, prevalence of depression in medical students in Birjand university of Medical Sciences is high, although studying medicine is not significantly decisive in the occurrence of the problem.

  7. Description and Pathology of Research Development in Tabriz Medical University

    Directory of Open Access Journals (Sweden)

    Alireza Farajollahi


    Full Text Available Background and purpose: Research in medical science, as in all other fields of science, is necessary in order to maintain and improve the public health. This is achievable only by researchers and faculty members. This study is attempt o identify intra-organizational factors that influence research planning and related interventions in Tabriz Medical University.Methods: In this descriptive cross-sectional study, the study group included all faculty members and masters of science (equivalent to faculties in Tabriz Medical University, of which 121 persons wereselected randomly. Lickert style questionnaires were developed to evaluate and compare the attitudes toward project approval process, knowledge about research facilities, departmental cooperationsin research, and researchers’ capabilities in project execution. Data analysis was performed using SPSS software.Results: During a 3 year period, each faculty member had, on average, supervised 5.17 dissertations, conducted 1.15 approved research projects, and had 3.4 presentations in domestic and 0.36 presentations in international conferences. Lack of time was the main problem in conducting research.Comparing faculties with and without research experience, there was significant differences in regard of access to research facilities (pthe level of research knowledge (pmotivations, job satisfaction, departmental cooperation, and expecting benefits from conductingresearch.Conclusion: According to the faculties’ views, intra-organizational problems are less important than personal factors in performing research projects; i.e. the main obstacles for research were lack of time, and lack of competence in research methodology and problem-finding. Intra-organizational factors such as delay in project approval and lack of knowledge about research priorities are classified in the next levels.Keywords: FACULTY MEMBERS, RESEARCH PROBLEMS, INTRA-ORGANIZATIONAL FACTORS

  8. Medical students' attitude of their success rate in clerkship period in Birjand University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Hadjyabady


    Full Text Available Background With regard to accelerated progresses in the world of science and technology, as well as changes in the needs of the society, medical education should be a developing process. One of the main factors that can promote education from a static to a dynamic and effective state is evaluation. Purpose The purpose of the present survey is to determine the rate of success of medical students passing their clerkship in Birjand University of Medical Sciences from their own views of attaining educational goals of Urology Department. Methods The study is descriptive-analytical and has been performed on 50 medical students in Birjand University of Medical Sciences. Having determined the validity as well as the reliability of the question­naires, we used them to collect the data. Results Participants were 37 men (74% and 13 women (26%. T-test demonstrated a significant statical difference between male and female students in practical management of cases in urology ward (p<0.03. significant. Better practical performance was evident when the students take practical approach, in addition to looking and listening. Also, if students used various methods of teaching and learning, they would better manage cases. Conclusion The rate of medical students' success in their clerkship period for educational goals of urology was good. However, providing required facilities for giving instructions on clinical skills such as educational clinical workshops, clinical skill workshops and clinical skills centre, educational films and bed­ side practice under supervision of professors, will promote the fulfilment of educational goals. Key word educational goals, medical students, urology ward

  9. Older medical students' performances at McGill University. (United States)

    Feil, D; Kristian, M; Mitchell, N


    To compare admission data and academic performances of medical students younger and older than 25, and to qualify older students' experiences and perceptions in medical school. The authors reviewed 1988-1991 data for applications to the McGill University Faculty of Medicine. Data included GPAs and MCAT scores, as well as ratings for reference letters, autobiographical statements, and interviews. For those same years, the authors measured students' academic performances in the preclinical and clinical years. The authors compared the data by students' age: "younger" students, aged 17 to 24; and "older" students, aged 25 and above. All enrolled students took the Derogatis Stress Profile, and the older students participated in focus groups. The older applicants had lower GPAs and MCAT scores, but higher interview and reference letter ratings. For older accepted students, basic science course scores were lower than those of younger students, but clinical scores did not differ significantly between the groups. The two groups had similar stress levels, although older students tested lower in driven behavior, relaxation potential, attitude posture, and hostility. In focus groups, the older students spoke of learning style differences, loss of social support, and loss of professional identity. Different scores in admission criteria suggest that McGill uses different standards to select older medical students. Older students admitted under different criteria, however, do just as well as do younger students by their clinical years. A broad-based study of admission criteria and outcomes for the older student population is warranted.


    Directory of Open Access Journals (Sweden)

    V. Ya Gelman


    Full Text Available The aim of the study is the analysis of the problems faced by heads and staff of IT departments in medical universities. Methodology and research methods. The methods involve expert estimation, analysis and generalization of practical work experience of IT departments. Results and scientific novelty. The main aspects and specifics of professional activity of IT departments of modern medical schools are designated. The approaches to the definition of the hierarchy of goals in the professional activities of the department, as well as quantitative and qualitative indicators that assess the effectiveness of their achievements are analyzed. The contradictions arising between long-term and short-term goals of the IT department are highlighted. The main challenges which heads of IT departments can deal with in the course of day-to-day management work planning are described. The problems arising in educational, educational-methodical and scientific work of department, in its economic activity, solution of personnel affairs, and aspects of material support are considered. The possible solutions to these problems are proposed. Practical significance. The results of the analysis, proposed approaches and practical recommendations will enable to better organize the work of the IT department in a medical school. The advantage of the proposed approaches consists in their versatility: with some adjustment, they can be used by other departments, regardless of the specifics and the type of educational institution.

  11. Depression in Nursing Students of Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    F Rafati


    Full Text Available Background: University students are important parts of all educational systems. They are susceptible to different psychiatric disturbances, which in turn may cause considerable problems with their course programs. Depression is among the most important indices for investigation on human mental health status. This research was planed to study the prevalence and characteristics of depression and its consequences (suicidality, hopelessness, etc. in nursing students at Shiraz University of Medical Sciences. Methods: All undergraduate nursing students at Fatemeh College of Nursing and Midwifery were tested with Beck Depression Inventory (BDI. Results: This research revealed that 60% of students were depressed, 34% of them had mild depression, 18.4% moderate, 6% relatively severe and 1.6% severe depression. Mean score of BDI was not significantly different between female and male subjects (13.8 ± 9 in females vs. 15.2 ± 10 in males; total 14.1 ± 11 Conclusions: This research shows that there is still a high proportion of University students having depression, which necessitates considerable attention to their problems. Keywords: Nursing Students, Beck Depression Inventory, Depression.

  12. Home Medication Cabinets and Medication Taking Behavior of the Staffs in a University in China (United States)

    Xue, Chengbin; Ye, Juan; Dong, Yuzhen; Xu, Chunmei


    Background: A growing sum of medicines is stored in home medication cabinets in China, with the behavior of self-medication increasing. Although responsible self-medication can help prevent and treat ailments that do not need professional consultation, it bears the risk of misuse of medicines issued on prescription due to inadequate prescription medicine administration. Objective: The objective of this study was to investigate the condition and safety of medication storage and intended self-medication in a University in China. Method: The study was conducted over 10 month period (May 2015-March 2016) and involved a random sample of households. The questionnaire survey and personal insight into household medicine supplies was performed by a team of trained pharmacy staffs. Interviewees (N = 398, aged 16-88 y) were visited door to door and the home medication cabinets were catalogued after the participants were interviewed. Results: The majority (89.71%) households have home medicine cabinets. The total number of medicine items in the 398 households was 5600, with a median of 14 per household. The most frequently encountered categories of registered medicines were cough and cold medcines (47.8%), antibacterials for systemic use (30.0%), topical products for joint and muscular pain(26.1%), vitamins (23.2%), medication for functional gastrointestinal disorders (23.2%), oral and external forms have not kept separately(55.1%). The most treatment related problems recorded were curative effect not ideal (57.9%). 68% of the sample population would choose doctors as medication consultation object about medicines purchased. Conclusion: Large sum of medicines were found per household, with a high prevalence of cough and cold medcines. Public services in China, mainly government and health organizations, need put more effort on educating people on how to store medicines, as well as finding a way to raise awareness of the public in promoting behavioral change about medication

  13. Medication therapy management clinic: perception of healthcare professionals in a University medical center setting

    Directory of Open Access Journals (Sweden)

    Shah M


    Full Text Available Objective: To determine the overall perception and utilization of the pharmacist managed medication therapy management (MTM clinic services, by healthcare professionals in a large, urban, university medical care setting.Methods: This was a cross-sectional, anonymous survey sent to 195 healthcare professionals, including physicians, nurses, and pharmacists at The University of Illinois Outpatient Care Center to determine their perception and utilization of the MTM clinic. The survey consisted of 12 questions and was delivered through a secure online application. Results: Sixty-two healthcare professionals (32% completed the survey. 82% were familiar with the MTM clinic, and 63% had referred patients to the clinic. Medication adherence and disease state management was the most common reason for referral. Lack of knowledge on the appropriate referral procedure was the prominent reason for not referring patients to the MTM clinic. Of the providers that were aware of MTM services, 44% rated care as ‘excellent’, 44% as ‘good’, 5% as ‘fair’, and 0% stated ‘poor’. Strengths of MTM clinic identified by healthcare providers included in-depth education to patients, close follow-up, and detailed medication reconciliation provided by MTM clinic pharmacists. Of those familiar with MTM clinic, recommendations included; increase marketing efforts to raise awareness of the MTM clinic service, create collaborative practice agreements between MTM pharmacists and physicians, and ensure that progress notes are more concise.Conclusion: In a large, urban, academic institution MTM clinic is perceived as a valuable resource to optimize patient care by providing patients with in-depth education as it relates to their prescribed medications and disease states. These identified benefits of MTM clinic lead to frequent patient referrals specifically for aid with medication adherence and disease state management.

  14. Learning Styles of Medical and Midwifery Students in Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    A Zeraati


    Full Text Available Background: Students have individual learning style preferences including visual (V; learning from graphs, charts, and flow diagrams, auditory (A; learning from speech, read-write(R; learning from reading and writing, and kinesthetic (K; learning from touch, hearing, smell, taste, and sight.These preferences can be assessed using the VARK questionnaire.Purpose: We aimed to assess different learning styles of medical students in our collage.Methods: This study was conducted to describe learning styles of 214 Medical and Midwifery students in Mashhad University of medical sciences. By using the English version of the VARK questionnaire, we measured the difference in learning styles of medical students and midwifery students and compared with 57336 global general students who completed the test in VARK website up to Sep 2007.Results: The dominant learning preference of our students was Aural preference (30.8% followed by Read/Write (20.6%, while (7.5% were in Kinesthetic and (5.6% were Visual learners; still most of the students (35.5% represented a multimodal learning preference. No significant difference was found between males and females. The general pattern between medical student and Midwifery student is the same. There was a significant relation between Internship Entrance Exam score and thelearning styles of medical student and who were more Read/Write got higher scores.Conclusion: Knowing that our students have different preferred learning modes will help medical instructors in our faculty develop appropriate learning approaches and explore opportunities so that they will be able to make the educational experience more productive.Key words: MEDICAL EDUCATION, LEARNING MODELS VARK, VISUAL, AUDITORY, READ-WRITE, KINESTHETIC, SSTUDENTS.

  15. Diversity leadership: the Rush University Medical Center experience. (United States)

    Clapp, J R


    Meeting the challenges of diversity is crucial, and within healthcare organizations a particularly strong case exists for a diversity strategy. Rush University Medical Center in 2006 was at an important juncture. Since its founding, the organization had made notable progress toward advancing diversity and inclusiveness. On the other hand, many diversity-related problems continued. Rush convened a committee to review the work of the institution in this area. The committee's report called for changes, and a Diversity Leadership Group (DLG) model was established. This article documents the progress made since 2006 through implementation of the DLG model. The changes prescribed for Rush are presented as recommendations and challenges that other healthcare organizations may find applicable to their own institutions.

  16. Medical Training Experience and Expectations Regarding Future Medical Practice of Medical Students at the University of Cape Verde. (United States)

    Delgado, Antonio Pedro; Soares Martins, Antonieta; Ferrinho, Paulo


    Cape Verde is a small insular developing state. Its first experience of undergraduate medical education began in October 2015. The purpose of this paper is to describe and analyze the professional expectations and profile of the first class of medical students at the University of Cape Verde. A piloted, standardized questionnaire, with closed and open-ended questions, was distributed to registered medical students attending classes on the day of the survey. All data were analyzed using SPSS. Students decided to study medicine in their mid-teens with relatives and friends having had significant influence over their decisions. Other major reasons for choosing medical training include "to take care of other people", "fascination for the subject matters of medicine" and "I have always wanted to". The degree of feminization of the student population is extremely high (20/25; 80.0%). Medical students are in general satisfied with the training program, and have expectations that the training received will allow them to be good professionals. Nevertheless, they consider the course too theoretical. Medical students know that this represents an opportunity for them to contribute to public welfare. Nonetheless, their expectations are to combine public sector practice with private work. Medical students come mostly from Santiago Island where the Capital of the Country is located. They still do not know about their future area of specialization. But all of those who want to specialize want to do so abroad. They mostly expect to follow hospital careers rather than health administration or family and community medicine. This study contributes to the growing body of knowledge about medical students' difficulties and expectations regarding medical schools or curriculums in lusophone countries. The decision to invest in the training of local physicians is justified by the need to be less dependent on foreigners. Local postgraduate medical training programs are already

  17. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.


    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  18. Organizational behavior of employees of Tehran University of Medical Sciences. (United States)

    Dargahi, Hossein


    Organizational behaviors are commonly acknowledged as fundamentals of organizational life that strongly influence both formal and informal organizational processes, interpersonal relationships, work environments, and pay and promotion policies. The current study aims to investigate political behavior tendencies among employees of Tehran University of Medical Sciences (TUMS). This cross-sectional, descriptive and analytical study was conducted on 810 TUMS employees at the headquarters of the Tehran University of Medical Sciences, Iran during 2010-2011. The research tool for data collection was a researcher-tailored questionnaire on political behaviors. The validity of the questionnaire was confirmed by seven management professors, and its reliability was tested by a pilot study using test-retest method which yielded a Cronbach's alpha coefficient of 0.71. The respondents were asked to fill the questionnaire and express their perceptions and tendencies to engage in organizational behaviors. The collected data was read to and analyzed by IBM SPSS environment and correlation analytical methods. Overall, 729 respondents filled and returned the questionnaire yielding a response rate of 90%. Most of the respondents indicated that they had no tendency to engage in political behavior. Moreover, we found that there was a significant correlation between sex, higher education degrees, tenure and the employees' tendency to engage in political behavior. The participants were not overtly political because of their personal belief, ethical values, and personal characters. Non-political and overtly political employees are both prejudicial for all organizations. Therefore, it seems that the medium rate of good political behavior is vital and prevalent in Iranian organizations.

  19. Perceptions of Ghanaian medical students completing a clinical elective at the University of Michigan Medical School. (United States)

    Abedini, Nauzley C; Danso-Bamfo, Sandra; Moyer, Cheryl A; Danso, Kwabena A; Mäkiharju, Heather; Donkor, Peter; Johnson, Timothy R B; Kolars, Joseph C


    International medical electives typically represent a unidirectional flow of students from economically advantaged countries in the global "North" to resource-poor nations in the global "South." Little is known about the impact of bilateral exchanges on students from less affluent nations. Since 2007, students from the University of Michigan Medical School (UMMS) and medical schools in Ghana have engaged in a bilateral clinical exchange program. A 45-item online survey was distributed to all 73 Ghanaian medical students who had rotated at UMMS from 2008 to 2010 to assess perspectives on the value and impact of their participation. Incoming Ghanaian students outnumbered outgoing UMMS students 73 to 33 during the study period. Of eligible Ghanaian students, 70% (51/73) participated in the survey, with 40 of 51 providing valid data on at least 50% of questions. Ninety-seven percent (37/38) reported that the UMMS rotation was valuable to their medical training, 90% (35/39) reported changes in how they approach patient care, and 77% (24/31) reported feeling better equipped to serve patients in their home community. Eighty-five percent of students (28/33) felt more inclined to pursue training opportunities outside of their home country after their rotation at UMMS. More studies are needed to determine the feasibility of bidirectional exchanges as well as the short-term and long-term impact of rotations on students from underresourced settings and their hosts in more resource-rich environments.

  20. Cardiopulmonary Resuscitation Training for Medical Students in Anesthesiology Rotation in Ardabil Medical University (Iran

    Directory of Open Access Journals (Sweden)

    Kh Isazadehfar


    Full Text Available Background and purpose: Cardiopulmonary resuscitation (CPR training for undergraduate medical students has been noted to be poor in the past. Attempts have been made The aim of this study is to determine effect of CPR training in the anesthetic ward to improve knowledge and practice undergraduate medical student of CPR.Methods: A 12 month Educational experimental study with self control was done on all undergraduate medical student (n=30 at the medical university of Ardabil in 2006-2007. During I month of program allthis students have undergone CPR training including basic life support (BLS , advanced cardiac life support (ACLS and practical skills. Data were collected via questionnaire, demographic, pre/post knowledge and practice.Results: After training the acceptable score (good and very good about knowledge of BLS, ACLS and practical skill significantly increased %6.7 to %50 (p=0.0001 , %13.3 to %53.4 (p=0.001 and %3.3 to %100 (p=0.001 respectively. A significant relationship between knowledge of ACLS and practical skills was shown (p=0.005.Conclusion: The CPR training course in anesthetic ward leads to a significant increased in skills and knowledge. Adding this course to undergraduate curriculum of medical students especially in operaticallywards (e.g. Anesthetic ward is essential.Keywords: CARDIOPULMONARY RESUSCITATION; TRAINING; BASIC LIFE SUPPORT; ADVANCED CARDIAC LIFE SUPPORT

  1. Improvement of the training system of medical and pharmaceutical specialists at medical college of Saratov State Medical University

    Directory of Open Access Journals (Sweden)

    Popkov V.M.


    Full Text Available The development of high-technological medical care in Russia has improved the quality of rendering of medical aid to the population, but at the same time the lack of efficient, qualified specialists has been revealed. Today graduates of professional educational institution are characterized by the knowledge in theory and inefficient practical experience, while the employer is interested in the optimal combination of these qualities. All of these facts lead to the necessity of introducing into the educational process technologies of dual training as a tool of approximation theory to practice Saratov. Medical University may share the experience of introduction and organization of elements of the complex educational system in the process of realization of the programs of secondary professional education through the creation of educational-productive cluster on the bases of clinics.

  2. Brand equity in the Pakistani hotel industry


    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.


    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  3. Medicalization of global health 4: The universal health coverage campaign and the medicalization of global health. (United States)

    Clark, Jocalyn


    Universal health coverage (UHC) has emerged as the leading and recommended overarching health goal on the post-2015 development agenda, and is promoted with fervour. UHC has the backing of major medical and health institutions, and is designed to provide patients with universal access to needed health services without financial hardship, but is also projected to have 'a transformative effect on poverty, hunger, and disease'. Multiple reports and resolutions support UHC and few offer critical analyses; but among these are concerns with imprecise definitions and the ability to implement UHC at the country level. A medicalization lens enriches these early critiques and identifies concerns that the UHC campaign contributes to the medicalization of global health. UHC conflates health with health care, thus assigning undue importance to (biomedical) health services and downgrading the social and structural determinants of health. There is poor evidence that UHC or health care alone improves population health outcomes, and in fact health care may worsen inequities. UHC is reductionistic because it focuses on preventative and curative actions delivered at the individual level, and ignores the social and political determinants of health and right to health that have been supported by decades of international work and commitments. UHC risks commodifying health care, which threatens the underlying principles of UHC of equity in access and of health care as a collective good.

  4. Clinical education stressors in medical trainees in Shahid Sadoughi University of Medical Sciences, Yazd

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Stress is an important factor in the educational process. Teaching and learning are stressful processes. This stress can affect one’s ability and change his/her performance. The purpose of this study was to investigate stressors of clinical education from the perspective of medical students in Yazd University of Medical Sciences. Methods: This descriptive-analytic study was conducted in Yazd University of Medical Science during year 2014-2015. The sample size was 170 medical students who were selected randomly. The data were collected by a questionnaire including four components: interpersonal relationship, educational environment, clinical experience and the unpleasant emotions. A significance level of 0.05 was considered for analysis. The statistical analyses included descriptive statistics, ANOVA and T-tests, using SPSS software, version 14. Results: The results showed that the highest domain score belonged to interpersonal relationship (3.33±0.3 followed by unpleasant emotions domain (3.3±0.3. The lowest domain score of clinical education stressors was educational environment (3.12±0.1. The results showed that the mean score of interpersonal relationship domain was more in women than in men (p<0.05. Conclusion: The relationship between teachers and students is an effective factor in all dimensions of clinical education stressors. So proper measures such as the promotion of scientific awareness of teachers and educational staff about factors that lead to stress and the best way to communicate with students should be taken to reduce the students’ stress.

  5. Self-Medication in University Students from the City of Mansoura, Egypt. (United States)

    Helal, R M; Abou-ElWafa, H S


    Background . Self-medication is a common practice in developed and developing countries. Objectives . To explore the prevalence of self-medication practices among university students, probable reasons, symptoms requiring self-medication, and sources of advice. Methods . A descriptive cross-sectional study was carried out in Mansoura University, Egypt, and included 1st and last year students of both medical and nonmedical faculties. Results . Prevalence of self-medication was 62.9%. Younger age, female, medical, and ever-married students and those having home pharmacy tended to self-medicate more than their peers with significant difference between them. Being medical student, being from urban area, having good current health condition, being careless about health, and having drugs stored at home pharmacy were independently associated with the likelihood of self-medicating. Conclusion . Prevalence of self-medication among university students is high which constitutes a health problem that needs intervention.

  6. Dietary habits of Wroclaw Medical University students (Poland) (United States)

    Ilow, Rafał; Regulska-Ilow, Bożena; Różańska, Dorota

    The World Health Organization considers an unhealthy diet to be related to the risk of cardiovascular diseases development. The aim of this study was to evaluate dietary habits among Wroclaw Medical University students with a view towards the nutritional risk factors for cardiovascular diseases. The study was conducted between the years 2004-2012. The study group consisted of 892 women and 276 men. The respondents were asked to complete a questionnaire based on the principles outlined in “The Polish food-based dietary guidelines”. There were numerous eating habits not in compliance with the recommendations. Men failed to take ≥ 3 meals/ day (10.1% vs 6.3%) at a significantly higher frequency than women. Food products exhibiting a high glycaemic index (GI) were preferred over low GI, especially among men. About 62% of women and 75% of men failed to consume ≥ 5 portions of fruits and vegetables per day. Women chose low-fat dairy products and meat significantly more frequently than men. 73% of women and 67% of men declared that they consumed vegetable oils on an irregular basis. About 8% of women and 11% of men used salt without restrictions, while 58% and 64% respectively, used sugar to sweeten beverages. Improper nutritional habits were observed in a high part of the studied students, especially among men. It is therefore strongly suggested that the rules of proper nutrition be promoted among this group.

  7. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-


    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  8. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim


    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  9. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-


    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  10. Evaluation of self-medication practices in acute diseases among university students in Oman

    Directory of Open Access Journals (Sweden)

    Marwa Al Flaiti


    Conclusion: The prevalence of self-medication among university students was very high. There is a need for intensive education and comprehensive awareness campaign to advocate for reduction in the prevalence of self-medication practices among students.

  11. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. (United States)

    Qureshi, Mustafa; Abbas, Zaigham


    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  12. Using Mind Maps to Improve Medical Student Performance in a Pharmacology Course at Kunming Medical University. (United States)

    Ying, Guo; Jianping, Xie; Haiyun, Luo; Xia, Li; Jianyu, Yang; Qun, Xuan; Jianyun, Yu


    To determine whether students using mind maps would improve their performance in a final examination at the end of lecture-based pharmacology course. Aquasi-experimental study. Kunming Medical University, from September 2014 to January 2015. One hundred and twenty-two (122) third year undergraduate medical students, starting a 48-hour lecturebased pharmacology course, volunteered to use mind maps as one of their study strategies (intervention group), while the remaining 100 students in the class continued to use their usual study strategies (control group) over the duration of the course. The performance of both groups in the final course examination was compared. Students in the intervention group also completed a questionnaire on the usefulness of mind maps during the course and in preparation for the final examination. The students' performance of intervention group was superior to performance of the control group in all parts of a multi-modal final examination. For the multiple choice questions and comprehensive scores, average marks of 45.97 ±7.22 and 68.07 ±12.77, respectively were acquired by the control group, and 51.77 ±4.95 (pcontrol group, and were all significantly higher at 8.00 (4.00) (p=0.024), 10.00 (2.00) (pmind maps helped them to prepare more efficiently for the final exam; 90.91% believed that mind maps helped them to better understand all of pharmacology. Ninety-one percent also thought that mind maps would help them to better understand other disciplines, and 86.36% students would like the lecturers to utilize mind mapping as an alternative to conventional teaching formats, such as the use of Power Point. The addition of mind maps to students' study of pharmacology at Kunming Medical University improved their performance in all aspects of a multi-modal final examination.

  13. Evaluation of information literacy status among medical students at Shiraz University of Medical Sciences. (United States)

    Bazrafkan, Leila; Hayat, Ali Asghar; Abbasi, Karim; Bazrafkan, Aghdas; Rohalamini, Azadeh; Fardid, Mozhgan


    The information literacy status and the use of information technology among students in the globalization age of course plans are very momentous. This study aimed to evaluate the information literacy status and use of information technology among medical students of Shiraz University of Medical Sciences in 2013. This was a descriptive-analytical study with cross-sectional method. The study population consisted of all medical students (physiopathology, externship and internship) studying at Shiraz University of Medical Sciences. The sample size (n=310) was selected by systematic random sampling. The tool of data gathering was LASSI questionnaire (assigned by America research association) with 48 closed items in five-point LIKERT scale. The questionnaire included two distinct parts of demographic questions and the information literacy skills based on the standards of information literacy capacities for academic education. The content validity was acquired by professors' and experts' comments. The reliability was also calculated by Cronbach'salpha (0.85). Data were analyzed in both descriptive (frequency- mean) and analytical level (t-test, analysis of variance) using SPSS 14 software. 60.3% of the participants were females, and the remaining (29.7%) were males. The mean score of information literacy and its five subgroups among the students weren't at a desirable level. The mean scores of information literacy for educational grades from the highest to lowest belonged to the internship, physiopathology and externship. The results showed that the highest average was related to the effective access ability to information among interns (9.27±3.57) and the lowest one was related to the ability of understanding legal and economical cases related with using information among externs (3.11±1.32).The results of ANOVA showed that there wasn't a significant difference between educational grades and information literacy. Finally, the result of independent t-test did not show a

  14. Consultation Needs Assessment in Kermanshah University of Medical Sciences: Viewpoints of Medical Students

    Directory of Open Access Journals (Sweden)

    Cyrus Jalili


    Full Text Available Introduction: Consultation can play an effective role in accommodating students to conditions and can be followed by academic achievement. This study was aimed to determine the consultation needs assessment among medical students in Kermanshah University of Medical Sciences (KUMS. Methods: This cross-sectional study was conducted among 300 students from undergraduate basic sciences of medical faculty of KUMS during 2016. Two structured questionnaires were applied for collecting data: demographics and consultation needs assessment. Data were analyzed by SPSS version 16 using bivariate correlations, t-test, and ANOVA test. Results: The age range of participants was 19 to 31 with the average of 22.78±2.30. Gender was associated significantly and statistically with the areas of individual growth and promotion needs, educational needs, employment needs and emotional needs; girls in these areas acquired a higher score compared to boys (P<0.05. Furthermore, the domain of individual growth and promotion needs acquired the highest score. Conclusion: Our findings indicated that most of the students' needs were in the field of individual and educational growth and promotion. Furthermore, the average scores of guidance and consultation needs assessment of the female students was higher, with the necessity of paying more attention to the consultation problems among them.

  15. Source of learning basic clinical skills by medical interns Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Meshkani Z


    Full Text Available Background: Effective clinical teaching is a major objective in general practitioner’s education at medical schools. Purpose: To identify the sources of clinical skills learning that medical student experience Methods: In this cross sectional study, interns of Tehran medical university who spent at least 12 months of their internship answered a questionnaire on the sources of clinical skills training. Chi2 test was used to examine the association of source of learning and students,’ specification such as sex, score of pre –internship exam, and marital status. Results: All 250 interns who were eligible participated. Over all 46.60% interns learned their clinical skills from residents or clinical teachers, 29.61% observed others performing the procedures, 16.25 learned the skills from hospital staff or nurses, 7.54% practiced their knowledge when confronted to an emergency situation Conclusion: Our results warrant a more attentive approach to clinical skills (specially procedural skills training Key words: LEARNING RESOURCES

  16. [Tobacco smoking amongst students in the Medical Faculty of Wroclaw Medical University]. (United States)

    Kurpas, Donata; Jasińska, Ajicja; Wojtal, Mariola; Sochocka, Lucyna; Seń, Mariola


    The main aim of health promotion and diseases profilaxis is a struggle with smoking, which is a well known factor in many disorders, i.e. malignant carcinomas, noncarcinomatous diseases of respiratory system and cardiovascular diseases. The aim of the study was the analysis of the smoking level amongst the students of 6th year of the Medical Faculty of Wroclaw Medical University. Amongst 131 polled women--116 were non-smoking persons (88.5%), 15 smoking (11.5%). Amongst 55 polled men--43 these are non-smoking persons (78%), 12 smoking (22%). Out of smoking women, the most women (6) is smoking from 11 to 15 cigarettes per day, out of smoking men, the most (5 men)--6-10 cigarettes per day. Smoking women began smoking during the secondary school the most often. 8 of men began the smoking in the secondary school. The majority of examined didn't try to limit smoking. Respondents would expect the biggest support from close persons during giving up smoking Only 59% of women and 64% of men disagree definitely to smoking in their presence. In the consequence of above results surprising seems still high percentage of smokers amongst examined, scantiness of taking attempts of giving up smoking and indifference of non-smoking medical students towards smoking in their presence.

  17. Effect of Facebook on the life of Medical University students. (United States)

    Farooqi, Hassan; Patel, Hamza; Aslam, Hafiz Muhammad; Ansari, Iqra Qamar; Khan, Mariya; Iqbal, Noureen; Rasheed, Hira; Jabbar, Qamar; Khan, Saqib Raza; Khalid, Barira; Nadeem, Anum; Afroz, Raunaq; Shafiq, Sara; Mustafa, Arwa; Asad, Nazia


    Facebook is a social networking service launched in February 2004, owned and operated by Facebook, Inc. As of June 2012, Facebook reports more than 1 billion active users. Objective of study was to evaluate the effect of Facebook on the social life, health and behavior of medical students. It was a cross sectional, observational and questionnaire based study conducted in Dow University OF Health Sciences during the period of January 2012 to November 2012. We attempted to interview all the participants who could be approached during the period of the study. Participants were MBBS students, while all students of other courses and programs were taken as exclusion criteria. Approximately 1050 questionnaires were distributed to participants. Fifty questionnaires were rejected due to incomplete answers, yielding 1000 usable responses for an approximate 95% response rate. Informed verbal consent was taken from each participant. Study was ethically approved by Institutional Review Board of Dow University of Health Sciences. All the data was entered and analyzed through SPSS 19. Out of total 1000 participants, males were 400 (40%) and females were 600 (60%). Participants were in the age group of 18-25 years with a mean age of 20.08 years. Most of the participants were using Facebook daily (N = 640, 64%) for around 3-4 hours (N = 401, 40.1%). Majority of them (N = 359, 35.9%) believed that they were equally active on Facebook and in real life while few believed their social life became worse after start using Facebook (N = 372, 37.2%). Most of the participants admitted that they were considered as shy in real world (N = 390, 39.0%) while in the world of Facebook they were considered as fun loving by their friends (N = 603, 60.3%). A large number of participants (N = 715, 75%) complained of mood swings. Youngsters are willing to compromise their health, social life, studies for the sake of fun and entertainment or whatever satisfaction they get

  18. Effect of Facebook on the life of Medical University students (United States)


    Background Facebook is a social networking service launched in February 2004, owned and operated by Facebook, Inc. As of June 2012, Facebook reports more than 1 billion active users. Objective of study was to evaluate the effect of Facebook on the social life, health and behavior of medical students. Methodology It was a cross sectional, observational and questionnaire based study conducted in Dow University OF Health Sciences during the period of January 2012 to November 2012. We attempted to interview all the participants who could be approached during the period of the study. Participants were MBBS students, while all students of other courses and programs were taken as exclusion criteria. Approximately 1050 questionnaires were distributed to participants. Fifty questionnaires were rejected due to incomplete answers, yielding 1000 usable responses for an approximate 95% response rate. Informed verbal consent was taken from each participant. Study was ethically approved by Institutional Review Board of Dow University of Health Sciences. All the data was entered and analyzed through SPSS 19. Result Out of total 1000 participants, males were 400 (40%) and females were 600 (60%). Participants were in the age group of 18–25 years with a mean age of 20.08 years. Most of the participants were using Facebook daily (N = 640, 64%) for around 3–4 hours (N = 401, 40.1%). Majority of them (N = 359, 35.9%) believed that they were equally active on Facebook and in real life while few believed their social life became worse after start using Facebook (N = 372, 37.2%). Most of the participants admitted that they were considered as shy in real world (N = 390, 39.0%) while in the world of Facebook they were considered as fun loving by their friends (N = 603, 60.3%). A large number of participants (N = 715, 75%) complained of mood swings. Conclusion Youngsters are willing to compromise their health, social life, studies for the sake of fun and

  19. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad


    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  20. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.


    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  1. Relationship between Eating Disorders, Stress and Depression in Medical Students of Lorestan University of Medical Sciences & Health Services


    Afarin Ahmadian


    Background & Aim: Nowadays eating disorders are considered as one of the main psychological disorders. These types of disorder result in physical and mental health problems and affect the individuals’ quality of life. This study has aimed to survey eating disorders and its relation with depression and stress in medical students of Lorestan University of Medical Sciences. Methodology: In a descriptive study, 340 university students were chosen by the use of simple random sampling and als...

  2. Attitudes of undergraduate medical students of Addis Ababa University towards medical practice and migration, Ethiopia

    Directory of Open Access Journals (Sweden)

    Deressa Wakgari


    Full Text Available Abstract Background The health care system of Ethiopia is facing a serious shortage of health workforce. While a number of strategies have been developed to improve the training and retention of medical doctors in the country, understanding the perceptions and attitudes of medical students towards their training, future practice and intent to migrate can contribute in addressing the problem. This study was carried out to assess the attitudes of Ethiopian medical students towards their training and future practice of medicine, and to identify factors associated with the intent to practice in rural or urban settings, or to migrate abroad. Methods A cross-sectional study was conducted in June 2009 among 600 medical students (Year I to Internship program of the Faculty of Medicine at Addis Ababa University in Ethiopia. A pre-tested self-administered structured questionnaire was used for data collection. Descriptive statistics were used for data summarization and presentation. Degree of association was measured by Chi Square test, with significance level set at p  Results Only 20% of the students felt ‘excellent’ about studying medicine; followed by ‘very good’ (19%, ‘good’ (30%, ‘fair’ (21% and ‘bad’ (11%. About 35% of respondents responded they felt the standard of medical education was below their expectation. Only 30% of the students said they would like to initially practice medicine in rural settings in Ethiopia. However, students with rural backgrounds were more likely than those with urban backgrounds to say they intended to practice medicine in rural areas (adjusted OR = 2.50, 95% CI = 1.18-5.26. Similarly, students in clinical training program preferred to practice medicine in rural areas compared to pre-clinical students (adjusted OR = 1.83, 95% CI = 1.12-2.99. About 53% of the students (57% males vs. 46% females, p = 0.017 indicated aspiration to emigrate following graduation, particularly to the

  3. Determining the Correlation Between Language Scores Obtained by Medical Students in their University Entrance and Comprehensive Medical Basic Sciences Exams

    Directory of Open Access Journals (Sweden)

    Majid Ahmadi


    Full Text Available Background and Purpose: Some professors and educators in the field of English language believe that the high grades attained by medical students in their Comprehensive Medical Basic Sciences Exam (CMBSE are mainly a result of the students prior fluency in the language before entering medical colleges; they are of the opinion that these grades are not necessarily a result of the combined effort of the English teachers and students in language courses at the university. This research aimsat determining the correlation between the level of fluency in English of medical students prior to university entrance and the grades obtained by them in their CMBSE after 3 terms of language courses at the university.Methods: Seven of the major and smaller universities of medical sciences were selected. The language scores of 2426 students admitted to these universities during the three academic years of 1999 to 2002 in both the National University Entrance Examination (NUEE and the Comprehensive Medical Basic Sciences Exam (CMBSE were obtained from their related universities and from the secretariat of the Council of Medical Basic Sciences Education respectively. The language scores of each studentobtained in both NUEE and CMBSE were then matched. The related SPSS software was used to assess the level of correlation between these two groups of language scores for the students of each university, for each academic year and semester and also the overall score for the three years.Results: Overall a positive and moderately significant correlation was found between the NUEE language scores and those of the CMBSE of the students of the universities studied (P<0/001; R=443%. The level of correlation for the various universities studied differed (Max. 69%, min.27%.A comparison of the means of these two groups of scores also confirmed this correlation.Conclusion: students’ grades The NUEE language score was not the only factor affecting the student’s CMBSE score

  4. Awareness and Knowledge of Oral Cancer among Medical Students in Kathmandu University School of Medical Sciences. (United States)

    Pokharel, M; Shrestha, I; Dhakal, A; Amatya, R Cm

    Background Oral cancer is a major public health problem worldwide. It has high mortality rates and chances of survival is relatively superior when detected early. Lack of knowledge and awareness about oral cancer among medical students may contribute to delay in diagnosis and treatment. Objective To assess awareness and knowledge of oral cancer among medical students. Method A cross-sectional study conducted among 286 students by Department of Otorhinolaryngology and Head & Neck surgery, Kathmandu University School of Medical sciences between July to August 2016. A questionnaire with questions on socio-demographic profile, awareness and knowledge of oral cancer was used. Independent sample t test and Pearson Chi-square tests were used for statistical analysis. Result Out of 329 students approached, 286 participated in the study yielding a response rate of 86.9%. Symptoms of oral cancer as reported were ulceration in mouth (92.3%), oral bleeding (85.0%),whitish or reddish patch (84.3%), halitosis (75.5%) and swelling in neck (74.5%), trismus (69.2%), numbness (67.1%), loosening of teeth (49.3%) and tooth sensitivity (41.6%). The perceived risk factors were smoking (97.2%), tobacco chewing (96.5%), chronic irritation (86.7%), immunodeficiency (83.9%), poor oral hygiene (88.5%), human papilloma virus infection (82.5%), dietary factors (81.1%), alcohol (79.4%), ill-fitting dentures (72.4%), hot spicy food (65.4%) and hot beverages (58.0%). Significant differences were found between pre-clinical and clinical students for knowledge of risk factors, signs and symptoms of oral cancer (pcancer. Active involvement while examining patients and taking biopsies of malignant and premalignant lesions may help in improving students' knowledge about oral cancer.

  5. Scientific Production of Medical Universities in the West of Iran: a Scientometric Analysis. (United States)

    Rasolabadi, Masoud; Khaledi, Shahnaz; Khayati, Fariba; Kalhor, Marya Maryam; Penjvini, Susan; Gharib, Alireza


    This study aimed to compare scientific production by providing quantitative evaluation of science output in five Western Iranian Medical Universities including Hamedan, Ilam, Kermanshah, Kurdistan and Lorestan University of Medical Sciences using scientometrics indicators based on data indexed in Scopus for period between the years 2010 to 2014. In this scientometric study data were collected using Scopus database. Both searching and analyzing features of Scopus were used to data retrieval and analysis. We used Scientometrics indicators including number of publications, number of citations, nationalization index (NI), Internationalization Index (INI), H-index, average number of citations per paper, and growth index. Five Western Iranian Universities produced over 3011 articles from 2010 to 2014. These articles were cited 7158 times with an average rate of 4.2 citations per article. H- Index of under study universities are varying from 14 to 30. Ilam University of Medical Sciences had the highest international collaboration with an INI of 0.33 compared to Hamedan and Kermanshah universities with INI of 0.20 and 0.16 respectively. The lowest international collaboration belonged to Lorestan University of Medical Sciences (0.07). The highest Growth Index belonged to Kurdistan University of Medical Sciences (69.7). Although scientific production of five Western Iranian Medical Universities was increasing, but this trend was not stable. To achieve better performance it is recommended that five Western Iranian Universities stabilize their budgeting and investment policies in research.


    Directory of Open Access Journals (Sweden)

    Andrii V. Semenets


    Full Text Available The Information Technologies role in the medical university management is analyzed. The importance of the application of the electronic document management in the medical universities is shown. The implementation capabilities of the electronic document management system within a cloud services are shown. A Podio collaboration and project management cloud service features overview is presented. The methodology of the Podio capabilities usage to the medical university task management solving is developed. An approaches to the Podio Workspaces and Applications development for the faculties collaboration and project management in the departments of the medical universities are presented. The examples of the Podio features usage to the work-flow automation of the information-analytical and hardware and software support departments of the Ternopil State Medical University named after I. Ja. Horbachevsky are shown.

  7. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences


    Yazdi, Zohreh; Loukzadeh, Ziba; Moghaddam, Parichehr; Jalilolghadr, Shabnam


    Introduction: Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. Methods: In this descriptive-correlational study, a total of 285 ...

  8. Requirements of British universities for higher medical degrees.


    Johnson, R


    OBJECTIVE--To examine the requirements and opportunities for obtaining a doctor of medicine or master of surgery degree from a university in the United Kingdom other than the graduate's own, particularly in the case of foreign graduates. DESIGN--Review of regulations governing the award of doctor of medicine and master of surgery degrees in British universities. SETTING--All 19 universities in the United Kingdom offering clinical courses. MAIN OUTCOME MEASURE--Availability of degrees to gradu...

  9. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif


    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  10. Suicidal ideation in Pakistani college students. (United States)

    Khokher, Sehar; Khan, Murad M


    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  11. Analysis of the Status Quo of Humanistic Quality-Oriented Education in Medical Colleges and Universities (United States)

    Liu, Shulei; Li, Yamin


    With transformation of contemporary modern medical educational modes and improvement of requirement upon doctors' humanistic quality, it seems quite important to strengthen humanistic quality-oriented education in medical colleges and universities. Medical humanistic quality-oriented education in China started late, which determines that there are…

  12. Daytime Sleepiness among Medical Students in University of Benin ...

    African Journals Online (AJOL)

    ... of daytime sleepiness could be associated with underlying medical/ psychological disorders. There is a need for future studies to address these correlates of day time sleepiness. It is recommended that strategies to enlighten students on sleep hygiene should be pursued. Keywords: Day time sleepiness, medical students, ...

  13. Medical waste management at the University of Port Harcourt ...

    African Journals Online (AJOL)

    Background: The generation and handling of wastes from medically related procedures poses a potential health hazard to health workers and non health workers alike, and this has far reaching consequences for the public in areas where such wastes are disposed of carelessly. Aim: To investigate the medical waste ...

  14. Attitude of final year medical students of a Nigerian university ...

    African Journals Online (AJOL)

    Doctors' attitude towards homosexuality may determine their responses and care for patients whose sexual orientation is homosexuality. Despite this, there is near absence of data on the attitude of medical students to homosexuals in Nigeria. Thus, this study investigated the attitude of final year medical students to ...

  15. Medical Interns’ and Clerkship Students’ Viewpoints on Nutrition Course in Birjand University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Reza Ghaderi


    Full Text Available  Background and purpose: Nutrition plays a key role in maintaining and promoting health and preventing diseases. In most medical schools, Nutrition education is not sufficient and only 26% of college students have proper nutritional education programs. Physicians should use their knowledge through education and counseling with patients and healthy people to increase people’s level of health. Poor eating habits are considered as a factor of chronic disease. Therefore, the aim of this study was to determine medical interns and clerkship students’ viewpoint about nutrition course at a specific medical school.Methods: This study was descriptive and 87 interns and clerkship students of Birjand University of Medical Sciences participated. The data were collected using a valid and reliable questionnaire based on the existing topics in nutrition, the time allocated, their educational needs as well as the issues that physicians have the greatest exposure to. After completing the questionnaire, all of the data were collected, coded, and analyzed using SPSS software, version 15. The chi-square test was used to compare the views of interns and medical students.Results: Of the participants, 72.4% were female, 27.6% were male, 57.5% were medical students, and 42.5% were interns. According to these students, 51.7% considered one nutrition course in the second semester to be appropriate, and that the topic of improved nutrition in vulnerable groups was more effective during the clinical stage (63.2%. In addition, the need to learn about nutrition in vulnerable groups, foods and nutritious, diseases caused by malnutrition, and food health (66.7%, 57.5%, 54%, and 52.9%, respectively was considered to be more important. Moreover, 55.2% of the participants considered nutrition in vulnerable groups to be highly relevant, while 51.7% believed that malnutrition-related diseases was more relevant. Most of the students considered the topics of foods and nutrients

  16. Vision Survey of the Nnamdi Azikiwe University Medical Students

    African Journals Online (AJOL)

    Keywords: Eye disorders, medical students, Nigeria ... Refractive error was defined as >0.5 diopters (D) in the student's better eye. ... students with positive family history (risk ratio - 3.88). .... ocular symptoms associated with ametropia and.

  17. Knowledge of Medical Students of Tehran University of Medical Sciences Regarding Plagiarism

    Directory of Open Access Journals (Sweden)

    Mohammad Hadi Gharedaghi


    Full Text Available The core concept of plagiarism is defined as the use of other people’s ideas or words without proper acknowledgement. Herein, we used a questionnaire to assess the knowledge of students of Tehran University of Medical Sciences (TUMS regarding plagiarism and copyright infringement. The questionnaire comprised 8 questions. The first six questions of the questionnaire were translations of exercises of a book about academic writing and were concerning plagiarism in preparing articles. Questions number 7 and 8 (which were concerning plagiarism in preparing Microsoft PowerPoint slideshows and copyright infringement, respectively were developed by the authors of the present study. The validity of the questionnaire was approved by five experts in the field of epidemiology and biostatistics. A pilot study consisting of a test and retest was carried to assess the reliability of the questionnaire. The sampling method was stratified random sampling, and the questionnaire was handed out to 74 interns of TUMS during July and August 2011. 14.9% of the students correctly answered the first six questions. 44.6% of the students were adequately familiar with proper referencing in Microsoft PowerPoint slideshows. 16.2% of the students understood what constitutes copyright infringement. The number of correctly answered questions by the students was directly proportionate to the number of their published articles. Knowledge of students of TUMS regarding plagiarism and copyright infringement is quite poor. Courses with specific focus on plagiarism and copyright infringement might help in this regard.

  18. Knowledge of medical students of Tehran University of Medical Sciences regarding plagiarism.

    Directory of Open Access Journals (Sweden)

    Mohammad Hadi Gharedaghi


    Full Text Available The core concept of plagiarism is defined as the use of other people's ideas or words without proper acknowledgement. Herein, we used a questionnaire to assess the knowledge of students of Tehran University of Medical Sciences (TUMS regarding plagiarism and copyright infringement. The questionnaire comprised 8 questions. The first six questions of the questionnaire were translations of exercises of a book about academic writing and were concerning plagiarism in preparing articles. Questions number 7 and 8 (which were concerning plagiarism in preparing Microsoft PowerPoint slideshows and copyright infringement, respectively were developed by the authors of the present study. The validity of the questionnaire was approved by five experts in the field of epidemiology and biostatistics. A pilot study consisting of a test and retest was carried to assess the reliability of the questionnaire. The sampling method was stratified random sampling, and the questionnaire was handed out to 74 interns of TUMS during July and August 2011. 14.9% of the students correctly answered the first six questions. 44.6% of the students were adequately familiar with proper referencing in Microsoft PowerPoint slideshows. 16.2% of the students understood what constitutes copyright infringement. The number of correctly answered questions by the students was directly proportionate to the number of their published articles. Knowledge of students of TUMS regarding plagiarism and copyright infringement is quite poor. Courses with specific focus on plagiarism and copyright infringement might help in this regard.

  19. Knowledge of medical students of Tehran University of Medical Sciences regarding plagiarism. (United States)

    Gharedaghi, Mohammad Hadi; Nourijelyani, Keramat; Salehi Sadaghiani, Mohammad; Yousefzadeh-Fard, Yashar; Gharedaghi, Azadeh; Javadian, Pouya; Morteza, Afsaneh; Andrabi, Yasir; Nedjat, Saharnaz


    The core concept of plagiarism is defined as the use of other people's ideas or words without proper acknowledgement. Herein, we used a questionnaire to assess the knowledge of students of Tehran University of Medical Sciences (TUMS) regarding plagiarism and copyright infringement. The questionnaire comprised 8 questions. The first six questions of the questionnaire were translations of exercises of a book about academic writing and were concerning plagiarism in preparing articles. Questions number 7 and 8 (which were concerning plagiarism in preparing Microsoft PowerPoint slideshows and copyright infringement, respectively) were developed by the authors of the present study. The validity of the questionnaire was approved by five experts in the field of epidemiology and biostatistics. A pilot study consisting of a test and retest was carried to assess the reliability of the questionnaire. The sampling method was stratified random sampling, and the questionnaire was handed out to 74 interns of TUMS during July and August 2011. 14.9% of the students correctly answered the first six questions. 44.6% of the students were adequately familiar with proper referencing in Microsoft PowerPoint slideshows. 16.2% of the students understood what constitutes copyright infringement. The number of correctly answered questions by the students was directly proportionate to the number of their published articles. Knowledge of students of TUMS regarding plagiarism and copyright infringement is quite poor. Courses with specific focus on plagiarism and copyright infringement might help in this regard.

  20. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)


    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...


    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García


    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  2. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo


    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  3. Utilization of smart phones related medical applications among medical students at King Abdulaziz University, Jeddah: A cross-sectional study. (United States)

    Sayedalamin, Zaid; Alshuaibi, Abdulaziz; Almutairi, Osama; Baghaffar, Mariam; Jameel, Tahir; Baig, Mukhtiar

    The present study explored the utility, attitude, and trends regarding Smartphone related Medical Applications (Apps) among medical students of King Abdulaziz University (KAU) Jeddah, Saudi Arabia (SA) and their perceptions of the impact of Medical Apps in their training activities. This survey was conducted at the Faculty of Medicine, Jeddah, and Rabigh campuses, KAU, Jeddah, SA. All participants were medical students of 2nd to 6th year. The data was collected by using an anonymous questionnaire regarding the perception of medical students about Medical Apps on the smart devices and the purpose of installation of the Apps. Additionally examined was the use of different Medical Apps by the students to investigate the impact of Medical Apps on the clinical training/practice. Data was analyzed on SPSS 21. The opinion of 330/460 medical students from all academic years was included in the study with a response rate of 72%. There were 170 (51.5%) males and 160 (48.5%) females with a mean age of 21.26±1.86 years. Almost all participating students 320 (97%) were well aware of Medical Apps for smart devices and 89.1% had installed different applications on their smart devices. The main usage was for either revision of courses (62.4%) or for looking up of medical information (67.3%), followed by preparing for a presentation (34.5%) and getting the medical news (32.1%). Regarding the impact of Medical Apps, most of the students considered these helpful in clinical decision-making, assisting in differential diagnosis, allowing faster access to Evidence-Based Medical practice, saving time and others. The practical use of these Apps was found to be minimal in medical students. Around 73% were occasional users of Medical Apps, and only 27% were using Medical Apps at least once a day. The regular use of Medical Apps on mobile devices is not common among medical students of KAU. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd

  4. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq


    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  5. Acceptability of GM foods among Pakistani consumers (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad


    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  6. Acceptability of GM foods among Pakistani consumers. (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad


    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  7. Integration of Educational and Research Activities of Medical Students (Experience of the Medical Faculty of Saint Petersburg State University). (United States)

    Balakhonov, Aleksei V; Churilov, Leonid P; Erman, Mikhail V; Shishkin, Aleksandr N; Slepykh, Lyudmila A; Stroev, Yuri I; Utekhin, Vladimir J; Basantsova, Natalia Y


    The article is devoted to the role of research activity of the medical students in higher education of physicians. The teaching of physicians in classical universities and specialized medical schools is compared. The history of physicians' training in Russia in imperial, Soviet and post-Soviet periods is reviewed and compared to development of higher medical education in other countries. Article gives the the description of all failed attempts to establish a Medical Faculty within oldest classical university of Russia, crowned by history of last and successful attempt of its establishment. Authors' experience of adjoining education and research in curriculum and extra-curricular life of this Medical Faculty is discussed. The problems of specialization and fundamentalization of medical education are subjected to analysis. Clinical reasoning and reasoning of scholar-experimentalist are compared. The article reviews the role of term and course papers and significance of self-studies and graduation thesis in education of a physician. The paper gives original definition of interactive learning, and discusses the methods and pathways of intermingling the fundamental science and clinical medicine in medical teaching for achievement of admixed competencies of medical doctor and biomedical researcher.

  8. Drug Use Pattern Among Medical Students in a Nigerian University

    African Journals Online (AJOL)

    Item 21 - 31 ... Studies have reported that for medical students to cope with ... might be on the rise and may be related to the level of stress among them. ... management strategies in their curriculum. ... studies in Nigeria had evaluated the relationship between drug ..... teachers' knowledge and views about drug abuse in Ogun.

  9. Homophobia in Medical Students of the University of Hong Kong (United States)

    Kan, R. W. M.; Au, K. P.; Chan, W. K.; Cheung, L. W. M.; Lam, C. Y. Y.; Liu, H. H. W.; Ng, L. Y.; Wong, M. Y.; Wong, W. C.


    Homosexuality is now accepted as a normal variant of human sexuality, but homophobia among healthcare professionals is well documented. Establishment of trustful doctor-patient relationships is impossible in the presence of homophobia. We were interested to examine the extent of homophobia among medical students, the future doctors. This article…

  10. Managing Medical Education at the University of Pennsylvania. (United States)

    Burg, Fredric D.; And Others


    The approach used by the University of Pennsylvania School of Medicine for developing management systems that promote change and encourage innovation is described. The major elements of this scheme are: centralization of administrative functions, communication networks, consensus among constituencies, teaching performance in promotion process, and…

  11. One year audit of surgical admissions at Gondar university medical ...

    African Journals Online (AJOL)

    Background: The new University of Gondar enrolled surgeons for post graduate training in November 2003. A new surgical curriculum was designed in partnership with the Leicester Gondar Link. Admissions to the Department of Surgery over twelve months were subject to audit. The objectives of the audit study were to ...

  12. Medical faculty members' attitude on lesson planning Semnan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Masomeh Saberian


    Full Text Available Background: Lesson planning has a distinct role in enhancing education quality, as well as maintaining the friendly and dynamic atmosphere of the academic environment and increasing student's initiatives for achieving better educational attainments. Lesson planning is a process for defining the goals, understanding the needs, and specifying available tools and possible limitations. Lesson planning is a written description of this process, which shows the materials, the route, the time, and the place of instructions, as well as a method for evaluating students. Purpose: to identify the attitudes of Semnan University of Medical Sciences (SUMS on lesson planning. Methods: Fifty-three faculty members of the SUMS participated in this study. A questionnaire was used, which contained 8 demographic questions, and 24 r questions for identification the faculty members' attitude. Questionnaires were distributed among the faculty members in sealed envelopes, without denoting their names. The questionnaires were gathered after being completed. Results were analyzed by calculating the mean, standard deviation, absolute and relative frequencies, and using Chi-square and Fischer exact test at the level of 5%. Results: II was shown that 88% of faculty members favoured lesson planning before the beginning of the semester. But they found lesson planning a difficult task, because of their heavy workload. Of the faculty members, 60.4% organized their teaching classes according to a designed lesson plan, and believed that it did affect the quality of their teaching, but 49.1% disagreed with distributing the designed lesson plan among the students. Discussion: Although professor favoured lesson planning and find it necessary to work according to such a plan, workload and lack of knowledge are defined as two main obstacles in doing so. It is believed that by decreasing the professor's workload and provision of lesson planning workshops, these problems could be solved

  13. Master's Level Graduate Training in Medical Physics at the University of Colorado Health Sciences Center. (United States)

    Ibbott, Geoffrey S.; Hendee, William R.


    Describes the master's degree program in medical physics developed at the University of Colorado Health Sciences Center. Required courses for the program, and requirements for admission are included in the appendices. (HM)

  14. Type 2 diabetes in 'the young' | Iro | Abia State University Medical ...

    African Journals Online (AJOL)

    Abia State University Medical Students' Association Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 2, No 1 (2000) >. Log in or Register to get access to full text downloads.

  15. [Department of Otorhinolaryngology of the I.P. Pavlov Saint-Peterburg First State Medical University]. (United States)

    Karpishchenko, S A

    This article is designed to report the results of the analysis ofacademic, scientific, and clinical activities of the Department of Otorhinolaryngology of the I.P. Pavlov Saint-Peterburg First State Medical University.

  16. Mistreatment of university students most common during medical studies

    Directory of Open Access Journals (Sweden)

    Nuutinen Matti


    Full Text Available Abstract Background This study concerns the occurrence of various forms of mistreatment by staff and fellow students experienced by students in the Faculty of Medicine and the other four faculties of the University of Oulu, Finland. Methods A questionnaire with 51 questions on various forms of physical and psychological mistreatment was distributed to 665 students (451 females after lectures or examinations and filled in and returned. The results were analysed by gender and faculty. The differences between the males and females were assessed statistically using a test for the equality of two proportions. An exact two-sided P value was calculated using a mid-P approach to Fisher's exact test (the null hypothesis being that there is no difference between the two proportions. Results About half of the students answering the questionnaire had experienced some form of mistreatment by staff during their university studies, most commonly humiliation and contempt (40%, negative or disparaging remarks (34%, yelling and shouting (23%, sexual harassment and other forms of gender-based mistreatment (17% and tasks assigned as punishment (13%. The students in the Faculty of Medicine reported every form of mistreatment more commonly than those in the Faculties of Humanities, Education, Science and Technology. Experiences of mistreatment varied, but clear messages regarding its patterns were to be found in each faculty. Female students reported more instances of mistreatment than males and were more disturbed by them. Professors, lecturers and other staff in particular mistreated female students more than they mistreated males. About half of the respondents reported some form of mistreatment by their fellow students. Conclusion Students in the Faculty of Medicine reported the greatest amount of mistreatment. If a faculty mistreats its students, its success in the main tasks of universities, research, teaching and learning, will be threatened. The results

  17. Factor Analysis of Teacher Professional Development in Chinese Military Medical Universities (United States)

    Yue, Juan-Juan; Chen, Gang; Wang, Zhen-Wei; Liu, Wei-Dong


    Background and purpose: Teacher professional development potentially enhances teachers' professional morale, knowledge, skills and autonomy, which helps improve the quality of education. The military medical university is an important medical education institution in China; however, studies of teacher professional development within military…

  18. Attitudes toward Psychiatry: A Survey of Medical Students at the University of Nairobi, Kenya (United States)

    Ndetei, David M.; Khasakhala, Lincoln; Ongecha-Owuor, Francisca; Kuria, Mary; Mutiso, Victoria; Syanda, Judy; Kokonya, Donald


    Objectives: The authors aim to determine the attitudes of University of Nairobi, Kenya, medical students toward psychiatry. Methods: The study design was cross-sectional. Self-administered sociodemographic and the Attitudes Toward Psychiatry-30 items (ATP-30) questionnaires were distributed sequentially to every third medical student in his or her…

  19. Sleep pattern of medical students as seen in a Nigerian university ...

    African Journals Online (AJOL)

    Sleep pattern of medical students as seen in a Nigerian university. ... we used a modified self-administered questionnaire adapted from Pittsburg Sleep Quality Index to determine the sleep pattern of students in College of Health Sciences, University of Ilorin, Nigeria. ... Gender had significant influence on their sleep habit.

  20. Medical Universities Educational and Research Online Services: Benchmarking Universities’ Website Towards E-Government (United States)

    Farzandipour, Mehrdad; Meidani, Zahra


    Background: Websites as one of the initial steps towards an e-government adoption do facilitate delivery of online and customer-oriented services. In this study we intended to investigate the role of the websites of medical universities in providing educational and research services following the E-government maturity model in the Iranian universities. Methods: This descriptive and cross- sectional study was conducted through content analysis and benchmarking the websites in 2012. The research population included the entire medical university website (37). Delivery of educational and research services through these university websites including information, interaction, transaction, and Integration were investigated using a checklist. The data were then analyzed by means of descriptive statistics and using SPSS software. Results: Level of educational and research services by websites of the medical universities type I and II was evaluated medium as 1.99 and 1.89, respectively. All the universities gained a mean score of 1 out of 3 in terms of integration of educational and research services. Conclusions: Results of the study indicated that Iranian universities have passed information and interaction stages, but they have not made much progress in transaction and integration stages. Failure to adapt to e-government in Iranian medical universities in which limiting factors such as users’ e-literacy, access to the internet and ICT infrastructure are not so crucial as in other organizations, suggest that e-government realization goes beyond technical challenges. PMID:25132713

  1. Effects of the Islamic Revolution in Iran on Medical Education: The Shiraz University School of Medicine. (United States)

    Ronaghy, Hossain A.; And Others


    Of 173 full-time faculty employed in 1978 at Shiraz University School of Medicine, 108 had left the university by December 1982, and 81 of these had left the country, aggravating the chronic shortage of medical personnel in Iran. Iranian authorities have not been able to counteract these trends. (GC)

  2. Medical clerks in a national university hospital: improving the quality of medical care with a focus on spinal surgery. (United States)

    Kobayashi, Kazuyoshi; Ando, Kei; Noda, Makiko; Ishiguro, Naoki; Imagama, Shiro


    In our institution, which is a national university hospital, medical clerks were introduced in 2009 to improve the doctor's working environment. Seventeen clerks were assigned to 9 separate departments and the work content differed greatly among departments, but sufficient professional work was not done efficiently. The purpose of this study is to investigate the effects of the work of medical clerks on improvement of medical quality in recent years. In 2011, we established a central clerk desk on our outpatient floor to improve efficiency and centralize the clerk work. Since 2013, periodic education of clerks on spine disease has been provided by spine doctors, and this has facilitated sharing of information on spinal surgery from diagnosis to surgical treatment. This has allowed medical clerks to ask patients questions, leading to more efficient medical treatment and a potential reduction of doctors' work. In 2016, a revision of the insurance system by the Ministry of Health, Labour and Welfare of Japan increased the amount of medical work that clerks can perform, and it became possible to increase the number of medical clerks. Currently, we have 30 medical clerks, and this has allowed establishment of new clerk desks in other departments to handle patients. A training curriculum will be developed to reduce the burden on doctors further and to improve the quality of medical treatment.



    Salleha Khalid; Tengku Madeehah Tengku Mohd; Khadijah Hassanah; Suhaila Sanip; Muhammad Shamsir Aris; Khaironi Sharif; Mohd Mokthar


    Recent advances in information technology has made e-learning feasible in many fields of education. Medical education is not any different. This survey is conducted among all the medical educators in Universiti Sains Islam Malaysia (USIM) assessing their readiness and attitudes towards e-learning. A cross-sectional questionnaires assessing the IT skills, Internet usage, attitude, perceived benefits and usage of e-learning among USIM medical lecturers were used. Data gained were then analyzed....

  4. Factors Affecting the Use of Indigenous Publications by Medical and Dental Students in Nigerian Universities


    Ahiaoma Ibegwam; Oshiotse Andrew Okwilagwe


    This study examined the indigenous medical publications used by medical and dental students in Nigeria with a view to discovering factors that affects their usage. Data was gathered through a questionnaire survey. The population of the study was 1,264 undergraduate medical and dental students from ten universities in all the geopolitical zones of Nigeria. Data gathered was analysed using SPSS to obtain the summaries of the variables in form of frequency distribution and other descriptive stat...

  5. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin


    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  6. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-


    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  7. To determine the level of satisfaction among medical students of a public sector medical university regarding their academic activities

    Directory of Open Access Journals (Sweden)

    Manzar Bushra


    Full Text Available Abstract Background An ongoing evaluation system is essential to determine if the academic system in place has worked to produce a better product, hence the objective of our study was to evaluate the satisfaction level among medical students regarding their academic teaching and assessment method and what measures will they suggest for the future to rectify the current situation. This questionnaire based cross sectional study was conducted in a public sector medical university from February to July 2010. A well structured questionnaire was administered to a random sample of 375 final year medical students. However 292 of the students provided informed consent and filled in the questionnaire which included their demographic profile as well as questions in line with the study objective. Data was entered in a Statistical Package for Social Sciences (SPSS version.16 and analyzed using descriptive statistics. Findings The male to female ratio in our study was 1:2. Most of the students (57.2% were dissatisfied with the quality of teaching in the university. Fifty-seven percent of the participants believed that the current standard of their institute were not at par with those of international medical universities. BCQ's were the mode of examination questions preferred by the majority of the students. Most of the students (66.1% wanted the university to conduct career planning seminars to help them plan their career. Conclusions These results suggest that the students of public sector medical universities are unsatisfied from current academic facilities and teaching activities. Students recommend increased emphasis on better lectures and practical training as well as a need to incorporate career planning sessions for the students to help plan them their future career paths.

  8. Antibiotic Self-Medication among Non-Medical University Students in Punjab, Pakistan: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Ali Hassan Gillani


    Full Text Available Background: Antibiotic resistance is a global threat. Scarce knowledge about safe and appropriate antibiotic use is coupled with frequent self-administration, e.g., in China. This repeated self-medication poses potential risk in terms of antibiotic resistance. Low-resource countries are facing an elevated burden of antibiotic self-medication as compared to developed ones. Thus, this study focused on evaluating the pervasiveness of antibiotic self-medication in 3 universities of Southern Punjab, Pakistan. Methods: We conducted a descriptive cross-sectional survey in three government sector universities of Southern Punjab, Pakistan. The study was carried out with self-administered paper-based questionnaires. Data was analyzed using SPSS version 18.0 (IBM, Chicago, IL, USA. Results: Seven hundred twenty-seven students out of 750 (response rate 97% with a mean age ± SD of 23.0 ± 3.4 years agreed to participate in the study. The proportion of females was slightly greater (52% compared with males (48%, and almost one-third of the respondents (36% were in their 2nd year of university. Out of the total, 58.3% practiced self-medication in the preceding six months, and 326 (45% confirmed the use of antibiotics. Metronidazole was the most frequently self-medicated antibiotic (48%. Out of the total, 72% demonstrated awareness regarding the side effects of antibiotics. Diarrhea was the well-known adverse effect (38%. Forty-three percent affirmed having antibiotic resistance knowledge, and 30% knew that the irregular use of antibiotics would lead to increased antibiotic resistance. Conclusion: Despite having ample awareness of the adverse antibiotic reactions, self-medication among the university students was high and antibiotic resistance was a fairly unknown term.

  9. Antibiotic Self-Medication among Non-Medical University Students in Punjab, Pakistan: A Cross-Sectional Survey. (United States)

    Gillani, Ali Hassan; Ji, Wenjing; Hussain, Waqar; Imran, Ali; Chang, Jie; Yang, Caijun; Fang, Yu


    Background : Antibiotic resistance is a global threat. Scarce knowledge about safe and appropriate antibiotic use is coupled with frequent self-administration, e.g., in China. This repeated self-medication poses potential risk in terms of antibiotic resistance. Low-resource countries are facing an elevated burden of antibiotic self-medication as compared to developed ones. Thus, this study focused on evaluating the pervasiveness of antibiotic self-medication in 3 universities of Southern Punjab, Pakistan. Methods : We conducted a descriptive cross-sectional survey in three government sector universities of Southern Punjab, Pakistan. The study was carried out with self-administered paper-based questionnaires. Data was analyzed using SPSS version 18.0 (IBM, Chicago, IL, USA). Results : Seven hundred twenty-seven students out of 750 (response rate 97%) with a mean age ± SD of 23.0 ± 3.4 years agreed to participate in the study. The proportion of females was slightly greater (52%) compared with males (48%), and almost one-third of the respondents (36%) were in their 2nd year of university. Out of the total, 58.3% practiced self-medication in the preceding six months, and 326 (45%) confirmed the use of antibiotics. Metronidazole was the most frequently self-medicated antibiotic (48%). Out of the total, 72% demonstrated awareness regarding the side effects of antibiotics. Diarrhea was the well-known adverse effect (38%). Forty-three percent affirmed having antibiotic resistance knowledge, and 30% knew that the irregular use of antibiotics would lead to increased antibiotic resistance. Conclusion : Despite having ample awareness of the adverse antibiotic reactions, self-medication among the university students was high and antibiotic resistance was a fairly unknown term.

  10. Die Ärztliche Zentralbibliothek des Universitätsklinikums Hamburg-Eppendorf / The Medical Library of the University Medical Center Hamburg-Eppendorf

    Directory of Open Access Journals (Sweden)

    Kintzel, Melanie


    Full Text Available This article introduces the Medical Library of the University Medical Center Hamburg-Eppendorf. Firstly, history, role and status of the library within the University Medical Center are illustrated, followed by a description of the library’s facilities and services. Finally, recent projects are presented as well as a selection of key figures.

  11. Nutrition in medical education: reflections from an initiative at the University of Cambridge

    Directory of Open Access Journals (Sweden)

    Ball L


    Full Text Available Lauren Ball,1 Jennifer Crowley,2 Celia Laur,3 Minha Rajput-Ray,3 Stephen Gillam,4 Sumantra Ray3 1Nutrition and Dietetics, School of Allied Health Sciences, Centre for Health Practice Innovation, Griffith University, Queensland, Brisbane, Australia; 2Faculty of Medical and Health Sciences, University of Auckland, Auckland, New Zealand; 3Need for Nutrition Education/Innovation Programme, Medical Research Council Human Nutrition Research, Cambridge, UK; 4Department of Public Health and Primary Care, Institute of Public Health, University of Cambridge, Cambridge, UK Abstract: Landmark reports have confirmed that it is within the core responsibilities of doctors to address nutrition in patient care. There are ongoing concerns that doctors receive insufficient nutrition education during medical training. This paper provides an overview of a medical nutrition education initiative at the University of Cambridge, School of Clinical Medicine, including 1 the approach to medical nutrition education, 2 evaluation of the medical nutrition education initiative, and 3 areas identified for future improvement. The initiative utilizes a vertical, spiral approach during the clinically focused years of the Cambridge undergraduate and graduate medical degrees. It is facilitated by the Nutrition Education Review Group, a group associated with the UK Need for Nutrition Education/Innovation Programme, and informed by the experiences of their previous nutrition education interventions. Three factors were identified as contributing to the success of the nutrition education initiative including the leadership and advocacy skills of the nutrition academic team, the variety of teaching modes, and the multidisciplinary approach to teaching. Opportunities for continuing improvement to the medical nutrition education initiative included a review of evaluation tools, inclusion of nutrition in assessment items, and further alignment of the Cambridge curriculum with the

  12. Foreign Experience in Mastering Medical Professional Terminology by Foreign Students at Medical Universities (United States)

    Homonyuk, Olena; Avramenko, Natalia


    Professional broadcasting of future medical foreign workers in the medical sector is a compulsory component of their professional readiness. The diversity of professional broadcasting functions of foreign students, the skillful use of the entire range of speech functionality, its external expressive attributability of speech; these are the most…

  13. Collaboration between the University of Michigan Taubman Health Sciences library and the University of Michigan Medical School Office of Research. (United States)

    Black, Christine; Harris, Bethany; Mahraj, Katy; Schnitzer, Anna Ercoli; Rosenzweig, Merle


    Librarians have traditionally facilitated research development resulting in grants through performing biomedical literature searches for researchers. The librarians at the Taubman Health Sciences Library of the University of Michigan have taken additional steps forward by instituting a proactive approach to assisting investigators. To accomplish this, the librarians have taken part in a collaborative effort with the University of Michigan Medical School Office of Research. Through this partnership, both units have created and adopted various techniques intended to facilitate the submission of grants, thus allowing researchers more time to conduct their primary activities.

  14. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.


    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  15. Characteristics of undergraduate medical thesis of a Peruvian public university

    Directory of Open Access Journals (Sweden)

    Betty Castro Maldonado


    Full Text Available Introduction: The undergraduate thesis rather than a requirement to graduate, are a way of doing research. Previous studies show a thesis published between 2.7% to 17.6% in indexed journals. Objective: Describe the characteristics of the undergraduate thesis of the Faculty of a medical school. Bibliometric study. 221 theses were reviewed, collecting: Year, number of authors, advisers, and references, study population, and national priorities for health research. A search was performed on Google Scholar to assess publication. Descriptive statistics were used. Results: Being lower production in the years 2008-2010 was observed. 91.6% had one advisor, 76% descriptive, 82.8% in hospital population, and 62.4% of adults. Theses displayed between 2010-2014 72.9% did not correspond to any national health research priority. Only 6.8% was based on literature of the last five years. Only 9 (4.1% were published in a scientific journal indexed. Conclusions: The undergraduate thesis were characterized as descriptive, hospital, adults, literature based on outdated and not in line with the national priorities for health research. The publication is low.

  16. [Medical surveillance in university: organizational difficulties, legal problems, scientific e technical specificities. Experience of University of Milan Bicocca]. (United States)

    D'Orso, M I; Giuliani, C; Assini, R; Riva, M A; Cesana, G


    Our research describes activities of Occupational Health carried out during last year in University of Milan Bicocca by Occupational Doctors. We describe results of medical surveillance in 1153 employees or students exposed to occupational risks for health and safety. We report results obtained, technical difficulties, organizational problems, and preventive actions decided to improve functionality of our activity. Students seem to be less protected and consequently seem to have higher professional safety and health risks.

  17. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif


    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  18. Jewish Medical Students and Graduates at the Universities of Padua and Leiden: 1617–1740

    Directory of Open Access Journals (Sweden)

    Kenneth Collins


    Full Text Available The first Jewish medical graduates at the University of Padua qualified in the fifteenth century. Indeed, Padua was the only medical school in Europe for most of the medieval period where Jewish students could study freely. Though Jewish students came to Padua from many parts of Europe the main geographical sources of its Jewish students were the Venetian lands. However, the virtual Padua monopoly on Jewish medical education came to an end during the seventeenth century as the reputation of the Dutch medical school in Leiden grew. For aspiring medieval Jewish physicians Padua was, for around three hundred years, the first, simplest, and usually the only choice.

  19. Viewpoints of students of Shahid Sadoughi University of Medical

    Directory of Open Access Journals (Sweden)

    Sh Mojahed


    Full Text Available Introduction: Academic advisors have been proven important in students’ success. Insufficient guidance and counseling can delay professional and educational achievements. Proper counseling can provide opportunities for educational success and also positive change students’ behavioral models. This study was accomplished with the purpose of assigning the function of advisors from the viewpoint of the students. Methods: This descriptive study was done on 385 students of Shahid Sadoughi University. Randomized stratified sampling was used. The data were collected by completing the self-reported questionnaire and then were analyzed by SPSS software. Advisors’ functions in each of the items were evaluated. The significance level of 0.05 was considered. Results: The majority of samples were from Nursing, Midwifery, and Public Health School and a few from Faculty of Medicine. The majority of students (41.8% agreed to have the same advisor from the first term to the last. Also the results showed that the functions of advisors were poor in the areas of constant supervision and monitoring of students’ educational status (35.8%, preparing the timetable for performing the personal or group counseling (41.8% and providing counseling sessions according to the timetable (42.3%. But their functions were fair in the areas of acceptable guidance of students in the educational problems (35.1%, and the advisor’s familiarity to educational regulations (43.9%. It is necessary to note that the advisor's ability in making the intimate relationship with students (37.1%, and the advisors’ motivation and tendency to guidance and counseling (30.1% were the two items evaluated excellent by students. Conclusion: It is necessary that advisors make the students familiar with educational regulations at the first semester of higher education. Also, the policies and regulations for advisors will clarify their activities and will help them to perform better.

  20. Medical Training Experience and Expectations Regarding Future Medical Practice of Medical Students at the University of Cape Verde

    Directory of Open Access Journals (Sweden)

    Antonio Pedro Delgado


    Conclusion: Cape Verde is pursuing a bold strategy to deal with a shortage of medical doctors. The problems experienced by medical students provide an important insight to help the new medical school to provide a better learning environment for students. The fact that students are not sure about their future area of specialization is an opportunity to guide them towards the areas of the health system with pressing needs. The current feminization of the medical workforce will be sustained with the profile of the present intake, hence the need to take this into account in workforce planning.


    Directory of Open Access Journals (Sweden)

    Svetoslav Garov


    Full Text Available Introduction: In Bulgaria there are five medical universities: in the cities of Sofia, Plovdiv, Varna, Pleven and Stara Zagora. Their main mission is training specialists in the fields of medicine and health care, increasing their qualification by means of postgraduate education and performing research activities. One of medical universities’ top priorities is encouraging research activities mainly aimed at preparation and implementation of research projects. Aim: The purpose of our study is to examine the current status of research project activities in Bulgarian medical universities.Material and methods: In order to define the science competitions related to Bulgarian medical universities we have applied a documentary and sociological approach. Results: Research projects that Bulgarian medical universities can apply for are divided into two groups – national and international. The most significant international projects are European ones since Bulgaria is an EU member state and this allows us to participate in such projects. Conclusion: Universities should strive for establishing even better conditions for encouraging application for research projects aimed at developing competent and experienced staff, even though the majority of them may not obtain approval for financing.The changes in the situation regarding Bulgarian science require the implementation and development of more research staff motivated to improve their knowledge and skills in the relevant dynamically changing competition and project field.

  2. Evaluation of Randomly Selected Completed Medical Records Sheets in Teaching Hospitals of Jahrom University of Medical Sciences, 2009

    Directory of Open Access Journals (Sweden)

    Mohammad Parsa Mahjob


    Full Text Available Background and objective: Medical record documentation, often use to protect the patients legal rights, also providing information for medical researchers, general studies, education of health care staff and qualitative surveys is used. There is a need to control the amount of data entered in the medical record sheets of patients, considering the completion of these sheets is often carried out after completion of service delivery to the patients. Therefore, in this study the prevalence of completeness of medical history, operation reports, and physician order sheets by different documentaries in Jahrom teaching hospitals during year 2009 was analyzed. Methods and Materials: In this descriptive / retrospective study, the 400 medical record sheets of the patients from two teaching hospitals affiliated to Jahrom medical university was randomly selected. The tool of data collection was a checklist based on the content of medical history sheet, operation report and physician order sheets. The data were analyzed by SPSS (Version10 software and Microsoft Office Excel 2003. Results: Average of personal (Demography data entered in medical history, physician order and operation report sheets which is done by department's secretaries were 32.9, 35.8 and 40.18 percent. Average of clinical data entered by physician in medical history sheet is 38 percent. Surgical data entered by the surgeon in operation report sheet was 94.77 percent. Average of data entered by operation room's nurse in operation report sheet was 36.78 percent; Average of physician order data in physician order sheet entered by physician was 99.3 percent. Conclusion: According to this study, the rate of completed record papers reviewed by documentary in Jahrom teaching hospitals were not desirable and in some cases were very weak and incomplete. This deficiency was due to different reason such as medical record documentaries negligence, lack of adequate education for documentaries, High work

  3. Computer-based medical education in Benha University, Egypt: knowledge, attitude, limitations, and suggestions. (United States)

    Bayomy, Hanaa; El Awadi, Mona; El Araby, Eman; Abed, Hala A


    Computer-assisted medical education has been developed to enhance learning and enable high-quality medical care. This study aimed to assess computer knowledge and attitude toward the inclusion of computers in medical education among second-year medical students in Benha Faculty of Medicine, Egypt, to identify limitations, and obtain suggestions for successful computer-based learning. This was a one-group pre-post-test study, which was carried out on second-year students in Benha Faculty of Medicine. A structured self-administered questionnaire was used to compare students' knowledge, attitude, limitations, and suggestions toward computer usage in medical education before and after the computer course to evaluate the change in students' responses. The majority of students were familiar with use of the mouse and keyboard, basic word processing, internet and web searching, and e-mail both before and after the computer course. The proportion of students who were familiar with software programs other than the word processing and trouble-shoot software/hardware was significantly higher after the course (Pcomputer (P=0.008), the inclusion of computer skills course in medical education, downloading lecture handouts, and computer-based exams (Pcomputers limited the inclusion of computer in medical education (Pcomputer labs, lack of Information Technology staff mentoring, large number of students, unclear course outline, and lack of internet access were more frequently reported before the course (Pcomputer labs, inviting Information Technology staff to support computer teaching, and the availability of free Wi-Fi internet access covering several areas in the university campus; all would support computer-assisted medical education. Medical students in Benha University are computer literate, which allows for computer-based medical education. Staff training, provision of computer labs, and internet access are essential requirements for enhancing computer usage in medical

  4. [Profile and tasks of a medical university polyclinic in the past and present using as example the Medical Polyclinical Institutes of the Karl Marx University of Leipzig]. (United States)

    Hambsch, K; Treutler, H; Pietruschka, W D


    After a short survey of the historical development of the Medico-Policlinical Institute of the Karl Marx University Leipzig tasks and developmental tendencies of university medical policlinics are described, evaluating hereby the results of the Vth conference of higher education. They are understood as a university representation of ambulatorily working internists and to a large extent of the specialists for general medicine. Their main tasks consist in education and continued professional training of this group of physicians under integrative description of the whole subject internal medicine, a research oriented to practice as well as a guiding and coordination function for the ambulatory internistic care, taking into particular consideration the early recognition of a disease, in primary and secondary prevention as well as in a scientifically based ambulatory therapy of epidemiologically important diseases.

  5. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.


    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  6. Perceptions of personal health risks by medical and non-medical workers in a university medical center : a survey study

    NARCIS (Netherlands)

    Listyowardojo, Tita Alissa; Nap, Raoul E.; Johnson, Addie


    Background: Health care workers (HCWs) are faced with many work-related choices which may depend on how they perceive risk, such as whether or not to comply with safety regulations. Little research has investigated risk perception in medical workers in comparison with non-medical workers and the

  7. Internationalizing Medical Education: The Special Track Curriculum 'Global Health' at Justus Liebig University Giessen

    Directory of Open Access Journals (Sweden)

    Knipper, Michael


    Full Text Available Internationalizing higher education is considered to be a major goal for universities in Germany and many medical students aspire to include international experiences into their academic training. However, the exact meaning of “internationalizing” medical education is still poorly defined, just as is the possible pedagogic impact and effects. Against this background, this article presents the special track curriculum on global health (in German: , short: at Justus Liebig University Giessen, which was established in 2011 as a comprehensive teaching program to integrate international perspectives and activities systematically into the clinical years of the medical curriculum. The report of the structure, content, didactic principles and participants’ evaluations of the SPC is embedded into a larger discussion of the pedagogic value of a broad and interdisciplinary perspective on “global health” in medical education, that explicitly includes attention for health inequities, social determinants of health and the cultural dimensions of medicine and health abroad and “at home” (e.g. in relation to migration. We conclude that if properly defined, the emerging field of “global health” represents a didactically meaningful approach for adding value to medical education through internationalizing the curriculum, especially in regard to themes that despite of their uncontested value are often rather weak within medical education. The concrete curricular structures, however, have always to be developed locally. The “SPC” at Giessen University Medical School is only one possible way of addressing these globally relevant issues in one particular local academic setting.

  8. Perception of self-medication among university students in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Mustafa S Saeed


    Full Text Available The aim of this study is to assess self-medication practice among university students in the Al-Qassim Province of Saudi Arabia. A cross-sectional community-based survey was conducted by distributing a self-administered 18-item questionnaire among university students in the Al-Qassim Province of Saudi Arabia in the period between October and December 2012. The participants were selected using a convenience sampling technique. Data were collected from the questionnaire and analyzed using SPSS version 19. A total of 354 male students with an average age of 21.95 (SD ± 3.43 participated in this study. Our study showed that self-medication among male students was high (86.6% compared to results shown in other studies in the same region. Headache (59.9%, cough/cold (41% and fever (24.6% were the most common symptoms associated with self-medication. Congruent with the medical conditions reported, the most widely used medications without prescriptions were paracetamol (34.7%, followed by antibiotics (31.4% and nonsteroidal anti-inflammatory drugs (28.7%. Our study shows that antibiotics were sometimes irrationally used for self-treatment of cough and fever. Self-medication was highly frequent among the students. Influence of TV advertisements, high accessibility of pharmacies and convenience stores, as well as good buying power were found to be leading factors for self-medication among male university students.

  9. Internationalizing Medical Education: The Special Track Curriculum 'Global Health' at Justus Liebig University Giessen. (United States)

    Knipper, Michael; Baumann, Adrian; Hofstetter, Christine; Korte, Rolf; Krawinkel, Michael


    Internationalizing higher education is considered to be a major goal for universities in Germany and many medical students aspire to include international experiences into their academic training. However, the exact meaning of "internationalizing" medical education is still poorly defined, just as is the possible pedagogic impact and effects. Against this background, this article presents the special track curriculum on global health (in German: Schwerpunktcurriculum Global Health, short: SPC) at Justus Liebig University Giessen, which was established in 2011 as a comprehensive teaching program to integrate international perspectives and activities systematically into the clinical years of the medical curriculum. The report of the structure, content, didactic principles and participants' evaluations of the SPC is embedded into a larger discussion of the pedagogic value of a broad and interdisciplinary perspective on "global health" in medical education, that explicitly includes attention for health inequities, social determinants of health and the cultural dimensions of medicine and health abroad and "at home" (e.g. in relation to migration). We conclude that if properly defined, the emerging field of "global health" represents a didactically meaningful approach for adding value to medical education through internationalizing the curriculum, especially in regard to themes that despite of their uncontested value are often rather weak within medical education. The concrete curricular structures, however, have always to be developed locally. The "SPC" at Giessen University Medical School is only one possible way of addressing these globally relevant issues in one particular local academic setting.

  10. The Medical Academic Advancement Program at the University of Virginia School of Medicine. (United States)

    Fang, W L; Woode, M K; Carey, R M; Apprey, M; Schuyler, J M; Atkins-Brady, T L


    Since 1984 the University of Virginia School of Medicine has conducted the Medical Academic Advancement Program for minority and disadvantaged students interested in careers in medicine. The program is a six-week residential program for approximately 130 undergraduate and post-baccalaureate students per year. It emphasizes academic course work--biology, chemistry, physics, and essay writing--to prepare the participants for the Medical College Admission Test. Non-graded activities, such as a clinical medicine lecture series, clinical experiences, and a special lecture series, and special workshops are also offered. The participants take two simulated MCAT exams. Between 1984 and 1998, 1,497 students have participated in the program, with complete follow-up information available for 690 (46%). Of the 1,487 participants, 80 (5%) have graduated from the University of Virginia School of Medicine and 174 (12%) from other medical schools; 44 (3%) are attending the medical school now, and 237 (16%) are at other medical schools; 44 (3%) have graduated from other health professions schools, and 54 (3%) are attending such schools. The retention rate for participants at the University of Virginia School of Medicine is 91% (that is, all but seven of the 80 who matriculated have been retained past the first year). The Medical Academic Advancement Program has been successful in increasing the number of underrepresented minority students matriculating into and continuing in medical education. Such programs warrant continued support and encouragement.

  11. A Dual Hesitant Fuzzy Multigranulation Rough Set over Two-Universe Model for Medical Diagnoses (United States)

    Zhang, Chao; Li, Deyu; Yan, Yan


    In medical science, disease diagnosis is one of the difficult tasks for medical experts who are confronted with challenges in dealing with a lot of uncertain medical information. And different medical experts might express their own thought about the medical knowledge base which slightly differs from other medical experts. Thus, to solve the problems of uncertain data analysis and group decision making in disease diagnoses, we propose a new rough set model called dual hesitant fuzzy multigranulation rough set over two universes by combining the dual hesitant fuzzy set and multigranulation rough set theories. In the framework of our study, both the definition and some basic properties of the proposed model are presented. Finally, we give a general approach which is applied to a decision making problem in disease diagnoses, and the effectiveness of the approach is demonstrated by a numerical example. PMID:26858772

  12. Factors Affecting the Use of Indigenous Publications by Medical and Dental Students in Nigerian Universities

    Directory of Open Access Journals (Sweden)

    Ahiaoma Ibegwam


    Full Text Available This study examined the indigenous medical publications used by medical and dental students in Nigeria with a view to discovering factors that affects their usage. Data was gathered through a questionnaire survey. The population of the study was 1,264 undergraduate medical and dental students from ten universities in all the geopolitical zones of Nigeria. Data gathered was analysed using SPSS to obtain the summaries of the variables in form of frequency distribution and other descriptive statistics. The findings reveal several factors affecting the usage of indigenous medical publications. In spite of all the inhibitors, 88.2% of the respondents indicated that they need indigenous medical publications for a well-rounded medical education.

  13. Medical students’ perception of the learning environment at King Saud University Medical College, Saudi Arabia, using DREEM Inventory

    Directory of Open Access Journals (Sweden)

    Soliman MM


    Full Text Available Mona M Soliman,1,2 Kamran Sattar,2 Sami Alnassar,3 Faisal Alsaif,4 Khalid Alswat,5 Mohamed Alghonaim,6 Maysoon Alhaizan,7 Nawaf Al-furaih7 1Department of Physiology, 2Department of Medical Education, 3Department of Surgery, College of Medicine, King Saud University, 4Department of Surgery, King Saud University Medical City, 5Department of Internal Medicine, 6Department of Medicine, 7College of Medicine, King Saud University, Riyadh, Saudi Arabia Background: The students’ perception of the learning environment is an important aspect for evaluation and improvement of the educational program. The College of Medicine at King Saud University (KSU reformed its curriculum in 2009 from a traditional to a system-oriented hybrid curriculum.Objective: The objective of the present study was to determine the perception of the second batch (reformed curriculum of medical graduates about the educational environment at the College of Medicine, KSU, using the Dundee Ready Education Environment Measure (DREEM scale.Methods: The fifth year medical students were asked to evaluate the educational program after graduation in May 2014. The questionnaire was distributed to the graduate students electronically. The DREEM questionnaire consisted of 50 items based on Likert’s scale; and five domains, namely, students’ perceptions of learning, perceptions of teachers, academic self-perceptions, perceptions of atmosphere, and social self-perceptions. Data were analyzed using SPSS.Results: A total of 62 students participated in the study. The score for students’ perception of learning among medical students ranged from 2.93 to 3.64 (overall mean score: 40.17. The score for students’ perception of teachers ranged from 2.85 to 4.01 (overall mean score: 33.35. The score for students’ academic self-perceptions ranged from 3.15 to 4.06 (overall mean score: 28.4. The score for students’ perception of atmosphere ranged from 2.27 to 3.91 (overall mean score: 41.32. The

  14. Mental health status among Japanese medical students: a cross-sectional survey of 20 universities. (United States)

    Ohtsu, Tadahiro; Kaneita, Yoshitaka; Osaki, Yoneatsu; Kokaze, Akatsuki; Ochiai, Hirotaka; Shirasawa, Takako; Nanri, Hinako; Ohida, Takashi


    The purposes of this study were to evaluate the mental health status of Japanese medical students and to examine differences based on gender, as well as on university type and location, using the results of a nationwide survey. Between December 2006 and March 2007, we conducted a questionnaire survey among fourth-year medical students at 20 randomly selected medical schools in Japan. The data from 1,619 students (response rate: 90.6%; male: 1,074; female: 545) were analyzed. We used the Japanese version of the 12-item General Health Questionnaire (GHQ-12) to measure mental health status. Poor mental health status (GHQ-12 score of 4 points or higher) was observed in 36.6% and 48.8% of the male and female medical students, respectively. The ratio of the age-adjusted prevalence of poor mental health status in female versus male medical students was 1.33 (95% confidence interval: 1.10-1.62). The universities were categorized into two groups based on the university type (national/public: 15 vs. private: 5) or location (in a large city: 7 vs. in a local city: 13 cities). The prevalence of poor mental health status in both men and women differed between these groups, although not significantly. The GHQ-12 scores in men significantly differed between the categorized groups of universities. These results suggest that adequate attention must be paid to the mental health of medical students, especially females, and that a system for providing mental health care for medical students must be established in the context of actual conditions at each university.

  15. Self-medication among healthcare and non-healthcare students at University of Ljubljana, Slovenia. (United States)

    Klemenc-Ketis, Zalika; Hladnik, Ziga; Kersnik, Janko


    To determine the incidence of self-medication among University of Ljubljana students and the effect of the type of curriculum on the pattern of self-medication. The study included a sample of 1,294 students who freely accessed a self-administered web-based questionnaire in the Slovene language that consisted of a preliminary letter introducing the term 'self-treatment' and 2 sections about self-medication. The preliminary letter asked participants to report the practice of self-treatment during the past year. The main outcome measures were percentages of those reporting self-medication during the past year, which were then used to compare healthcare and non-healthcare students. A majority of students (1,195, 92.3%), both healthcare and non-healthcare, reported the use of some sort of self-medication during the study period. More healthcare students in their senior year (353, 94.1%) than those in their junior year (245, 89.4%) used self-medication (p = 0.04). Healthcare students (p = 0.05) thought that self-medication without improvement of the symptoms should last for 1 week or less. They acquired the drugs for self-medication from pharmacies; thought that previous doctors' advice in a similar situation was a more important reason for self-medication; would seek the advice of a physician or pharmacist for different ways of self-treatment, and quite interestingly thought that self-medication was not very safe. On the other hand, non-healthcare students acquired the drugs from healers and friends. The study showed that self-medication was common among all University of Ljubljana students, but that healthcare-related education in students and young adults led to more responsible use of self-medication. Copyright 2010 S. Karger AG, Basel.

  16. Student-Life Stress Level and its Related Factors among Medical Students of Hamadan University of Medical Sciences in 2015

    Directory of Open Access Journals (Sweden)

    Roya Nikanjam


    Full Text Available Background and Objectives: Student-life stress can lead to various negative consequences such as physical illness, mental disorders or exhaustion. The present study was conducted to evaluate the level of student life stress and its related factors among medical students of Hamadan University of Medical Sciences. Materials and Methods: This cross-sectional study applied multistage random sampling to select 500university students at Hamadan University of Medical Sciences during 2015. The data collection tool used in this study was a self-report questionnaire containing two parts: a section on subjects' demographic details and another section for Student-Life Stress Inventory (SLSI. Data were analyzed in SPSS20-using descriptive and inferential statistics, such as independent t-test, Pearson’s correlation test and one-way ANOVA. Results: This study revealed that %57of the students had moderate levels of stress. The most important stressors included self-impose and pressure, and also the most important reactions to stressors included cognitive appraisal and emotional reactions, respectively. There was a significant association between exam stressors and branch, educational level, and mother's and father's education level (P< 0.05. Conclusions: According to the high level of stress in students and the recognition of demographic factors, effective educational interventions can be conducted to reduce stress.

  17. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences. (United States)

    Yazdi, Zohreh; Loukzadeh, Ziba; Moghaddam, Parichehr; Jalilolghadr, Shabnam


    Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. In this descriptive-correlational study, a total of 285 medical students completed a self-administered questionnaire. Demographic data, sleep-wake schedule in weekday and weekend, and sleep duration were collected. Students' sleep quality was assessed by Pittsburg Sleep Quality Index (PSQI). Data were analyzed by SPSS Ver 13. Overall, 164 (57.5) of students had poor sleep quality. Mean global PSQI score and average score of four subscales were significantly higher in male than female. Regression analysis showed that male students (β=-0.85, Psleep hygiene practices slept worse. The findings of this study showed that the prevalence of poor sleep quality in medical students is high. Improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students.

  18. Sleep Hygiene Practices and Their Relation to Sleep Quality in Medical Students of Qazvin University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Zohreh Yazdi


    Full Text Available Introduction: Poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. Sleep hygiene practices are one of the important variables that affect sleep quality. The objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in Qazvin University of Medical Sciences. Methods: In this descriptive-correlational study, a total of 285 medical students completed a self-administered questionnaire. Demographic data, sleep-wake schedule in weekday and weekend, and sleep duration were collected. Students' sleep quality was assessed by Pittsburg Sleep Quality Index (PSQI. Data were analyzed by SPSS Ver 13. Results: Overall, 164 (57.5 of students had poor sleep quality. Mean global PSQI score and average score of four subscales were significantly higher in male than female. Regression analysis showed that male students (β=-0.85, P<0.05, students at senior level (β=-0.81, P<0.05, married students (β=-0.45, P<0.05, and those with improper sleep hygiene practices slept worse. Conclusion: The findings of this study showed that the prevalence of poor sleep quality in medical students is high. Improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students.

  19. Educational needs of faculty members of Shahid Sadoughi University of Medical Sciences in 2011

    Directory of Open Access Journals (Sweden)

    S. S Mazloomy Mahmoodabad


    Full Text Available Introduction: Identifying educational needs is an essential step in planning faculty development programs. It plays an important role in promoting the quality of education. The aim of this study was to determine and prioritize the educational needs of clinical and non clinical faculty members of Faculty of Medicne of Shahid Sadoughi University of Medical Sciences. Methods: A questionnaire was developed for this cross-sectional study using the indices identified by reviewing the literature. The questionnaire was sent to all faculty members of Medical Faculty (n=260. The items were scored from 1 to 20 according to the importance of the educational needs. Data was analyzed by SPSS software. Results: Different areas of educational needs of the clinical faculty members were respectively prioritized as: familiarity with National Medical Universities Ranking Schemeresearch, personal development, administrative and executive activities, education, specialized activities outside the university and health services and health promotion. In the non clinical faculty members: research, familiarity with National Medical Universities Ranking Schemeeducation, personal development, specialized activities outside the university, administrative and executive activities. The first priority of education in the clinical faculty members was design, implementation and analysis of oral exams. In research domain priorities were data analysis skills and the first priority of education in the non clinical faculty members was how to foster critical thinking and reasoning in research and critical appraisal skills. Conclusion: Faculty members need all of the seven studiedmajor areas. It is recommended further research to determine the weight of these seven areas using a standard method.

  20. Effect of Professional Ethics on Reducing Medical Errors from the Viewpoint of Faculty Members in Medical School of Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Fatemeh Donboli Miandoab


    Full Text Available Background: Professionalism and adherence to ethics and professional standards are among the most important topics in medical ethics that can play a role in reducing medical errors. This paper examines and evaluates the effect of professional ethics on reducing medical errors from the viewpoint of faculty members in the medical school of the Tabriz University of Medical Sciences. Methods: in this cross-sectional descriptive study, faculty members of the Tabriz University of Medical Sciences were the statistical population from whom 105 participants were randomly selected through simple random sampling. A questionnaire was used, to examine and compare the self-assessed opinions of faculty members in the internal, surgical, pediatric, gynecological, and psychiatric departments. The questionnaires were completed by a self-assessment method and the collected data was analyzed using SPSS 21. Results: Based on physicians’ opinions, professional ethical considerations and its three domains and aspects have a significant role in reducing medical errors and crimes. The mean scores (standard deviations of the managerial, knowledge and communication skills and environmental variables were respectively 46.7 (5.64, 64.6 (8.14 and 16.2 (2.97 from the physicians’ viewpoints. The significant factors with highest scores on the reduction of medical errors and crimes in all three domains were as follows: in the managerial skills variable, trust, physician’s sense of responsibility against the patient and his/her respect for patients’ rights; in the knowledge and communication skills domain, general competence and eligibility as a physician and examination and diagnosis skills; and, last, in the environmental domain, the sufficiency of trainings in ethical issues during education and their satisfaction with basic needs. Conclusion: Based on the findings of this research, attention to the improvement of communication, management and environment skills should


    Directory of Open Access Journals (Sweden)

    Svetlana Tarasova


    Full Text Available The pedagogical aspects of making and teaching a special course «Statistical methods of prognostication in medicine» are discussed on the basis of the analysis of the application of various pedagogical tools, shows the significance of implementing a predictive function in the training of medical students. The efficiency of formation of medical university students’ prognostic competence in the process of studying a special course is estimated.

  2. Perceptions of personal health risks by medical and non-medical workers in a university medical center: a survey study

    Directory of Open Access Journals (Sweden)

    Nap Raoul E


    Full Text Available Abstract Background Health care workers (HCWs are faced with many work-related choices which may depend on how they perceive risk, such as whether or not to comply with safety regulations. Little research has investigated risk perception in medical workers in comparison with non-medical workers and the extent to which risk perception differs in these groups. The current study thus investigates risk perception of medical and non-medical workers to inform and complement future research on safety compliance. The study has implications for the design of intervention programmes to increase the level of compliance of HCWs. Methods A survey study was conducted in which questionnaires were distributed to 6380 HCWs. The questionnaire asked for ratings of risk perception for cold, annual influenza, pandemic influenza, cancer, heart attack and food poisoning. Of 2495 returned questionnaires (response rate: 39%, 61.40% were from medical workers (24.1% of these were from physicians, 39.7% from nurses and 36.2% from paramedics and 38.60% were from non-medical workers. Results Medical workers gave lower risk perception ratings than did non-medical workers for cancer, but not for other health risks. Within the medical workers, physicians rated the risk of getting a cold as higher, but of having a heart attack as lower than did nurses and paramedics; physicians also rated their risk of getting cancer as lower than did nurses. Perceived risk was higher as a function of age for pandemic influenza, cancer and heart attack, but lower for cold and annual influenza. HCWs who lived with a partner and children rated the risk of getting a cold or annual influenza higher than those who lived alone or with a partner only. Full-time HCWs gave lower ratings for annual influenza than did part-time HCWs. Conclusions Different base levels of risk perception between medical and non-medical workers need to be taken into account for successful implementation of safety regulations

  3. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.


    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  4. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia

    Directory of Open Access Journals (Sweden)

    Haque M


    Full Text Available Mainul Haque,1 Nor Azlina A Rahman,2 Md Anwarul Azim Majumder,3 Seraj Zohurul Haque,4 Zubair M Kamal,5 Zakirul Islam,6 ATM Emdadul Haque,7 Nor Iza A Rahman,8 Ahmed Ghazi Alattraqchi8 1Unit of Pharmacology, Faculty of Medicine and Defense Health, National Defense University of Malaysia, Kuala Lumpur, 2Department of Biomedical Science, Kulliyyah of Allied Health Sciences, Kuantan, Malaysia; 3Department of Clinical Sciences, School of Medical Sciences, Faculty of Life Sciences, University of Bradford, Bradford, 4School of Medicine, University of Dundee, Ninewells Hospital & Medical School, Dundee, UK; 5Sleep Research Unit, Toronto Western Hospital, University Health Network, Toronto, ON, Canada; 6Department of Pharmacology and Therapeutics, Eastern Medical College, Comilla, Bangladesh; 7Department of Medical Education, Universiti Kuala Lumpur Royal College of Medicine Perak (UniKL RCMP, Ipoh, 8Faculty of Medicine, Universiti Sultan Zainal Abidin, Kuala Terengganu, Malaysia Background: The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia.Methods: This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center

  5. The Arabian Gulf University College of Medicine and Medical Sciences: a successful model of a multinational medical school. (United States)

    Hamdy, Hossam; Anderson, M Brownell


    In the late 1970s, leaders of the Arabian [corrected] Gulf countries proposed a novel idea of a joint educational and cultural venture: establishing a new regional university based in the Kingdom of Bahrain that would be managed as a multinational consortium of Gulf countries including Saudi Arabia, United Arab Emirates, Kuwait, Oman, Qatar, and Bahrain. It was intended to promote higher education and research in the Gulf region; to serve the development needs of the region; to reflect the unique economic, social, and cultural attributes of the Gulf communities and their environments; and to respond to the health care needs of the member countries. Since its inception in 1982, the College of Medicine and Medical Sciences (CMMS) at Arabian Gulf University (AGU) has adopted the educational philosophy of problem-based learning (PBL) and self-directed, student-centered education. The curriculum is integrated, with early introduction of education to foster clinical skills and professional competencies. The strategic alliance with the health care systems in Bahrain and other Gulf regions has created a successful model of efficient and effective initialization of health care resources in the community. The experience that has accumulated at the AGU-CMMS from introducing innovative medical education has allowed it to take a leadership position in medical education in the Gulf region. The original goals of this unique experiment have been realized along with unanticipated outcomes of spearheading changes in medical education in the Gulf region. Old and new medical schools have adopted several characteristics of the AGU educational program. Several elements contributed to its success: a clear vision of providing quality medical education and realizing and sustaining this vision by a supportive leadership at the university and college levels; an alliance with the regional health care systems; a dedicated faculty who have been able to work as a team while continually

  6. Learning Styles of Medical and Midwifery Students in Mashhad University of Medical Sciences


    A Zeraati; H Hajian; R Shojaian


    Background: Students have individual learning style preferences including visual (V; learning from graphs, charts, and flow diagrams), auditory (A; learning from speech), read-write(R; learning from reading and writing), and kinesthetic (K; learning from touch, hearing, smell, taste, and sight).These preferences can be assessed using the VARK questionnaire.Purpose: We aimed to assess different learning styles of medical students in our collage.Methods: This study was conducted to describe lea...

  7. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia (United States)

    Haque, Mainul; Rahman, Nor Azlina A; Majumder, Md Anwarul Azim; Haque, Seraj Zohurul; Kamal, Zubair M; Islam, Zakirul; Haque, ATM Emdadul; Rahman, Nor Iza A; Alattraqchi, Ahmed Ghazi


    Background The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia. Methods This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center for Internet Addiction, USA, was used. One hundred forty-nine medical students of Universiti Sultan Zainal Abidin participated in this study. Data were analyzed using Statistical Package for the Social Sciences software. Results The mean scores were 44.9±14.05 and 41.4±13.05 for male and female participants, respectively, which indicated that both the genders were suffering from mild Internet addiction. Conclusion This study shows almost similar level of Internet usage among medical students irrespective of their socioeconomic background, with no statistically significant (p>0.05) differences, except among the years of study (p=0.007). Overall, from the research data and having worked with this cohort very closely, Universiti Sultan Zainal Abidin medical students can be labeled as wonted and recurring users of the Internet. Nevertheless, it is very difficult to define as Internet addicts or pathological users of the Internet because of small sample size and cross-sectional study. PMID

  8. Internet use and addiction among medical students of Universiti Sultan Zainal Abidin, Malaysia. (United States)

    Haque, Mainul; Rahman, Nor Azlina A; Majumder, Md Anwarul Azim; Haque, Seraj Zohurul; Kamal, Zubair M; Islam, Zakirul; Haque, Atm Emdadul; Rahman, Nor Iza A; Alattraqchi, Ahmed Ghazi


    The use of Internet has now become indispensable, and the technology has revolutionized the medical education and practice worldwide. Currently, medical students and professionals have an enormous opportunity to keep them always updated with the exponential growth of knowledge because of potential progression of Internet throughout the world that enables them to become a lifelong learner. Internet addiction is a widespread phenomenon among students and academicians at universities in Malaysia. Students use the Internet for recreational purpose and personal and professional development. The Internet has become an integral part of day-to-day life of the university students, including medical students. The aim of the present study was to examine the Internet use and addiction among students of Universiti Sultan Zainal Abidin, Malaysia. This was a cross-sectional study in which a questionnaire, Internet Addiction Diagnostic Questionnaire, developed by the Center for Internet Addiction, USA, was used. One hundred forty-nine medical students of Universiti Sultan Zainal Abidin participated in this study. Data were analyzed using Statistical Package for the Social Sciences software. The mean scores were 44.9±14.05 and 41.4±13.05 for male and female participants, respectively, which indicated that both the genders were suffering from mild Internet addiction. This study shows almost similar level of Internet usage among medical students irrespective of their socioeconomic background, with no statistically significant ( p >0.05) differences, except among the years of study ( p =0.007). Overall, from the research data and having worked with this cohort very closely, Universiti Sultan Zainal Abidin medical students can be labeled as wonted and recurring users of the Internet. Nevertheless, it is very difficult to define as Internet addicts or pathological users of the Internet because of small sample size and cross-sectional study.

  9. Content and technical evaluation of Type III Iranian medical universities\\' websites

    Directory of Open Access Journals (Sweden)

    Khadejeh Shabankareh


    Full Text Available Background: Besides the role that universities websites have in reflection of universities’ educational and research activities, they have also significant importance in promotion of universities’ national and international ranking in webometrics ranking of world universities and also in webometric ranking of Islamic world Science Citation and subsequently obtaining national and international credibility and gaining student and funding. So, continuous evaluation of universities websites in different aspects, especially based on considering index of these ranking systems, is important. Therefore, present study aimed to review the situation of Type 3 Iranian medical universities’ websites based on content and technical features effecting on promotion of webometric rank. Materials and Methods : Present study is a survey with descriptive approach which descriptive the present situation of Type 3 Iranian medical universities’ websites. Data were collected using a researcher-made checklist which was consisted of two parts including content criteria effecting on webometric ranking (50 criteria and technical criteria of search engines optimization (52 criteria. Content evaluation of websites was done by researcher direct referring and observing. In order to evaluation of these websites, based on technical criteria of search engines optimization, automatic tools about website evaluation were used. Data were analyzed by SPSS20. Results: The finding of this study showed that, Gonabad, Bushehr & Shahrekord universities of medical sciences have the most accommodation with the research checklist.  Bam, Dezful & Jiroft universities of medical sciences have the least accommodation. According to research findings less than 50 percent of the research community, reached more than 50 percent of the criteria in checklist. Conclusion: Evaluation of studied websites indicated that whole websites are far from ideal situation. So type 3 medical universities

  10. Attitudes to Organ Donation and Knowledge of Donation and Transplantation among University of Auckland Medical Students

    Directory of Open Access Journals (Sweden)

    Lindsey Harbour


    Full Text Available Aims • To explore organ donation and transplantation knowledge and attitudes among medical students at the University of Auckland. • To understand students' perception of the extent of training received prior to and during the medical program. Method A validated web-based questionnaire consisting of 42 questions in five categories was anonymously administered to all enrolled medical students at the Faculty of Medical and Health Sciences, University of Auckland, in September 2012. Results In all, 419 out of 989 (42% Year 2–6 students responded. A total of 99.3% of medical students supported organ donation, but knowledge was limited (mean score 7.54/15±2.26. A total of 38% of students reported having participated in organ donation learning. A total of 96% of students believed that organ donation information should be available in primary care settings. A total of 69% of students reported that if a patient asked a question about organ donation that they did not know the answer to, they also would not know where to source the correct information from. Conclusion This study demonstrates that although medical students support organ donation, they lack the knowledge required to facilitate informative discussions with patients. Enhanced organ donation education in medical programs may enable students to develop skills and knowledge allowing them to better discuss donation with patients.

  11. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.


    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  12. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad


    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  13. Self-medication among non-healthcare students of the University of Sharjah, United Arab Emirates

    Directory of Open Access Journals (Sweden)

    Suleiman Ibrahim Sharif


    Full Text Available Objectives: The objective of the following study is to estimate the prevalence of self-medication among university students and evaluate factors associated with the practice. Materials and Methods: This study was conducted during May, 2012 using a pre-validated questionnaire distributed to 250 students of the 4 years of study at the college of business administration. Data were analyzed using PASW Statistics for Windows, Version 18.0. Chicago: SPSS Inc and results are expressed as counts and percentages. Chi-square test was used to evaluate significant association among the study variables and P < 0.05 were considered to be statistically significant. Results: The response rate was 80% and all respondents were Arabs with 114 (57% females and 86 (43% males. Self-medication was practiced by 118 (59% students and most (88.1% of them obtained medications from pharmacies. About 21 (11% respondents self-medicated with antibiotics. Only 34 (17% and 16 (8% of respondents were aware of bacterial resistance and rational drug use respectively. The most common reasons for self-medication were seeking quick relief (134, 67%, physician′s advice of self-management (100, 50%, illness is minor (91, 45.5%. Common reasons against self-medication include risk of misdiagnosis of illness (160, 80%, risk of using the wrong medication (154, 77%, risk of adverse effects (140, 70%. Self-medication was practiced for headache or mild pain, eye and ear symptoms, gastric problems, cold, fever and allergy. Conclusion: Self-medication among non-healthcare students is common with high prevalence. Knowledge of students of reasons for and against self-medication was adequate, but awareness of respondents of rational drug use and risk of bacterial resistance in response to misuse was poor. Orientation courses/workshops directed to university students would be beneficial.

  14. Pattern of self-medication with analgesics among Iranian University students in central Iran

    Directory of Open Access Journals (Sweden)

    Shadi Sarahroodi


    Full Text Available Background: Self-medication is defined as the use of drugs for the treatment of self-diagnosed disorders. It is influenced by factors such as education, family, society, law, availability of drugs and exposure to advertisements. This study was performed to evaluate self-medication with analgesics and its pattern among different groups of Iranian University Students. Materials and Methods: A randomized, cross-sectional, multicenter study was conducted from December 2009 to February 2010. The target population of this study was 564 students out of 10,000 students attending four medical and non-medical science universities in Qom state. Data was analyzed using SPSS version 16, and analysis was conducted with descriptive analysis procedures. Results: 76.6% of the students had used analgesics in self-medication in the previous 3 months. The frequency of analgesic use in the study period was once in 19.2% of the participants, twice in 22.2%, three times in 16.3% and more than three times in 35.5% of the participants, although 6.8% of them were not sure when they were used. Of all the respondents, 49.8% reported headache as the problem. This was the most common problem, after which came Dysmenorrhea,headache and stomach ache. Bone and joint pains were other problems that led to the use of analgesics. The most commonly used source of information for self-medication with analgesics was advice from friends and family (54.7%, previously prescribed medications (30.1%, their medical knowledge (13.3% and recommendation of a pharmacist (1.9%. Conclusion: Self-medication with analgesics is very high among Iranian students in Qom city. This could be an index for other parts of the Iranian community. Because the source of information about analgesics is inappropriate, we would recommend education courses about analgesics and self-medication on the radio and television for the entire population.

  15. Current issues regarding radiation risk education in Medical Universities of Japan

    International Nuclear Information System (INIS)

    Tsuzuki, Teruhisa; Hosoi, Yoshio; Matsuda, Naoki; Kanda, Reiko; Hosoya, Noriko; Miyagawa, Kiyoshi; Awai, Kazuo; Kondo, Takashi


    The main purpose of radiation research is to understand the biological effects of radiation exposure to humans, the molecular mechanisms of biological response m organisms, and its sale application for medical and industrial use. In order to know the current state or education on fundamentals of radiology including radiation biology, a nation-wide questionnaire survey had been performed at medical schools and different co-medical courses in Japanese universities, during the period of 2004 and 2005. The survey results showed: (1) Difference in teaching hours for education on radiation between medical schools with and without department or division of radiation biology or radiation-related field. (2) Teaching hours for education on radiation in nursing course were very limited among the co-medical courses. Although, some improvement have been found about the state of education on radiation risk at medical schools, after the disaster of nuclear accident at Fukushima No.1 Nuclear Power Plant of TEPCO in March 2011. However, still much more effort t is needed to improve basic education on radiation. Science Council of Japan issued the recommendation on September 4, 2014 'Making radiation health risk education compulsory in medical education'. The working group for this purpose was set up under the Council of Head of National Medical Schools of Japan, on January 28, 2015. Here, we describe the details and current issues regarding radiation risk education in medical schools of Japan, as well as the efforts required for its betterment. (author)

  16. 75 FR 15439 - Food and Drug Administration/Xavier University Global Medical Device Conference (United States)


    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2010-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  17. 78 FR 15957 - Food and Drug Administration/Xavier University Global Medical Device Conference (United States)


    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  18. 77 FR 10537 - Food and Drug Administration/Xavier University Global Medical Device Conference (United States)


    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-0001] Food and Drug Administration/Xavier University Global Medical Device Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug Administration (FDA...

  19. Educational Service Quality in Zanjan University of Medical Sciences from Students' Point of View (United States)

    Mohammadi, Ali; Mohammadi, Jamshid


    This study aims at evaluating perceived service quality in Zanjan University of Medical Sciences (ZUMS). This study was cross-sectional and authors surveyed educational services at ZUMS. Through stratified random sampling, 384 students were selected and an adapted SERVQUAL instrument was used for data collection. Data analysis was performed by…

  20. 78 FR 55244 - Notice of Availability of Record of Decision for Medical Facilities Development and University... (United States)


    ... AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The United States Department of the Navy... alternative for the University Expansion will provide adequate education and research space to meet Military Health System commitments to deliver training and post-graduate level education to the military medical...

  1. Use of antibiotics among non-medical students in a Nigerian university

    African Journals Online (AJOL)

    Background: Antibiotic misuse is a major contributory factor to treatment failure, antibiotic resistance and high healthcare costs. Objectives: To evaluate level of self-reported antibiotic misuse among non-medical undergraduate students of a Nigerian university. Methods: Respondents' knowledge of antibiotics and disposal ...

  2. Use of antibiotics among non-medical students in a Nigerian university

    African Journals Online (AJOL)


    Abstract. Background: Antibiotic misuse is a major contributory factor to treatment failure, antibiotic resistance and high healthcare costs. Objectives: To evaluate level of self-reported antibiotic misuse among non-medical undergraduate students of a Nigerian university. Methods: Respondents' knowledge of antibiotics and ...

  3. Psychological Type and Undergraduate Student Achievement in Pharmacy Course in Military Medical University (United States)

    Shi, Ru; Shan, Shou-qin; Tian, Jian-quan


    The Myers-Briggs Type Indicator (MBTI) was given to 264 students in an undergraduate Pharmacy course at a military medical university. Selected MBTI personality types were compared for achievement in the course using a t-test to compare total points earned. High grades were earned by students stronger in the traits of introversion (I) and judgment…

  4. Relationship Between Cybernetics Management and Organizational Trust Among Librarians of Mazandaran University of Medical Sciences. (United States)

    Ghiasi, Mitra; Shahrabi, Afsaneh; Siamian, Hasan


    Organization must keep current skills, abilities, and in the current field of competition, and move one step ahead of other competitors; for this purpose, must be a high degree of trust inside the organization. Cybernetic management is a new approach in management of organizations that its main task according to internal issues. This study aimed to investigate the relationship between cybernetics management and organizational trust among librarians of Mazandaran University of Medical Sciences. This is applied and analytical survey. which its population included all librarians of Mazandaran University of Medical Sciences, amounting to 42 people which were selected by census and participated in this research. There has no relationship between components of Cybernetics management (participative decision making, commitment, pay equity, Correct flow of information, develop a sense of ownership, online education) with organizational trust amongst librarians of Mazandaran University of Medical Sciences. And there has a significant relationship between flat Structure of cybernetics management and organizational trust. For data analysis was used Kolmogorov-Smirnov test and linear regression. There is no significant relationship between Cybernetic management and organizational trust amongst librarians of Mazandaran University of Medical Sciences.

  5. Understanding the Use of Educational Technology among Faculty, Staff, and Students at a Medical University (United States)

    Kazley, Abby Swanson; Annan, Dustin L.; Carson, Nancy E.; Freeland, Melissa; Hodge, Ashley B.; Seif, Gretchen A.; Zoller, James S.


    A college of health professions at a medical university located in the southeastern United States is striving to increase the use of educational technology among faculty, staff, and students. A strategic planning group was formed and charged with enhancing the use of educational technology within the college. In order to understand the current…

  6. Attitudes of Cairo University medical students toward smoking: the need for tobacco control programs in medical education. (United States)

    Khan, Adeel A M; Dey, Subhojit; Taha, Alaa H; Huq, Farhan S; Moussawi, Ahmad H; Omar, Omar S; Soliman, Amr S


    Tobacco smoking rates are increasing in developing countries and so are tobacco-related chronic diseases. Reported figures from the WHO show rates of smoking in Egypt as high as 20% but limited information is available about smoking specifically among physicians and medical students. Final-year medical students of Cairo University were surveyed regarding their tobacco behavior and attitudes using a modified Global Health Professions Student Survey. We approached 220 students by randomly selecting clinical units into which they were assigned and requested completion of the survey. Ever users of some form of tobacco comprised 46.7% of students sampled, current users of cigarettes comprised 17.4%, and current users of water pipe 'sheesha' comprised 17.6%. The vast majority (87.7%) of students believed that smoking is a public health problem in Cairo and supported restriction of tobacco. Yet, only 58.5% stated that they were taught it is important for physicians to provide tobacco education materials to patients. Among ever users of cigarettes, 54.4% believed health professionals do not serve as health role models for patients, and only a small percentage of all students (34.2%) stated that they had received some form of training on smoking cessation in their medical curriculum to be able to instruct patients. A high rate of smoking was revealed among medical students in Cairo. Overall, approximately 23.4% of students were currently smoking cigarettes and/or sheesha, and 46.7% were ever users of some form of tobacco. A formal antitobacco program for medical students should be incorporated into their medical curriculum to change the attitudes of medical students and overcome the anticipated increase in chronic diseases in Egypt.

  7. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  8. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.


    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  9. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  10. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.


    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  11. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan


    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  12. Prevalence and predictors of suicidality among medical students in a public university. (United States)

    Tan, S T; Sherina, M S; Rampal, L; Normala, I


    Undergraduate medical students have been the most distressed group among the student population. Depression and anxiety have been found to be more prevalent in this group of students compared to others. This study was conducted to determine the prevalence and predictors of suicidality among undergraduate medical students in a public university. This was an analytical cross-sectional study, conducted in a public university in Selangor, Malaysia. Data were collected using self-administered questionnaires from January to February 2013, and analysed using the Statistical Package for Social Sciences Software (version 21). Out of 625 undergraduate medical students, 537 (85.9%) participated in the study. The prevalence of the suicidality among undergraduate medical students was 7.0%. The significant predictors of suicidality based on multiple logistic regression were the respondent's lifetime suicide attempts (Adjusted Odds Ratio, AOR 10.4, 95% CI 2.7 to 40.9); depression (AOR 5.9, 95% CI 1.5 to 23.0); breaking off a steady love relationship (AOR 5.4, 95% CI 1.3 to 22.4); hopelessness (AOR 4.9, 95% CI 1.1 to 21.6); and something valued being lost or stolen (AOR 4.4, 95% CI 1.2 to 15.9). These findings indicate that mental health care services should be strengthened at university level. The results show a need for an intervention programme to reduce suicidality among the undergraduate medical students.

  13. The Increasing Trend in Global Ranking of Websites of Iranian Medical Universities during January 2012-2015. (United States)

    Ramezan Ghorbani, Nahid; Fakour, Yousef; Nojoumi, Seyed Ali


    Researchers and academic institutions need assessment and rating to measure their performance. The criteria are designed to evaluate quality and adequacy of research and welcome by most universities as an international process to increase monitoring academic achievements. The study aimed to evaluate the increasing trend in global ranking of Iranian medical universities websites emphasizing on comparative approach. This is a cross-sectional study involving websites of Iranian medical universities. Sampling was conducted by census selecting universities affiliated to the Ministry of Health in webometrics rating system. Web sites of Iranian medical universities were investigated based on the webometrics indicators, global ranking as well as the process of changing their rating. Universities of medical sciences were associated with improved ratings in seven periods from Jan 2012 until Jan 2015. The highest rank was in Jan 2014. Tehran University of Medical Sciences ranked the first in all periods. The highest ratings were about impact factor in universities of medical sciences reflecting the low level of this index in university websites. The least ranking was observed in type 1 universities. Despite the criticisms and weaknesses of these webometrics criteria, they are critical to this equation and should be checked for authenticity and suitability of goals. Therefore, localizing these criteria by the advantages model, ranking systems features, continuous development and medical universities evaluation based on these indicators provide new opportunities for the development of the country especially through online media.

  14. Education at the Dittrick Museum of Medical History, Case Western Reserve University, Cleveland, Ohio, USA. (United States)

    Edmonson, James M


    The Dittrick Museum of Medical History pursues an educational mission as being part of a major research university. While the Dittrick dates to 1899 as a historical committee of the Cleveland Medical Library Association, it first affiliated with Case Western Reserve University in 1966, and became a department of the College of Arts and Sciences of CWRU in 1998. The Dittrick maintains a museum exhibition gallery that is open to the public free of charge, and museum staff provide guided tours on appointment. Much of the teaching and instruction at the Dittrick is conducted by university professors; their classes meet in the museum and use museum resources in the form of artifacts, images, archives, and rare books. Class projects using Dittrick collections may take the form of research papers, exhibitions, and online presentations. Dittrick staff assist in these classes and are available to help researchers use museum resources.

  15. Assessing the impact of faculty development fellowship in Shiraz University of Medical Sciences. (United States)

    Ebrahimi, Sedigheh; Kojuri, Javad


    Changing concepts of education have led many medical schools to design educational programs to enhance teaching skills, as traditional approaches cannot fulfill the current students' needs. The educational development of medical faculty members has recently received impetus in Iran and the Eastern Mediterranean region. The aim of this study was to investigate whether participation in a faculty development program reinforced new teaching skills. A teacher-training program was designed at Shiraz University of Medical Sciences to help medical instructors improve their teaching skills. The program, imparted in workshop format, covered effective teaching methods, feedback, knowledge assessment, and time management. Program sessions lasted four hours, four days each week for one month. Instruction was in the form of lectures, group discussions, case simulations, video presentations, and role-playing. All participants in the study (n = 219) belonged to the academic staff of Shiraz University of Medical Sciences. The participants highly rated the quality of the program. They felt that the educational intervention was appropriate and had a positive impact on their knowledge (P effectiveness of the program in strengthening the participants' teaching ability showed that students noticed significant improvements in the participants' teaching abilities (P effect on medical teachers' competencies, and we suggest that our educational intervention is effective in achieving its aims. Further research should investigate whether this faculty development program actually results in improved teaching performance.

  16. Knowledge, Attitudes and Practices towards Medication Use among Health Care Students in King Saud University

    Directory of Open Access Journals (Sweden)

    Abdullah T. Eissa


    Full Text Available Background: Health sciences students are expected to have appropriate knowledge and attitudes toward medication use. However, literary evidence of such expertise among health sciences students of King Saud University is unknown. This study was completed to assess the knowledge about medicines and behavior of health science students towards safe use of medications. It also aims to assess the health knowledge, attitude and practices of the students. Methods: This cross-sectional study used a questionnaire consisting of 24 questions. This was administered by the researcher between October and December 2009 in the colleges of medicine, dentistry, pharmacy, applied medical science and nursing of the King Saud University. The survey consisted of three parts: Ten questions assessed the students’ knowledge on drug safety (Part 1. Four questions assessed student attitude toward medication consultations by the pharmacist (Part 2 and ten questions involved medication use practices and consultation with pharmacists (Part 3. A stratified sampling method was used to select participants. Results: Pharmacy students had better medication knowledge compared to other health sciences students especially regarding antihypertensive drugs, antibiotics, paracetamol and antacids (p<0.05. Pharmacy students showed a positive attitude regarding the trustworthiness of a pharmacist to give a consultation. Nearly all other health science students showed a negative attitude about dispensing and consultation concerning nutritional supplements by a pharmacist. All health sciences students had a similar perception toward medication use and practice. Conclusion Pharmacy students had better knowledge about medication practice compared to other health sciences students. All other health sciences students lacked the appropriate attitude and practice related to the safe use of medications.

  17. Patenting of university and non-university public research organisations in Germany: evidence from patent applications for medical research results.

    Directory of Open Access Journals (Sweden)

    Peter Tinnemann

    Full Text Available BACKGROUND: Patents are one of the most important forms of intellectual property. They grant a time-limited exclusivity on the use of an invention allowing the recuperation of research costs. The use of patents is fiercely debated for medical innovation and especially controversial for publicly funded research, where the patent holder is an institution accountable to public interest. Despite this controversy, for the situation in Germany almost no empirical information exists. The purpose of this study is to examine the amount, types and trends of patent applications for health products submitted by German public research organisations. METHODS/PRINCIPAL FINDINGS: We conducted a systematic search for patent documents using the publicly accessible database search interface of the German Patent and Trademark Office. We defined keywords and search criteria and developed search patterns for the database request. We retrieved documents with application date between 1988 and 2006 and processed the collected data stepwise to compile the most relevant documents in patent families for further analysis. We developed a rationale and present individual steps of a systematic method to request and process patent data from a publicly accessible database. We retrieved and processed 10194 patent documents. Out of these, we identified 1772 relevant patent families, applied for by 193 different universities and non-university public research organisations. 827 (47% of these patent families contained granted patents. The number of patent applications submitted by universities and university-affiliated institutions more than tripled since the introduction of legal reforms in 2002, constituting almost half of all patent applications and accounting for most of the post-reform increase. Patenting of most non-university public research organisations remained stable. CONCLUSIONS: We search, process and analyse patent applications from publicly accessible databases

  18. Job dissatisfaction in lecturers in School of Medical Sciences Universiti Sains Malaysia and Faculty of Medicine Universiti Kebangsaan Malaysia. (United States)

    Huda, B Z; Rusli, B N; Naing, L; Tengku, M A; Winn, T; Rampal, K G


    Job dissatisfaction in doctors and teachers is known to have direct consequences on the quality of service and teaching for patients and students respectively. A cross-sectional study to assess dissatisfaction in lecturers of School of Medical Sciences, Universiti Sains Malaysia (USM) and Faculty of Medicine, Universiti Kebangsaan Malaysia (UKM) was undertaken between August 2001 and May 2002. The original English version of the Job Content Questionnaire (CQ) version 1.7 (revised 1997) by Robert Karasek was self-administered to 73 (response rate 58.4%) and 80 (response rate 41.7%) lecturers in the medical faculties of USM and UKM, respectively. The prevalence of job dissatisfaction in USM and UKM lecturers were 42.6% and 42.9%, respectively; the difference was not significant (p>0.05). Risk factors of job dissatisfaction in USM lecturers were decision authority (pjob demand (pjob dissatisfaction in UKM lecturers were skill discretion (pjob demand (pjob demand was a risk factor of job dissatisfaction in both USM and UKM lecturers; in USM, decision authority was protective, while in UKM, skill discretion was protective against job dissatisfaction.

  19. Should Undergraduate Lectures be Compulsory? The Views of Dental and Medical Students from a UK University

    Directory of Open Access Journals (Sweden)

    Alaa Daud


    Full Text Available Formal lectures have been a traditional part of medical and dental education, but there is debate as to their compulsory status. This study was designed to explore dental and medical students’ views on compulsory lectures and the use of Video-Recorded Lectures (VRL. A cross-sectional study of University of Bristol students in Years 2 to 4 was conducted using an online questionnaire. The majority of both dental (76% and medical (66% students felt lectures should be non-compulsory. The most common learning resources used by both dental and medical students were live lectures, lecture handouts and VRL. The majority of both dental (84% and medical (88% students used VRL. Most students attended lectures all of the time both before and after the introduction of VRL, even though most dental and medical students believe lectures should be non-compulsory. VRL is a popular learning resource. These findings tie-in with General Dental Council and General Medical Council recommendations that encourage self-directed learning. Dental and Medical schools should offer a range of learning resources and make use of current technology, including the use of VRL.

  20. A Survey of Cultural Infrastructure and Performance in Medical Sciences Universities of Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Feizi


    Full Text Available ​Background and objectives: Recently, the role of universities in developing and education of culture is considered increasingly but Iranian universities have great distance in achieving the desired objectives in this context. So, this study aimed to survey the cultural infrastructure and performance in medical sciences universities of Iran. Material and Methods: This is a cross-sectional study that was done using researcher-made checklist which its face and content validity were approved by the cultural experts' opinion via statistical indicators. The study was conducted in census method by responses of 25 managers of cultural affairs in medical sciences universities of Iran. The obtained data were analyzed descriptively and results were reported as frequency (percentages for qualitative and mean (standard deviation for quantitative variable. Results: The study results were presented in four areas: “the general status of universities in cultural affairs”, “cultural facilities of the universities”, “the activity of cultural organizations and publications in universities” and “performance of cultural deputies”. The results showed that although there are considerable strengths, the significant weaknesses are evident in all areas. The results of the present study were focused solely on the quantity of functions, and quality evaluation of each activity requires special attention and further investigations and interventions. Conclusion: Researchers hope that the authorities and planners use the results of this study and similar studies especially in quality of cultural practices of universities and move towards improving the status of culture in medical sciences universities in developing Iranian-Islamic culture.

  1. Research priorities in medical education at Shiraz University of Medical Sciences: categories and subcategories in the Iranian context

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Research in education is a globally significant issue without a long history. Due to the importance of the issue in Health System Development programs, this study intended to determine research priorities in medical education, considering their details and functions. By determining barriers existing in research in education progress, it is tried to make research priorities more functional by recommending acceptable strategies. Methods: This is a qualitative-descriptive study in two descriptive phases. The goal of these phases was to determine research priorities subcategories in medical education by Nominal Group Technique (NGT and two rounds of Delphi method. Through the first phase, subcategories of research priorities were determined, using Nominal Group Technique under medical education experts’ supervision. Through two rounds of Delphi, a questionnaire was constructed based on the subcategories. Eventually, research priorities were determined based on their highest score (scores more than 7 out of 10. Results: In the first phase (NGT, 35 priorities in 5 major fields of medical education were presented. In the second phase, priorities were scored, using Delphi method. Medical Ethics and professionalism gained the highest scores (7.63±1.26 and educational evaluation the lowest (7.28±1.52. In this stage, 7 items were omitted but 2 of them were added again after experts’ revision in the third round of Delphi. Conclusion: According to the results of the present study and based on previous studies, it really seems that the fields of “Learning and Teaching Approaches” and “Medical Ethics and Professionalism” were more important. Because of financial and resource limitations in our country and the importance of research priorities, it is recommended to frequently study “research priorities determination program” at universities.

  2. [Reliability and validity of assessment of educational outcomes obtained by students of Medical Rescue at Medical University of Warsaw]. (United States)

    Panczyk, Mariusz; Stachacz, Grzegorz; Gałązkowski, Robert; Gotlib, Joanna


    In the interest of preservation of high degree of objectivity of information about students' educational outcomes, a system of assessment needs to meet criteria of appropriate reliability and validity. Analysis of reliability and validity of the system of assessment of students' educational outcomes for courses followed by an examination and covered by a curriculum in Medical Rescue at Medical University of Warsaw (MU W). A retrospective study enrolling a group of 421 students of eight subsequent full education cycles. Detailed data concerning grades for fourteen courses followed by an examination in the entire course of studies were collected. Reliability (Cronbach's alpha coefficient) and criteria validity (Spearman's rank correlation) were assessed. Internal consistency was estimated using a multiple regression model. The levels of assessment reliability for the general university, pre-clinical, and clinical scopes amounted to alpha: 0.42, 0.53, and 0.70, respectively. The strongest positive correlations between the results of pre-clinical and clinical trainings were found for the Anatomy course (r ≈ 0.30). Only in the case of the Pharmacology course it was found that students' achievements in this field were significantly correlated with all other courses of clinical training. The influence of educational outcomes in particular areas of clinical training on the final grade for the entire course of studies was diverse (β regression between 0.04 and 0.11). While the Pharmacology course had the strongest impact on final results, the Surgery course had the least influence on students' final grades (β = 0.04). 1. Sufficient reliability of the system of assessment of educational outcomes in Medical Rescue showed good precision and repeatability of assessment. 2. A low level of validity was caused by a failure to keep the appropriateness of the assessment of educational outcomes in several clinical courses. 3. Prognostic and diagnostic validity of methods used for

  3. Medical and surgical ward rounds in teaching hospitals of Kuwait University: students’ perceptions

    Directory of Open Access Journals (Sweden)

    AlMutar S


    Full Text Available Sara AlMutar,1 Lulwa AlTourah,1 Hussain Sadeq,2 Jumanah Karim,2 Yousef Marwan3 1Department of Medicine, 2Department of Pediatrics, Mubarak Al-Kabeer Hospital, 3Department of Orthopedic Surgery, Al-Razi Orthopedic Hospital, Kuwait City, Kuwait Background: Teaching sessions for medical students during ward rounds are an essential component of bedside teaching, providing students with the opportunity to regard patients as actual people, and to observe their physical conditions directly, allowing a better understanding of illnesses to be developed. We aim to explore medical students’ perceptions regarding medical and surgical ward rounds within the Faculty of Medicine at Kuwait University, and to evaluate whether this teaching activity is meeting the expectation of learners. Methods: A pretested questionnaire was used to collect data from 141 medical students during the 2012–2013 academic year. They were asked to provide their current and expected ratings about competencies that were supposed to be gained during ward rounds, on a scale from 1 (lowest to 5 (highest. Mean scores were calculated, and the Student t-test was used to compare results. P < 0.05 was the cut-off level for significance. Results: Only 17 students (12.1% declined to participate in the study. The students' current competency scores (for competencies taught within both disciplines – medical and surgical were significantly lower than the scores indicating students’ expectations (P < 0.001. The best-taught competency was bedside examination, in both medical (mean: 3.45 and surgical (mean: 3.05 ward rounds. However, medical ward rounds were better than surgical rounds in covering some competencies, especially the teaching of professional attitude and approach towards patients (P < 0.001. Conclusion: Both medical and surgical ward rounds were deficient in meeting the students’ expectations. Medical educators should utilize the available literature to improve the bedside

  4. Medical students perception of undergraduate ophthalmology training in Nnamdi Azikiwe University Nnewi Campus. (United States)

    Onyekwe, L O; Nwosu, S N N


    To determine the perception and aspiration of medical students towards ophthalmology. Information for the study was obtained through forced-choice questionnaire set to 102 medical students in 2000/2001 graduating class in Nnamdi Azikiwe University. One hundred questionnaires were completed. As a specialty of choice ophthalmology ranked fourth {16.0%} as a first choice; second {21.0%} as a second choice and first {26.0%} as a third choice. Ninety-five of respondents found ophthalmology training useful. This cohort of medical students considered ophthalmic training in this institution essential and adequate. Undergraduate ophthalmic course should ensure an understanding of the basic principles of ophthalmology and should be designed to motivate the interest and confidence of the medical students in the specialty. Training period should be at least 4 weeks. With appropriate training ophthalmology can attract reasonable interest as a choice for specification.

  5. A university-sponsored home health nursing program in Karachi, Pakistan. (United States)

    Smego, Raymond A; Khan, Mohammad Aslam; Khowaja, Khurshid; Rafique, Rozina; Datoo, Farida


    This article describes a university-sponsored home health nursing program in a large urban center in Pakistan and details the essential elements needed in implementing such a program in a developing country. Compared to in-hospital treatment, home healthcare reduced hospital stay from 12.8 days to 3.9 days, and resulted in a net savings of Pakistani rupees (PRs) 5,374,135 (USD 89,569). A cost-effective home treatment program in a resource-limited country can be successfully implemented by using the hospital pharmacy as the central point for the preparation and distribution of medications and specialty nursing services.

  6. Drug use prevalence among students of universities of medical sciences in Tehran

    Directory of Open Access Journals (Sweden)

    Farhad Taremian


    Full Text Available Objective: This study was aimed to determine the prevalence of drug use among students of universities of Medical Sciences in Tehran. Method: Four thousands of medical students (both sexes in academic year 1388-89 in different level of education, B.A., M.Sc. and Ph.D. were selected by random stratified sampling method. These students were selected from Iran, Tehran and Shahid Beheshti Universities of Medical Sciences considering their sex and level of education. We used drug use prevalence questionnaire. Findings: The most prevalent drug of abuse in life time period was qalyan (classical pipe, followed by cigarette, and alcohol. The least frequent drug of abuse was Shisheh, followed by heroine krack. As we expected, drugs morphine, ritalin and tramadol were placed in forth, fifth and sixth of prevalent drugs. Use of different substances was significantly more prevalent in male students. Conclusion: Using soft drugs (qalyan, cigarette and alcohol was more prevalent than hard drugs (hashish, taryak, heroine kerack among Universities Medical Sciences of Tehran. Similar to drug use pattern in society, use of all of drugs were more prevalent in male students. We should pay special attention to use of drugs such as tramadol, ritalin, petedin and morphine.

  7. Developing a Model of Tuition Fee Calculation for Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Seyed Amir Mohsen Ziaee


    Full Text Available Background: The aim of our study was to introduce and evaluate a practicable model for tuition fee calculation of each medical field in universities of medical sciences in Iran.Methods: Fifty experts in 11 panels were interviewed to identify variables that affect tuition fee calculation. This led to key points including total budgets, expenses of the universities, different fields’ attractiveness, universities’ attractiveness, and education quality. Tuition fees were calculated for different levels of education, such as post-diploma, Bachelor, Master, and Doctor of Philosophy (Ph.D degrees, Medical specialty, and Fellowship. After tuition fee calculation, the model was tested during 2013-2015. Since then, a questionnaire including 20 questions was prepared. All Universities’ financial and educational managers were asked to respond to the questions regarding the model’s reliability and effectiveness.Results: According to the results, fields’ attractiveness, universities’ attractiveness, zone distinction and education quality were selected as effective variables for tuition fee calculation. In this model, tuition fees per student were calculated for the year 2013, and, therefore, the inflation rate of the same year was used. Testing of the model showed that there is a 92% of satisfaction. This model is used by medical science universities in Iran.Conclusion: Education quality, zone coefficient, fields’ attractiveness, universities’ attractiveness, inflation rate, and portion of each level of education were the most important variables affecting tuition fee calculation.Keywords: TUITION FEES, FIELD’S ATTRACTIVENESS, UNIVERSITIES’ ATTRACTIVENESS, ZONE DISTINCTION, EDUCATION QUALITY

  8. Strategies to Improve Students’ Educational Achievement Motivation at Guilan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Mahdokht Taheri


    Full Text Available Introduction: In view of the fact that motivation is linked directly to the learning process and educational achievement, this study endeavored to identify strategies to improve students’ educational achievement motivation at Guilan University of Medical Sciences. Methods: To conduct this descriptive-analytical study, 368 students from Guilan University of Medical Sciences were selected using simple random sampling from 2013-2014. All of the Guilan University of Medical Sciences’ students met the general eligibility criteria except guest students. The questionnaire included five domains of economic, socio-cultural, educational, geo-regional, and personality factors in educational achievement motivation. Through using descriptive and inferential statistics (Kolmogorov-Smirnov, Mann-Whitney U and Kruskal-Wallis tests, the compiled data were analyzed at the significance level of 0.05. Results: Data analysis revealed that socio-cultural factors have the maximum score (64.14 ± 9.92 and geo-regional factors have the minimum score (19.01±3.63 on the participants’ educational achievement motivation. What is more, a significant difference was revealed between educational field and educational effective factors as well as educational level and educational effective factors (p<0.011, p<0.004, respectively. Conclusion: Given that the socio-cultural factors had the maximum score on the students’ educational achievement motivation, it is recommended that university officials take these factors into account, and attempt to plan to provide appropriate strategies to enhance their students’ motivation, specifically their educational achievement motivation.


    Directory of Open Access Journals (Sweden)

    Svetoslav Garov


    Full Text Available Introduction: There are five Bulgarian medical universities in the cities of Sofia, Plovdiv, Varna, Pleven and Stara Zagora. A major priority of medical universities is to encourage research activities mainly aimed at preparation and implementation of research projects. Projects are managed by the participating organizations called “beneficiaries”. Beneficiaries develop projects, apply for finances and if approved they implement those projects.Aim: The purpose of our study is to examine the organizational structure of research project activities on the macro level and on the micro level in Bulgarian medical universities.Material and methods: In order to define the separate elements of the organizational structure and to analyze the relations and interaction between them we have applied a documentary and sociological approach. Results: During the last six years there was a significant increase in the number and the overall annual financial value of the projects performed at medical universities in Bulgaria. The reasons for such increase are: managers realizing the advantages of and benefits from the implementation of research projects ensuring high quality modernization of research units’ equipment and facilities; access to innovative technologies; development of interdisciplinary relations, etc. Benefits arising from improved results motivate us to consider as appropriate some additional investments aimed at increasing the number of team members and further optimization of the currently existing structures (research centers in charge of research with the purpose of achieving even better results in this particular field. Conclusion: The role of research project activities in medical universities’ research field is of vital importance for the educational institutions’ success. Taking into consideration the changed conditions, European possibilities and the highly competitive environment, realizing this aspect will be essential for the

  10. Job Satisfaction in Basic and Clinical Faculty Members in Shiraz University of Medical Sciences, Iran

    Directory of Open Access Journals (Sweden)

    Mehdi Saberi-Firoozi


    Full Text Available Background and Purpose: Shiraz University of Medical Sciences as one of the oldest and largest universities of medicine in Iran with 50 years history has more than 450 faculty members and 5000 students. This study is an attempt to find out the level of job satisfaction among Shiraz University ofMedical Sciences’ faculty members.Methods: In midterm of 2003-2004, data on job satisfaction level among 404 faculty members from all schools of Shiraz University of Medical Sciences were collected. The translation of Spector’s job satisfaction score was used including 34 questions in 9 items of job satisfaction and each one based on Likert’s Scale with score an of 1-5. A question related to overall job satisfaction of faculty members was added.Results: Of all faculties,, 252 responded to the questionnaire and 70.1% expressed satisfaction in response the added question. The mean scores of job satisfaction in items of coworkers, work nature, supervision, management methods, academic relations, promotion, salary and suitable benefits were3.771, 3.265, 2.557, 2.454, 2.395, and 2.376 out of 5 respectively (F=223.8, p=0.0001. In the promotion item, the satisfaction of female faculty was lower than male subjects. The level of job satisfaction was not different between clinical faculty members of Medical School with or without private activity. The results of linear regression analysis between the items of job satisfaction revealed that reimbursement and fringe benefits could predict the overall job satisfaction (r2=0.70, p<0.01.Conclusion: As a whole, the faculty members of the university were satisfied with their jobs, but a correction in reimbursement, benefits and promotion regulations especially in lower academic ranks is needed to improve the level of job satisfaction in this group.Key words: JOB SATISFACTION, FACULTY MEMBER, BASIC AND CLINICAL DEPARTMENTS, FULLTIME, PART-TIME

  11. Financial and Transactional Bylaw of Universities and Faculties of Medical Sciences: Opportunities and Threats

    Directory of Open Access Journals (Sweden)

    Masoud Abolhallaje


    Full Text Available Background and purpose: According to developments related to the relative autonomy of universities and acquired extensive powers by the board of trustees of universities of medical sciences and healthcare services in a twenty-year perspective of country and in the context of the fourth and fifth socio-economic cultural development of country, necessity of developing financial and transactional bylaw of universities of medical sciences has become increasingly clear throughout country. Materials and Methods: Grounded theory is the qualitative methodology used for this study in order to identify the threats and opportunities of new financial tax bylaw of universities and faculties of medical sciences and through the study of documents, surveys of experts and beneficiaries and elites by Delphi method. Results: Releasing potential of public administration in order to control sources and uses, increasing management confidence in documented decision making, establishing organizational concentration on controlling costs, providing conditions of decision-making according to financial reports, independency in firing and hiring manpower by adopting specific provisions and creating independency in method of keeping accounts are among the most important opportunities. While poor organizational structure, lack of knowledge and skills in the existing structure, mental processes caused by reactions and incompatibility of staff, lack of criteria and rules in selection appointment and dismissal of managers and employees, lack of discipline and proper mechanisms in order to pursue the purposes, calculating financial burden and human resources required and finally, passing through traditional thinking and management system are among the most threats. Conclusion: Considering the mentioned threats and opportunities, financial and transactional bylaw of universities and faculties of medical sciences was basically revised and modified in January 2006, and then after

  12. Confirmatory Factor Analysis of the Universiti Sains Malaysia Emotional Quotient Inventory Among Medical Students in Malaysia

    Directory of Open Access Journals (Sweden)

    Wan Nor Arifin


    Full Text Available The Universiti Sains Malaysia Emotional Quotient Inventory (USMEQ-i is a Malay-language emotional intelligence (EI inventory that was based on a mixed-model approach of EI. It was specifically developed and validated for use among medical course applicants. However, evidence to support its use among medical students is inadequate. This study aims to provide further construct validity evidence for the USMEQ-i among medical students through confirmatory factor analysis (CFA. A cross-sectional study was carried out on a sample of 479 medical students in Universiti Sains Malaysia (USM. After a preliminary analysis, data from only 317 respondents were found suitable for inclusion in CFA. CFA was performed using the maximum likelihood estimation method with bootstrapping due to the nonnormality of items at the multivariate level. The results of the analysis support the two-factor model of the EI component and the one-factor model of the faking component. However, the USMEQ-i should be administered with caution until further cross-validation studies are conducted among students in other medical schools in Malaysia.

  13. Scientific production of Vice Chancellors for Research in Peruvian universities with a medical school. (United States)

    Herrera-Añazco, Percy; Valenzuela-Rodríguez, Germán; Pacheco-Mendoza, Josmel; Málaga, Germán


    To determine the scientific production of Research Vice-chancellors at Peruvian universities that have medical schools, as well as their academic degrees as an indirect way to evaluate their suitability for the position they hold. We searched all Peruvian universities that register medical schools. Of these, the scientific production of the universities registered in SCOPUS was identified in September of the 2016. The scientific production of the vice chancellors of investigation of these faculties of medicine was determined through the search of its scientific publications registered in SCOPUS and those reported in the National Registry of Researchers in Science and Technology. Academic degrees were obtained from the database of the National Superintendence of Higher University Education. The sample included 28 research vice chancellors. Only 4/28 had any publications. The average number of articles published by the vice chancellors of research was 1.71, the number of citations 23.1 on average and the H index 0.64. Besides, 22 Vice-chancellors of research had the degree of doctor, four had the degree of bachelor and two the degree of master. The scientific production of research vice chancellors is poor. The required academic grade requirement for the position is not met in all cases. It is likely that, having no research experience, his leadership in directing a university's research policies may be questioned.

  14. Evaluation of self-medication amongst university students in Abbottabad, Pakistan; prevalence, attitude and causes. (United States)

    Ullah, Hanif; Khan, Shujaat A; Ali, Sayyad; Karim, Sabiha; Baseer, Abdul; Chohan, Ossam; Hassan, Syed M F; Khan, Kashif M; Murtaza, Ghulam


    Self-medication is a serious issue in most parts of the world. This study aims to evaluate self-medication among university students of Abbottabad, Pakistan. This cross-sectional survey study was carried out in COMSATS Institute of Information Technology, Abbottabad during December 1 - December 31,2011. A sample of 275 students was selected for the study using convenience method of sampling. Data were managed and analyzed via SPSS version 16.0. Inferences were drawn using Z-test Out of 268 respondents (male = 61.6%, female = 38.6%), 138 were non-health professional students whereas 130 were health professional students. The prevalence of self-medication was 95.5%. Most common factor (45.7%) responsible for self-medication was "low severity of disease". Most common symptom (50.8%) that caused self-medication and stocking of medicines was "storage of medicines for multi purposes". Some respondents (22.7%) got addicted due to self-medication. Most of the students trust in allopathic medicines system. High prevalence of self-medication can be controlled through regulatory authorities, mass education and availability of health facilities.

  15. Knowledge and perception of physiotherapy by final year medical students of a Nigerian university. (United States)

    Odebiyi, D O; Omotunde, A O; Aiyejusunle, C B; Olalekan, T A


    It has been shown that multidisciplinary interactions have become a feature of the changing medical education system. It is not clear to what extent medical students have been integrated into this newer model, more especially at the College of Medicine of the University of Lagos (CMUL), AIM: To assess the level of knowledge and perception of physiotherapy by the final year medical students of CMUL about physiotherapy. Ninety eight final year medical students of CMUL participated in the study. They were required to complete a standard 22 item closed-ended questionnaire which was self administered. Data were presented as mean +/- standard deviation; Inferential statistics of chi-square and t-tests were used to compare differences between variables. The respondents displayed above average knowledge of physiotherapy as the mean scores obtained for knowledge of physiotherapy were 20.25 +/- 4.50 and 18.77 +/- 4.60 for males and females respectively. They also showed a fair perception towards physiotherapy as the mean scores obtained were 32.70 +/- 7.20 and 34.33 +/- 7.30 for males and females respectively. However there was a significant gender difference in the medical students' knowledge of physiotherapy (p students of CMUL had a good knowledge and fair perception of physiotherapy. Their main source of knowledge was classroom lectures. The need for further education of medical students with particular emphasis on clinical interaction was identified. It is hereby suggested that interprofessional courses and communication should be given greater attention during medical training.

  16. [Prospective assessment of medication errors in critically ill patients in a university hospital]. (United States)

    Salazar L, Nicole; Jirón A, Marcela; Escobar O, Leslie; Tobar, Eduardo; Romero, Carlos


    Critically ill patients are especially vulnerable to medication errors (ME) due to their severe clinical situation and the complexities of their management. To determine the frequency and characteristics of ME and identify shortcomings in the processes of medication management in an Intensive Care Unit. During a 3 months period, an observational prospective and randomized study was carried out in the ICU of a university hospital. Every step of patient's medication management (prescription, transcription, dispensation, preparation and administration) was evaluated by an external trained professional. Steps with higher frequency of ME and their therapeutic groups involved were identified. Medications errors were classified according to the National Coordinating Council for Medication Error Reporting and Prevention. In 52 of 124 patients evaluated, 66 ME were found in 194 drugs prescribed. In 34% of prescribed drugs, there was at least 1 ME during its use. Half of ME occurred during medication administration, mainly due to problems in infusion rates and schedule times. Antibacterial drugs had the highest rate of ME. We found a 34% rate of ME per drug prescribed, which is in concordance with international reports. The identification of those steps more prone to ME in the ICU, will allow the implementation of an intervention program to improve the quality and security of medication management.

  17. Developing eLearning Technologies to Implement Competency Based Medical Education: Experiences from Muhimbili University of Health and Allied Sciences (United States)

    Nagunwa, Thomas; Lwoga, Edda


    This paper provides the practical experience of developing an eLearning technology as a tool to implement Competency-based Medical Education (CBME) in Tanzania medical universities, with a specific focus on Muhimbili University of Health and Allied Sciences. The paper provides a background to eLearning and the early attempt to adopt it in 2006 at…

  18. How Medical Statistics has been established at the University of Freiburg: a historical perspective

    Directory of Open Access Journals (Sweden)

    Schumacher, Martin


    Full Text Available This contribution gives an outline on the reasons why the Faculty of Medicine at the University of Freiburg established an Institute of Medical Statistics and Documentation about fourty years ago as one of the first in Germany. It will be shown that the Professor of Medical Microbiology and Hygiene at that time initiated and promoted this development being himself motivated by the successful implementation of a vaccine against poliomyelitis through rigorous design, conduct and statistical analysis of a large scale field trial.

  19. The situation analysis of the international relations management and inter-university collaboration in Tabriz University of Medical Sciences, Iran, during the years 2005-2010

    Directory of Open Access Journals (Sweden)

    Alireza Farajollahi


    Full Text Available BACKGROUND: Nowadays, with the development of science and communication, collaboration with other countriesand universities seems inevitable to universities. The aim of this study was to analyze the situation of internationalrelations management and inter-university collaboration (IRM-IUC in Tabriz University of Medical Sciences (TUMS,Iran, during the years 2005-2010. METHODS: In this descriptive study, one checklist was used for analysis of the inter-university collaboration management and another one for the situation analysis of international relations management which included 4 sections itself. There were a total of 56 questions designed and developed through literature review and the expert panel.RESULTS: The results indicated the poor performance of Tabriz University of Medical Sciences in the international relations management and inter-university collaboration fields. Most of the reviewed items had not been adequatelypaid attention to in the management of international relations and only one out of 14 evaluated items was considered inthe field of inter-university collaboration. CONCLUSIONS: In line with the overall globalization process, education and research have also become globalizedprocesses, and as a result, it is necessary for universities to develop effective ties and relationships with otherorganizations. However, Tabriz University of Medical Sciences has not been doing quite optimally in this regard. Thus,it is suggested that, based on the shortcomings pointed out in this study, new appropriate plans and policies be set todevelop fruitful and effective relations and correspondences with other universities and countries.

  20. Impact of universal medical insurance system on the accessibility of medical service supply and affordability of patients in China (United States)

    Zhang, Zhiguo; Ren, Jing; Zhang, Jie; Pan, Xiaoyun; Zhang, Liang; Jin, Si


    Background China’s universal medical insurance system (UMIS) is designed to promote social fairness through improving access to medical services and reducing out-of-pocket (OOP) costs for all Chinese. However, it is still not known whether UMIS has a significant impact on the accessibility of medical service supply and the affordability, as well as the seeking-care choice, of patients in China. Methods Segmented time-series regression analysis, as a powerful statistical method of interrupted time series design, was used to estimate the changes in the quantity and quality of medical service supply before and after the implementation of UMIS. The rates of catastrophic payments and seeking-care choices for UMIS beneficiaries were selected to measure the affordability and medical service flow of patients after the implementation of UMIS. Results China’s UMIS was established in 2008. After that, the trending increase of the expenditure of the UMIS was higher than that of increase in revenue compared to previous years. Up to 2014, the UMIS had covered 97.5% of the entire population in China. After introduction of the UMIS, there were significant increases in licensed physicians, nurses, and hospital beds per 1000 individuals. In addition, hospital outpatient visits and inpatient visits per year increased compared to the pre-UMIS period. The average fatality rate of inpatients in the overall hospital and general hospital and the average fatality rate due to acute myocardial infarction (AMI) in general hospitals was significantly decreased. In contrast, no significant and prospective changes were observed in rural physicians per 1000 individuals, inpatient visits and inpatient fatality rate in the community centers and township hospitals compared to the pre-UMIS period. After 2008, the rates of catastrophic payments for UMIS inpatients at different income levels were declining at three levels of hospitals. Whichever income level, the rate of catastrophic payments for

  1. The performance of select universities of medical sciences based on the components affecting medical education [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Mehdi Tayebi Arasteh


    Full Text Available Background: Every educational institution requires an evaluation system in order to find out about the quality and desirability of its activities, especially if it is a complex and dynamic environment. The present study was conducted to evaluate the educational performance of schools affiliated to Alborz University of Medical Sciences to help improve their performance. Methods: This descriptive analytical study was conducted in six schools affiliated to Alborz University of Medical Sciences in April 2016-October 2016 and October 2016-April 2017. The evaluation was carried out in two stages: self-assessment by service executives across schools, and external assessment in person by the university’s expert staff. The study tools included the components, criteria and desirable standards of educational performance in ten categories. Data were analyzed in SPSS. Results: The results obtained showed that, in April-October 2016, the highest performance evaluation scores pertained to the "secure testing" and "rules and regulations" components and the lowest to the "packages for reform and innovation in education" and "the school action plan" components. In October 2016-April 2017, the highest scores pertained to "workforce empowerment" and "secure testing" and the lowest to "faculty affairs" and "electronic education management system". Conclusions: Offering a balanced portrayal of the actual performance of schools using the right performance indicators in two consecutive periods can help further motivate the superior schools and encourage the weaker schools to strive harder. Competition among schools to get a higher score in the components affecting medical education helps mobilize them to move toward reform and improvement.

  2. A survey on the quality of Master of Medical Education e-learning Course at Mashhad University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    M nobakht


    Full Text Available Introduction:Universities and educational institutes provide a great variety of e-learning programs to accommodate the increasing demands for higher education. However, some specialists believe that many of these courses fail to meet the required standards of e-learning, thus cannot achieve the goals of implemented programs. Therefore, regular quality assessment of e-learning programs should be carried out by education providers. This study aimed to assess the quality of medical education e-learning course at Mashhad University of Medical Science. Methods:In the first step, most important components of e-learning standards were extracted through a comprehensive literature review of previous studies and a rating scale consisting of nine elements and 173 items were designed. Content validity of the scale was assured by consulting with ten different instructional design experts using Lawshe's Content Validity Ratio. Reliability of this scale is also investigated by inter-rater reliability coefficient which was 88% . In the next step we provided three instructional design experts with the above mentioned scale to collect required information for each sample lesson. Data was analyzed through SPSS Ver 16.0 software. Result: The elements associated with ‘quality of contents’ and ‘accessibility’ were satisfactory, elements related to ‘instructional design’, ’learning management system’, ’multimedia’ and ‘student assessment’ were relatively satisfactory, and elements associated with ‘interaction’, ‘feedback’ and ‘student support’ were unsatisfactory. Overall, we evaluated the quality of the medical education e-learning course as relatively satisfactory. Conclusion: Although the quality of the assessed e-learning course was relatively satisfactory, it is still necessary for corresponding administrators to reassess those items with an average of less than 1.66 (satisfactory level and pay their special attentions to

  3. Study the relationship between medical sciences students’ self-esteem and academic achievement of Guilan university of medical sciences (United States)

    Jirdehi, Maryam Mirzaee; Asgari, Fariba; Tabari, Rasool; Leyli, Ehsan Kazemnejad


    BACKGROUND: Achievement of productivity and improvement of quality in the educational system is the effective, influential factors for countries development. Academic achievement is the main objective of the training program and the most important concerns of teachers, education officials, and university Student's families. Self-esteem is one of the factors affecting student academic achievement. This study is aimed to investigate the relationship between self-esteem and academic achievement in Medical Sciences students of in 2014–2015. SUBJECTS AND METHODS: This is a descriptive–correlational study. In this study, 537 university students were selected using random stratified sampling method from Guilan University of Medical Sciences in 2014–2015. Data were collected using the standard self-esteem questionnaire of Cooper Smith consisting of four elements (general, social, familial, and educational) and a demographic questionnaire. Data were analyzed using SPSS software version 21 and descriptive statistics such as Spearman correlation and Logistic Regression. RESULTS: The results indicated a significant relationship between grade point average and educational self-esteem (P = 0.002, r = 0.135) and global self-esteem (P = 0.02, r = 0.102). There was also a significant relationship between composite Index educational status and general self-esteem (P = 0.019, r = 0.102) and academic achievement (P = 0.007, r = 0.116) and global self-esteem (P = 0.020, r = 0.102). CONCLUSIONS: According to the results, the highest mean score of self-esteem was related to the familial element, and the lowest average was in terms of social self-esteem, therefore, given the importance and necessity of self-esteem in academic achievement, strengthening of all aspects of self-esteem is suggested. PMID:29693033

  4. Designing and conducting MD/MPH dual degree program in the Medical School of Shiraz University of Medical Sciences. (United States)

    Salehi, Alireza; Hashemi, Neda; Saber, Mahboobeh; Imanieh, Mohammad Hadi


    Many studies have focused on the need of health systems to educated physicians in the clinical prevention, research methodology, epidemiology and health care management and emphasize the important role of this training in the public health promotion. On this basis, Shiraz University of Medical Sciences (SUMS) has established MD/MPH dual degree program since the year 2012. In the current study, Delphi technique was used. Both qualitative and quantitative methods were applied in the Delphi process. The Delphi team members including experts with extensive experience in teaching, research and administration in the field of educational management and health/medical education reached consensus in almost 86% of the questionnaire items through three Delphi rounds. MD/MPH program for SUMS was designed based on the items agreed and thematic analysis used in these rounds. The goals, values, mission and program requirements including the period, the entrance condition, and the number of units, and certification were determined. Accordingly, the courses of the program are presented in parallel with the MD education period. MPH courses consist of 35 units including 16 obligatory and 15 voluntary ones. Designing MD/MPH program in SUMS based on the existent models in the universities in different countries, compatible with educational program of this university and needs of national health system in Iran, can be a beneficial measure towards promoting the students' knowledge and theoretical/practical skills in both individual and social level. Performing some additional research to assess the MD/MPH program and some cohort studies to evaluate the effect of this program on the students' future professional life is recommended.

  5. Study the relationship between medical sciences students' self-esteem and academic achievement of Guilan university of medical sciences. (United States)

    Jirdehi, Maryam Mirzaee; Asgari, Fariba; Tabari, Rasool; Leyli, Ehsan Kazemnejad


    Achievement of productivity and improvement of quality in the educational system is the effective, influential factors for countries development. Academic achievement is the main objective of the training program and the most important concerns of teachers, education officials, and university Student's families. Self-esteem is one of the factors affecting student academic achievement. This study is aimed to investigate the relationship between self-esteem and academic achievement in Medical Sciences students of in 2014-2015. This is a descriptive-correlational study. In this study, 537 university students were selected using random stratified sampling method from Guilan University of Medical Sciences in 2014-2015. Data were collected using the standard self-esteem questionnaire of Cooper Smith consisting of four elements (general, social, familial, and educational) and a demographic questionnaire. Data were analyzed using SPSS software version 21 and descriptive statistics such as Spearman correlation and Logistic Regression. The results indicated a significant relationship between grade point average and educational self-esteem ( P = 0.002, r = 0.135) and global self-esteem ( P = 0.02, r = 0.102). There was also a significant relationship between composite Index educational status and general self-esteem ( P = 0.019, r = 0.102) and academic achievement ( P = 0.007, r = 0.116) and global self-esteem ( P = 0.020, r = 0.102). According to the results, the highest mean score of self-esteem was related to the familial element, and the lowest average was in terms of social self-esteem, therefore, given the importance and necessity of self-esteem in academic achievement, strengthening of all aspects of self-esteem is suggested.

  6. Internship workplace preferences of final-year medical students at Zagreb University Medical School, Croatia: all roads lead to Zagreb. (United States)

    Polasek, Ozren; Kolcic, Ivana; Dzakula, Aleksandar; Bagat, Mario


    Human resources management in health often encounters problems related to workforce geographical distribution. The aim of this study was to investigate the internship workplace preferences of final-year medical students and the reasons associated with their choices. A total of 204 out of 240 final-year medical students at Zagreb University Medical School, Croatia, were surveyed a few months before graduation. We collected data on each student's background, workplace preference, academic performance and emigration preferences. Logistic regression was used to analyse the factors underlying internship workplace preference, classified into two categories: Zagreb versus other areas. Only 39 respondents (19.1%) wanted to obtain internships outside Zagreb, the Croatian capital. Gender and age were not significantly associated with internship workplace preference. A single predictor variable significantly contributed to the logistic regression model: students who believed they would not get the desired specialty more often chose Zagreb as a preferred internship workplace (odds ratio 0.32, 95% CI 0.12-0.86). A strong preference for Zagreb as an internship workplace was recorded. Uncertainty about getting the desired specialty was associated with choosing Zagreb as a workplace, possibly due to more extensive and diverse job opportunities.

  7. Prevalence of ADHD among the Students Residing in Dormitory of Ardabil University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Fariba Sadeghi Movahed


    Full Text Available Background & Objective: Attention Deficit-Hyperactivity Disorder (ADHD is a heredity and psychological disorder that often continues to adulthood and causes great number of emotional, social, educational and occupational problem for college students. The aim of this study is to determine the prevalence of ADHD among students residing in the dormitory of Ardabil University of Medical Sciences.   Methods: In this cross sectional study, all students in the dormitory of Ardabil University of Medical Sciences were included. They filled the Self reporting Conner’s ADHD questionnaires. Data were extracted and analyzed with SPSS.   Results: During this study, the prevalence of ADHD was 8.6 percent. The males show more involvement rate than females. The students with ADHD showed more incidences of smoking and psychotropic drug consumption.   Conclusion: Due to the high prevalence of ADHD among the college students, early diagnosis and treatment of ADHD seems to be necessary.

  8. Cohesion assessment of student groups from the faculty of dentistry at Burdenko Voronezh State Medical University

    Directory of Open Access Journals (Sweden)

    Pashkov A. N.


    Full Text Available the article presents data on the study of the cohesion of 115 students from the faculty of dentistry at Burdenko Voronezh State Medical University. The study revealed that students have high and medium favorable psychological climate. 99 of them have the average level of group cohesion, and 16 revealed a low level of this indicator. To improve the educational process and interpersonal relations, these results must be taken into account when forming groups.



    A. V. Semenets; V. Yu. Kovalok


    An importance of the application of the electronic document management to the Ukraine healthcare is shown. The electronic document management systems market overview is presented. Example of the usage of the open-source electronic document management system in the Ternopil State Medical University by I. Ya. Horbachevsky is shown. The implementation capabilities of the electronic document management system within a cloud services are shown. The electronic document management features of the Mi...

  10. On the scene: American University of Beirut Medical Center, Beirut, Lebanon. (United States)

    Mouro, Gladys; Tashjian, Hera; Daaboul, Tania; Kozman, Katia; Alwan, Farah; Shamoun, Anthony


    American University of Beirut Medical Center is the first Magnet hospital in the Middle East. In this article, authors reflect back on the journey to excellence, specifically in establishing shared governance in a challenging cultural and organizational milieu. Perspectives from nurses at different levels are included to highlight their experiences throughout the journey. Evolution of the organization's shared governance model is described and initiatives of the councils are illustrated.

  11. Return of TRIGA fuel from the Medical University of Hanover (MHH) to the United States

    International Nuclear Information System (INIS)

    Hampel, Gabriele; Klaus, Uwe; Schmidt, Thomas


    The Medical University of Hanover (MHH) returned its TRIGA fuel to the United States in the summer of 1999. This paper deals with the procedure for handling the fuel elements within and outside the reactor facility. It describes the dry loading technology, taking into account the special conditions relevant to the MHH. It also includes the time scale for both the various steps of the procedure and the entire process, as well as the main results of the radiological surveys. (author)

  12. The modern trends of forming internet additional disorder between students of medical university


    Vanyushina E.; Goncharova M.


    Today the so-called internet–space occupies the special place in our world. The Internet is applying in almost all spheres of human life. That’s why there were manifested different side effects, in particular, the “Internet Additional Disorder”. This paper examines current trends and features of excessive internet–using by students of a medical university as a group of people, who has a predisposition to incipience of Internet Additional Disorder. During research, we interviewed 100 students ...

  13. Ethnic Differences And Motivation Based On Maslow’s Theory At a MedicaL University


    Jagmohni Kaur Sidhu


    Introduction: Motivation in Malaysia is to a largeextent influenced by the value system amongst allMalaysians. Being able to motivate employees is one ofthe important keys to the success of the organization.In this paper, an attempt was made to look into theneeds of employees in organizations and in particular,the needs based on Maslow’s theory on motivation. Subjects and Methods: Employees which consisted ofboth academic and administrative employees of theInternational Medical University (...

  14. Achievement Motivation and Academic Motivation among Students of Kermanshah University of Medical Sciences in 2013


    Firoozeh Khamoushi; Arash Parsa Moghaddam; Mahtab Sadeghi; Ali Akbar Parvizifard; Akram Ahmadzadeh


    Introduction: Students are often similar in terms of learning ability and talent. However, there are remarkable differences in their academic performance during their schooling, which can be due to the differences in their academic motivation and achievement motivation. The current study was carried out to compare achievement motivation and academic achievement among the students of Kermanshah University of Medical Sciences (KUMS) in 2013. Methods: In this descriptive Analytical cross-sec...

  15. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.


    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  16. Dysmenorrhea among female medical students in King Abdulaziz University: Prevalence, Predictors and outcome (United States)

    Ibrahim, Nahla Khamis; AlGhamdi, Manar Saleh; Al-Shaibani, Alanoud Nawaf; AlAmri, Fatima Ali; Alharbi, Huda Abdulrahman; Al-Jadani, Arwa Kheder; Alfaidi, Raghad Ahmed


    Objective: To determine the prevalence, predictors and outcome of dysmenorrhea among female medical students in King Abdulaziz University (KAU), Jeddah, Saudi Arabia. Methods: A cross-sectional study was conducted among 435 medical students at KAU, Jeddah selected through stratified random sample method. A pre-constructed, validated, self-administered questionnaire was used to collect personal and socio-demographic information. Data about menstrual history, stress, smoking were also collected. The severity of dysmenorrhea was scored by the “Visual Analogue Scale (VAS)”. Descriptive and analytical statistics were conducted. Results: The prevalence of dysmenorrhea was 60.9%. Logistic regression showed that heavy period was the first predictor of dysmenorrhea (aOR=1.94; 95% CI: 1.29- 2.91), followed by stress (aOR=1.90; 95% C.I.: 1.19-3.07). The prevalence of severe dysmenorrhea among the sufferers was 38.6%. Depressed mood was the commonest (80.8%) symptom accompanying dysmenorrhea. Regarding the outcome of dysmenorrhea, 67.5% of the sufferes reported emotional instability, while 28.3% reported absenteeism from the university. Conclusions: A high prevalence of dysmenorrhea was prevalent among medical students in King Abdulaziz University (KAU), Health promotion, screening programs, and stress management courses are recommended. PMID:26870088

  17. The analysis of the medical university students’ health condition and lifestyle

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Significant psychophysiological burdens and unhealthy lifestyle constitute the risk factors leading to students’ health deterioration. Purpose: The purpose of the research was the analysis of students’ health condition and lifestyle in medical university. Material and methods: The objects of the research were 100 third year students of the Faculties of General Medicine and Pediatrics of Grodno State Medical University. For the study of students’ orientation on healthy lifestyle, a special scale-type questionnaire was developed and used. Results: According to the respondents’ opinions it has been detected that the basic factors influencing the state of health are the lifestyle and the living conditions. The students activity is evaluated as very low as well as their rational nutrition. The majority of them smoke and drink alcohol. Conclusions: The peculiarities of studying at a medical university accompanied by imbalanced nutrition might lead to the deterioration of health in the students which are doctors to be. The results ought to lead to the optimization of prophylaxis programs and entire alteration of the students’ lifestyles.

  18. Study on attitudes of students of Islamic Azad University Tehran Medical Branch toward food safety, 2016. (United States)

    Miri, Ali; Poursadeghiyan, Mohsen; Baneshi, Mohammad Mehdi; Biglari, Hamed; Yari, Ahmad Reza; Khammar, Alireza


    Given the importance of high-quality healthy food for humans, contamination control is the most important concern for healthy staff. To determine the attitudes of students at Islamic Azad University (Tehran Medical Branch) toward food safety. This cross-sectional and analytic-descriptive study was conducted on 326 students of Azad University of Medical Sciences in 2016. A self-made questionnaire consisting of 40 questions was used. The reliability of the questionnaire was confirmed using internal consistency method (Cronbach's alpha coefficient of 0.80). After collecting data, we use descriptive statistical indexes (mean and standard deviation) among demographic variables and the level of knowledge to describe and analyze the data. The participants' attitudes and operation are measured by Spearman tests, and the analytical results are given using SPSS version 20. According to the findings, 55.3, 30 and 14.7 percent of students had high, moderate and low attitude scores toward food safety, respectively. In addition, male and female students had equal attitudes toward food safety, and no significant relationship between sex and attitude was observed a significant difference (p>0.05), but between educational levels (p=0.008) and ages (p=0.001) of students significance was a positive correlation. Due to the low attitudes score of about half of the students of Islamic Azad University Tehran Medical Branch toward food safety, it can be claimed, food safety training in this community is required.

  19. Pediatric сlinic of Odessa National Medical University: the quality of emergency medical care for children

    Directory of Open Access Journals (Sweden)

    E.A. Starets


    Full Text Available Background. The purpose of the article is to discuss the issue of improving the quality of emergency care for children with the most common diseases. Materials and methods. The quality of medical care includes 6 characteristics: 1 effectiveness — evidencebased health care results in improved health outcomes; 2 relevancy: health care is delivered in a manner that maximizes resource use and avoids wasting and provided in a setting where skills and resources are appropriate to medical need; 3 accessibility: health care is provided timely, reasonable and affordable; 4 acceptability/patient-centered: health care provided takes into account the preferences and aspirations of individual service users; 5 equity: health care provided does not vary in quality because of personal characteristics or socioeconomic status; 6 safety: health care provided minimizes risks and harm to service users and providers. Results. The Intensive Care Unit (ICU started working in the Pediatric Clinic of the Odessa National Medical University on February 1, 2017. The main task of ICU is the treatment of children with emergency conditions (who needs monitoring of breathing and cardiac activity, oxygen therapy, large-volume rehydration therapy, etc. The patients admit to the ICU according the results of triage. Triage is the process of rapidly screening of sick children soon after their addmission to hospital and in ICU, in order to identify those with emergency signs — obstruc-ted breathing or severe respiratory distress; central cyanosis; signs of shock; signs of severe dehydration; those with priority signs — very high temperature, severe pallor, respiratory distress etc. The local guidelines for the most common diseases in children have been developed in the Pediatric Clinic. These local guidelines are based on: 1 modern national guidelines; 2 WHO: Pocket book of hospital care for children: guidelines for the management of common childhood illnesses (2013; clinical

  20. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children. (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira


    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  1. Designing a system of mentorship in Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)



    Full Text Available As you know, one of the new programs of the medical universities is to familiarize the students to the medical atmosphere with the help of compassionate and experienced university professors. The program is planned and implemented under the title of mentorship, in which an experienced instructor takes the responsibility of orientation, guidance and problem solving of a number of students. The students at the time of admission face some problems, usually due to the young age, unfamiliarity with the university context, the amount of the texts, etc.; therefore, they feel somehow defenseless in this atmosphere. In this program, which was longitudinal and often causes a long-term and friendly relationship between the professor and students during the education years, these problems of students discuss with teachers (Mentor and in this interact somewhat elevated. To do the appropriate implementation of this concept in the university, the university was required to be familiar with the concept of mentorship at the first step (1. So, the Education Development Center of Shiraz University of Medical Sciences (EDC has implemented this issue in a series of educational fellowship workshops for the professors of postgraduate levels. In teaching this concept, the Jowhari model (Joseph Luft and Harry Ingham famous model (2 has attracted the attention of authorities and professors of this period. In educating the concept of mentoring, the development of selfgeneralization window of the professors was considered. Because this section covers the ability of communication and flexibility in the leadership of the individuals, development of the window (area decreases the incidence of conflicts and misunderstandings and struggles between individuals in this regard. To develop this area, there was an attempt in this period that the professors get familiar with the two methods of self-openness and feedback. This educational program was a pilot which was implemented in

  2. Interdisciplinary Medication Adherence Program: The Example of a University Community Pharmacy in Switzerland

    Directory of Open Access Journals (Sweden)

    Mélanie Lelubre


    Full Text Available The Community Pharmacy of the Department of Ambulatory Care and Community Medicine (Policlinique Médicale Universitaire, PMU, University of Lausanne, developed and implemented an interdisciplinary medication adherence program. The program aims to support and reinforce medication adherence through a multifactorial and interdisciplinary intervention. Motivational interviewing is combined with medication adherence electronic monitors (MEMS, Aardex MWV and a report to patient, physician, nurse, and other pharmacists. This program has become a routine activity and was extended for use with all chronic diseases. From 2004 to 2014, there were 819 patient inclusions, and 268 patients were in follow-up in 2014. This paper aims to present the organization and program’s context, statistical data, published research, and future perspectives.

  3. Interdisciplinary Medication Adherence Program: The Example of a University Community Pharmacy in Switzerland. (United States)

    Lelubre, Mélanie; Kamal, Susan; Genre, Noëllie; Celio, Jennifer; Gorgerat, Séverine; Hugentobler Hampai, Denise; Bourdin, Aline; Berger, Jerôme; Bugnon, Olivier; Schneider, Marie


    The Community Pharmacy of the Department of Ambulatory Care and Community Medicine (Policlinique Médicale Universitaire, PMU), University of Lausanne, developed and implemented an interdisciplinary medication adherence program. The program aims to support and reinforce medication adherence through a multifactorial and interdisciplinary intervention. Motivational interviewing is combined with medication adherence electronic monitors (MEMS, Aardex MWV) and a report to patient, physician, nurse, and other pharmacists. This program has become a routine activity and was extended for use with all chronic diseases. From 2004 to 2014, there were 819 patient inclusions, and 268 patients were in follow-up in 2014. This paper aims to present the organization and program's context, statistical data, published research, and future perspectives.

  4. Anxiety sensitivity as a predictor of academic success of medical students at the University of Mostar. (United States)

    Zalihić, Amra; Mešukić, Sabina; Sušac, Bože; Knezović, Katarina; Martinac, Marko


    Higher education students comprise a particularly vulnerable group for the development of anxiety symptoms and disorders. The aim of our research was to examine the impact of anxiety sensitivity on the success of medical students at the University of Mostar, and to establish the differences between students depending on their sex and the year of study. One hundred students in their first and fifth year of medical school were interviewed using the ASI questionnaire, 7 days prior to their final exams. Here we demonstrate a positive correlation between anxiety sensitivity and academic success. We did not find any significant differences between the first and fifth-year medical students, nor between participants based on their sex. We conclude that anxiety can have a positive impact on the academic achievement of higher education students.

  5. Barriers and challenges in researches by Iranian students of medical universities. (United States)

    Anbari, Zohreh; Mohammadbeigi, Abolfazl; Jadidi, Rahmatollah


    Health sciences research (HSR) is an essential part of improving health care which plays a critical role in the field of medicine and clinical practice. The aim of the current study was to assess barriers to the research by students of medical sciences as well as to find out effective strategies for management of student researches in Iranian universities. This study utilized a hybrid design with quantitative and qualitative analytical approaches conducted on 627 students in six schools of medical sciences in two universities in Central Province in Iran from April to December, 2012. Questionnaires were distributed among researcher and non-researcher students to find barriers to the research. These barriers were approved and validated by similar studies and strategies using the Delphi technique on 36 students. The most important barriers among researcher students were institutional barriers (3.3 ± 1.3), but in non-researcher students they were individual barriers (3.6 ± 1.7). The majority of barriers to involvement in the research among researcher students appeared to be time, lack of access to electronic resources and prolongation of the process of buying equipment. In addition, the greatest barriers among non-researcher students included the lack of time, scientific writing skills, and access to trained assistants. The results showed the issue of attitudes towards compulsory research as a component of critical scholarship in the curriculum of medical courses. Moreover, employment of the research experts can be helpful for research training in schools of medical sciences.

  6. Prediction of internet addiction based on information literacy among students of Iran University of Medical Sciences. (United States)

    Langarizadeh, Mostafa; Naghipour, Majid; Tabatabaei, Seyed Mohsen; Mirzaei, Abbas; Vaghar, Mohammad Eslami


    A considerable group of internet users consists of university users; however, despite internet benefits and capabilities, internet overuse is a threat to societies especially to young people and students. The objective of this study was to determine the predictive role of information literacy in internet addiction among students of Iran University of Medical Sciences during 2016. This analytical cross-sectional study was conducted in Iran University of Medical Sciences in 2016. Using stratified random sampling method, 365 students from different disciplines were selected. Measuring tools included the Information Literacy Questionnaire, the Yang Online Drug Addiction Scale and the General Health Questionnaire. The collected data were analyzed by Pearson product-moment correlation, independent samples t-test and multiple linear regression using SPSS version 22. According to this study, 31.2% of students had internet addiction (29.9% were mildly addicted and 1.3% had severe addiction). There was a significant and inverse relationship between higher information literacy and internet addiction (R= -0.45) and (pInformation literacy" explained 20% of the variation in the outcome variable "Internet addiction". Students play a substantial role in promoting the cultural and scientific level of knowledge in society; the higher their information literacy, the lower the level of Internet addiction, and consequently the general health of society will improve. It seems that wise planning by authorities of Iran's universities to prevent internet addiction and to increase information literacy among students is needed.

  7. Knowledge, attitudes and practices concerning self-medication with antibiotics among university students in western China. (United States)

    Lv, Bing; Zhou, Zhongliang; Xu, Guiping; Yang, Dingkun; Wu, Lina; Shen, Qian; Jiang, Minghuan; Wang, Xiao; Zhao, Guilan; Yang, Shimin; Fang, Yu


    To evaluate the knowledge, attitude and behaviours of university students on the use of antibiotics. A knowledge-attitude-practice questionnaire was developed and distributed to undergraduate students of Xi'an Jiaotong University, comprising 18 schools/colleges in Shaanxi Province, western China. Chi-square test and logistic regression analysis were applied to identify risk factors associated with self-medication with antibiotics. Of the 731 respondents (response rate = 73.1%), 294 (40.2%) had self-medicated with antibiotics in the past 6 months. Most of the antibiotics (59.2%) for self-medication were purchased without prescription in retail pharmacies. The median score of students' knowledge about antibiotics was 4 (IQR: 3-6) of a maximum possible score of 10. Students had moderately accurate beliefs towards antibiotics. More than half of the students (56.5%) were storing antibiotics frequently. During self-medication, 16.7% of students claimed to have experienced adverse reactions, and 30.6% had used antibiotics to prevent common colds. The majority preferred to use broad-spectrum antibiotics, and nearly half preferred intravenous antibiotics. Over 44% of students had changed antibiotic dosage, and 36.5% had switched to another antibiotic during the treatment course. Logistic regression analysis identified college and home town as independent risk factors for self-medication with antibiotics (P students had inadequate knowledge, moderately accurate beliefs and inappropriate practices concerning antibiotics, and a high rate of self-medication. This highlights the need for focused educational intervention and stricter governmental regulation concerning antibiotic use and sale in retail pharmacies. © 2014 John Wiley & Sons Ltd.

  8. Assessment of the interns’ ability based on Dundee model in Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: The importance of medical profession and the role of the physician in society is no secret to anyone. Skills and competencies in clinical practice are necessary for the medical profession. In fact, in patient care, doctors require practical skills in addition to scientific knowledge. This study examines the potentials of medical school students in three areas of doing the right thing, doing the right thing in an intermediate range, and doing the right thing by the right person. Methods: This study was done in a descriptive-analytical and sectional model. The population of this study was all interns of Shiraz University of Medical Sciences who were passing internship at Internal Medicine, Surgery, Pediatrics, Obstetrics and Emergency wards. About 100 persons were selected were selected by simple randomization. In order to collect data, a questionnaire with 12 questions was designed in two parts. The questionnaire was approved by 7 Faculty members of Clinical Medicine and Medical Education, and its reliability was approved by test-retest method on 20 medical students in the form of a pilot study and through Cronbach’s alpha (82%. Collected data were analyzed by SPSS software version 14 using descriptive statistical methods. Results: Results showed that within the inner circle, interns evaluated their skills in surgery, internal medicine, and gynecology wards, intermediate and at other wards as weak. Also within the center circle, interns evaluated adequate educational evidence-based training in the field of medicine, and sufficiency of educational training in the field of clinical decision making and clinical care as suitable. Conclusion: According to the results, it seems that medical interns’ skills in performing most medical skills are moderate. So teaching students by new educational methods and workshop techniques, using experienced teachers will be effective. The use of clinical skills training centers and objective

  9. Understanding the Influence of the Pakistani Government in South Asia (United States)


    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  10. Factors Affecting job satisfaction of employees in Pakistani banking sector


    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman


    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...



    Syeda Bushra Zaidi


    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  12. [Scientific dissemination of medical dissertations at the University of Lomé (Togo)]. (United States)

    Pitche, Palokinam T; Onipoh, Dodji K; Tchangai-Walla, Kissem L


    The medicine dissertation is often the last step of a physician's medical studies. Long considered a rite of passage, it is now regarded as a scientific work deserving attention from the national and international scientific community. The objectives of this study were to document the means by which dissertations at the University of Lomé Medical School are diffused and to determine their impact on the scientific production of medical school faculty. This cross-sectional study included all dissertations in medicine at the University of Lomé from 1993 through 2002. We interviewed dissertation supervisors and co-supervisors (questionnaire-structured interviews) and consulted the Medline and CNRS/PASCAL databases, scientific communication registers and local journals to collect information. During this period, 240 dissertations were defended at the University of Lomé medical school. More than half came from the departments of medicine (n=85, 35.4%), surgery (n=57, 23.7%) and paediatrics (n=51, 22.5%). The majority dealt with epidemiological (47 %) and clinical (35.8 %) themes, and only a small minority concerned topics in microbiology and biochemistry (7.5 %). Ninety-nine dissertations (41 %) were published: 54 (22.5%) in indexed journals and 45 (18.5 %) in non-indexed journals; 130 (54%) were delivered as papers or posters at scientific meetings. The distribution of published dissertations according to department showed that the departments of paediatrics (51.3 %), medicine (21.2 %) and surgery (21 %) had the best rates of publication in indexed journals, compared with obstetrics and gynaecology (4 %) and basic science (13.8 %) departments. During the study period, faculty at the University of Lomé medical school published 264 articles in indexed journals: dissertations accounted for only 20.4 %. Dissertations made up a higher proportion of publications in the paediatrics department (32.2 %) than in surgery (20.7 %), medicine (19.8 %), basis sciences (14 %) or

  13. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal


    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.


    Directory of Open Access Journals (Sweden)

    Muhammad Usman


    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  15. Turning microscopy in the medical curriculum digital: Experiences from the faculty of health and medical sciences at University of Copenhagen

    Directory of Open Access Journals (Sweden)

    Ben Vainer


    Full Text Available Familiarity with the structure and composition of normal tissue and an understanding of the changes that occur during disease is pivotal to the study of the human body. For decades, microscope slides have been central to teaching pathology in medical courses and related subjects at the University of Copenhagen. Students had to learn how to use a microscope and envisage three-dimensional processes that occur in the body from two-dimensional glass slides. Here, we describe how a PathXL virtual microscopy system for teaching pathology and histology at the Faculty has recently been implemented, from an administrative, an economic, and a teaching perspective. This fully automatic digital microscopy system has been received positively by both teachers and students, and a decision was made to convert all courses involving microscopy to the virtual microscopy format. As a result, conventional analog microscopy will be phased out from the fall of 2016.

  16. The "schola medica salernitana": the forerunner of the modern university medical schools. (United States)

    de Divitiis, Enrico; Cappabianca, Paolo; de Divitiis, Oreste


    The schola medica salernitana is considered the oldest medical school of modern civilization. Salerno's long medical tradition began during the Greco-Roman period in a Greek colony named Elea, where Parmenides decided to found a medical school. The fame of the school became more and more important during the 10th century, and it was best known in the 11th century. In the middle of 12th century, the school was at its apogee, and Salerno provided a notable contribution to the formulation of a medical curriculum for medieval universities. The most famous work of the Salernitan School was the Regimen Sanitatis Saleritanum, a Latin poem of rational, dietetic, and hygienic precepts, many of them still valid today. The school also produced a physician's reference book, with advice on how to treat a patient, a sort of code of conduct to help the physician to respect the patient and his or her relatives. The first science-based surgery appeared on the scene of the discredited medieval practice in Salerno, thanks to Roger of Salerno and his fellows. He wrote a book on surgery, called Rogerina or Post Mundi Fabricam, in which surgery from head to toe is described, with surprising originality. The important contribution to the School of Salerno made by women as female practitioners is outlined, and among them, Trotula de Ruggiero was the most renowned. The period when the School of Salerno, universally recognized as the forerunner of the modern universities, became a government academy was when Frederick II reigned over the Kingdom of the Two Sicilies, as Emperor of the Holy Roman Empire.

  17. Incidence of academic failure and its underlying factors in Lorestan university of medical sciences

    Directory of Open Access Journals (Sweden)

    Farzad Ebrahimzadeh


    Full Text Available Background: Academic failure, conceived of as lack of success in one’s education, is of paramount importance for students of medical sciences and it might lead to more acute problems. The present study set out to investigate the prevalence and underlying reasons of academic failure in Lorestan University of medical sciences.  Materials and Methods: In this cohort study, academic records of all students of Lorestan University of Medical Sciences during the academic years of 2006-2011 were collected from education and student affair center and also, demographic and educational records were entered into a checklist. Inappropriate grade point average, being a provisional student, prolonged graduation, expulsion and dropout were taken into account as academic failure. To model the related effective factors, logistic regression was adopted and significance level was set at 0.05. Results: The cumulative incidence of academic failure was about 25.1%. Factors such as department, being self-funded or government-funded student, academic grade students are pursuing, the elapsed time between academic grades, gender and location of residence were related to academic failure (P<0.05. It is worth mentioning that no relationship was observed between the academic failure and being accepted based on quota system. Conclusion: The most important at risk groups were students of department of medicine and health, associate or medical doctoral students, self-funded students, students with a considerable time elapsed between their academic grades, male students and students living in dormitory. It is suggested that these students refer to consulting centers of university or educational supervisors and receive particular attention.

  18. Assessing the Oldness and Capacity of Radiography and Ultrasound Equipments in Tehran University of Medical Sciences

    International Nuclear Information System (INIS)

    Salamati, Payman; Ghanaati, Hossein; Ghasemzadeh, Shahram; Jalali, Amir Hossein


    Maintenance of imaging equipment is a very important part of the management of all medical imaging centers. To assess the oldness and capacity of radiography and ultrasound equipment in Tehran University of Medical Sciences. The study was performed in 16 hospitals, 4 faculties and three healthcare centers of Tehran University of Medical Sciences. We evaluated all the X-ray equipment (including the simple plain and dental, panorex, mammography, fluoroscopy and C-arm X-Ray devices) and also simple and Doppler ultrasound machines in terms of the type and usage of the device, production year, quantity of utilization, location, brand and current condition. Among fixed X-ray systems, 15 were currently in use, two were junk, two were damaged, and one was not utilized. The mean (SD) of the usage of these was 2151 (2230) cliché/month, and the mean (SD) of the oldness was 16.9 (13.6) years. The oldness of radiography equipment in our study was more than 20 years in 16, between 11 and 20 in 46, and less than 10 years in 76 devices. The mean (SD) usage (patients/month) of simple and color Doppler devices were 234.1 (365.2) and 597.5 (505.3), respectively. The oldness of ultrasonography equipment in our study was more than 11 years in 12 and less than 10 years in 55 devices. We found that 22 (15.9%) of the radiography systems and two (3%) of the ultrasonography systems had been used for more than 20 years. Radiology equipment in Tehran University of Medical Sciences have potential capacity, but they need repair, and better maintenance and management and application of standards for the imaging system needs organized supervisory mechanisms

  19. [Publications in the Croatian medical journals by doctoral candidates at University of Zagreb School of Medicine]. (United States)

    Sember, Marijan; Petrak, Jelka


    By searching Medline/PubMed bibliographic database we collected data on publications of two groups of PhD candidates who earned their PhD degrees at University of Zagreb Medical School in 2000 and 2010. We identifed their publications in the Croatian medical journals and separately in the Croatian language. First group of PhD candidates (y 2000) published in the Croatian journals 34% of all published papers, with a share of 29% in the Croatian language. Another group (y 2010) published in the Croatian journals 44% of all published papers in which the number of papers published in the Croatian journals in English language grow significantly (5% vs. 31%). The number of papers published in the Croatian language decreased to 13%. Our results agreed with the global decreasing trend of the number of medical papers in non-English languages. The importance of mother-tongue in the medical education and health care may have influence on preserving scientific communication in non-English medical journals.

  20. Assessment of basic behavioural risks concerning health of students attending Medical University

    Directory of Open Access Journals (Sweden)

    T.N. Govyazina


    Full Text Available We chose students from all the six years attending Medical and Prevention Faculty of Perm State Medical University named after academician E.A. Vagner as our research object. Our research goal was to examine and to assess basic behavioral risks which could cause health risks for students attending medical higher educational establishment. We applied a set of techniques in our work: information-bibliographic one (15 literature sources were studied, both periodicals and monographs, sociological one (467 students of Medical and Prevention Faculty were included into a one-time questioning, them all being an entire assembly, statistic one (we calculated relative values and mean values, as well as correlation coefficients. The research was performed in two steps; the first one was based on analyzing subjective evidence, namely, sociologic questioning results; in our second step we focused on examining pathologic damages as per medical examinations data as well as data on morbidity obtained from register of visits to a students' polyclinic.

  1. Viewpoints of the interns on their future career in Qazvin University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Saeed Asefzadeh


    Full Text Available Background The imbalance between the public needs and the number of the medical graduates has created problems in recruitment of young physicians who are trained to provide medical and health services in the country. Purpose To assess the attitudes of interns at Qazvin University of Medical Sciences toward'i their future profession in 200I-2002. Methods This descriptive study assesses the viewpoints of all I20 interns through a self-administered questionnaire. Results The findings indicated that 77.5% of the students were in the age range of 22 to 27 with the average of 26. ./ years. of all cases 67.5% wished to continue their training to become a specialist and 6.7% decided to work as a general practitioner. of all students, 95.8% expected their future income to be low, to an extent which will not provide a comfortable life for them. of all cases. 89.2% believed that the present system of medical education does not give them the necessary capabilities and skills to practice efficiently in the future. Conclusion. The students• viewpoints on fulfillment of their economic needs and provision of a comfortable life for them and their families were negative; however, regarding fulfillment of their mental and emotional needs and participation in a scientific field, they were positive. Key word: intern, Medical profession

  2. Absenteeism among medical and health science undergraduate students at Hawassa University, Ethiopia. (United States)

    Desalegn, Anteneh Assefa; Berhan, Asres; Berhan, Yifru


    Student absenteeism is a major concern for university education worldwide. This study was conducted to determine the prevalence and causes of absenteeism among undergraduate medical and health sciences students at Hawassa University. We conducted a cross-sectional study using a pretested self-administered structured questionnaire from May-June 2013. The primary outcome indicator was self-reported absenteeism from lectures in the semester preceding the study period. The study included all regular undergraduate students who were enrolled in the University for at least one semester. The data was entered and analyzed using SPSS version 20. The association between class absenteeism and socio-demographic and behavioral correlates of absenteeism was determined by bivariate and multivariate analyses. Results were reported as crude odds ratios (COR), adjusted odds ratios (AOR) and 95% confidence intervals (CI). 1200 students consented and filled the questionnaire. Of these students, 43.7% had missed three or more lectures and 14.1% (95% CI = 12.2-16.2) missed more than 8 lectures in the preceding semester. There was a significant association between missing more than 8 lectures and age of students, chosen discipline (medicine), and social drug use. The main reasons reported for missing lectures were preparing for another examination, lack of interest, lecturer's teaching style, and availability of lecture material. At Hawassa University College of Medicine and Health Science student habits and teacher performance play a role in absenteeism from lectures. A university culture that promotes discipline and integrity especially among medical and older students discourages social drug use will likely improve motivation and attendance. Training in teaching methodologies to improve the quality and delivery of lectures should also help increase attendance.

  3. Outpatients flow management and ophthalmic electronic medical records system in university hospital using Yahgee Document View. (United States)

    Matsuo, Toshihiko; Gochi, Akira; Hirakawa, Tsuyoshi; Ito, Tadashi; Kohno, Yoshihisa


    General electronic medical records systems remain insufficient for ophthalmology outpatient clinics from the viewpoint of dealing with many ophthalmic examinations and images in a large number of patients. Filing systems for documents and images by Yahgee Document View (Yahgee, Inc.) were introduced on the platform of general electronic medical records system (Fujitsu, Inc.). Outpatients flow management system and electronic medical records system for ophthalmology were constructed. All images from ophthalmic appliances were transported to Yahgee Image by the MaxFile gateway system (P4 Medic, Inc.). The flow of outpatients going through examinations such as visual acuity testing were monitored by the list "Ophthalmology Outpatients List" by Yahgee Workflow in addition to the list "Patients Reception List" by Fujitsu. Patients' identification number was scanned with bar code readers attached to ophthalmic appliances. Dual monitors were placed in doctors' rooms to show Fujitsu Medical Records on the left-hand monitor and ophthalmic charts of Yahgee Document on the right-hand monitor. The data of manually-inputted visual acuity, automatically-exported autorefractometry and non-contact tonometry on a new template, MaxFile ED, were again automatically transported to designated boxes on ophthalmic charts of Yahgee Document. Images such as fundus photographs, fluorescein angiograms, optical coherence tomographic and ultrasound scans were viewed by Yahgee Image, and were copy-and-pasted to assigned boxes on the ophthalmic charts. Ordering such as appointments, drug prescription, fees and diagnoses input, central laboratory tests, surgical theater and ward room reservations were placed by functions of the Fujitsu electronic medical records system. The combination of the Fujitsu electronic medical records and Yahgee Document View systems enabled the University Hospital to examine the same number of outpatients as prior to the implementation of the computerized filing system.

  4. Medical emergencies in the imaging department of a university hospital: event and imaging characteristics. (United States)

    van Tonder, F C; Sutherland, T; Smith, R J; Chock, J M E; Santamaria, J D


    We aimed to describe the characteristics of medical emergencies that occurred in the medical imaging department (MID) of a university hospital in Melbourne, Australia. A database of 'Respond Medical Emergency Team (MET)' and 'Respond Blue' calls was retrospectively examined for the period June 2003 to November 2010 in relation to events that occurred in the MID. The hospital medical imaging database was also examined in relation to these events and, where necessary, patients' notes were reviewed. Ethics approval was granted by the hospital ethics review board. There were 124 medical emergency calls in the MID during the study period, 28% Respond Blue and 72% Respond MET. Of these 124 calls, 26% occurred outside of usual work hours and 12% involved cardiac arrest. The most common reasons for the emergency calls were seizures (14%) and altered conscious state (13%). Contrast anaphylaxis precipitated the emergency in 4% of cases. In 83% of cases the emergency calls were for patients attending the MID for diagnostic imaging, the remainder being for a procedure. Of the scheduled imaging techniques, 45% were for computed tomography. The scheduled imaging was abandoned due to the emergency in 12% of cases. When performed, imaging informed patient management in 34% of cases in diagnostic imaging and in all cases in the context of image-guided procedures. Medical emergency calls in the MID often occurred outside usual work hours and were attributed to a range of medical problems. The emergencies occurred in relation to all imaging techniques and imaging informed patient management in many cases. Crown Copyright © 2012. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Predictors of self-reported academic performance among undergraduate medical students of Hawassa University, Ethiopia

    Directory of Open Access Journals (Sweden)

    Gedefaw A


    Full Text Available Abel Gedefaw,1 Birkneh Tilahun,2 Anteneh Asefa3 1Department of Gynecology and Obstetrics, 2Department of Pediatrics and Child Health, 3School of Public and Environmental Health, College of Medicine and Health Sciences, Hawassa University, Hawassa, Ethiopia Background: This study was conducted to identify predictors of self-reported academic performance in undergraduate medical students at Hawassa University. Methods: An analytical cross-sectional study involving 592 undergraduate medical students was conducted in November 2012. The academic performance of the study subjects was measured by self-reported cumulative grade point average (GPA using a self-administered questionnaire. Data were entered and analyzed using Statistical Package for the Social Sciences version 16 software. Pearson's bivariate correlations, multiple linear regression, and multiple logistic regression were used to identify predictors of academic performance. Results: The self-reported academic performance of students had been decreasing as the academic years progressed, with the highest and lowest performance being in the premedicine (mean GPA 3.47 and clinical I (mean GPA 2.71 years, respectively. One hundred and fifty-eight (26.7% of the participants had ever been delayed, 37 (6.2% had ever re-sat for examination, and two (0.3% had ever been warned due to academic failure. The overall variation in self-reported academic performance of the students was 32.8%. Participant age alone explained 21.9% of the variation. On the other hand, university entrance examination results, substance use at university, and medicine as first choice by students were identified as predictors of variation in self-reported academic performance, accounting for 6.9%, 2.7%, and <1% of the variation, respectively. Students who had never used tobacco, alcohol, or khat after starting university were twice as likely to score a self-reported cumulative GPA above 3.0 (adjusted odds ratio 1.95, 95

  6. Designing a model for critical thinking development in AJA University of Medical Sciences (United States)



    Introduction: In the new concept of medical education, creativity development is an important goal. The aim of this research was to identify a model for developing critical thinking among students with the special focus on learning environment and learning style. Methods: This applied and cross-sectional study was conducted among all students studying in undergraduate and professional doctorate programs in Fall Semester 2013-2014 in AJA University of Medical Sciences (N=777). The sample consisted of 257 students selected based on the proportional stratified random sampling method. To collect data, three questionnaires including Critical Thinking, Perception of Learning Environment and Learning Style were employed. The data were analyzed using Pearson's correlation statistical test, and one-sample t-test. The Structural Equation Model (SEM) was used to test the research model. SPSS software, version 14 and the LISREL software were used for data analysis. Results: The results showed that students had significantly assessed the teaching-learning environment and two components of "perception of teachers" and "perception of emotional-psychological climate" at the desirable level (pcritical thinking among students in terms of components of "commitment", "creativity" and "cognitive maturity" was at the relatively desirable level (pcritical thinking through learning style. Conclusion: One of the factors which can significantly impact the quality improvement of the teaching and learning process in AJA University of Medical Sciences is to develop critical thinking among learners. This issue requires providing the proper situation for teaching and learning critical thinking in the educational environment. PMID:27795968

  7. A first evaluation of a pedagogical network for medical students at the University Hospital of Rennes. (United States)

    Fresnel, A; Jarno, P; Burgun, A; Delamarre, D; Denier, P; Cleret, M; Courtin, C; Seka, L P; Pouliquen, B; Cléran, L; Riou, C; Leduff, F; Lesaux, H; Duvauferrier, R; Le Beux, P


    A pedagogical network has been developed at University Hospital of Rennes from 1996. The challenge is to give medical information and informatics tools to all medical students in the clinical wards of the University Hospital. At first, nine wards were connected to the medical school server which is linked to the Internet. Client software electronic mail and WWW Netscape on Macintosh computers. Sever software is set up on Unix SUN providing a local homepage with selected pedagogical resources. These documents are stored in a DBMS database ORACLE and queries can be provided by specialty, authors or disease. The students can access a set of interactive teaching programs or electronic textbooks and can explore the Internet through the library information system and search engines. The teachers can send URL and indexation of pedagogical documents and can produce clinical cases: the database updating will be done by the users. This experience of using Web tools generated enthusiasm when we first introduced it to students. The evaluation shows that if the students can use this training early on, they will adapt the resources of the Internet to their own needs.

  8. A comparison of attitudes toward euthanasia among medical students at two Polish universities. (United States)

    Leppert, Wojciech; Gottwald, Leszek; Majkowicz, Mikolaj; Kazmierczak-Lukaszewicz, Sylwia; Forycka, Maria; Cialkowska-Rysz, Aleksandra; Kotlinska-Lemieszek, Aleksandra


    The aim of the study conducted upon completion of obligatory palliative medicine courses among 588 medical students at two universities was to compare their attitudes toward euthanasia. Four hundred ninety-two (84.97 %) students were Catholics; 69 (11.73 %) declared they would practice euthanasia, 303 (51.53 %) would not, and 216 students (36.73 %) were not sure. The idea of euthanasia legalisation was supported by 174 (29.59 %) respondents, opposed by 277 (47.11 %), and 137 (23.30 %) were undecided. Five hundred fifty-six (94.56 %) students did not change their attitudes toward euthanasia after palliative medicine courses. Students from the two universities were found to have different opinions on practicing euthanasia, euthanasia law and possible abuse which might follow euthanasia legalisation, but they shared similar views on the choice of euthanasia if they themselves were incurably ill and the legalisation of euthanasia. Gender and religion influenced students' answers. Differences observed between medical students at the two universities might be related to gender and cultural differences.

  9. Subjective experience of depressed mood among medical students at the University of Pretoria

    Directory of Open Access Journals (Sweden)

    L van Niekerk


    Full Text Available Introduction. Following the suicide of a 4th-year medicalstudent, questions were raised as to whether medicalstudents are more vulnerable to depression and suicide thantheir counterparts studying other courses at the University ofPretoria. A literature search revealed that medical students anddoctors run a higher risk for suicide than other students andprofessions. Method. A questionnaire was devised and distributed tomedical students and a control group of other students, askingabout feelings of despair/hopelessness, suicide ideation andprevious attempts, knowledge regarding support structuresprovided by the university, and willingness to use thesestructures. Results. Both groups of students responded similarly to allquestions. Frequency of diagnosed psychiatric illness, use ofmedication, and suicidal thoughts and attempts did not differsignificantly. Both groups of students were unaware of supportservices offered by the university, and both were unwilling toutilise such services. The students seemed to have high ratesof depression in comparison with prevalence data from othercountries. Conclusion. Attempts to improve support for medical studentsshould address students’ awareness of available supportstructures and their willingness to utilise them.

  10. New Methods of Evaluation for Postgraduate Training in Kermanshah University of Medical Sciences (2014

    Directory of Open Access Journals (Sweden)

    Nasrin Jalilian


    Full Text Available Revered editor evaluation of medical students in specialized medical fields has great importance in determining the necessary competence to learning clinical environments and necessary ability for functioning in the real environment (1. New specialized medical evaluation focuses on ways that confirm the clinical competence assistant that can point to the students’ experience booklet (log book; assay exams; Multiple Choice Question (MCQ; Objective Structural Clinical Examination (OSCE; observation with check list or rating scale; self-assessment and assessment by peers rating scale general; Portfolio; Direct Observation of Procedure Skill (DOPS; Mini Clinical Evaluation Exercise (Mini-CEX; 360-degree comprehensive assessment of Clinical Skills based on Records assistants (CSR; Objective Structural Practical Examination (OSPE (2. This descriptive-analytical study was performed to evaluate the use of modern methods of evaluation among eleven postgraduate departments in Kermanshah University of Medical Sciences in 2015. Data collection tool was a checklist that was prepared by researchers and was completed by clinical group managers. Data were analyzed with SPSS-16 software, Chi-square test and analysis of variance. In total of 11 studied groups, 106 full-time board faculty members, 14 co-education, 221 residents were working. The most modern methods to evaluate in %100 of groups were OSCE and MCQ, DOPS in %80 of groups, and Mini-CEX and CSR in% 27 of groups. Assay exams were used in infectious and pathology groups as the use of other modern methods of evaluation was not observed in all groups. Statistically, the most important reasons for the lack of significant new methods of evaluation were: internal decision of the department (P=0.002, unfamiliarity of team members with modern methods of evaluation (P=0.06, and the adequacy of other methods of evaluation according to the decision of the department (P<0.001. Other cited reasons such as lack of

  11. Analysis of Multiple Choice Tests Designed by Faculty Members of Kermanshah University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Reza Pourmirza Kalhori


    Full Text Available Dear Editor Multiple choice tests are the most common objective tests in medical education which are used to assess the ind-ividual knowledge, recall, recognition and problem solving abilities. One of the testing components is the post-test analysis. This component includes; first, qualitative analysis of the taxonomy of questions based on the Bloom’s educational objectives and percentage of the questions with no structural problems; and second, the quantitative analysis of the reliability (KR-20 and indices of difficulty and differentiation (1. This descriptive-analytical study was aimed to qualitatively and quan-titatively investigate the multiple-choice tests of the faculty members at Kermanshah University of Medical Sciences in 2009-2010. The sample size comprised of 156 tests. Data were analyzed by SPSS-16 software using t-test, chi-squared test, ANOVA and Tukey multiple comparison tests. The mean of reliability (KR-20, difficulty index, and discrimination index were 0.68 (± 0.31, 0.56 (± 0.15 and 0.21 (± 0.15, respectively, which were acceptable. The analysis of the tests at Mashad University of Medical Sciences indicated that the mean for the reliability of the tests was 0.72, and 52.2% of the tests had inappropriate difficulty index and 49.2% of the tests did not have acceptable differentiation index (2. Comparison of the tests at Kermanshah University of Medical Sciences for the fields of anatomy, physiology, biochemistry, genetics, statistics and behavioral sciences courses at Malaysia Faculty of Medicine (3 and tests at Argentina Faculty of Medicine (4 showed that while difficulty index was acceptable in all three universities, but differentiation indices in Malaysia and Argentina Medical Faculties were higher than that in Kermanshah University of Medical Sciences. The mean for the questions with no structural flaws in all tests, taxonomy I, taxonomy II, and taxonomy III were 73.88% (± 14.88, 34.65% (± 15.78, 41.34% (± 13

  12. Occupational status of Shaheed Beheshti University of Medical Sciences Graduates in 1993-7

    Directory of Open Access Journals (Sweden)

    Davood Yadegarinia


    Full Text Available Background and purpose: Job Satisfaction of the physicians and factors influencing it, are the issues receiving special attention by the health systems of every country. The present study aimed at revealing the current status of the employment and academic achievements of our physician and their attitude toward their job, in order to provide required information for the relevant authorities.Methods: In this descriptive cross-sectional study, an 8-item questionnaire was developed including 7 closed as well as 1 open question. The list of the physicians who were graduated from the Medical School of Shaheed Beheshti University of Medical Sciences and Health Services (SBMU from 1993 to 1997, was obtained from the Education Deputy of the University and Islamic Republic of Iran Medical Council. The questionnaires were then posted to the target group of physicians. The returned questionnaires were controlled and the related data was entered into the SPSS software.Results: Of all respondents, 356(67.3% were male and others were female; 363(68.4% were married; 260 (50.8% had completed the military service, and others were exempted. One hundred ninety(55.1% of the men and 103 (62% of the women had entered the university using open quota. Ninety four (61% of the single participants were dissatisfied with their jobs. This was 174 (49.2% in the married group. The most dissatisfied (162, 57.4% were among open quota group. More than half of the men and half of the women were dissatisfied with their jobs Conclusion: Physician’s workforce are among the most expensive human resources. A general dissatisfaction which has been shown in this study should be viewed as warning for policymakers and authorities to take measures to safeguard this expensive human capitals.Key word: JOB SATISFACTION, PHYSICIAN OCCUPATION

  13. A 5-year scientometric analysis of research centers affiliated to Tehran University of Medical Sciences (United States)

    Yazdani, Kamran; Rahimi-Movaghar, Afarin; Nedjat, Saharnaz; Ghalichi, Leila; Khalili, Malahat


    Background: Since Tehran University of Medical Sciences (TUMS) has the oldest and highest number of research centers among all Iranian medical universities, this study was conducted to evaluate scientific output of research centers affiliated to Tehran University of Medical Sciences (TUMS) using scientometric indices and the affecting factors. Moreover, a number of scientometric indicators were introduced. Methods: This cross-sectional study was performed to evaluate a 5-year scientific performance of research centers of TUMS. Data were collected through questionnaires, annual evaluation reports of the Ministry of Health, and also from Scopus database. We used appropriate measures of central tendency and variation for descriptive analyses. Moreover, uni-and multi-variable linear regression were used to evaluate the effect of independent factors on the scientific output of the centers. Results: The medians of the numbers of papers and books during a 5-year period were 150.5 and 2.5 respectively. The median of the "articles per researcher" was 19.1. Based on multiple linear regression, younger age centers (p=0.001), having a separate budget line (p=0.016), and number of research personnel (p<0.001) had a direct significant correlation with the number of articles while real properties had a reverse significant correlation with it (p=0.004). Conclusion: The results can help policy makers and research managers to allocate sufficient resources to improve current situation of the centers. Newly adopted and effective scientometric indices are is suggested to be used to evaluate scientific outputs and functions of these centers. PMID:26157724

  14. The relationship between emotional intelligence with administrators’ performance at Mashhad University of Medical Sciences (United States)

    Sadeghi, Tooraj; Saeidi, Masumeh; Moghaddam, Habibolah Taghizade; Ghodsi, Mohammad Jafari; Hoseini, Rasoul


    Background The leadership of an organization requires specific features to adapt to changes and to survive and grow in new environments, and emotional intelligence is one of the most important attributes that can help leaders and managers respond to these changes. Objective This study aimed to determine the relationship between emotional intelligence with administrators’ performance at Mashhad University of Medical Sciences, Mashhad, Iran. Methods This cross-sectional study was conducted on 100 basic and middle managers of Mashhad University of Medical Sciences, Mashhad, Iran who were selected by census method in 2016. The instrument of data collecting was the “Inventory Shrinkage”, and the “Organizational performance evaluation forms”. The data were analyzed by SPSS version 16 using descriptive statistics and Spearman correlation. Results The results showed there was a significant negative correlation between emotional intelligence and organizational performance in administrators (r=−0.214, p=0.032). The findings also showed that among the components of emotional intelligence and administrators’ performance, only components of empathy, was there a significant negative correlation (r=−0.199, p=0.047). Also, there was no statistically significant relationship between emotional intelligence and demographic variables such as work experience, age, marital status and education level (p>0.05). There was no significant relationship between organizational performance and demographic variables, either (p>0.05). But between the components of emotional intelligence, only for social skills and work place of administrators, a significant positive correlation was confirmed (r=0.203, p=0.043). Conclusions The results of this study showed that there was a negative and significant correlation between the components of emotional intelligence and administrators’ performance of Mashhad University of Medical Sciences administrators, only in the empathy component. PMID

  15. Professional Ethics and Organizational Commitment Among the Education Department Staff of Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ali Imani


    Full Text Available Background: Concepts such as organizational commitment and employees’ and managers’ ethics provide decision-makers and policy makers with potentially useful information which can result in increasing organizational efficiency and effectiveness. This study aimed to explore the relationship between professional ethics and organizational commitment among the staff working in the education departments of Tabriz University of Medical Sciences. Methods: This cross-sectional study was conducted in 2015. The study population consisted of all staff working as educational experts in the education departments of Tabriz University of Medical Sciences (N = 65. Data collection instruments used in this study were two standard questionnaires on professional ethics and organizational commitment. SPSS software version 21 was used to analyze the data. Results: According to the results, mean scores obtained for professional ethics and organizational commitment were (91.57± 9.13 (95% CI, 89.23-93.91 and (64.89 ± 10.37 (95% CI, 62.2367.54, respectively. A significant relationship was observed between professional ethics and organizational commitment among the educational experts working in Tabriz University of Medical Sciences (correlation coefficient = 0.405 (P = 0.001 (at 95% confidence level. Furthermore, there was a significant relationship between professional ethics and work experience (P = 0.043. The highest level of professional ethics observed was associated with those participants having a work experience of ranging from 6 to 10 years. Individuals with fulltime employment scored the highest in organizational commitment. Conclusion: Educational experts possessed a high level of professional ethics. The finding provides the grounds for promoting organizational commitment, which will lead to higher levels of organizational effectiveness.

  16. Predictors of self-reported academic performance among undergraduate medical students of Hawassa University, Ethiopia. (United States)

    Gedefaw, Abel; Tilahun, Birkneh; Asefa, Anteneh


    This study was conducted to identify predictors of self-reported academic performance in undergraduate medical students at Hawassa University. An analytical cross-sectional study involving 592 undergraduate medical students was conducted in November 2012. The academic performance of the study subjects was measured by self-reported cumulative grade point average (GPA) using a self-administered questionnaire. Data were entered and analyzed using Statistical Package for the Social Sciences version 16 software. Pearson's bivariate correlations, multiple linear regression, and multiple logistic regression were used to identify predictors of academic performance. The self-reported academic performance of students had been decreasing as the academic years progressed, with the highest and lowest performance being in the premedicine (mean GPA 3.47) and clinical I (mean GPA 2.71) years, respectively. One hundred and fifty-eight (26.7%) of the participants had ever been delayed, 37 (6.2%) had ever re-sat for examination, and two (0.3%) had ever been warned due to academic failure. The overall variation in self-reported academic performance of the students was 32.8%. Participant age alone explained 21.9% of the variation. On the other hand, university entrance examination results, substance use at university, and medicine as first choice by students were identified as predictors of variation in self-reported academic performance, accounting for 6.9%, 2.7%, and academic performance was explained by the studied variables. Hence, efficacious mechanisms should be designed to combat the intervenable determinants of self-reported academic performance, like substance use and a low medical school entrance examination result. Further studies should also be undertaken to gain a better understanding of other unstudied determinants, like personality, learning style, cognitive ability, and the system used for academic evaluation.

  17. Burnout and study engagement among medical students at Sun Yat-sen University, China (United States)

    Liu, Hongchun; Yansane, Alfa Ibrahim; Zhang, Yurong; Fu, Haijun; Hong, Nanrui; Kalenderian, Elsbeth


    Abstract This study aims to investigate burnout and study engagement among medical students at Sun Yat-sen University, China. A cross-sectional survey was conducted among undergraduate medical students of Sun Yat-sen University, China. A total of 453 undergraduate students completed a self-administered, structured questionnaire between January and February, 2016. Burnout and study engagement were measured using the Maslach Burnout Inventory-Student Survey (MBI-SS) and the UTRECHT Work Engagement Scale-Students (UWES-S), respectively. Subjects who scored high in emotional exhaustion subscale, high in cynicism subscale, and low in professional efficacy subscale simultaneously were graded as having high risk of burnout. Independent sample t tests and chi-square tests were used to compare the differences in burnout and work engagement between genders, majors, and grade levels. The means (standard deviations) of the MBI-SS subscales were 3.42 (1.45) for emotional exhaustion, 2.34 (1.64) for cynicism, and 3.04 (1.30) for professional efficacy. The means (standard deviations) of the UWES-S subscales were 3.13 (1.49) for vigor, 3.44 (1.47) for dedication and 3.00 (1.51) for absorption. Approximately 1 in 11 students experienced a high risk of burnout. There were no statistically significant gender differences in burnout and study engagement. There were also no statistically significant differences in burnout and study engagement subscales according to student major. Students in higher grades displayed increased burnout risk, higher mean burnout subscale score of cynicism, lower mean burnout subscale score of professional efficacy, and decreased mean study engagement subscale scores of dedication and absorption. There were strong correlations within study engagement subscales. Chinese medical students in this university experience a high level of burnout. Students at higher-grade level experience more burnout and decreased study engagement compared with students in lower

  18. Academic procrastination and related factors in students of Guilan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    MM Chehrzad


    Full Text Available Introduction: One of the challenges that students faced during their education is academic procrastination. It means “delay in performing a task”. Since academic procrastination could effect on various aspects of students' personal and social life, by identifying related factors it may be limited. This study aimed to determined academic procrastination and related factors in Students of Guilan University of Medical Sciences in 2015. Methods:  In this cross-sectional study, 459 students of all major programs of Guilan University of Medical Sciences were selected by stratified random sampling method. Data collection scales included three parts of demographic information, academic information and Procrastination Assessment Scale for Students (PASS by Solomon and Rothblum. Data was analyzed with T- Test, ANOVA, multiple regressions by SPSS V. 20.  Result: Most of students were female (72.7%, single (86% and undergraduate (66.6%. Mean score of academic procrastination was 63.3±9.1 and most students (69.5% had moderate procrastination. Academic procrastination had significant difference with gender (p=0.002 and academic level (p=0.03. Also in multiple regression models, gender, program of study  and academic level were main predictors of procrastination.  Females, dental students and postgraduate students had higher level of academic procrastination. Conclusion: There is a moderate academic procrastination in students of Guilan University of Medical Sciences and its relationship with gender, program of study and academic level was observed.  Investigation on causes and appropriate strategies to reduce this behavior is recommended.

  19. Integrating bioethics into postgraduate medical education: the University of Toronto model. (United States)

    Howard, Frazer; McKneally, Martin F; Levin, Alex V


    Bioethics training is a vital component of postgraduate medical education and required by accreditation organizations in Canada and the United States. Residency program ethics curricula should ensure trainees develop core knowledge, skills, and competencies, and should encourage lifelong learning and teaching of bioethics. Many physician-teachers, however, feel unprepared to teach bioethics and face challenges in developing and implementing specialty-specific bioethics curricula. The authors present, as one model, the innovative strategies employed by the University of Toronto Joint Centre for Bioethics. They postulate that centralized support is a key component to ensure the success of specialty-specific bioethics teaching, to reinforce the importance of ethics in medical training, and to ensure it is not overshadowed by other educational concerns.

  20. Energy drinks consumption practices among medical students of a Private sector University of Karachi, Pakistan. (United States)

    Usman, Asma; Bhombal, Swaleha Tariq; Jawaid, Ambreen; Zaki, Samar


    Consumption of energy drinks has become popular among students and athletes over the past few years. To explore the phenomenon, a cross-sectional survey was conducted through a self-administered pilot-tested questionnaire. Frequency of energy drinks consumption was found to be 121(52%) in a sample of 233 medical students. Red bull was the most common brand consumed 101(43%). The major reasons reported for its usage were to gain/replenish energy by 36(15.4%), and studying for examination by 34(14.6%). Television was reported as the major source of information 153(66%) followed by friends 113(48%). There was a high frequency of energy drinks' consumption among medical students of a private university. There is a strong need to create awareness regarding these drinks, especially among adolescents and teenagers.

  1. [Marcel Labbe's (1870-1937) conferences in Istanbul University Medical School]. (United States)

    Ozaydin, Z


    Marcel Labbe, a French physician, who was famous with his studies on nutrition and diabetes, visited Istanbul three times, in 1908, 1922 and 1930. During his second visit in 1922, he gave seven lectures at Istanbul University Medical School about diabetes mellitus, hyperglysemia of diabetics, acidosis, nefrotic diseases, liver insufficiency, endocrin diseases and anaphylactia. These lectures were translated and published in Turkish. During his third visit he lectured on paradiabetes and visited historical places and cities of Istanbul, and also visited Yalova thermal springs and Brusa. Labbe respected Turkish physicians with whom he had established close relations with in Paris, where he also met Ord. Prof. Dr. Suheyl Unver (1898-1986) who was a very famous professor and researcher in medical history. In return, he was respected by Turkish physicians, as well. Labbe's research was translated into Turkish and published in Turkish journals.

  2. [Interdisciplinary longitudinal curriculum "Medical psychology, psychotherapy and psychosomatics" (MPPP) at the University of Ulm]. (United States)

    Allert, Gebhard; Gommel, Michael; Tamulionyté, Liudvika; Appelt, Matthias; Zenz, Helmuth; Kächele, Horst


    We report the clinical part of the longitudinal curriculum MPPP which was developed by the departments of Medical Psychology, Psychotherapy and Psychosomatic Medicine at the University of Ulm. The commitment and creativity of the participating students in their two undergraduate years inspired us to offer them an interest-guided curriculum for their six clinical semesters. Our paper reports the extensive results of two evaluations that we conducted during the clinical part of this new teaching-model. It became evident that we were successful in transferring continuous, intense and patient-centred psychosomatic and psychosocial contents. Yet the transfer of basic and methodological knowledge was not realised to the extent the students would have appreciated. The positive results of our project encouraged us to expand the concept of an interest-guided curriculum onto the whole academic education in psychotherapy and psychosomatic medicine at our university.

  3. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers


    Summaira Naz


    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  4. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-


    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  5. Advanced medical students' experiences and views on professionalism at Kuwait University. (United States)

    Al-Abdulrazzaq, Dalia; Al-Fadhli, Amani; Arshad, Andleeb


    Professionalism is a core competency in the medical profession worldwide. Numerous studies investigate how this competency is taught and learned. However, there are few reports on the students' views and experiences with professionalism especially in the Arab world. Our aim was to explore the experiences and views of Kuwait final-year medical students on professionalism. This was a questionnaire study of final-year medical students at Kuwait University (n = 95). Open- and close-ended questions were used to determine the students' experiences and views on: definition, teaching, learning, and assessment of professionalism. Eighty-five of the students completed the questionnaire (89.5%). A total of 252 attributes defining professionalism were listed by our respondents. The majority (98.0%) of these attributes were categorized under the CanMEDS theme describing professionalism as commitment to patients, profession, and society through ethical practice. The most helpful methods in learning about professionalism for the students were contact with positive role models, patients and families, and with their own families, relatives and peers. The students' rating of the quality and quantity of teaching professionalism in the institution was quite variable. Despite this, 68.2% of the students felt very or somewhat comfortable explaining the meaning of medical professionalism to junior medical students. Almost half of the students felt that their education had always or sometimes helped them deal with professionally-challenging situations. Majority (77.6%) of the students thought that their academic assessments should include assessment of professionalism and should be used as a selection criterion in their future academic careers (62.3%). Most of the students discussed and sought advice regarding professionally-challenging situations from their fellow medical students and colleagues. Seventy-five (88.2%) students did not know which organizational body in the institution

  6. The University of Maryland Medical System invests in its community's minorities. (United States)

    Schimpff, S C; Rapoport, M I; O'Keefe, S L; Grote, D A; Snow, L K


    As a private, non-state-owned teaching hospital adjacent to a predominately low income African American community in Baltimore, the University of Maryland Medical System (hereafter called the Medical System) in partnership with the state's medical school has historically provided excellent medical care to the community's residents regardless of their ability to pay. Nevertheless, executive leadership recognized that the Medical System needed to be even more socially and economically responsible to the minority community by investing more of the system's resources in that community. Doing so would improve the economic strength of the community, and this strength would help the Medical System to continue to thrive and expand its business in Baltimore City. Therefore, in the late 1980s, the Medical System created a program that focuses on greater inclusion of minorities particularly African Americans, in personnel, construction, purchasing, and community outreach. In the area of personnel, recruitment efforts have focused on increasing the representation of minorities, particularly African Americans, in management and residency positions. The result has been the creation of a more supportive environment for minority personnel throughout the organization as well as for minority patients and vendors who have dealings with the medical system. In the area of construction, minority development efforts have included the establishment of a flexible bid-award policy and a partnership with the minority business community. As a result, total construction dollars spent with minority-owned firms increased from $2 million to $18 million over seven years, and the portion of these dollars spent with African American-owned firms increased sixfold. In the area of purchased goods and services, more creative approaches to improving minority participation have been necessary. These have included partnering minority distributors with major suppliers and literally assisting in the creation

  7. Comparison of Two Different Curricula in Psychiatry Clerkship at Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    S. Ali Ahmadi-Abhari


    Full Text Available Objectives: The aim of this study was to evaluate the efficacy of a new psychiatry clerkship curriculum which was designed to improve the knowledge and skills of medical students of Tehran University of Medical Sciences (TUMS, Iran.Methods:This quasi-experimental study was conducted in two consecutive semesters from February 2009 to January 2010. In total, 167 medical students participated in the study. In the first semester, as the control group, the clerks’ training was based on the traditional curriculum. In the next semester, we constructed and applied a new curriculum based on the SPICES model (student-centered, problem-based, integrated, community-based, elective and systematic.At the end of the clerkship, the students were given two exams: Multiple Choice Questions (MCQ to assess their knowledge, and Objective Structured Clinical Examination (OSCE to assess their skills. Baseline data and test performance for each student were analyzed. Results:Compared to the control group, students in the intervention group showed significantly higher OSCE scores (P= 0.01. With respect to MCQ score, no significant difference was found between the two groups.Conclusions:The results suggest that the revised curriculum is more effective than the traditional one in improving the required clinical skills in medical students during their psychiatry clerkship.

  8. Self-medication in academics of a public university in the south of Minas Gerais.

    Directory of Open Access Journals (Sweden)

    Cristina Martiniano MONTANARI


    Full Text Available Introduction: Self-medication is a common practice anywhere in the world and the study of drug use is recognized as an important indicator in identifying the major pathologies in specific populations, estimating the prevalence and enabling better understanding on how populations use therapeutic resources. Objective: The objective of the study was to verify the prevalence of self-medication among students of a public university in southern Minas Gerais and verify if the healthcare academics behave differently from the ones of humanities area. To this end, we performed a descriptive cross-sectional study with a sample of 200 students, with 100 in the area of ​​Health Science (group 1 and 100 of the area of Humanities (group 2. Results: The prevalence of self-medication was 96.9 % among students in group 1 and 82.6 % in group 2 (p = 0.002. The most commonly used classes of drugs were analgesics/antipyretics. The main responsible for the indication of the drug in group 1 was the pharmacist; and in group 2 relatives and friends (p = 0.002 Conclusion: The self-medication proved to be a frequent practice among academics, demonstrating the need to devise strategies to sensitize the academic community regarding this practice.

  9. Systematic Education of Self-Medication at Tokyo University of Pharmacy and Life Sciences. (United States)

    Narui, Koji; Samizo, Kazuo; Inoue, Michiko; Watanabe, Kinzo


    The promotion of self-medication by pharmacies, with the aim of encouraging a patient's self-selection of proper OTC drug, is written about in the national action plan "Japan is Back". The subject of self-medication has been improved in the 2013 revised edition of "Model Core Curriculum for Pharmaceutical Education". At Tokyo University of Pharmacy and Life Sciences, the systematic education of self-medication was started from the onset of the six-year course in the third, fourth and fifth grade. We introduce here a new approach in our systematic education of self-medication. In the practice of the fourth grade, groups of around 5-6 students are formed. The pharmacy students assume various roles-of pharmacist, rater, observer, and chairman-and perform role-playing. We prepared a standardized patient (SP) showing various symptoms. The student of the role of pharmacist asks about the SP's symptoms, chooses an OTC drug suitable for the SP, and explains the OTC drug to the SP. After the role-playing, those in the roles of rater, observer, SP, and faculty give feedback to the student who played the role of pharmacist. Because we conduct this role-playing using SPs with a variety of symptoms, we can create a situation similar to a real drugstore.

  10. Marmara University Medical Students' Perception on Sexual Violence against Women and Induced Abortion in Turkey. (United States)

    Lüleci, Nimet Emel; Kaya, Eda; Aslan, Ece; Şenkal, Ece Söylem; Çiçek, Zehra Nadide


    Historically, sexual assault is a common issue in Turkey. As doctors are one of the steps to help sexually assaulted women, medical students should have basic knowledge of and sensitivity regarding this subject. Another common women's public health issue is induced abortion. In countries where access to abortion is restricted, there is a tendency towards unhealthy abortion. The aims of this study are: (1) to determine the attitudes and opinions of Marmara University Medical Faculty students about sexual assault against women and induced abortion and (2) to propose an educational program for medical students about sexual assault and abortion. Cross-sectional study. The questionnaires were self-administered and the data were analyzed using SPSS v.15.0. First, the descriptive statistics were analyzed, followed by Chi-square for contingency tests assessing differences in attitudes toward sexual assault and induced abortion by factors such as gender and educational term. Differences were considered statistically significant at p0.05). Although there was no significant difference regarding the extent of punishment by victim's status as a virgin, 21.3% (n=63) agreed that punishment should be more severe when the victim was a virgin. About 40.7% (n=120) agreed that the legal period of abortion in Turkey (10 weeks) should be longer. The majority (86.1%, n=255) agreed that legally prohibiting abortions causes an increase in unhealthy abortions. An educational program on these issues should be developed for medical students.

  11. Learning styles of first-year medical students attending Erciyes University in Kayseri, Turkey. (United States)

    Baykan, Zeynep; Naçar, Melis


    Educational researchers postulate that every individual has a different learning style. The aim of this descriptive study was to determine the learning styles of first-year medical students using the Turkish version of the visual, auditory, read-write, kinesthetic (VARK) questionnaire. This study was performed at the Department of Medical Education of Erciyes University in February 2006. The Turkish version of the VARK questionnaire was administered to first-year medical students to determine their preferred mode of learning. According to the VARK questionnaire, students were divided into five groups (visual learners, read-write learners, auditory learners, kinesthetic learners, and multimodal learners). The unimodality preference was 36.1% and multimodality was 63.9%. Among the students who participated in the study (155 students), 23.3% were kinesthetic, 7.7% were auditory, 3.2% were visual, and 1.9% were read-write learners. Some students preferred multiple modes: bimodal (30.3%), trimodal (20.7%), and quadmodal (12.9%). The learning styles did not differ between male and female students, and no statistically significant difference was determined between the first-semester grade average points and learning styles. Knowing that our students have different preferred learning modes will help the medical instructors in our faculty develop appropriate learning approaches and explore opportunities so that they will be able to make the educational experience more productive.


    Directory of Open Access Journals (Sweden)

    A. V. Semenets


    Full Text Available An importance of the application of the electronic document management to the Ukraine healthcare is shown. The electronic document management systems market overview is presented. Example of the usage of the open-source electronic document management system in the Ternopil State Medical University by I. Ya. Horbachevsky is shown. The implementation capabilities of the electronic document management system within a cloud services are shown. The electronic document management features of the Microsoft Office 365 and Google Apps For Education are compared. Some results of the usage of the Google Apps For Education inTSMUas electronic document management system are presented.

  13. Journal publications from Zagreb University Medical School in 1995-1999. (United States)

    Petrak, Jelka; Bozikov, Jadranka


    To analyze a five-year publication output of the Zagreb University Medical School in scientific journals, especially in the journals covered by the Current Contents (CC), bibliographic database of the Institute for Scientific Information. Medical School of the Zagreb University is organized in 10 preclinical, 6 public health, and 17 clinical departments, with 359 faculty members. Research activity is important for the academic promotion, with the number of publications (especially in journals covered by CC) and their impact as a key element. Bibliographic data on the published papers by the authors affiliated to the Zagreb University Medical School in the 1995-1999 period were searched in the CC and Biomedicina Croatica databases, according to the official faculty name list. The collected data were classified into three groups according to the source journals: papers published in international journals covered by the CC, Croatian journals covered by the CC, and Croatian journals not covered by the CC. The publication production was measured on individual and departmental levels by using two counting schemes: a) full publication to each author/department; and b) an equal fraction of a publication (1/n) to each author/department. In the 1995-1999 period, the faculty published 578 papers in the journals covered by the CC, 22.6% of them in the subset of Croatian journals. The differences among departments were considerable, with publishing activity per faculty member varying from 0.25 to 6.23 papers in CC journals and from 0.0 to 15.8 in Croatian non-CC journals. Preclinical departments published significantly less in the Croatian journals indexed in the CC then public health and clinical departments. There was a high variance in the number of publications on the individual level, with the 15.4% of the faculty in the professor rank and 45% in the assistant rank who did not publish a single paper in journals covered by the CC in the analyzed period. On the contrary, 10


    Directory of Open Access Journals (Sweden)

    Andrii V. Semenets


    Full Text Available Moodle is one of the open-source software learning management system using to support an educational process. The problem of updating the outdated Moodle versions is studied in the article. It is shown a successful implementation of a modified version on the basis of I. Ya. Horbachevsky Ternopil State Medical University. The step-by-step manual of the updating and a new server migration process are described. Examples of the application of the virtualization techniques and version control system to the SDE Moodle system administration tasks solving are presented. The SDE Moodle server optimization and customization recommendations are also given.

  15. Medical engineering at Cardiff University. Part 2: Postgraduate programmes of study. (United States)

    Theobald, P; O'Doherty, D M; Holt, C A; Evans, S L; Jones, M D


    The Medical Engineering team within the School of Engineering, Cardiff University, delivers two postgraduate programmes of study. Established over 10 years ago, the part-time MSc programmes in Orthopaedic Engineering and Clinical Engineering offer the opportunity of further study while remaining within full-time employment. Both programmes deliver 120 taught credits over two academic years via a series of residential weekends, with successful completion enabling the student to undertake and then defend a 60-credit research dissertation. Fulfilling a specific role on the career pathway for both student cohorts, the strength of each programme is indicated by the consistent number of applicants.

  16. Migraine attacks among medical students in Soochow University, Southeast China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Gu X


    Full Text Available Xiao Gu,1,2 Yaojie Xie1 1School of Nursing, The Hong Kong Polytechnic University, Hong Kong; 2Intensive Care Unit, Suzhou Municipal Hospital, Suzhou, China Purpose: Migraine is one of the most common primary headache disorders and is burdensome to both the individual and society, influencing the academic performance and quality of daily lives of medical students worldwide. This study aimed to investigate the migraine prevalence in a sample of university medical students in China and to examine the features and typical trigger factors of migraine among these students. Patients and methods: From May 2016 to August 2016, a total of 1,060 medical students who were enrolled in Soochow University in Jiangsu Province in China were chosen through stratified random sampling. A self-administered questionnaire that included the ID MigraineTM for screening of migraine cases was used to collect data. The frequency, severity, duration of migraine attacks, and relevant trigger factors were measured for migraine cases. In total, 986 students completed the questionnaire. Results: The overall migraine prevalence among students was 7.91%, with 4.64% in male and 9.84% in female students. Junior-grade students had a higher migraine prevalence than senior students (prevalence of migraine of year 1 to year 5 undergraduates: 10.83%, 8.9% vs. 6.25%, 4.42%, 5.33%, P<0.05; prevalence of migraine of year 1 to year 3 graduates: 9.68%, 9.71% vs. 6.38%, P<0.05. Students with a positive family history were more likely to suffer migraine than those without (OR=8.48, 95% CI: 4.33–16.59. Stress (n=73, 93.59%, lack of sleep (n=72, 92.31%, and change of sleeping time (n=68, 87.18% were the top three trigger factors among the students. Conclusion: Migraine was common among medical students from a university in China, and especially higher in female and junior-grade students, and those with a family history of migraine. Reducing stress and improving sleep quality might be effective

  17. The Prevalence of Pemphigus (Razi Hospital and Department of Oral Pathology, Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Eshghyar N


    Full Text Available The aim of this retrospective statistical study was to determine the prevalcence and frequency of"nage and sex distributions of pemphigus disease. Pemphigus disease classified as autoimmune bullous"ndermatoses which is a chronic mucocutaneous disease."nThis study was performed in Razi Hospital and department of oral pathology of dental school, Tehran"nUniversity of Medical Sciences. The most frequently effected area was buccal moucosa of oral cavity. The"nmost rate of recurrence was found in oral cavity which being more common in middle age females (25-44"nyears.

  18. Body-art practices among undergraduate medical university students in dar es salaam, Tanzania, 2014. (United States)

    Chacha, Chacha Emmanuel; Kazaura, Method R


    Body-art practices are increasing among adolescents and young adults. Although substantial data are available in developed countries, little has been documented about body-art practices in developing countries. To determine the magnitude, types and reasons for practicing body-art practices among undergraduate medical University students in Dar es Salaam, Tanzania. A cross-sectional descriptive study was conducteed among undergraduate University students in Dar es Salaam involving 536 respondents from two Universities. We used a self-administered questionnaire to collect data. Analyses were based on summary measures and bivariate analyses. While 7.5% of undergraduate students reported having tattoos, 20% reported having body puncturing or piercing. Body piercing is reported more among female university undergraduate students than their male counterparts. Reported main reasons for undergoing body-art include "a mark of beauty," 24%, "just wanted one," 18% and "a mark of femininity or masculinity," 17%. The majority (98%) of students were aware that unsafe body-art practices may lead to contracting HIV and more than half (52%) reported awareness of the risk of Hepatitis B infection. Despite high awareness of the potential risks involved in unsafe body arts that include tattoo and piercing, these practices are increasing among adolescents and young adults. There is need to have educational and counseling efforts so as to minimize associated health risks.

  19. Study of Association between Social Adjustment and Spiritual Health in Qom University of Medical Sciences Students

    Directory of Open Access Journals (Sweden)

    zahra Aliakbarzade arani


    Full Text Available Background and Objectives: Admission to university is considered an opportunity to learn more and mentally grow further. At the same time, it is considered a stressor by some students and causes maladaptive reactions in them. This study was conducted to investigate the association between social adjustment and spiritual health in university students. Methods: Two hundred and fifty students were enrolled in this descriptive-analytical, cross-sectional study according to random, systematic sampling. The used instruments were Bell Adjustment Inventory, consisting of 32 items, with 89% reliability coefficient and Paloutzian & Ellison Spiritual Well-Being Scale, consisting of 20 items, with validity and reliability of 79% and 82%, respectively. Data were analyzed by descriptive statistics, Pearson's correlation coefficient, and univariate and multivariate linear regression in SPSS 16. Results: Women comprised 50.2% of the participants. The mean (SD age of the participants was 21.72 (5.02 and only 18.4% were married. Social adjustment was significantly correlated with total score of spiritual health and scores of the subscales religious health and existential health (P<0.001. Conclusion: Because social adjustment was moderate among Qom University of Medical Sciences students, and in the light of the association between spiritual health and social adjustment, group and individual counseling services can be delivered to students with low levels of social adjustment in universities to help them improve their social and spiritual health. Keywords:

  20. Dr. Auzoux's botanical teaching models and medical education at the universities of Glasgow and Aberdeen. (United States)

    Olszewski, Margaret Maria


    In the 1860s, Dr. Louis Thomas Jérôme Auzoux introduced a set of papier-mâché teaching models intended for use in the botanical classroom. These botanical models quickly made their way into the educational curricula of institutions around the world. Within these institutions, Auzoux's models were principally used to fulfil educational goals, but their incorporation into diverse curricula also suggests they were used to implement agendas beyond botanical instruction. This essay examines the various uses and meanings of Dr. Auzoux's botanical teaching models at the universities of Glasgow and Aberdeen in the nineteenth century. The two main conclusions of this analysis are: (1) investing in prestigious scientific collections was a way for these universities to attract fee-paying students so that better medical accommodation could be provided and (2) models were used to transmit different kinds of botanical knowledge at both universities. The style of botany at the University of Glasgow was offensive and the department there actively embraced and incorporated ideas of the emerging new botany. At Aberdeen, the style of botany was defensive and there was some hesitancy when confronting new botanical ideas. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Body-art practices among undergraduate medical university students in Dar Es Salaam, Tanzania, 2014

    Directory of Open Access Journals (Sweden)

    Chacha Emmanuel Chacha


    Full Text Available Background: Body-art practices are increasing among adolescents and young adults. Although substantial data are available in developed countries, little has been documented about body-art practices in developing countries. Objective: To determine the magnitude, types and reasons for practicing body-art practices among undergraduate medical University students in Dar es Salaam, Tanzania. Materials and Methods: A cross-sectional descriptive study was conducteed among undergraduate University students in Dar es Salaam involving 536 respondents from two Universities. We used a self-administered questionnaire to collect data. Analyses were based on summary measures and bivariate analyses. Results: While 7.5% of undergraduate students reported having tattoos, 20% reported having body puncturing or piercing. Body piercing is reported more among female university undergraduate students than their male counterparts. Reported main reasons for undergoing body-art include "a mark of beauty," 24%, "just wanted one," 18% and "a mark of femininity or masculinity," 17%. The majority (98% of students were aware that unsafe body-art practices may lead to contracting HIV and more than half (52% reported awareness of the risk of Hepatitis B infection. Conclusions: Despite high awareness of the potential risks involved in unsafe body arts that include tattoo and piercing, these practices are increasing among adolescents and young adults. There is need to have educational and counseling efforts so as to minimize associated health risks.

  2. Evaluation of Antidiabetic Prescriptions from Medical Reimbursement Applications at Banaras Hindu University Health Care Facility

    Directory of Open Access Journals (Sweden)

    Dev Priya


    Full Text Available Background: Diabetes is on rapid increase in third world countries undergoing rapid transition in terms of development particularly in India, which is often being referred as Diabetic capital. It is a disease more prevalent at latter part of life of human beings when finances dwindle and social care gets neglected. The medication continues till the whole life on a regular basis. In present study, the objective has been to provide pharmacoeconomic medication to the diabetic pensioners in the backdrop as mentioned in above background.Methods: The data was collected at the medical reimbursement section of pensioners of the University. The data was examined to answer issues of therapeutic decisions in the light of the pharmacoeconomic considerations. In this paper essentially data on choice of prescriptions with the angle of pharmacoeconomic prudence were included. The dichotomy of specialist versus non specialist prescribers at the tertiary center (i.e. medical college hospital was compared. Effort was made to define merit of the prescription based on comprehensive considerations of patient profile, disease profile and therapeutic choice.Results: Total 72 prescriptions were analyzed for the study in which 475 drugs were prescribed to the patients.  Total antidiabetic drugs prescribed to the patients were 169. Out of 72 cases 39 were males and 33 were females with mean age 66.04 ± 5.80 (Mean ± SEM. The average number of drugs per prescription was 6.59 which was very high as per guidelines. Most commonly prescribed antidiabetic drug was Metformin (63.89% followed by Glimepiride (31.95%.Conclusion: This study reflects that there is need to make available the standard therapeutic optionat University Health Care Facility based upon pharmacoeconomic considerations.

  3. Barriers and challenges in researches by Iranian students of medical universities

    Directory of Open Access Journals (Sweden)

    Zohreh Anbari


    Full Text Available Background: Health sciences research (HSR is an essential part of improving health care which plays a critical role in the field of medicine and clinical practice. The aim of the current study was to assess barriers to the research by students of medical sciences as well as to find out effective strategies for management of student researches in Iranian universities. Materials and Methods: This study utilized a hybrid design with quantitative and qualitative analytical approaches conducted on 627 students in six schools of medical sciences in two universities in Central Province in Iran from April to December, 2012. Questionnaires were distributed among researcher and non-researcher students to find barriers to the research. These barriers were approved and validated by similar studies and strategies using the Delphi technique on 36 students. Results: The most important barriers among researcher students were institutional barriers (3.3 ± 1.3, but in non-researcher students they were individual barriers (3.6 ± 1.7. The majority of barriers to involvement in the research among researcher students appeared to be time, lack of access to electronic resources and prolongation of the process of buying equipment. In addition, the greatest barriers among non-researcher students included the lack of time, scientific writing skills, and access to trained assistants. Conclusion: The results showed the issue of attitudes towards compulsory research as a component of critical scholarship in the curriculum of medical courses. Moreover, employment of the research experts can be helpful for research training in schools of medical sciences.

  4. Factors Affecting Job Satisfaction among the Faculty Members at Guilan University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Fardin Mehrabian


    Full Text Available Introduction: Job satisfaction plays a pivotal role in the performance of university faculty members. Identification of the factors influencing job satisfaction can be useful in advancing the educational and research objectives of the university. The aim of the present study was to analyze the factors influencing job satisfaction among the faculty members of Guilan University of medical sciences. Methods: This study was a descriptive cross-sectional research that was conducted in 2012. The statistical population of the research included 139 faculty members at faculties of Guilan University of Medical Sciences selected using stratified random sampling. The instrument of data collection was a questionnaire consisting of two sections; the first section contained 10 questions about demographic information and the second section comprised of 19 questions which was designed based on Herzberg's two-factor theory. The questionnaire was scored according to 5-point Likert scale. Data were analyzed by SPSS 18 software and descriptive statistics indices of frequency, mean, standard deviation and Pearson correlation coefficient reported.Results: 66.2% of the faculty members were male, 62.6% were clinical faculty members and 37.4% basic sciences faculty members. The most important factors affecting the faculty members’ job satisfaction were job security (4.14±0.96, friendly relationship with colleagues (4.01±0.81, and technology and technical knowledge (3.99±0.87. The most important motivational factors influencing job satisfaction were interest in job (4.24+0.71, achievement (3.99±0.87 and equal opportunities for career promotion (3.95±0.99.Conclusion: stability and job satisfaction, creating friendly working environment, proper environmental conditions, professor’s welfare and providing spiritual and material incentives are factors that influence the professor’s job satisfaction.

  5. Performance of the libraries in Isfahan University of Medical Sciences based on the EFQM model. (United States)

    Karimi, Saeid; Atashpour, Bahareh; Papi, Ahmad; Nouri, Rasul; Hasanzade, Akbar


    Performance measurement is inevitable for university libraries. Hence, planning and establishing a constant and up-to-date measurement system is required for the libraries, especially the university libraries. The primary studies and analyses reveal that the EFQM Excellence Model has been efficient, and the administrative reform program has focused on the implementation of this model. Therefore, on the basis of these facts as well as the need for a measurement system, the researchers measured the performance of libraries in schools and hospitals supported by Isfahan University of Medical Sciences, using the EFQM Organizational Excellence Model. This descriptive research study was carried out by a cross-sectional survey method in 2011. This research study included librarians and library directors of Isfahan University of Medical Sciences (70 people). The validity of the instrument was measured by the specialists in the field of Management and Library Science. To measure the reliability of the questionnaire, the Cronbach's alpha coefficient value was measured (0.93). The t-test, ANOVA, and Spearman's rank correlation coefficient were used for measurements. The data were analyzed by SPSS. Data analysis revealed that the mean score of the performance measurement for the libraries under study and between nine dimensions the highest score was 65.3% for leadership dimension and the lowest scores were 55.1% for people and 55.1% for society results. In general, using the ninth EFQM model the average level of all dimensions, which is in good agreement with normal values, was assessed. However, compared to other results, the criterion people and society results were poor. It is Recommended by forming the expert committee on criterion people and society results by individuals concerned with the various conferences and training courses to improve the aspects.

  6. Sleep Quality and Academic Progression among Students of Tabriz University of Medical Sciences, Northwest of Iran

    Directory of Open Access Journals (Sweden)

    Horyeh Sarbazvatan


    Full Text Available Background: Sleep deprivation and drowsiness are very common among university students. The aim of this study was to examine the sleep quality and academic achievement among university students across all medical disciplines in Northwest of Iran. Methods: This study was based on data from a longitudinal study, the "Health and Lifestyle of University Students" (HeLiS. The Pittsburgh Sleep Quality Index (PSQI, a self-administered questionnaire consisting of general information about sleep quality, was completed by students during the first eight weeks of the first semester and academic achievement was assessed via Grade Point Average (GPA in the two semesters following the administration of the PSQI. Results: The mean age of students was 19.16±1.04 and the majority were female (64%. The mean overall score on the PSQI was 6.87±2.25; the majority of students (70% had a global PSQI score greater than 5, indicating they were poor sleepers. Only 28% reported getting over 7 hours of sleep. Female students had higher scores than male students in subjective sleep quality, which was statistically significant (2.15 vs. 1.95 respectively, P = 0.01; however, there was no difference between males and females on other component scores or on the global score. Results of a multiple regression model showed that PSQI score was a predictor of academic achievement (β=-.07, P=0.035, which implies that GPA will be lower among students whose quality of sleep is lower. Conclusion: Based on our sleep quality should be considered and assessed, and sleep hygiene should be promoted among medical university students in order to improve academic achievement.

  7. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA


    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  8. Predictive factors of job satisfaction among nurses in therapeutic-educational centers of Guilan University of Medical Science

    Directory of Open Access Journals (Sweden)

    Nastaran Mirfarhadi


    satisfaction in job environment, using a comprehensive program by organization managers and planners seems necessary.* Corresponding Author: Rasht, Guilan University of Medical Sciences, Faculty of Nursing and Midwifery.Email:


    Directory of Open Access Journals (Sweden)

    Iqra Mubeen


    Full Text Available Background: Upper cross syndrome is becoming more prevalent in today’s population. The syndrome is expressed as a postural disorder presenting with over active pectoralis musculature and upper trapezius musculature. Also there is inhibition of lower and middle trapezius musculature, which results in winging of scapula, elevated and abducted scapula. This scapulardyskinesia there by resulted inrounding of shoulders. The syndrome is often associated with bad posture in routine life oroccupation of a person.The purpose of the study is to determine the prevalence of upper cross syndrome in medical students of Lahore. Methods: A convenience sample of 384 medical students was selected from university of Lahore, based on inclusion and exclusion criteria. Medical students of age between 17 to 2 years with sound physical and mental state were included. Students with any trauma, recent injury, recent fracture or surgery and any serious underlying pathology that may interfere with mobility of upper limb were excluded from the study. The research was a cross sectional observational study and self-administered questionnaires were circulated among participants and the data was analyzed using SPSS version 21. Reed-co scale was used to analyze the proper alignment of head, neck and shoulder; where as wall push test was used to assess the abnormal protrusion of scapula. Results: The study have revealed that48.7% population of the students haveneck pain;and the results have concluded that high prevalence of upper cross syndrome in medical students of university of Lahore and a 66.8% of population was found to have poor studying posture. Conclusion: In this study relation between upper cross syndrome and bad posture were seen and it was found that the individuals suffering with upper cross syndrome were somehow related to bad posture or indulge in activities which make individual to adopt a posture of high physiologic cost there by leading to muscular imbalance

  10. Contraceptive behavior as risk factor for reproductive health of junior students attending a medical university

    Directory of Open Access Journals (Sweden)

    T.N. Govyazina


    Full Text Available 1–3 year students attending medical and preventive faculty of a medical university were our research object. Our research had many stages, and at the first one our goal was to examine and to assess basic behavioral risks for reproductive health of students attending medical and preventive faculty of a medical university. We conducted a sociological examination via questioning. 428 students were questioned as per materials collecting program which included 74 parameters; they accounted for 91.6 % out of the overall official number of students, 45.0 % male students and 40.0 % female students combined work and studies. We detected that, as per questioning results, the specific weight of students who took care of their health amounted to 79.2 % boys and 95.2 % girls. However, the students tended to have bad habits, i.e. constant alcohol intake or smoking. And although information on diseases prevention and on how to pursue healthy lifestyle was perfectly available to them, students didn't try to use it and preserve their health. All the respondents said they were against abortion. Girls were likely to adopt a complex approach when choosing a contraceptive, they resorted to hormonal agents, and, with their partners' consent, to condoms. But they often took hormonal agents without any consultations with a gynecologist or an endocrinologist. Contraceptives were rather rarely applied, and students appeared to have no knowledge on risk factors causing reproductive health deterioration. They also tended to be negligent and too self-confident when it came to reproductive health protection. A risk of abortions was very high for girls who didn't use contraceptives, and also all students ran rather high risk of catching sexual diseases. Sexual education is needed to correct contraceptive behavior; medical workers are a main source of information on reproductive health of young people in 7–10 % cases only. We need to create interactive educational programs

  11. An Evaluation of Graduates\\' Theses at Shahid Sadoughi University of Medical Sciences in Yazd

    Directory of Open Access Journals (Sweden)

    H Mozaffari Khosravi


    Full Text Available Introduction : Writing the thesis is one of the first experiences of university students. It is usually conducted satisfactorily under the advice an advisor. Yet, there are some problems in this regard. Objectives : The purpose of the present study was to evaluate the quality of the medical and dental theses at Shahid Sadoughi University of Medical Sciences. Methods and Materials : This was a qualitative observational study conducted on 30% of medical theses and all the dental theses at Shahid Sadoughi University of Medical Sciences during 1992-2002. The characteristics and features of the different parts of the theses were recorded in a questionnaire. Then, the quality score was calculated for each thesis. Results : In this study, 215 (76.2% volumes of theses of medical students and 67 (23.8% volumes of theses of dentistry students were studied and reviewed. Most of the theses studied (13.8% related to internal medicine, and least of them (1.8% related to pathology. The majority of the theses (92.7% were of experimental research type, and 2.5% included case studies.95.7% of the theses were appropriate regarding title characteristics. Almost 19% of them lacked the part "Statement of the Problem" and 43.2% were deficient in this part. 40.7% of the theses (52% of medical theses and 6% of dental theses lacked "Review of Literature". Only 51.6% of them (40.7% of medical theses and 86.4% of dental theses possessed a "Review of Literature" that was quite related to the thesis topic. In approximately 5.8% of the theses, there was no direct reference to the objectives. For 12.4% of theses, the objectives have been stated accurately while for 81.8% of them this was not the case. Regarding objectives, the medical theses were in a better state and showed a statistically significant correlation with the dental theses. Regarding the part "Results", in 6.9% of the theses, specific objectives have not been stated clearly. 82.6% reached completely to the preset

  12. Social and psychological factors affecting eating habits among university students in a Malaysian medical school: a cross-sectional study


    Ganasegeran, Kurubaran; Al-Dubai, Sami AR; Qureshi, Ahmad M; Al-abed, Al-abed AA; AM, Rizal; Aljunid, Syed M


    Abstract Background Eating habits have been a major concern among university students as a determinant of health status. The aim of this study was to assess the pattern of eating habits and its associated social and psychological factors among medical students. Methods A cross sectional study was conducted among 132 medical students of pre-clinical phase at a Malaysian university. A self-administered questionnaire was used which included questions on socio-demography, anthropometry, eating ha...

  13. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.


    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional


    Rafique, Rafia; Anjum, Afifa


    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  15. Health rights knowledge among medical school students at King Abdulaziz University, Jeddah, Saudi Arabia.

    Directory of Open Access Journals (Sweden)

    Samia M Al-Amoudi

    Full Text Available Health care is a basic human right, and Saudi Arabia affirms these rights for all its citizens.To assess the knowledge of medical students regarding health rights in Saudi Arabia.This cross-sectional study was conducted at King Abdulaziz University (KAU from September 2015 through November 2015. A questionnaire written in English collected demographic data and included questions about reproductive health care and health rights of women and patients with cancer, senility, or special needs.Of the 267 participants, 184 (68.9% were female, and 252 (94.4% were Saudi. Regarding consent, 87 (32.6% and 113 (42.3% participants believed a female patient required the consent of a male guardian to receive medical treatment or surgery, respectively, in Saudi Arabia, and only 106 (39.7% knew that a female patient could provide consent for a caesarean section. Sixty-six (24.7% believed that abortion is never allowed in Islam. Only 93 (34.8% were aware that acquired immunodeficiency syndrome (AIDS and human immunodeficiency virus (HIV patients had health rights, about half (144, 53.9% knew that cancer patients have a right to full information, and most (181, 67.8% believed that a patient had the right to withhold health information from his/her family. Approximately half were aware that cancer patients have the right to free medical treatment (138, 51.7% or that health rights applied to special needs patients (137, 51.3% and senile patients (122, 45.7%.The knowledge of KAU medical students regarding health rights of certain patient populations highlights the importance of health rights education in medical school.

  16. The Relationship Between Organizational Culture and Organizational Commitment in Zahedan University of Medical Sciences (United States)

    Azizollah, Arbabisarjou; Abolghasem, Farhang; Amin, Dadgar Mohammad


    Background and Objective: Organizations effort is to achieve a common goal. There are many constructs needed for organizations. Organizational culture and organizational commitment are special concepts in management. The objective of the current research is to study the relationship between organizational culture and organizational commitment among the personnel of Zahedan University of Medical Sciences. Materials and Methods: This is a descriptive- correlational study. The statistical population was whole tenured staff of Zahedan University of Medical Sciences that worked for this organization in 2012-2013. Random sampling method was used and 165 samples were chosen. Two standardized questionnaires of the organizational culture (Schein, 1984) and organizational commitment (Meyer & Allen, 2002) were applied. The face and construct validity of the questionnaires were approved by the lecturers of Management and experts. Reliability of questionnaires of the organizational culture and organizational commitment were 0.89 and 0.88 respectively, by Cronbach’s Alpha coefficient. All statistical calculations performed using Statistical Package for the Social Sciences version 21.0 (SPSS Inc., Chicago, IL, USA). The level of significance was set at Porganizational culture and organizational commitment (P value=0.027). Also, the results showed that there was a significant relation between organizational culture and affective commitment (P-value=0.009), organizational culture and continuance commitment (P-value=0.009), and organizational culture and normative commitment (P-value=0.009). PMID:26925884

  17. Physiotherapy and pharmacy students perception of educational environment in a medical university from Pakistan. (United States)

    Memon, Aamir Raoof; Ali, Bahadur; Kiyani, Mubin Mustafa; Ahmed, Imran; Memon, Attiq-Ur-Rehman; Feroz, Jam


    To assess and compare the perceptions of the educational environment between physiotherapy and pharmacy students in a public-sector medical university. This cross-sectional study was conducted at the Peoples University of Medical and Health Sciences for Women, Nawabshah, Pakistan, and comprised undergraduate physiotherapy and pharmacy students. The Dundee Ready Educational Environment Measure questionnaire was used to assess the perceptions of students about their educational environment. Global and subscale scores were computed and compared between the respondents. Pphysiotherapy students, the mean global score was 124.9±14.0 while it was 131.7±18.9 for pharmacy students (p=0.16). The domain scores were comparable for both specialties (p>0.05). There was no significance difference in the global and domain scores for preclinical and clinical years in the students (p>0.05). However, in the physiotherapy students, the global and domain scores for Dundee Ready Educational Environment Measure were significantly lower in clinical than preclinical students (pstudents' social self-perception (p>0.05). Students were overall positive about their educational environment.

  18. Evaluation of Board Performance in Iran’s Universities of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Haniye Sajadi


    Full Text Available Background The critical role that the board plays in governance of universities clarifies the necessity of evaluating its performance. This study was aimed to evaluate the performance of the boards of medical universities and provide solutions to enhance its performance. Methods The first phase of present study was a qualitative research in which data were collected through face-to-face semi-structured interviews. Data were analyzed by thematic approach. The second phase was a mixed qualitative and quantitative study, with quantitative part in cross-sectional format and qualitative part in content analysis format. In the quantitative part, data were collected through Ministry of Health and Medical Education (MoHME. In the qualitative part, the content of 2,148 resolutions that were selected by using stratified sampling method were analyzed. Results Participants believed that the boards had no acceptable performance for a long time. Results also indicated the increasing number of meetings and resolutions of the boards in these 21 years. The boards’ resolutions were mostly operational in domain and administrative in nature. The share of specific resolutions was more than the general ones. Conclusion Given the current pace of change and development and the need to timely respond them, it is recommended to accelerate the slow pace of improvement process of the boards. It appears that more delegation and strengthening the position of the boards are the effective strategies to speed up this process.

  19. New open source medical imaging tools released by CERN and University of Bath collaboration

    CERN Multimedia

    Anaïs Rassat, KT group


    New toolbox has applications in medical imaging and cancer diagnosis.   3D X-ray imaging of a patient’s lungs and thorax. The TIGRE toolbox provides a high resolution image with only 1/30th of the radiation for the patient. (Image: Ander Biguri) CERN and the University of Bath have released a new toolbox for fast, accurate 3D X-ray image reconstruction with applications in medical imaging and cancer diagnosis. The software offers a very simple and affordable way to improve imaging and potentially reduce radiation doses for patients. The toolbox is based on Cone Beam Computed Tomography (CBCT), a type of scanning process that takes a series of 2D X-ray pictures and that then processes them into a 3D image. As part of the collaborative project between CERN and the University of Bath, Ander Biguri, a PhD student at Bath, has reviewed a broad range of published CBCT algorithms and adapted them to be faster. Ander Biguri modified the algorithms to run on a laptop fitted with a GPU &ndash...

  20. Training and education in nuclear medicine at the Medical Faculty of the University of Zagreb

    International Nuclear Information System (INIS)

    Ivancevic, D.; Popovic, S.; Simonovic, I.; Vlatkovic, M.


    Training for specialization in nuclear medicine in Yugoslavia includes 12 months of training in departments of clinical medicine and 24 months of training in departments of nuclear medicine. Since 1974 many physicians have passed the specialist examination in Zagreb. A postgraduate study in nuclear medicine began at the Medical Faculty of the University of Zagreb in 1979. It includes four semesters of courses and research on a selected subject leading to the degree of Magister (Master of Science). Most of the training is conducted by the Institute of Nuclear Medicine at the University Hospital, Rebro, in Zagreb, which has the necessary teaching staff, equipment and space. Forty-four students have completed this postgraduate study. Nuclear medicine in a developing country faces several problems. Scarcity of expensive equipment and radiopharmaceuticals calls for modifications of methods, home made products and instrument maintenance. These, mostly economic, factors are given special emphasis during training. Nuclear power generation may solve some of the country's energy problems; therefore, specialists in nuclear medicine must obtain additional knowledge about the medical care and treatment of persons who might be subject to irradiation and contamination in nuclear power plants. Lower economic resources in developing countries require better trained personnel, stressing the need for organized training and education in nuclear medicine. With some support the Institute of Nuclear Medicine will be able to offer various forms of training and education in nuclear medicine for physicians, chemists, physicists, technologists and other personnel from developing countries. (author)

  1. Smoking Prevalence and Associated Factors to Quit among Tabriz Dormitory University Medical Students, Tabriz, Iran

    Directory of Open Access Journals (Sweden)

    Shamsipour M.


    Full Text Available Background and Objectives: Cigarette smoking as a major public health problem contributes extra health costs, and smoking cessation among youths is a priority for any prevention program. This study aimed to determine the prevalence of smoking and examined factors associated with having attempts to quit smoking and the motivations to quit among medical university students. Methods: A cross-sectional survey using a random sampling was carried out among 523 (293 male, and 246 female, aged 22.48±3.33years students in Tabriz University of Medical Sciences. Data were collected by using a self-administered questionnaire. The data were analyzed by t-test, chi-square test and Fisher exact tests.Results: The overal prevalence of smoking was 8.9%. (male 18% and 1.4% female. There were significant relationships between smoking status with male gender and alcohol consumption (p<0.001. The reasons for smoking initiation were: satisfying their curiosity, new experience (37.76%, pleasure and entertainment (17.48%, mental, emotional problems and sedation (16.08%, smoker friends (15.38%, inexperience and ignorance (4.89%. 54.16% of the current smokers had a history of smoking cessation.Conclusion: Regarding the higher prevalence of cigarette smoking in students, especialy in male and attempting to quit smoking in majority of them, preventive interventions in younger age and providing cigarette smoking cessation services for students seem necessary.

  2. Learning styles of nursing and allied health students in Semnan university of medical sciences

    Directory of Open Access Journals (Sweden)

    Fatemeh Ahadi


    Full Text Available Introduction: Several factors as learning styles can influence the learning process. The aim of thisstudy was to determine learning styles, which are used by nursing and allied health students in SemnanUniversity of Medical Sciences.Materials and Methods: This cross-sectional study was performed on 199 nursing and allied healthstudents of Semnan university of medical sciences (2007, Iran. Students were selected using a simplesampling method. The assessment instrument was the last version of Kolb learning style inventory (KLSIV.3.1.Results: Generally, the learning styles of students were divergent (% 27.1, accommodations (% 26.6,convergent (%23.6, and assimilation (%22.6. The preferred learning style in nursing students wasconvergent (%31.9, and in allied health students was divergent (%36.1. There was a significantrelationship between the type of learning styles with academic courses (P=0.006 married status(P=0.004 and average score (P=0.031, but there was no correlation between the type of learning stylesand gender.Conclusion: Considering the predominance of convergent and divergent learning styles in thesestudents, the usage of some educational methods such as problem -based learning, group discussions,brain storming, role playing, computerized simulation and demonstration are recommended in theoretical,clinical and skill laboratory fields, so that; the students in the new and objective situations can apply theirvisualization for more earning knowledge and professional skills.

  3. Assessment of Kolb's Learning Styles among College Students of Qom University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Elaheh rahiminia


    Full Text Available Background and Objective: Learning styles are effective factors in the learning. Learning is a relatively permanent change in the behavior or attitude of a person over time. Whereas improvement of existing conditions is pivotal in educational activities; therefore, the aim of this study was the assessment of stages and learning styles based on the Kolb theory among students of Qom University of Medical Sciences. Materials and Methods: This cross-sectional study was performed on 279 students of the QomUniversity of Medical Sciences, Iran in October 2015. The participants were selected using a stratified sampling method. The assessment instrument was the Kolb learning style inventory (KLSI V.3.1. Data analysis was performed by SPSS using descriptive statistics and Chi square test. Results: The mean age of students was 22.23±4.38 years, and the average grade was 16.85±1.65. Generally, the learning styles of students were convergent (% 38.9, assimilative (% 37.5, divergent (%13.2 and accommodative (%10.4. There was a significant relationship between learning styles with gender (P=0.01. Conclusion: Considering the predominance of convergent and assimilative learning styles in these students, it is recommended that faculty members use visual methods such as diagrams, self learning, individualized instruction and emphasize on practical methods in teaching.

  4. The Relationship Between Organizational Culture and Organizational Commitment in Zahedan University of Medical Sciences. (United States)

    Azizollah, Arbabisarjou; Abolghasem, Farhang; Mohammad Amin, Dadgar


    Organizations effort is to achieve a common goal. There are many constructs needed for organizations. Organizational culture and organizational commitment are special concepts in management. The objective of the current research is to study the relationship between organizational culture and organizational commitment among the personnel of Zahedan University of Medical Sciences.  This is a descriptive- correlational study. The statistical population was whole tenured staff of Zahedan University of Medical Sciences that worked for this organization in 2012-2013. Random sampling method was used and 165 samples were chosen. Two standardized questionnaires of the organizational culture (Schein, 1984) and organizational commitment (Meyer & Allen, 2002) were applied. The face and construct validity of the questionnaires were approved by the lecturers of Management and experts. Reliability of questionnaires of the organizational culture and organizational commitment were 0.89 and 0.88 respectively, by Cronbach's Alpha coefficient. All statistical calculations performed using Statistical Package for the Social Sciences version 21.0 (SPSS Inc., Chicago, IL, USA). The level of significance was set at Porganizational culture and organizational commitment (P value=0.027). Also, the results showed that there was a significant relation between organizational culture and affective commitment (P-value=0.009), organizational culture and continuance commitment (P-value=0.009), and organizational culture and normative commitment (P-value=0.009).

  5. Study of educational furniture conformity with students anthropometric dimensions of Isfahan university of medical sciences

    Directory of Open Access Journals (Sweden)

    mehdi Sadeghi


    Full Text Available Musculoskeletal disorders, early fatigue induced by static work and the same symptoms are caused by inappropriate designed tools, equipment, building and workplace. Inadequate educational furniture is taken to be the reason of severe posture problems such as low back pain, spinal disorders, fatigue, shoulder and neck pain, and disturbance circulation in legs. So ergonomic design of educational furniture should be carefully considered. Materials and Methods: The present research was a cross-sectional study. Samples included desks and chairs (n=150 chosen from reading rooms of dormitories and faculties of Isfahan university of medical sciences Isfahan- Iran. In the study 2 parameters from desk and 5 parameters from chairs were assessed using a tape-measure and a set-sqare. Data were analyzed by SPSS ver 10 software. Results: Comparing the results from the mean of measured values (for seating height, desk height and desk clearance indicated a significant difference between them (p<0. 00. Conclusion: Findings of the study showed that existing standard in Iran about chairs and tables for educational institutions should be reviewed. Also the most important problem with chairs and desks are seating height and desk surface height respectively. These two parameters didn’t match with anthropometric dimensions of the sudents of Isfahan university of medical sciences.

  6. The role of Social Networks on Academic Achievement of Gonabad University of Medical Science\\' students

    Directory of Open Access Journals (Sweden)

    Meisam Dastani


    Full Text Available Introduction: Social networks are the most important means of communication in the societies as well as in the world, so the use of virtual social networks among students is important. The purpose of this study was to evaluate the use of virtual social networks among students in Gonabad University of Medical Sciences. Methods: In this descriptive study, 277 students were randomly selected from  Gonabad University of  Medical Sciences. They completed a questionnaire which its validity and reliability were obtained in earlier studies. Then the data were analyzed using SPSS software version 20. Results: The findings showed that 87 percent of the students were aware of virtual social networks, and 52 percent were members of these social networks. Students spend about an hour and eleven minutes (SD=2.20771 on the virtual networks. There was no significant difference between academic achievement of students in the groups. Conclusion: The results showed that more than half of the students were members of social networks. Students are not familiar with all of the effects of these social networks since they are recently emerged, so performing more research on other aspects of their impact on the life and health of students are necessary.

  7. Systemic Thinking and Partnership Working: A Cross Sectional Study in a Medical Sciences University in Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Khammarnia


    Full Text Available Background: Systemic thinking can provide practice in multidisciplinary team working and improve the organizational efficacy. This study aimed to determine the association between systemic thinking and partnership working in the employees of a medical sciences university in the south of Iran. Methods: A cross-sectional study was performed in Zahedan University of Medical Sciences (ZAUMS in 2015. The study population consisted of all employees in ZAUMS; 370 participants were selected through stratified random sampling. Two standard questionnaires were used for data gathering. The data were analyzed in SPSS (v21 using Pearson, One way ANOVA, and logistic regression. The level of significance was considered as 0.05. Results: In this study, 225 participants (60.8% were female and their mean age was 34.7±8.7. The score of partnership working for 362 participants was higher than the mean standard (40. Systemic thinking had a positive association with partnership working (p=0.001 and married status of the participants (p=0.04. Partnership working in male and older staff was more than others in ZAUMS (p<0.001 and p=0.01, respectively. Conclusion: Systematic thinking had a positive association with the employees’ working partnership. Moreover, the male staff had better systematic thinking. It is recommended that the managers should promote systematic thinking in staff, especially in females, for better partnership and efficacy in organizations.

  8. Quality gap of educational services in viewpoints of students in Hormozgan University of medical sciences. (United States)

    Aghamolaei, Teamur; Zare, Shahram


    Higher education is growing fast and every day it becomes more and more exposed to globalization processes. The aim of this study was to determine the quality gap of educational services by using a modified SERVQUAL instrument among students in Hormozgan University of Medical Sciences. A cross-sectional study was carried out at Hormozgan University of Medical Sciences in 2007. In this study, a total of 300 students were selected randomly and asked to complete a questionnaire that was designed according to SERVQUAL methods. This questionnaire measured students' perceptions and expectations in five dimensions of service that consists of assurance, responsiveness, empathy, reliability and tangibles. The quality gap of educational services was determined based on differences between students' perceptions and expectations. The results demonstrated that in each of the five SERVQUAL dimensions, there was a negative quality gap. The least and the most negative quality gap means were in the reliability (-0.71) and responsiveness (-1.14) dimensions respectively. Also, there were significant differences between perceptions and expectations of students in all of the five SERVQUAL dimensions (p < 0.001). Negative quality gaps mean students' expectations exceed their perceptions. Thus, improvements are needed across all five dimensions.

  9. Survey of Anxiety Levels and Its Relation to Students Demographic of Alborz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    R. Norouzinia


    Full Text Available Background: Today, changing lifestyles, social relations and the advancement of technology causes fear, threats and concerns of different groups in society, especially students. Adverse impact of Anxiety on the efficacy and talents, personality and social identity formation of students, threat to achieve the goals of academic achievement and mental health. The present study was conducted to determine level of anxiety and some of their demographic correlates in the Alborz University of Medical Sciences in 1390. Methods: This study is a descriptive cross sectional study. The study population included all students of the Alborz university. 305 students were selected by stratified random sampling method. The data collection instrument was a demographic questionnaire and standardized Spielberger Anxiety Inventory. Data were analyzed using descriptive and inferential statistical methods. Results: Based on our results, 64 percent of students were anxious. Anxiety levels were significantly higher in men than women (p=0.049. The level of anxiety and interesting in medical course (p<0.001, non-academic study (p=0.007 and a major physical illness (p=0.009 had significant correlations with together. Conclusion: Results showed a high percentage of students anxious. Regarding the relation between anxiety and other problems such as depression and other disorders including failure in educational function, social relationships and lifestyle, Training courses on coping skills for anxiety and stress as well as consulting services and further guidance is recommended for them.

  10. Medical University of South Carolina Environmental Hazards Assessment Program. Deliverables: Volume 2, Annual report, July 1, 1993--June 30, 1994

    Energy Technology Data Exchange (ETDEWEB)


    This reference is concerned with the Crossroads of Humanity workshop which is part of the Environmental Hazards Assessment Program at the Medical University of South Carolina. This workshop was held during the months of June and July 1994. Topics discussed include: Radioactive contamination, aging, medical ethics, and environmental risk analysis.

  11. The impact of organizational culture on employees’ organizational silence In Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ebrahim Parcham


    Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced

  12. Psychometric Properties of Interpersonal Communication skills Questionnaire (ISAQ from the Viewpoint of Students at Tabriz University and Tabriz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Firoz Mahmoodi


    Full Text Available Background and Objective: One of the skills needed for social life is interpersonal communication skills. Assessing the Interpersonal communication skills due to the growth and development of social networks is very important. This study aimed to validate the Fetro's (2000 interpersonal communication skills questionnaire among students of Tabriz University and Tabriz University of Medical Sciences. Materials and Methods: In this descriptivestudy, 750 students of Tabriz University and Tabriz University of Medical Sciences were selected by simple random sampling. Data collected by Fetro (2000 interpersonal communication skills questionnaire. This questionnaire has 65 items with five degrees based on Likert scale. Data were analyzed using Exploratory Factor Analysis through SPSS 23. Results: In total 750 Students filled questionnaires. 423 from University of Tabriz and 327 from of Tabriz University of Medical Sciences. Based on the results of exploratory factor analysis on original 65 items, 6 factors extracted and 54 items remained. Based on original questionnaire factors and literature extracted factors were labeled. So 45.26% of total variance were explained by these six factors (empathy and intimacy, communication skills, ability to maintain communication, assertiveness, listening and conflict resolution skills. Conclusion: According to the result of factor analysis, new validated questionnaire has less items and more components than the original questionnaire. So it is a suitable instrument for measuring interpersonal communication skills by researchers.

  13. Assessing the Process of Receiving Students’ Meals in Tabriz University of Medical Sciences in 2012

    Directory of Open Access Journals (Sweden)

    Farahnaz Varmazyar


    Full Text Available ​ Background and Objectives : The process of receiving meal is one of the most important daily events of university students and managers. Since this process happens within a limited time during the day, and all the students are directly involved in this process, proper management is one  of the main factors of conducting this process appropriately. The aim of this study was to evaluate the process of receiving meals step by step and analyzing how this process takes place and finally offer some strategies for promoting the quality of conducting this process at Tabriz University of Medical Sciences. Material and Methods : The is a cross-sectional study which was conducted by observation, interview and the questionnaires filled out by students and automation section staff. The flowchart for the process of receiving meals of the university was drawn after step by step observation. The questionnaire including 14 questions were answered by 60 students randomly. A suggested flowchart was adjusted after general and specialized analysis of the flowchart in 5W1H method. For analyzing data, Excel 2007 software was applied. Results : Data analysis indicated that 55% of the students believed that too much time was wasted in this process. Currently, each student spends about 43 minutes for having lunch everyday. Although the university has facilitated food reservation by internet, 80% of students do not use this service and refer to self-service restaurant operators and cause long queues . After interviewing with the manager of food section, it was specified that an average amount of Rls. 300,000,000/- is allocated daily for students’ food by students’ deputy which is Rls. 100,000/- for each student and each student pays only 6.5% of the whole price and 93.5% of the price is supplied by students’ welfare affairs deputy. Conclusion: The process of receiving meals of students at Tabriz University of Medical Sciences is a time-consuming process and

  14. Quality assesment of medical education at faculty of medicine of Sarajevo University. (United States)

    Masic, Izet


    Goal of measurement of the quality assessment of students' satisfaction is identification of weak and outdated sections of medical education. By finding out the unnecessary aspects, it is possible to start with improvement of the educational system. The survey was conducted on the sample of 108 students of the final year of the study of Medical faculty in Sarajevo in December 2011. Questionnaire has 24 process and outcome variables for the purpose of quality assessment of the education at the Medical faculty. The measurement of quality of realized lectures of final year of Medical faculty in Sarajevo with formatted questionnaires determined that above 90% students rated it very low with grades under 3 of possible 5, compared with average 3 in survey from 2008. Unpreparedness of independent service after finished medical education has raised to 70% of questioned students, compared to 53% in 2008. Ratio of educators and assistents to students was graded mostly with grades under 3 of possible 5 by more then 80% questioned participants. Students grading satisfaction with concept of preclinical training has peaked in low levels of grade 1 by 44% survey participants, what are similar results compared to 2008. The measurement of satisfaction with concept of clinical education determined even lower and embarassing values of 94% negative attitudes and opinions by questioned students, compared with 83% in 2008. Availability of modern technical equipment at Faculty of Medicine is very low rated with grades under 2 by 87% of students. The problems and weak points in medical education of Faculty of Medicine University of Sarajevo have persisted during period of more then a decade what comparsion of survey results clearly show. There is urgent need of improving and reforming the educational system which will bring more practical clinical and preclincal work, patient-student contact and interaction with bigger full attendance of educators and tutors, all supported by new modern

  15. Factors associated to labour absenteeism due to medical cause in an university institution

    Directory of Open Access Journals (Sweden)

    Juan F. Saldarriaga


    Full Text Available Labor absenteeism due to medical cause has unfavorable implications for everybody. The employee suffers with the disease, the company loses productivity and society suffers delays in its economical and social growth. The study of this problem is obviously necessary in order to achieve an appropriate prevention and control of it. Objective: to explore the behavior of absenteeism by medical causes and its associated factors among the affiliates to the health program in the University of Antioquia, Colombia. Methods: frequency, duration, costs and causes of absenteeism are studied in relation to sex, age and physical activity as a regular behavior. Relative risk and its 95% confidence intervals are estimated. Results: respiratory diseases are the first cause of labor medical handicap. Absenteeism is higher in women. RR 1.65 (CI 95% 1.53-1.77. It has a close relationship to age RR 1.25 (CI 95% 1.12-1.38 and to sedentariness RR 2.17 (IC 95% 1.72-2.73.

  16. Analysis of the drug formulary and the purchasing process at a Moroccan university medical center. (United States)

    Lachhab, Z; Serragui, S; Hassar, M; Cherrah, Y; Errougani, A; Ahid, S


    To give an overview of the pharmaceutical policy in the largest medical center in Morocco, a developing country in socio-economic transition. This is an analytical descriptive study of the drug formulary and the purchasing process carried out at the Ibn Sina University Medical Center. Our formulary included 830 drugs belonging to 14 classes according to the Anatomical, Therapeutic and Chemical (ATC) Classification System. There was a respective predominance of class N (21.8%), class B (13.5%), and class J (12.6%). Injectable route was dominant (46%). Drugs had a significant actual benefit in 70% (according to the French Data), reimbursable in 42.8%, essential in 29.2% according to World Health Organization (WHO) list, and in 36.9% according to the Moroccan list. The calls for tenders included 542 drugs representing 65% of the formulary, and the attribution rate was 71%. The main reason for non-attribution was the lack of offers. Generics accounted for 45% by volume and 26.5% by value. With this first study, we were able to identify key indicators on drugs used in the largest medical center in Morocco. The current challenge is to introduce pharmacoeconomics in decision making concerning the updates of the drug formulary.

  17. Sedative Drug Use among King Saud University Medical Students: A Cross-Sectional Sampling Study

    Directory of Open Access Journals (Sweden)

    Ahmed A. Al-Sayed


    Full Text Available Introduction. Medical students experience significant psychological stress and are therefore at higher risk of using sedatives. There are currently no studies describing the prevalence of sedative drug use among medical students in Saudi Arabia. The aim of this study was to evaluate the prevalence and factors associated with sedative drug use among medical students in Saudi Arabia. Materials and Methods. A cross-sectional convenience sampling study gathered data by anonymous questionnaire from students enrolled at the King Saud University College of Medicine in 2011. The questionnaires collected data regarding social and demographic variables, sleep patterns, and the use of stimulant and sedative drugs since enrollment. Sedatives were defined as any pharmaceutical preparations that induce sleep. Results and Discussion. Of the 729 students who returned questionnaires, 17.0% reported sedative drug use at some time since enrollment. Higher academic year, lower grade point average, regular exercise, fewer hours of sleep per day, poorer quality of sleep, and the presence of sleeping disorders were found to be significantly associated with sedative drug use. Conclusions. Further study is required to increase our understanding of sedative drug use patterns in this relatively high-risk group, as such understanding will help in the development of early intervention programs.

  18. Information technologies in education of medical students at the university of sarajevo. (United States)

    Masic, Izet; Karcic, Emina; Hodzic, Ajla; Mulic, Smaila


    Information and communication technology have brought about many changes in medical education and practice, especially in the field of diagnostics. During the academic year 2013/2014, at Faculty of Medicine, University of Sarajevo, students in the final year of the study were subjected to examination which aim was to determine how medical students in Bosnia and Herzegovina subjectively assessing their skills for using computers, have gained insight into the nature of Information Technology's (IT) education and possessive knowledge. The survey was conducted voluntary by anonymous questionnaire consisting of 27 questions, divided into five categories, which are collecting facts about student's: sex, age, year of entry, computer skills, possessing the same, the use of the Internet, the method of obtaining currently knowledge and recommendations of students in order to improve their IT training. According to the given parameters, indicate an obvious difference in the level of knowledge, use and practical application of Information Technology's knowledge among students of the Bologna process to the students educated under the old system in favor of the first ones. Based on a comparison of similar studies conducted in Croatia, Sri Lanka, Pakistan and Denmark, it was observed that the level of knowledge of students of the Medical Faculty in Sarajevo was of equal height or greater than in these countries.

  19. Organizational Climate and Work Addiction in Shahid Sadoughi University of Medical Sciences, 2014: a Case Study. (United States)

    Rafiee, Noora; Bahrami, Mohammad Amin; Zare, Vahid; Mohammadi, Mahan


    The occupational nature of employees in headquarters units of the University requires them to deal with support issues. Thus, there is some pressure on these employees to complete their assignments on time so that employees in the line units can accurately and expeditiously perform their duties. As a result, work addiction behaviors are sometimes observed among the headquarters personnel. Considering the importance of work addiction and recognizing the factors that intensify it, this study investigated the relationship between organizational climate and the work addiction of headquarters personnel at the Shahid Sadoughi University of Medical Sciences. This descriptive-analytic study was conducted using stratified random sampling of 151 University employees in 2014. The data collection tool was an organizational climate questionnaire, which was supplemented by the Work Addiction Risk Test (WART). The data were analyzed using the Pearson test, Spearman test, independent t-test, Mann-Whitney test, one-way analysis of variance (ANOVA), and the Kruskal-Wallis test using IBM-SPSS version 20. The findings of this study showed that the organizational climate was at a moderate level, and employees were in the danger level in terms of work addiction. In addition, among the dimensions of organizational climate, the risk dimension had a significant relationship with work addiction (porganizational climate score was low and the work addiction score was at the high-risk level, this issue demands more attention of senior managers and human resource officers of organizations to improve the organizational climate and increase employees' awareness of work addiction.

  20. [Clinical pharmacy practice education in master's course of Meijo University in affiliation with medical school]. (United States)

    Matsuba, Kazuhisa


    In 2003, Meijo University has developed a new program to train students in master's degree in the field of clinical practice. This new curriculum has three big pillars of educational goal: Problem-Based Learning (PBL), communication skill and clinical pharmacy practice training. Before exposing students to clinical training, they must learn first how to solve various patients' problems through PBL and enhance their communication skill. To provide a clinical environment, education and training, the Faculty of Pharmacy cooperated with the School of Medicine of Fujita Health University. Master's students together with other members of the healthcare team observe patient's disease state and most especially monitor pharmacotherapy. At first, students will be trained for a month at the pharmacy division and experience one week-nursing job. Next, they will be trained at the clinical divisions such as General Internal Medicine, Cardiology, Endocrinology, Gastroenterology, Respiratory Medicine, Hematology, Chemotherapy, Gastroenterological Surgery, Psychiatry, and Emergency Unit. Students rotate three-month training on four clinical divisions during one year. The head physicians of the medical department hold concurrent post as professors and share responsibility with the pharmacy faculty in training the students. To have its venue where students, faculty and physicians conduct their discussion on clinical cases, a pharmacy satellite seminar class room was set up at Fujita Health University hospital. Through this, pharmacy students and faculty had more opportunities to exchange knowledge on medicine and pharmacy. Master's students are expected to acquire professionalism, ethical knowledge and pharmaceutical care skills through the clinical pharmacy practice program.

  1. Perceptions of Students and Clinical Instructors of Academic Learning Environments at Yazd University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Hamideh Montazeri


    Full Text Available Introduction: The purpose of this cross sectional study is to gain insight into the students and clinical instructors’ perception of learning environments at Yazd medical University in 2012. Various aspects of environment are compared between courses, gender and age. Students and instructors’ perspectives are reported. Methods: The sample consisted of 158 undergraduate students in their final year of graduation in the nursing, anesthesia, operating room, laboratory, radiology, midwifery courses and their 20 clinical instructors at Yazd University. Data were obtained using the Dundee Ready Education Environment Measure (DREEM. Scores were compared across grouping variables identified via demographic information. Results: Scores were fairly high for both students and clinical instructors (M=110.0; SD=21.2 and M=93.1; SD=10.3 respectively, indicating an overall positive perception of learning environments between both groups. The perception of atmosphere subscale (PA received the highest mean grade by both groups. Total DREEM scores didn’t vary significantly between courses (p>0.05 but the results of ANOVA test showed significant differences only for perception of teaching and perception of atmosphere domains. There was not a significant association between females and males regarding total DREEM score (p>0.05. Conclusions: The more positive than negative perception held by the Yazd University health science students and instructors is hopefully indicative of a favorable teaching-learning environment. Overall; teachers’ attention to principles of educational design and setting a favorable environment to promote better learning is recommended.


    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad


    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  3. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria


    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello


    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  4. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel


    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  5. Medical curriculum reform in Sun Yat-sen University: implications from the results of GMER evaluation in China. (United States)

    Xiao, Haipeng; Xian, Liqing; Yu, Xueqing; Wang, Jianping


    Created by interlocking economies, a global language, the informatics revolution and rapid travel, globalization has penetrated all aspects of human life including science, environment, public health and medicine. Physicians are now members of a global community. The global physician should possess universal core essential competences required for medical practice throughout the world. The Institute for International Medical Education (IIME), created by the China Medical Board (CMB) of New York, has developed the " global minimal essential requirements" (GMER) that define the knowledge, skills, professional behavior and ethics that all physicians must have regardless of where they received their general medical education and training. The IIME initiated a pilot project in China in October, 2003, to evaluate the graduates of the 7- or 8-year track program of eight leading medical schools, including Medical School of Sun Yat-sen University. The results of GMER evaluation indicated strengths and areas for improvement of our school in relation to international standards, which greatly re-invigorate our enthusiasm on medical curriculum reform on the new 8-year track program in Medical School of Sun Yat-sen University. The modifications of our medical curriculum for the new 8-year track program based on the results of GMER evaluation are discussed in this paper.

  6. Investigation of science production in Iran’s type I universities of medical sciences, a 6-year assessment

    Directory of Open Access Journals (Sweden)

    M Yadollahi


    Full Text Available Introduction: Science production is one of the main dimensions of sustainable development in any country. Thus, universities as the major centers for science production play a key role in development. The present study aimed to assess the trend of science production in Iran’s type I universities of medical sciences from 2007 to 2012. Method: In this study, the universities’ scores of empowering, governance and leadership, science production, student researches, and number of published articles were computed based on the evaluations of universities of medical sciences by the Ministry of Health, Treatment, and Medical Education from 2007 to 2012. Then, the data were analyzed using descriptive statistics and the figures were drawn by Excel software. Results: This study assessed science production in Iran’s type I universities of medical sciences and analyzed each university’s proportion in publication of articles. According to the results, most of the published articles were affiliated to Tehran University of Medical Sciences. However, considering the role of number of faculty members, different results were obtained. With respect to the evaluation raw scores, Isfahan University of Medical Sciences showed a considerable reduction of scores in 2012, while other universities had a constant or ascending trend. Besides, indexed articles followed an ascending trend in all the universities and most of the articles had been published in index 1. Conclusion: Similar to other studies, the findings of this study revealed an increase in science productions in Iran through the recent years. Yet, the highest scores of the studied indexes, except for student researches, were related to Tehran University of Medical Sciences. This great difference between this university and other universities might be due to accumulation of specific potentials and forces in this region. Overall, science productions followed an ascending trend in all type I universities of

  7. Conflict of Interest Policies at Canadian Universities and Medical Schools: Some Lessons from the AMSA PharmFree Scorecard

    Directory of Open Access Journals (Sweden)

    Mathieu, Ghislaine


    Full Text Available Launched in 2007, the American Medical Students Association (AMSA PharmFree Scorecard is an annual ranking of conflict of interest (COI policies at American medical centres; it focuses on COIs that may occur when medical education seems likely to be influenced by university-industry relationships, especially those with the pharmaceutical and medical device industries. The PharmFree Scorecard has proven influential in stimulating changes in policy regarding the management of COI at American medical institutions, thus it provides a useful jumping off point for reflection on how and why medical education institutions in other countries – and for our purposes, Canada – should pay more attention to the appropriate identification and management of COI. The PharmFree Scorecard methodology examines a diversity of factors and interests that could influence medical education; as such, it is an interesting approach to analysing the COI policies of medical schools. To test its utility or applicability outside the US, we decided to apply the PharmFree Scorecard to the COI policies of the 16 Canadian universities hosting medical schools. Overall, Canadian institutions rank very poorly, especially in ensuring that education and training tools are provided to staff, students and faculty members to enable the identification and management of COI. However, differences between the US and Canadian medical education contexts, e.g., with regards to the governance and funding of universities, limit to some extent the direct applicability of the AMSA ranking. Canadian medical schools – and their host universities – nonetheless have much to learn from insights provided by the AMSA PharmFree Scorecard ranking, although they can and should go further in developing their own COI policies and procedures.

  8. Risk factors of coronary heart disease among medical students in King Abdulaziz University, Jeddah, Saudi Arabia. (United States)

    Ibrahim, Nahla Khamis; Mahnashi, Morooj; Al-Dhaheri, Amal; Al-Zahrani, Borooj; Al-Wadie, Ebtihal; Aljabri, Mydaa; Al-Shanketi, Rajaa; Al-Shehri, Rawiah; Al-Sayes, Fatin M; Bashawri, Jamil


    Nowadays, Cardiovascular Diseases (CVDs) represents an escalating worldwide public health problem. Providing consistent data on the magnitude and risk factors of CVDs among young population will help in controlling the risks and avoiding their consequences. The objective was to estimate the prevalence of risk factors of Coronary Heart Disease (CHD) among medical students during their clinical clerkship (4th - 6th years). A cross-sectional study was done during the educational year 2012-2013 at King Abdulaziz University (KAU), Jeddah. Ethical standards were followed and a multistage stratified random sample method was used for selection of 214 medical students. Data was collected through an interviewing questionnaire, measurements and laboratory investigations. Both descriptive and analytical statistics were done by SPSS version 21. CHD risk percent in thirty years was calculated using Framingham algorithm for each student, then the risk among all students was determined. The commonest risk factors of CHDs were daily intake of high fat diet (73.4%), physical inactivity (57.9%), overweight/or obesity (31.2%) and daily consumption of fast food (13.1%). Hyper-cholesterolemia (17.2%) and hypertension (9.3%) were also prevalent risk factors. Smoking prevalence was low (2.8%). Males had significantly higher mean scores for most of CHD risk factors compared to females (p Students't test = 4.74, p students was 10.7%, 2.3% and 0.5% for mild, moderate and severe risk, respectively. An alarmingly high prevalence of CHD risk factors was prevailed among medical students, especially among males. However, a low prevalence of smoking may indicate the success of "Smoke-free Campus" program. Screening risk factors of CHD among medical students and implementation of intervention programs are recommended. Programs to raise awareness about CHD risk factors, encourage young adult students to adopt a healthy dietary behavior and promote physical exercise should be initiated.

  9. Knowledge and attitude on sex among medical students of a Malaysian university: a comparison study. (United States)

    Sidi, Hatta; Loh, Sit Fong; Mahadevan, Raynuha; Puteh, Sharifah Ezat Wan; Musa, Ramli; Wong, Chia Yee; Hadi, Ammar Amsyar Abdul; Sa'aid, Siti Hajara; Amali, Zulfahmi; Abidin, Murnira; Das, Srijit; Saharom, Mohamed Hatta; Zakaria, Hazli


    The objective of this study was to determine the relationship between clinical/socio-demographic factors with knowledge and attitude on sex among medical students of the National University of Malaysia (UKM). A cross-sectional study assessing 452 students using a self-administered questionnaire of knowledge and attitude was performed and had a response rate of 80%. The majority of respondents were Malays (56%), females (57.5%), lived in urban areas (66.4%), had a median family income of RM3000 and perceived themselves as moderately religious (60%). The overall score on knowledge about sex was 21.7 of 35 (a higher score indicates better knowledge about sex). It was noted that 73.2% of students felt that they did not receive adequate training in medical school to deal with patients' sexuality and sexual problems, while 51.5% felt uncomfortable talking to patients about these issues. Students in the clinical year were more knowledgeable than those in pre-clinical years (22.67 versus 20.71, P students had a satisfactory level of knowledge on sex (>22 marks [median score]). The students' attitude on sex was considered conservative as the majority of them disagreed on premarital sex, masturbation, abortion, homosexuality and oral sex. Gender and religiosity have a large influence on attitudes on controversial sexual issues, whereas clinical status plays a small role. Knowledge on sex among UKM medical students is inadequate and their attitudes on sex are considered conservative. Integration of sexual medicine and health modules in the medical curriculum is crucial for students to more effectively address patients' sexual problems and promote non-judgmental attitudes towards patients. Copyright © 2013 Wiley Publishing Asia Pty Ltd.

  10. Academic leagues: a Brazilian way to teach about cancer in medical universities. (United States)

    Ferreira, Diogo Antonio Valente; Aranha, Renata Nunes; de Souza, Maria Helena Faria Ornellas


    Performance of qualified professionals committed to cancer care on a global scale is critical. Nevertheless there is a deficit in Cancer Education in Brazilian medical schools (MS). Projects called Academic Leagues (AL) have been gaining attention. However, there are few studies on this subject. AL arise from student initiative, arranged into different areas, on focus in general knowledge, universal to any medical field. They are not obligatory and students are responsible for the organizing and planning processes of AL, so participation highlights the motivation to active pursuit of knowledge. The objective of this study was to explore the relevance of AL, especially on the development of important skills and attitudes for medical students. A survey was undertaken in order to assess the number of AL Brazilian MS. After nominal list, a grey literature review was conducted to identify those with AL and those with Oncology AL. One hundred eighty of the 234 MS were included. Only 4 MS selected held no information about AL and 74.4 % of them had AL in Oncology. The majority had records in digital media. The number of AL was proportional to the distribution of MS across the country, which was related to the number of inhabitants. The real impact and the potential of these projects can be truly understand by a qualitative analysis. AL are able to develop skills and competencies that are rarely stimulated whilst studying in traditional curriculum. This has positive effects on professional training, community approach through prevention strategies, and development on a personal level permitting a dynamic, versatile and attentive outlook to their social role. Besides stimulating fundamental roles to medical practice, students that participate in AL acquire knowledge and develop important skills such as management and leadership, entrepreneurship, innovation, health education, construction of citizenship. Oncology AL encourage more skilled care to patients and more

  11. Knowledge of the Guarani language in medical students at a university hospital in Paraguay. (United States)

    Jiménez, Hassel Jimmy; Delgadillo, Lorena; Campuzano de Rolon, Ana; Jiménez, Diana; de Samudio, Angélica; Agüero, Adriana; Radice, César; Jiménez-Britez, Gustavo


    Paraguay is a bilingual country and knowledge of the guarani language is an important communication tool for the doctor- patient relationship. To determine the degree of and the factors that influence the knowledge of the Guaraní language in medical students at a University Hospital in Paraguay. Observational, cross-sectional, analytical study in which an anonymous questionnaire was applied to the final year medical students of a University Hospital of Paraguay. The baseline characteristics of the medical students and their degree of knowledge of the Guarani language were described. The association between the characteristics of the students and the degree of knowledge of the Guarani language was evaluated with the Chi square association test and the logistic regression model. We included 264 students in the survey. Eighty two percent come from the capital, 72% made their pre-university studies in the capital; 92% studied Guaraní in primary and secondary education; 67.9% do not interpret Guarani correctly; 8.5% understand and express themselves totally in Guaraní. Of these, 86% refer to have the greater learning of the language in their home; 75.2% of respondents believe that primary and secondary education did not help in learning the language. The degree of knowledge of the language (speaks and understands the Guarani language correctly) varies according to: the origin of the student, the inland regions or the capital (31.25% vs. 2.5%, adjusted OR = 0.24, 95% confidence interval: 0.06 to 0.92, p = 0.003); the location of primary and secondary school: inland versus capital (25.6% vs. 1%, adjusted OR: 0.08, 95% confidence interval: 0.01 to 0.53, p = 0.009). The degree of knowledge of the Guaraní language of the students is lower compared to the general population; those who best understand and express themselves were born or studied in the interior of the country. The majority considers that primary and secondary education contribute little in the learning of

  12. Investigation the Role of Medical Teacher in Education in Universities of Medical Sciences in the Country from the Viewpoint of Medical Teachers

    Directory of Open Access Journals (Sweden)

    Hossein Jalahi


    Full Text Available Background and purpose: Ideal education is obtained when excellence and promotion of faculty members (faculty development considered in the university and it will not be possible unless the roles of faculty members (teachers are explained in education. In addition, by extracting these roles we can reason a part of policies of conditional employment (contractual and fixed employment, and theorize and reason their evaluation in order to promote and enhance.Methods: This study was done in two qualitative and quantitative stages. Qualitative stage is of content analysis type. Selection of participants was done based on the purpose. According to qualitative research method, open semi-structural interview was used which extracts the data. All interviews were handwritten word by word by the researcher. Same contents were in a group and each group was labeled based on its content meaning, which in this study the researcher named it the role of the professor. Ethical considerations were included in this research. In quantitative stage, in order to prioritize and the importance of extracted roles, a questionnaire was designed to achieve this important by the survey.Results: The study results are presented in two parts: 1. Qualitative study result 2. Quantitative study result, in qualitative study, 22 faculty members participated in the interview as participants. Extracted roles saturation occurred in 17th questionnaire analysis, but last role was obtained from 19th questionnaire. In this study 21 roles were extracted. In quantitative study (Poll the questionnaire was completed by 85 faculty members from six Universities of Medical Sciences of our country. The variables were defined in SPSS software and the scores were averaged and their difference was calculated in each role.Conclusions: Of 21 extracted roles, the role of parents, God reminder, critic and Critique giver, learner and self-assessor are of the cases that the researcher in no publication

  13. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)


    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  14. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.


    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  15. The joint cardiovascular research profile of the university medical centres in the Netherlands. (United States)

    van Welie, S D; van Leeuwen, T N; Bouma, C J; Klaassen, A B M


    Biomedical scientific research in the Netherlands has a good reputation worldwide. Quantitatively, the university medical centres (UMCs) deliver about 40 % of the total number of scientific publications of this research. Analysis of the bibliometric output data of the UMCs shows that their research is highly cited. These output-based analyses also indicate the high impact of cardiovascular scientific research in these centres, illustrating the strength of this research in the Netherlands. A set of six joint national cardiovascular research topics selected by the UMCs can be recognised. At the top are heart failure, rhythm disorder research and atherosclerosis. National collaboration of top scientists in consortia in these three areas is successful in acquiring funding of large-scale programs. Our observations suggest that funding national consortia of experts focused on a few selected research topics may increase the international competitiveness of cardiovascular research in the Netherlands.

  16. Assessment of dedicated revenue of non-educational hospitals in Guilan University of Medical Sciences (2012

    Directory of Open Access Journals (Sweden)

    S. Asefzadeh


    Full Text Available Hospitals, as one of the main providers of health services, are of great importance in health and economy. The aim of this descriptive study was to assess the dedicated revenue of all non-educational hospitals in Guilan University of Medical Sciences (14 hospitals in 2012. On average, 22.35% of income was provided by cash earnings and 77.65% was provided by insurance organizations.There was 1.25% deficit by insurance. The net income of small hospitals with few available beds was very low and they were not economically affordable. The out of pocket to total income ratio was higher in the hospitals located in deprived areas due to lack of full insurance coverage.

  17. Benefits and Barriers of E-Learning for Staff Training in a Medical University. (United States)

    Franz, Stefan; Behrends, Marianne; Haack, Claudia; Marschollek, Michael


    Learning Management Systems (LMS) are a feasible solution to fulfill the various requirements for e-learning based training in a medical university. Using the LMS ILIAS, the Institute of Diagnostic and Interventional Radiology has designed an e-learning unit about data protection, which has been used by 73% of the department's employees in the first three months. To increase the use of e-learning for staff training, it is necessary to identify barriers and benefits, which encourage the use of e-learning. Therefore, we started an online survey to examine how the employees evaluate this learning opportunity. The results show that 87% of the employees had no technical problems and also competence of Information and Communication Technology (ICT) was no barrier. If anything, reported issues were time shortages and tight schedules. Therefore, short learning modules (less than 20 minutes) are preferred. Furthermore, temporal flexibility for learning is important for 83% of employees.

  18. Laparoscopic findings of infertile women at Bangabandhu Sheikh Mujib Medical University

    Directory of Open Access Journals (Sweden)

    Shakeela Ishrat


    Full Text Available Background: Laparoscopy is an important component of infertility work up. It is the gold standard for evaluation of pelvic pathology and assessment of tubal patency. Objective: The objective of the study was to analyze the laparoscopic findings of infertile women presenting at Infertlity unit of Bangabandhu Sheikh Mujib Medical University. Method: We had a retrospective cross-sectional study on Japaroscopic findings of 110 women. Results: Out of all patients 22.7% women had endometriosis. Various degrees of adhesion of pouch of Douglus was present in 16.4 %. Regarding tubal pate:1cy , 26.4% had unilateral block and 28.2% had bilateral block. Conclusion: A significant number of infertile women at the Infertility unit of BSMMU has tuboperitoneal disease and bilateral tubal block and ultimately need in vitro fertilization.

  19. Study of Health-promotion behaviors among university of medical science students

    Directory of Open Access Journals (Sweden)

    Zahra Motlagh


    Full Text Available Background: Health promoting activities and a healthy lifestyle are major strategies to preserve health. Regarding the importance of health in young people, health promotion in society and also lack of related studies in Iran, this study was designed to determine the performance of the health-enhancing behaviors in medical university students and its effective factors.Materials and Method: This study was a cross-sectional-descriptive survey assessing health-promoting lifestyle among students of Yazd university of medical sciences. A total number of 440 students were recruited in this study using a stratified sampling method. Health-promoting lifestyle was measured using walker’s health–promoting life style profile II (HPLP-II instrument. Data were analyzed by χ2, student t-tests and one way ANOVA, using SPSS -11.5.Result: Age range of participants was from 17 to 33 years with a mean age of 21.1 years and was composed of 67.4% females and 32.6% males. Totally, the overall health-promoting lifestyle profile had a mean of 130.31 ±19. The highest mean in the subscales was 26.03±5.04 for spiritual growth and the lowest was 16.24±4.28 for physical activity. Statistical significant association was seen between the socio-demographic variables particularly employment situation (p=0.002, study field (p=0.001, mother’s education level (p=0.007 and mother’s job (p=0.01 with mean of overall health-promoting lifestyle profile.Conclusion: Regarding the situation of health-promoting behaviors due to low physical activity among students especially in girls providing health education programs toward increasing physical activity is recommended.

  20. Evaluation Methods of the Academic Achievement of Students Ilam University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Mirzaei AR


    Full Text Available Aims: Academic achievement exams have long played an important role in education and so have been always judged, reviewed and restudied. The aim of this study was to investigate the use of different types of academic achievement exams (evaluation methods by faculty of Ilam University of Medical Sciences. Instrument & Methods: In this descriptive and cross-sectional study, faculty members of Ilam University of Medical Sciences in the second semester of 2013-14 academic year (N=90 were studied by total counting. Data were gathered by a researcher made questionnaire by 29 questions that was assessing the application level of educational progress evaluation methods by faculty members. For data analysis, SPSS 16 software was used and descriptive and inferential statistics (Student T test and one-way ANOVA were performed. Findings: 76 of participants (93.8% placed a greater emphasis on the final exam. The most widely used methods for students' progress evaluation was multiple-choice questions (93.8% n=76, and low used assessment method was 360 degree evaluation (4.9% n=4. Comparing of mean scores of participants based on gender and academic degree, were not showed a significant differences, but comparison of the mean scores of participants based on faculty showed a significant difference (p<0.05. Conclusion: With respect to faculty member's emphasis on use and application of the final evaluation results and preferably less effort and common procedures, as well as less variety of evaluation methods of students' progress, paying attention to the new methods of educational achievement evaluation and implementation training courses for teachers is essential.

  1. [A Brief Homophobia Scale in Medical Students From Two Universities: Results of A Refinement Process]. (United States)

    Campo-Arias, Adalberto; Herazo, Edwin; Oviedo, Heidi Celina

    The process of evaluating measurement scales is an ongoing procedure that requires revisions and adaptations according to the characteristics of the participants. The Homophobia Scale of seven items (EHF-7) has showed acceptable performance in medical students attending to two universities in Colombia. However, performance of some items was poor and could be removed, with an improvement in the psychometric findings of items retained. To review the psychometric functioning and refine the content of EHF-7 among medical students from two Colombian universities. A group of 667 students from the first to tenth semester participated in the research. Theirs ages were between 18 and 34 (mean, 20.9±2.7) years-old, and 60.6% were females. Cronbach alpha (α) and omega of McDonald (Ω) were calculated as indicators of reliability and to refine the scale, an exploratory (EFA) and confirmatory factor analysis (CFA) was performed. EHF-7 showed α=.793 and Ω=.796 and a main factor that explained 45.2% of the total variance. EFA and CFA suggested the suppression of three items. The four-item version (EHF-4) reached an α=.770 and Ω=.775, with a single factor that accounted for 59.7% of the total variance. CFA showed better indexes (χ 2 =3.622; df=1; P=.057; Root-mean-square error of approximation (RMSEA)=.063, 90% CI, .000-.130; Comparative Fit Indices (CFI)=.998; Tucker-Lewis Index (TLI)=.991). EHF-4 shows high internal consistency and a single dimension that explains more than 50% of the total variance. Further studies are needed to confirm these observations, that can be taken as preliminary. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  2. The pipeline of physiology courses in community colleges: to university, medical school, and beyond. (United States)

    McFarland, Jenny; Pape-Lindstrom, Pamela


    Community colleges are significant in the landscape of undergraduate STEM (science technology, engineering, and mathematics) education (9), including biology, premedical, and other preprofessional education. Thirty percent of first-year medical school students in 2012 attended a community college. Students attend at different times in high school, their first 2 yr of college, and postbaccalaureate. The community college pathway is particularly important for traditionally underrepresented groups. Premedical students who first attend community college are more likely to practice in underserved communities (2). For many students, community colleges have significant advantages over 4-yr institutions. Pragmatically, they are local, affordable, and flexible, which accommodates students' work and family commitments. Academically, community colleges offer teaching faculty, smaller class sizes, and accessible learning support systems. Community colleges are fertile ground for universities and medical schools to recruit diverse students and support faculty. Community college students and faculty face several challenges (6, 8). There are limited interactions between 2- and 4-yr institutions, and the ease of transfer processes varies. In addition, faculty who study and work to improve the physiology education experience often encounter obstacles. Here, we describe barriers and detail existing resources and opportunities useful in navigating challenges. We invite physiology educators from 2- and 4-yr institutions to engage in sharing resources and facilitating physiology education improvement across institutions. Given the need for STEM majors and health care professionals, 4-yr colleges and universities will continue to benefit from students who take introductory biology, physiology, and anatomy and physiology courses at community colleges. Copyright © 2016 The American Physiological Society.

  3. Factors influencing the adoption of E-learning in Tabriz University of Medical Sciences (United States)

    Abdekhoda, Mohammadhiwa; Dehnad, Afsaneh; Ghazi Mirsaeed, Sayd Javad; Zarea Gavgani, Vahideh


    Background: Electronic Learning (E-learning), is the use of electronic technology in education via computer and the internet. Despite its slow adoption by faculty members, e-learning provides several benefits to individuals and organizations. This study was conducted to determine the factors influencing the adoption of e-learning by faculty members in Tabriz University of Medical Sciences. Methods: This was a cross- sectional study, in which a sample of 190 faculty members of Tabriz University of Medical Sciences was randomly selected, using stratified sampling. A Conceptual Path Model of Unified Theory of Acceptance and Use of Technology (UTAUT) was applied to assess the faculty members’ attitude towards e-learning. The collected data were analyzed by SPSS16, using descriptive statistics and regression analysis. The model was tested by structural equation modeling (SEM) and was finally represented by Analysis of Moment Structures. Results: The results evidenced that UTAUT model explains about 56% of the variance for adoption of elearning. The findings also revealed that performance expectancy, effort expectancy, social influences and behavior indentation had direct and significant effects on faculty members’ behavior towards the use of e-learning. However, facilitated condition had no significant effects on the use of e-learning. Conclusion: The authorized model provides considerable insight for perception and anticipation of faculty members’ behaviors in adopting e-learning. The survey clearly identified significant and non-significant factors that may affect the adoption of e-learning. The results of this study could help the policy makers when successful adoption of e-learning is in their agenda. PMID:28491832

  4. Knowledge and risk perception of oral cavity and oropharyngeal cancer among non-medical university students. (United States)

    Osazuwa-Peters, Nosayaba; Tutlam, Nhial T


    To assess non-medical university students' knowledge and perceived risk of developing oral cavity and oropharyngeal cancer. A cross-sectional survey was conducted among non-medical students of a private Midwestern university in the United States in May 2012. Questionnaire assessed demographic information and contained 21 previously validated questions regarding knowledge and perceived risk of developing oral cavity and oropharyngeal cancer. Knowledge scale was categorized into low and high. Risk level was estimated based on smoking, drinking, and sexual habits. Bivariate associations between continuous and categorical variables were assessed using Pearson correlation and Chi-square tests, respectively. The response rate was 87% (100 out of 115 students approached). Eighty-one percent (81%) had low oral cavity and oropharyngeal cancer knowledge; and only 2% perceived that their oral cavity and oropharyngeal cancer risk was high. Risk perception was negatively correlated with age at sexual debut, r (64) = -0.26, p = 0.037; one-way ANOVA showed a marginally significant association between risk perception and number of sexual partners, F(4, 60) = 2.48, p = 0.05. There was no significant association between knowledge and perception of risk; however, oral cavity and oropharyngeal cancer knowledge was significantly associated with frequency of prevention of STDs (p risk perception is low among this student population. Since oral cavity and oropharyngeal cancer incidence is increasingly shifting towards younger adults, interventions must be tailored to this group in order to improve prevention and control.

  5. Viewpoints of nursing and para-medical students about the features of a good university lecturer

    Directory of Open Access Journals (Sweden)

    Raheb Ghorbani


    Full Text Available Introduction: Since teachers play an important role in education, thus, the higher educationorganizations have items to evaluate their performance to promote the quality of education todetermine the characteristics of a good teacher. This study was performed to evaluate the opinions ofstudents in Semnan university of medical sciences about the features of a good academic lecturer.Materials and Methods: This analytical-descriptive study was performed on 133 para-medical andnursing students. A two-part questionnaire containing 24 features of a good educator was given tostudents. In this questionnaire, reliability and validity was considered and the students’ view wasasked in the scale of Likert measuring attitude in the form of without importance, low importance,nearly important, important, and too important. Then, these features were categorized in the fields ofresearch, methodology of teaching, in dividable character, and communication ability.Results: 76% of students were females and 53.4% were studying for B.S. degree. The mostimportant features obtained in this study were proficiency on the course, fluency in speech, organizingthe contents and having interest to teaching. On the other hand, decisiveness of teacher, having interestto research and the teaching experience were those items that had the least important for students. Inaddition, the results showed that there was a significant relation between the gender and the teacher’spersonality features (P=0.025.Conclusion: According to the results, proficiency on the course, fluency in speech and havinginterest in teaching are the items that in selecting the teachers should be considered. Therefore, itseems some workshops are necessary for university lecturers about how to organize the contents,teaching methodology, and how to communicate with others in order to improve the quality ofteaching and learning.

  6. Factors influencing the adoption of E-learning in Tabriz University of Medical Sciences. (United States)

    Abdekhoda, Mohammadhiwa; Dehnad, Afsaneh; Ghazi Mirsaeed, Sayd Javad; Zarea Gavgani, Vahideh


    Background: Electronic Learning (E-learning), is the use of electronic technology in education via computer and the internet. Despite its slow adoption by faculty members, e-learning provides several benefits to individuals and organizations. This study was conducted to determine the factors influencing the adoption of e-learning by faculty members in Tabriz University of Medical Sciences. Methods: This was a cross- sectional study, in which a sample of 190 faculty members of Tabriz University of Medical Sciences was randomly selected, using stratified sampling. A Conceptual Path Model of Unified Theory of Acceptance and Use of Technology (UTAUT) was applied to assess the faculty members' attitude towards e-learning. The collected data were analyzed by SPSS16, using descriptive statistics and regression analysis. The model was tested by structural equation modeling (SEM) and was finally represented by Analysis of Moment Structures. Results: The results evidenced that UTAUT model explains about 56% of the variance for adoption of elearning. The findings also revealed that performance expectancy, effort expectancy, social influences and behavior indentation had direct and significant effects on faculty members' behavior towards the use of e-learning. However, facilitated condition had no significant effects on the use of e-learning. Conclusion: The authorized model provides considerable insight for perception and anticipation of faculty members' behaviors in adopting e-learning. The survey clearly identified significant and non-significant factors that may affect the adoption of e-learning. The results of this study could help the policy makers when successful adoption of e-learning is in their agenda.

  7. Factors and Prevalence of Depression in Students at Iran’s Urmia University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Hamid Reza Khalkhali


    Full Text Available Background: Depression is characterized by decreased tendency to work, reduced pleasure from work, increased or decreased weight, increased or decreased appetite, insomnia or narcolepsy, irritability, fatigue, loss of energy, feelings of worthlessness, feelings of guilt, reduced ability to concentrate and think, and thoughts of suicide or actual suicide attempts. In this 2016 study, we examined the factors and prevalence of depression in students at Urmia University of Medical Sciences in Urmia, Iran. Methods: This cross-sectional study was conducted on 400 students. Data were collected through the Beck Depression Inventory II (BDI-II: a 21- item standard questionnaire in multiple-choice format to evaluate depression. The questionnaires were distributed randomly by trained students over a period of 5 months. Data were analyzed using SPSS ver. 19 software and by descriptive statistics, independent t-tests, logistic regression models, and the chi-squared test. Results: The mean BDI score was 14.67 ± 11.30. Of the study population, 278 (69.8% were men and 120 (30.2% were women. In terms of depression, 40.2% of the students were in the normal range and had no depression, 23.6% were slightly depressed, and 18.3% were partially depressed. Also, 6.03% of students had severe depression, and 3.51% of students had very severe depression. No statistically signi cant relationship was observed between depression and sex (P = 0.11. However, signi cant relationships were observed between depression and education level (P = 0.001, smoking history (P = 0.001, and age (P = 0.023. P values less than 0.05 were considered statistically signi cant. Conclusion: The prevalence of different degrees of depression in the plurality of students at Urmia University of Medical Sciences necessitates the development and institution of psychological training classes.

  8. [Patient-centered care. Improvement of communication between university medical centers and general practitioners for patients in neuro-oncology]. (United States)

    Renovanz, M; Keric, N; Richter, C; Gutenberg, A; Giese, A


    Communication between university medical centers and general practitioners (GP) is becoming increasingly more important in supportive patient care. A survey among GPs was performed with the primary objective to assess their opinion on current workflow and communication between GPs and the university medical center. The GPs were asked to score (grades 1-6) their opinion on the current interdisciplinary workflow in the care of patients with brain tumors, thereby rating communication between a university medical center in general and the neuro-oncology outpatient center in particular. Questionnaires were sent to1000 GPs and the response rate was 15 %. The mean scored evaluation of the university medical center in general was 2.62 and of the neuro-oncological outpatient clinic 2.28 (range 1-6). The most often mentioned issues to be improved were easier/early telephone information (44 %) and a constantly available contact person (49 %). Interestingly, > 60 % of the GPs indicated they would support web-based tumor boards for interdisciplinary and palliative neuro-oncological care. As interdisciplinary care for neuro-oncology patients is an essential part of therapy, improvement of communication between GPs and university medical centers is indispensable. Integrating currently available electronic platforms under data protection aspects into neuro-oncological palliative care could be an interesting tool in order to establish healthcare networks and could find acceptance with GPs.

  9. [Level of tobacco smoking amongst 6th year students of Wroclaw Medical University]. (United States)

    Kurpas, Donata; Wojtal, Mariola; Bielska, Dorota; Rogalska, Monika; Steciwko, Andrzej


    Prevention of tobacco smoking amongst youths and young adult could limit deaths because of illness tobacco related to 2050. The assessment of the level of smoking was the aim of examinations amongst medical students. An anonymous questionnaire containing questions on the subject of tobacco smoking was carried amongst 6th year students of the Medical Department of Wroclaw Medical University in the academic year 2008/2009. Two hundreds then students took part in the study. 62% of examined came from the provincial capital, the 11.4% from the town with the population above 100 hundred of inhabitants, 22.4% of towns with the population below 100 hundred of inhabitants and 3.8% of students--from country centers. 14.8 % respondents admitted to smoking cigarettes, 75.2% were non-smoking persons, 10% were smokers but ceased smoking cigarettes in the sequence of a few last years. Amongst smokers--the most (59% of students and 71% of students) is smoking to 5 cigarettes per day. The most students (56% of women and 60% of men) began smoking in the secondary school. In studied group 67.6% (142) examined is claiming that the anti-tobacco advice should give family doctors, and 43% thinks that a patient which isn't able to cease the smoking in spite of strong motivation should be seen by a family doctor. The percentage of smokers amongst medical students didn't take turns in the sequence of two last years, however amongst smokers--biggest percentage is smoking to 5 cigarettes per day. The students most often begin smoking in the secondary school. The straight majority of the medical students is paying attention, that family doctors should take up giving the anti-tobacco advice and helping patients which isn't able to cease the smoking in spite of strong motivation. The ones smoking the small number of cigarettes and which began smoking in the secondary school are predominating amongst smokers. Overbalancing percentage of examined is located anti-tobacco therapy into competence of

  10. James Cook University's rurally orientated medical school selection process: quality graduates and positive workforce outcomes. (United States)

    Ray, Robin A; Woolley, Torres; Sen Gupta, Tarun


    The regionally based James Cook University (JCU) College of Medicine and Dentistry aims to meet its mission to address the health needs of the region by using a selection policy favouring rural origin applicants and providing students with early and repeated exposure to rural experiences during training. This study seeks to determine if the JCU medical school's policy of preferentially selecting rural and remote background students is associated with differing patterns of undergraduate performance or graduate practice location. Data at application to medical school and during the undergraduate years was retrieved from administrative databases held by the university and the medical school. Postgraduate location data were obtained either from personal contact via email, telephone or Facebook or electronically from the Australian Health Practitioner Regulation Authority website. Practice location was described across Australian Standard Geographical Classification Remoteness Area (ASGC-RA) categories, with 1 being a major city and 5 being a very remote location. The 856 Australian-based students accepted into the JCU medical program between 2000 and 2008 came from all geographical regions across Australia: 20% metropolitan (ASGC-RA 1), 20% inner regional (ASGC-RA 2), 56% outer regional (ASGC-RA 3), and 5% from remote or very remote locations (ASGC-RA 4 and 5). Having a rural or remote hometown at application (ASGC-RA 3-5) was significantly associated with a lower tertiary entrance score (pacademic achievement across years 1 to 3 (p=0.002, p=0.005 and p=0.025, respectively). Graduates having either a rural or a remote home town at application were more likely to practise in rural (RA 3-5) towns than graduates from metropolitan/inner regional centre across all postgraduate years. For example, the prevalence odds ratios (POR) for graduates practising in a rural town at postgraduate year 1 (PGY 1) having either a rural or remote hometown were 2.6 and 1.8, respectively


    Directory of Open Access Journals (Sweden)

    Sergio Jiménez Morgan


    Full Text Available Those engaged in medical sciences are social models. For this reason, their daily habits influence their professional practice and the primary prevention they carry out. The main purpose of this research was to determine whether this group of medicine training students, all from University of Costa Rica, met national and international recommendations regarding health and wellness regulations. In 2014, second semester, anonymous questionnaires were applied to all undergraduate medical students from first year to seniors (n= 216. Based on this information, some personal data was gathered such as smoking habits, alcohol intake, fruit and vegetable consumption, and the amount of physical activities they practiced. According to this evidence, 52.91% drank alcohol beverages while the prevalence of active smokers was low (3.39%. Furthermore, although they accomplished the national and international standards related to fruit and vegetable consumption, 40% of the subjects did not exercise in any way. Among those who did exercise daily, 68.9% invested only 7.8 minutes per day. Among other findings, those who performed some physical activity at least once a week devoted more time to studying than to watching television. In brief, fitness and health promotion programs should target these future professionals to prevent risk factors such as overweight, obesity, and chronic diseases associated with a sedentary lifestyle. English translation by Jeannette Soto Segura

  12. The evaluation of psycho-emotional state in junior students of medical university

    Directory of Open Access Journals (Sweden)

    Tetiana Pavliuk


    Full Text Available Currently, psychosocial factors, stress and mental exhaustion are considered by WHO experts and the International Labour Organization as an important new factor affecting the health, working capacity, training and career. Young generation, especially students, who are an industrial and intellectual potential of the country can be attributed to the risk group because of the extremely high burden of adaptation. The intensity and tension of modern life at a psychological level preceding the occurrence of negative emotional experiences and stress reactions that, accumulating, cause the formation of depressions. The aim of the study was to examine the level of psycho-emotional stress in the junior students of medical university. The observations of the medical students of the second year of study were performed. To determine the psycho-emotional stress we have used adaptive varint of H.Ayzenko method that include an anxiety, frustration, aggressiveness and rigidity, through questionnaires. According to a survey results of the state of psycho-emotional state low levels of stress resistance were found in students in learning activities, indicating that students are exposed to the negative impact of the environment. It should also be noted that the level of emotional condition of students depends on the personal experience of stressful situations that arise in students’ lives.

  13. Impact of pathology theses supported at the medical university of Tunis (2000-2010). (United States)

    Chadli Debbiche, Aschraf; Mrabet, Ali; Abidi, Emna; Falfoul Borsali, Nabiha; Dziri, Chadli


    The thesis is an research work wish must submit to rigorous scientific criteria. However, this research effort remains inaccessible to international scientific communities. The aims of this study were to determinate the publication rates in indexed journals and factors affecting publication. This was a retrospective descriptive study of pathology theses listed in the theses catalog of the library medical university of Tunis whose theses were supported between 2000-2010. Publication had been searched in databases "Pub Med". The number of citations received by each published thesis was recorded in www. Our study concerned 189 theses. Thirty five original articles were derived from 33 theses (17.5%). Eleven medical indexed journals have made the support of articles, dominated by generalist journal (La Tunisie Médicale: 68.6%), specialist journals (Annales de Pathologies, Pathology, Ultrastructural Pathology: 11.4%). The number of article citations had an average of 1. Theses with informative title had been more publication (p=0.005). Theses with structured introduction had been more publication (p=0.002). Publication rate of pathology theses in indexed journals are relatively low. This publication rate could be improved by the organization of seminars and workshops on writing articles from theses or by the improvement of these articles in national competitions.

  14. Masters theses from a university medical college: publication in indexed scientific journals. (United States)

    Dhaliwal, Upreet; Singh, Navjeevan; Bhatia, Arati


    The thesis is an integral part of postgraduate medical education in India. Publication of the results of the thesis in an indexed journal is desirable; it validates the research and makes results available to researchers worldwide. To determine publication rates in indexed journals, of works derived from theses, and factors affecting publication. Postgraduate theses submitted over a five-year period (2001-05) in a university medical college were analyzed in a retrospective, observational study. Data retrieved included name and gender of postgraduate student, names, department and hierarchy of supervisor and co-supervisor(s), year submitted, study design, sample size, and statistically significant difference between groups. To determine subsequent publication in an indexed journal, Medline search was performed up to December 2007. Chi square test was used to compare publication rates based on categorical variables; Student's t-test was used to compare differences based on continuous variables. One hundred and sixty theses were retrieved, forty-eight (30%) were published. Papers were published 8-74 (33.7+/-17.33) months after thesis submission; the postgraduate student was first author in papers from 26 (54%) of the published theses. Gender of the student, department of origin, year of thesis submission, hierarchy of the supervisor, number and department of co-supervisors, and thesis characteristics did not influence publication rates. Rate of publication in indexed journals, of papers derived from postgraduate theses is 30%. In this study we were unable to identify factors that promote publication.

  15. [High frequency of plagiarism in medical thesis from a Peruvian public university]. (United States)

    Saldaña-Gastulo, J Jhan C; Quezada-Osoria, C Claudia; Peña-Oscuvilca, Américo; Mayta-Tristán, Percy


    An observational study was conducted to describe the presence of plagiarism in medical thesis in 2008 performed at a public university in Peru. Search for plagiarism in 33 thesis introductions using a Google search algorithm, characterizes of the study type and we search in electronic form if the thesis mentor have published articles in scientific journals. We found evidence of plagiarism in 27/33 introductions, 37.3% (171/479) of all the paragraphs analyzed had some degree of plagiarism, literal plagiarism was the most frequent (20/27) and journals were the most common sources of plagiarism (19/27). The characteristics of the studies were observational (32/33), cross-sectional (30/33), descriptive (25/33) and retrospective (19/33). None of the authors had published in a scientific journal, and only nine of his tutors of them had at least one publication. No association was found between the characteristics of the thesis and the presence of plagiarism. In conclusion, we found a high frequency of plagiarism in theses analyzed. Is responsibility of medical schools take the necessary actions to detect and avoid plagiarism among their students.

  16. Phased implementation of AT and T PACS at Duke University Medical Center

    International Nuclear Information System (INIS)

    Stockbridge, C.; Ravin, C.E.


    ''Help me communicate more quickly and more effectively with referring clinicians''. This request was the driving behind the installation of the AT and T CommView System at Duke. The CommView System is a type of Digital Image Management System and Picture Archival Communication System whose chief purpose is to deliver interpolated diagnostic images to referring clinicians and attending physicians. The system acquires electronic images from modalities in a diagnostic imaging facility, stores these images in computer managed patient files and distributes these on demand over fiber optic cable to Display Consoles. The CommView System was designed at AT and T Bell Labs; it uses fiber optic ribbon cable between buildings fused to multistrand lightguide building cables to distribute images, typically around a medical center or campus at data transfer rates of 40 Mbps. This paper gives the rationale used in designing a start-up network and placing the initial equipment for a field of the AT and T CommView System in the Radiology Department of Duke University Medical Center

  17. Learning styles of students of Baqiyatallah University of Medical Sciences in 2012

    Directory of Open Access Journals (Sweden)

    Hojat Rashidi-jahan


    Full Text Available Introduction: Understanding the learning styles of students may help educational planning and improve the learning. This study aims to assess learning styles, and relevant determinants, of students who study in various disciplines of medical sciences at Baqiyatallah University of Medical Sciences (BUMS in 2012. Methods: In this cross-sectional study, 180 students from BUMS were selected randomly. Data were collected sing the Kolb learning style questionnaire during April/May 2012. One-way ANOVA, Student t-test, Chi-square or Fisher exact tests were used for analyzing the data. Results: The mean age of participants was 29.3±7.0, majority of them were males. The preferred learning styles were diverger (76.7%, accommodator (12.8%, assimilator (7.8% and converger (2.8% respectively. The results showed that the factors such as age, sex, marriage status, father and mother education, grade point average (GPA and academic degree could be important to determine learning style characteristics of students. The findings also indicate that the preferred learning style among the students with different GPAs or academic degrees are not different considerably. Conclusion: Regarding the most preferred leaning style by the, proper planning to address proper teaching styles according to the preferred learning styles is necessary.

  18. [Factors associated with academic success of medical students at Buenos Aires University]. (United States)

    Borracci, Raúl A; Pittaluga, Roberto D; Álvarez Rodríguez, Juan E; Arribalzaga, Eduardo B; Poveda Camargo, Ricardo L; Couto, Juan L; Provenzano, Sergio L


    The aim of this study was to identify common factors relating to the academic success of medical students who were distinguished with honors at the Buenos Aires University. In 2011, 142 graduates were surveyed; the questionnaire included 59 questions on their sociodemographic environment, living conditions and social integration, motivation to study, learning capacity and health quality during their career. Compared to other students, these distinguished students more often lived in the city, far from their families; had been educated at private or universitary high schools, their economic needs were financed by their parents, who were on the whole professionals. Most of them were single and childless. The possibility of future employment oportunities (work) did not influence their choice of a medical career, academic success was important to them and they believed that success depended largely on personal effort; they knew how to handle anxiety, were sociable but independent and preferred solid experience to abstract conceptuality in order to obtain information. Our conclusion, within the current system of candidate selection, these results serve to calculate the covert self-selection mechanisms during the career, or in a more restrictive regime, to select those likely to reach academic success due to their privileged ambience. The analysis of demographic factors indicates some degree of inequality for socially disadvantaged students. Perhaps, a selection system based only on intellectual abilities would help identify and support the best candidates regardless of their social context.

  19. Satisfaction With Medication Therapy Management Services at a University Ambulatory Care Clinic. (United States)

    Kim, Shiyun; Martin, Michelle T; Pierce, Andrea L; Zueger, Patrick


    A survey was issued to patients enrolled in the Medication Therapy Management Clinic (MTMC) at University of Illinois Hospital and Health Sciences (June 2011-January 2012) in order to assess satisfaction with pharmacy services provided by pharmacists. A 23-item survey was offered to 65 patients in the MTMC program before or after clinic visits. Since there is a paucity of data indicating the level of satisfaction with MTM services provided by pharmacists, this survey may contribute to the process of building a greater collaboration between the pharmacist and patient. Sixty-two of 65 patients completed the survey; satisfaction with MTMC pharmacists was demonstrated to be significantly positively correlated with overall satisfaction with the MTMC. Patient satisfaction is not significantly different according to age, gender, ethnicity, or number of disease states. Satisfaction with the pillbox service is not significantly different between younger and older patients. It was also noted that patients taking a greater number of medications had higher levels of satisfaction. Most patients indicated that they were satisfied with the MTMC pharmacists and services; further study linking patient satisfaction with MTM services to improved patient outcomes may allow our MTMC to serve as a model for other pharmacist-managed MTMCs serving similar patient populations. © The Author(s) 2014.

  20. Awareness and attitudes towards organ donation among medical students at King Abdulaziz University, Jeddah, Saudi Arabia. (United States)

    Sayedalamin, Zaid; Imran, Muhammad; Almutairi, Osama; Lamfon, Mohammed; Alnawwar, Majd; Baig, Mukhtiar


    To assess awareness and attitude of medical students about organ donation. This cross-sectional study was conducted in 2014 at King Abdulaziz University, Jeddah, Saudi Arabia, and comprised medical students. The participants were asked about their religious and other beliefs towards organ donation, their reasons for not donating organs, and their personal opinions about organ donation through a questionnaire. SPSS 21 was used for data analysis. Of the 481 participants, 250(52%) were females, and 231(48%) were males. The overall mean age was 21.36±1.63 years. Besides, 437(90.9%) students knew what organ donation means, 433(90%) supported organ donation, and 90(18.7%) knew someone who had donated an organ. Moreover, 245(50.9%) participants were willing to donate their organ to their family alone, 198(41.2%) were willing to donate to any deserving patient while 439(91.3%) rejected that religion precluded organ donation, and 354(73.6%) did not know about the grafting of organs from a man to a woman and vice versa. Awareness and attitude towards organ donation were not up to the mark among the participants.

  1. Prevalence Rate of Using ٍEcstasy among Medical Sciences Students in Urmia University in 2007

    Directory of Open Access Journals (Sweden)

    Sh. Miri Ghaffarzadeh


    Full Text Available Introduction & Objective: The present study aims to achieve a comprehensive depiction of ecstasy consumption among the students of Urmia University of medical sciences in 2007.Materials & Methods: Totally 950 students were surveyed in this cross-sectional descriptive study. A census was used as a sampling method. A self-report questionnaire regarding demographic details and ecstasy consumption was completed by students. Data was stored in a database and then was analyzed through descriptive tests by SPSS software. Chi square test was used to determine the correlation coefficient.Results: There were 798 subjects of all target population who had never used this drug. However, 132 subjects (18 regularly, 56 occasionally for fun and 58 at least once consumed ecstasy pills. Thus the point prevalence of ecstasy consumption among the students was 14.19 percent. There were 232 subjects who had never heard of the term “ecstasy". Instead, the knowledge source of the rest about ecstasy was books (116 subject, internet (56 subjects, mass media (489 subjects, friends (28 subjects, and family (2 subjects. A significant relation was observed between ecstasy consumption and other variables (parents' education, residence in student campus, attending parties, smoking, canabis and opium consumption. Conclusion: Results of this study revealed that the point prevalence of ecstasy pills consumption among university students was 14.19% that raises the need for purposive intervention and the necessity of planning to prevent and decrease this phenomenon.(Sci J Hamadan Univ Med Sci 2012;18(4:67-72

  2. Educational needs assessment of Mashad University of Medical Sciences’ managers in management and leadership

    Directory of Open Access Journals (Sweden)

    Emad Zade A


    Full Text Available Background: The first step in human resource development is educational need assessment. A sound knowledge of managerial roles and skills is vital for a successful management in the educational system. Purpose: To determine the educational needs of managers and directors of Mashad Medical University in filed of educational management and leadership. Method: A survey of a 40-person sample of the university managers including deans and vice deans for education of the faculties and the heads of educational groups the data were analyzed with SPSS. Results: The mean age of the sample was 47.2(±7.5 and the mean duration of serving in managerial positions were 5.4(±3.6.The most needed items to be taught were identified as strategic planning in management, setting educational goals, deciding whether the ability to be a manager is inborn or must be acquired, main problems in educational planning and surveillance techniques, educational guidance, system analysis and educational evaluation. Characteristics of educational advisors were also of great importance. Conclusion: Our study showed that educational managers were aware of their need for further development of a sound basis of managerial knowledge. Key words: Need assessment, educational needs, educational managers

  3. Banner plans to issue new bonds to cover university of Arizona medical center purchase

    Directory of Open Access Journals (Sweden)

    Robbns RA


    Full Text Available No abstract available. Article truncated at 150 words. Modern Healthcare is reporting that Banner Health is issuing new bonds this week to refinance older debt (1. Banner financed the $1 billion purchase of the University of Arizona Health Network (UAHN including the University of Arizona Medical Center with a $700 million short-term loan from investment bank Mizuho in February. Banner is issuing $100 million in tax-exempt, fixed rate Series 2015A bonds. It is also planning to take on an additional $500 million in taxable and tax-exempt debt that will be used to replace the short-term loans associated with the purchase. Banner is focusing on how to improve the return on its UAHN investment, which has dragged down its earnings. UAHN's financial performance has deteriorated with an operating margin declining to -4.3% in fiscal 2014, down from -1.2% the previous fiscal year. Before that, UAHN was profitable, according to Banner Chief Financial Officer Dennis Dahlen. Banner reported an operating ...

  4. Sexual and reproductive health in Spanish University Students. A comparison between medical and law students. (United States)

    Coronado, Pluvio J; Delgado-Miguel, Carlos; Rey-Cañas, Adriana; Herráiz, Miguel A


    To describe behaviors and knowledge related to sexual and reproductive health of Spanish university students and their association with the subject area studied (biomedical or not). A descriptive cross-sectional observational study conducted with 2074 students aged 18-24years from the University Complutense of Madrid in the Faculties of Medicine and Law. Simple random stratified sampling without replacement was performed. A self-administered, anonymous and voluntary questionnaire was distributed. It was based on the Youth Risk Health Behavior Survey and assessed behavior and knowledge in three areas: sex, contraceptive methods (CM) and sexually transmitted infections (STIs). In total, 83.5% of respondents had had sexual intercourse, from a mean age of 16.8years and with a mean of 3.4 sexual partners. Compared with the law students (LS), fewer medical students (MS) were sexually active, they had a later age of sexual initiation and they had had fewer sexual partners (plaw students. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Non medical use and abuse of psychoactive substances among university students in health-related courses

    Directory of Open Access Journals (Sweden)

    Clesio Nepomuceno


    Full Text Available Objective: To understand the pattern of consumption of legal andillicit drugs among students of health-related courses and, if thereare users among the participants in the survey, and find out whetherthey wish to participate in prevention and treatment programs.Methods: Quantitative and descriptive study performed using aself-applicable questionnaire. The study population consisted ofstudents at a private university in the city of Sao Paulo whoanswered a questionnaire on research objectives. Anonymity wasassured, and all of them signed an informed consent form. Results:Five hundred and eighty-three students participated in the study,82% female and 18% male. Most students (75.45% were aged 20-35 years. The average family income ranged from 5 to 15 minimumwages. Among the legal substances, alcohol was most frequentlymentioned as used occasionally, frequently or daily (47.33%,followed by tobacco (36.02%. As to illicit drugs, Cannabis sativawas more often mentioned for experimental and occasional use(12.86% and 2.83% of students reported dependence. It wasfollowed by inhaled substances and cocaine. Crack, heroin in theform of medication (Dolantin, “mushroom tea” and othermedications were also mentioned as tried by the participants.Conclusion: These data were similar to those of other studiesperformed with university students and showed the need to createeducational programs in order to broaden the complexity of thecircle involving drug use and abuse.

  6. Does leadership effectiveness correlates with leadership styles in healthcare executives of Iran University of Medical Sciences. (United States)

    Ebadifard Azar, Farbod; Sarabi Asiabar, Ali


    Effective leadership is essential to passing through obstacles facing the health field.The current health care system in Iran has major problems and gaps in the field of effective leadership. The aim of this study was to evaluate hospital managers' leadership style through selfassessment and to determine the correlation between leadership styles with healthcare executives' leadership readiness and leadership effectiveness. In this cross-sectional study a self-administered questionnaire completed by all internal healthcare executives of all teaching and non-teaching hospitals affiliated to Iran University of Medical Sciences. Questionnaire was composed to determine demographic information, leadership style questions, leadership effectiveness and leadership readiness. Descriptive statistics and Pearson correlation coefficient were used for data analysis. According to the findings, the dominant style of healthcare executives was transformational leadership style (with a score of 4.34). The leadership effectiveness was estimated at about 4.36 that shows the appropriate level of leadership effectiveness. There was a significant correlation (correlation coefficient of 0.244) between leadership readiness and transformational leadership style (pleadership effectiveness with transformational (0.051) and transactional (0.216) styles. There was a correlation between leadership readiness and leadership effectiveness with leadership styles. Application of this research will be crucial to universities and healthcare executives. This study suggests that strengthening the scientific basis is essential for leadership readiness and leadership effectiveness in healthcare system.

  7. Attitudes towards psychiatry of undergraduate medical students at Bayero University, Nigeria

    Directory of Open Access Journals (Sweden)

    N C Aghukwa


    Full Text Available Background. This study determined and compared responses of 5th- and 6th (final-year medical students on their attitudes to psychiatry as a profession. Also elicited were their choices of area of future medical specialisation. Method. A prospective and cross-sectional study using an adapted 27-item self-administered questionnaire to obtain responses from 91 5th- and 6th-year medical students at Bayero University, Kano, Nigeria. Results. More than 60% of the students’ first choices for future specialisation were surgery, obstetrics/gynaecology or internal medicine. Psychiatry was the first preference for less than 2%. More than 75% of the students’ views on the overall merits and efficacy of psychiatry were positive, although they felt that psychiatry had low prestige and status as a profession. In addition, the same proportion considered that psychiatry was scientific, making advances in the treatment of major mental disorders, and helpful in liaison practice. More than 50% stated that psychiatry would not be their choice of last resort for residency education and the same proportion felt that friends and fellow students rather than family members would discourage them from specialising in psychiatry. More than 50% would feel uncomfortable with mentally ill patients, felt that psychiatry would not be financially rewarding, and did not think that psychiatrists abuse their legal power to hospitalise patients. Attitudes of the two groups of students to psychiatry as a profession were not significantly different (p>0.05. Conclusion. A clinical clerkship in psychiatry did not influence the students’ choice of future specialisation.

  8. Experience of Problem-Based Learning in Nursing Education at Kaohsiung Medical University

    Directory of Open Access Journals (Sweden)

    Fan-Hao Chou


    Full Text Available Nursing education must keep up with the rapidly changing medical landscape to support the competences of nurses in the areas of critical thinking, problem solving, and creativity. Problem-based learning (PBL provides an appropriate strategy for nursing education innovation. Nursing curricula based on PBL remain in the growing stage in Taiwan. Kaohsiung Medical University introduced PBL into nursing education in 2002. The critical events in the process included: (1 nurturing key tutors; (2 using PBL teaching methods in an elective course—Oncology Nursing, and designing a new elective course—Symposiums Regarding Clinical Cases; (3 holding conferences inside and outside the school to promote PBL teaching methods; (4 linking e-learning and PBL teaching methods; (5 conducting PBL research; (6 establishing a committee of PBL, objective structured clinical examination, and teaching material review for the College of Nursing; and (7 setting up a required course—Nursing Ethics. We now have 12 key tutors in the College of Nursing. We have also completed two studies to evaluate the ability of students and to explore the experience of tutors. From our studies, we know that PBL can increase learner abilities in self-directed learning, critical thinking, and PBL performance. The approach helps students to cope with the changing medical landscape. Furthermore, tutors and teachers develop adequate PBL teaching skills. Based on the experience above, we believe that we are on the right path in terms of continuing tutor development, gradually increasing the number of PBL courses, and undertaking further research to promote PBL methods in Taiwan.

  9. [Predictors of success among first-year medical students at the University of Parakou]. (United States)

    Adoukonou, Thierry; Tognon-Tchegnonsi, Francis; Mensah, Emile; Allodé, Alexandre; Adovoekpe, Jean-Marie; Gandaho, Prosper; Akpona, Simon


    Several factors including grades obtained in the Baccalaureate can influence academic performance of first year medical students. The aim of this study was to evaluate the relationship between results achieved by students taking Baccalaureate exam and student academic success during the first year of medical school. We conducted an analytical study that included the whole number of students regularly enrolled in their first year of medical school at the university of Parakou in the academic year 2010-2011. Data for the scores for each academic discipline and distinction obtained in the Baccalaureate were collected. Multivariate analysis using logistic regression and multiple linear regression made it possible to determine the best predictors of success and grade point average obtained by students at the end of the year. SPSS Statistics 17.0 was used to analyse data and a p value p grade point average obtained in the Baccalaureate and honors obtained in the Baccalaureate were associated with their success at the end of the year, but in multivariate analysis only a score in physical sciences > 15/20 was associated with success (OR: 2,8 [1,32-6,00]). Concerning the general average grade obtained at the end of the year, only an honor obtained in the Baccalaureate was associated (standard error of the correlation coefficient: 0,130 Beta =0,370 and p=0,00001). The best predictors of student academic success during the first year were a good grade point average in physical sciences during the Baccalaureate and an honor obtained in the Baccalaureate The inclusion of these elements in the enrollement of first-year students could improve academic performance.

  10. Barriers in Implementing E-Learning in Hormozgan University of Medical Sciences. (United States)

    Lakbala, Parvin


    E-learning provides an alternative way for higher educational institutes to deliver knowledge to learners at a distance, rather than the traditional way. The aim of this study is to identify the barrier factors of e-learning programs in Hormozgan University of Medical Sciences (HUMS) in respect of the students and lecturers' point of view. A cross-sectional study based on a questionnaire was conducted among 286 of students and lecturers in the nursing, midwifery and paramedic schools of HUMS. Two hundred and eighty-six participants filled in the questionnaire: 256 students, and 30 lecturers. Results of the study showed a lack of proper training in e-learning courses of the university 182 (69.1%), limited communication with the instructor 174 (68%) and the learners dominance of English language 174 (68%) showed the greatest importance for the students. The awareness about e-learning program was 80% and 43% among lecturers and students respectively.The dominance of English language 26 (86.7%) and lack of research grants for e-learning 23 (76.6%) and lack of proper training on e-learning courses from the university 20 (66.7 %) were the most important barrier factors of implementing e-learning for lecturers. E-learning courses to supplement classroom teaching was a solution that mentioned by the majority of students 240 (93.8%) and lecturers 29 (96.7%) in this study. The positive perception of e-learning is an important consequence effect in the future, educational development of nursing, midwifery and paramedic schools.

  11. Barriers in Implementing E-Learning in Hormozgan University of Medical Sciences (United States)

    Lakbala, Parvin


    Background: E-learning provides an alternative way for higher educational institutes to deliver knowledge to learners at a distance, rather than the traditional way. The aim of this study is to identify the barrier factors of e-learning programs in Hormozgan University of Medical Sciences (HUMS) in respect of the students and lecturers’ point of view. Methods: A cross-sectional study based on a questionnaire was conducted among 286 of students and lecturers in the nursing, midwifery and paramedic schools of HUMS. Two hundred and eighty-six participants filled in the questionnaire: 256 students, and 30 lecturers. Results: Results of the study showed a lack of proper training in e-learning courses of the university 182 (69.1%), limited communication with the instructor 174 (68%) and the learners dominance of English language 174 (68%) showed the greatest importance for the students. The awareness about e-learning program was 80% and 43% among lecturers and students respectively. The dominance of English language 26 (86.7%) and lack of research grants for e-learning 23 (76.6%) and lack of proper training on e-learning courses from the university 20 (66.7 %) were the most important barrier factors of implementing e-learning for lecturers. E-learning courses to supplement classroom teaching was a solution that mentioned by the majority of students 240 (93.8%) and lecturers 29 (96.7%) in this study. Conclusions: The positive perception of e-learning is an important consequence effect in the future, educational development of nursing, midwifery and paramedic schools. PMID:26925885

  12. The educational environment of the undergraduate medical curriculum at Kuwait University

    Directory of Open Access Journals (Sweden)

    Karim J


    Full Text Available Jumanah Karim,1 Becher Al-Halabi,2 Yousef Marwan,3 Hussain Sadeq,4 Ahmed Dawas,5 Dalia Al-Abdulrazzaq5 1Department of Pediatrics, Al-Amiri Hospital, Kuwait City, Kuwait; 2Department of Surgery, Mubarak Al-Kabeer Hospital, Kuwait City, Kuwait; 3Department of Orthopaedic Surgery, Al-Razi Orthopaedic Hospital, Kuwait City, Kuwait; 4Department of Pediatrics, Al-Adan Hospital, Kuwait City, Kuwait; 5Department of Pediatrics, Faculty of Medicine, Health Sciences Center, Kuwait University, Kuwait City, Kuwait Background: Educational environment of an institution affects the quality of learning. We aim to assess the educational environment of the undergraduate curriculum of Faculty of Medicine, Kuwait University (FOMKU. Methods: A cross-sectional study was carried out during April 2014. The validated Dundee Ready Education Environment Measure (DREEM questionnaire was e-mailed to 607 students. Mean scores of the main domains of the questionnaire, and for each item, were calculated, and their association with the students’ background information was measured using Student’s t-test (P-value of ≤0.05 was considered as the cut-off level of significance. Results: Of 607 students, 117 (19.3% completed the questionnaire. The total mean score for DREEM was 108.7/200 (54.3%. The mean score for students’ perception of teaching, perception of teachers, academic self-perception, perception of atmosphere, and social self-perception were 25.2/48 (52.5%, 24.6/44 (55.9%, 18.4/32 (57.5%, 26.2/48 (54.5%, and 14.3/28 (51.0%, respectively. The highest mean score for an item of DREEM questionnaire was for “my accommodation is pleasant” (3.48±0.75, while the lowest was for “there is a good support system for students who get stressed” (0.88±0.86. The total mean score was not significantly different between the two phases of the curriculum, or among males and females; however, few significant differences among the main domains and items were noted. Conclusion

  13. Study habits and skills, and academic achievement of students in Kerman University of medical sciences

    Directory of Open Access Journals (Sweden)

    Esmat Noohi


    Full Text Available Background and purpose: Study skills is one important factor influencing academic achievement of students . We must replace ineffective models and habits of study with more fruitful skills in order to gain better learning. This study investigates the study skills and habits of medical students and their educational achievement.Methods: Based on a pilot study the sample size was estimates as 400. Systematic cluster sampling based on medical school registry of students was used. The subjects were medical sciences students of different program. Data gathered with a researcher – made questioner of study skills containing five part including demographic question ; 14 items on planning and time management; 20 on active reading , 8 on concentration and 18 on note taking; and 20 on study habits.Results: The mean score was 163/1±28/2 (range 50-250 for study skill and 25/6±6/86 (range 20-60 for study habits. The mean scores of students for different components of study skills were 16.89±1.7 for planning and time management (Possible of 14-70, 59.1±14.1 for reading comprehension and speed (20-100, 19.8±6.6 for concentration (8-40, and 46.43±13.8 for note taking (18-90.The major defects in students’ study skills were planning and time management followed by concentration and note taking skills. Study skills had a significant correlation with educational achievement (r = 0.101, P < 0.05 while study habits correlation with educational achievement was not significant (r = 0.085, P > 0.05. Although males scored slightly better in study habits and all components of study skills but this superiority was only significant for reading comprehension and speed.Conclusion: Students need to learn study skills early in their university life. results showed weakness in study habits and study skill and deficit in planning and time management ,concentration and note taking skill. We suggest educational course or workshop about university skills for students

  14. Work-Related Quality of Life among Medical Residents at a University Hospital in Northeastern Thailand. (United States)

    Somsila, Nattamon; Chaiear, Naesinee; Boonjaraspinyo, Sirintip; Tiamkao, Somsak


    1) To assess work-related quality of life (WRQOL) among medical residents at a university hospital in northeast Thailand. 2) To determine the strength of the association between personal and working condition components and WRQOL among medical residents. A descriptive study was used to describe the WRQOL among medical residents. The study population comprised of all 375 residents affiliated with the university hospital. The Thai version of a self-administered work-related quality of life scale-2 was used for data collection. Testing the reliability revealed a Cronbach's alpha of 0.908. Questionnaires were completed by 259 of 375 (68.3%). The study found that the mean rating by residents for overall WRQOL was 113.8 out of 170 (SD 14.8). Most rated WRQOL as moderate (76.6%). The seven sub-factors were rated as moderate to high for employee engagement and control at work, moderate for home/work interface, general well-being and working conditions, high-moderate for job career satisfaction, and low-moderate for stress at work. Relationships between the personal and working condition components and WRQOL were analyzed using binary logistic regression. Residents in minor specialties had a higher WRQOL than those in major specialties (OR 2.522, 95% CI: 1.37, 4.63). Residents who had less than eight duty shifts/week had a higher WRQOL than those with more than eight duty shifts/week (OR 2.263, 95% CI: 1.16, 4.41). Similarly, residents working with less than 80 hours/week had a higher WRQOL than those working more than 80 hours/week (OR 2.344, 95% CI: 1.17, 4.72). A subgroup analyzes of those working in minor specialties showed the trend that working less than eight shifts/month and working less than 80 hours/week had the potential association with good quality of work-life (QWL). This phenomenon is presented in the subgroup analyses of those working in major specialties. Therefore, working hours and number of shifts might have played important role in contributing good QWL

  15. Attitude of clinical faculty members in Shiraz Medical University towards private practice physicians' participation in ambulatory care education

    Directory of Open Access Journals (Sweden)

    Khatereh Mahori


    Full Text Available Background: Improvement of medical education is necessary for meeting health care demands. Participation of private practice physicians in ambulatory care training is an effective method for enhancing medical students' skills. Purpose This study was undertaken to determine clinical professors' views about participation of physicians with private office in ambulatory care training. Methods: Participants composed of 162 Shiraz Medical University faculty members from 12 disciplines. A questionnaire requesting faculty members' views on different aspects of ambulat01y care teaching and interaction of community-based organizations was distributed. Results: Of 120 (74.1% respondents, 64 (54.2% believed that clinical settings of medical university are appropriate for ambulatory care training. Private practice physicians believed more than academic physicians without private office that private offices have wider range of patients, more common cases, and better follow up chance; and is also a better setting for learning ambulatory care compared with medical university clinical centers. Overall, 32 (29.1% respondent’s found the participation of physicians with private practice on medical education positive. Key words medical education, ambulatory medicine, private practice

  16. Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

    Directory of Open Access Journals (Sweden)

    Muhammad Arif Soomro


    Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

  17. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah


    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  18. [Lecturers in chemistry at the Medical Faculty of the University of Nagyszombat]. (United States)

    Szabadváry, F; Vámos, E


    After a short introduction on the development of the medieval universities at Pécs, Obuda, and Pozsony, and mentioning those who lectured in medicine in Hungary, the authors emphasise that modern chemistry was born during the 16th and 17th century. They stress the role of Paracelsus who invented iatro-chemistry, and that the first independent chairs, were founded in Germany in the beginning of 17th century at Altdorf, Marburg, Jéna, but were followed suit by Paris, when the Jardin des Plantes were erected. The first chemical textbook, the Cours de Chimie (Paris 1665), was also the work of a Frenchman, namely Nicolas Lémery (1645-1715). From the 18th century chemistry was also included in the curriculum of medical education in Hungary. Among the chairs of the newly founded medical faculty at Nagyszombat we find the chemical-botanical department in 1769. Its first professor was an Austrian physician Jakab Winterl (1773-1809), who had been a head physician at Selmecbánya, in Northern Hungary. Owing to a rash and premature publication Winterl's international reputation was unfortunately undermined in the last century by a leading German science historian, Hermann Kopp. The authors stress, however, that Winterl indeed played an important role in organizing the chemical department, and purchasing all the necessary equipment needed for up to date researches and analyses. And above all, in his Prolusiones ad chemiam saeculi decimi noni, he foresaw many forthcoming paths and discoveries of 19th century chemistry. After Winterl's retirement the department was divided into two parts. Pál Kitaibel (1757-1817) led the botanica department and János schuster (1777-1838) the other one for chemistry. Kitaibel made a name for himself by depicting Hungarian flora, but he also made discoveries in chemistry. He discovered chlore lime, before Tennant in 1795, a material which might have been used for whitening textiles. Schuster, on the other hand, introduced a system of Hungarian

  19. Perspective of midwives working at hospitals affiliated to the Isfahan University of Medical Sciences regarding medical errors

    Directory of Open Access Journals (Sweden)

    Mahboubeh Valiani


    Conclusions: Based on the results of this study on the perspectives of participants, among the three factors of medical errors (human factors, structural factors, and management factors, human factors are the biggest threat in committing medical errors. Modification in the pattern of teaching by the midwifery professors and their presence in the hospitals, creating a no-blame culture, and sharing of alerts in medical errors are among appropriate actions in the dimensions of human, structural, and managerial factors.

  20. Assessment of students’ perspectives about master of public health program in medical school of Shiraz University

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Integration of public health and medical education has been thought to have an important role in medical students’ training. Shiraz University of Medical Sciences has developed an MD/MPH dual degree educational program for the talented volunteer students. The aim of this study was to assess the students’ viewpoints about various aspects of Shiraz MD/MPH program. Methods: This cross-sectional study was conducted on Shiraz undergraduate medical students, who were enrolled in MD/MPH program. A self-structured questionnaire in Persian consisting of 4 parts was used; it included demographic factors including 16 questions which evaluated the students’ perspective of the goals, content, skill development, applicability and meeting their expectations; 7 questions evaluating the self-reported increase of knowledge; and 3 multiple choice questions to assess the students’ motivations and opinions on the impact of the program on their future career. Descriptive statistics was used for data analysis. Results: All MD/MPH students (89 with a mean age of 21.4±1.34 participated in this study. Forty one of the students (46.1% were male and 48 (53.9% female. Overall, 86.1% of them had positive views about the goals of the program; also, 83.5%, 81.2% and 81.9% of them reported a positive viewpoint about the contents, the applicability and development of specific skills, and meeting their expectations, respectively. The students’ most frequent motivation was “learning how to research systematically” (73%. The majority of the students reported this program to be moderately to highly effective in increasing their knowledge in the provided courses. Conclusion: The students had a positive view about almost all of the aspects of the MD/MPH program; this may be indicative of the program being successful in delivering the goals, increasing the students’ knowledge and skills, and meeting their expectations to date. Students’ enthusiasm for

  1. Conference '48-annual Science-Practical Conference of Medical University, dedicated to tenth anniversary of Independence of the Republic of Tajikistan'. Proceedings

    International Nuclear Information System (INIS)


    In this collection bring together scientific articles, which was presented on 48-annual Science-Practical Conference of Medical University, dedicated to tenth anniversary of Independence of the Republic of Tajikistan. Those articles dedicated to different directions of medicine and progress of Tajik State Medical University in medical science

  2. Research on Practice Carrier and Method Formed by Medical Humanistic Spirit for Medical Students: Tianjin Medical University as a Case in Point (United States)

    Hou, Jie; Geng, Xin; Su, Zhenxing; Wang, Yutao


    Medical humanistic quality is an indispensable quality that eligible doctors should possess, and medical humanism is strongly advocated and carried forward by contemporary medicine. These are commonly understood worldwide, and formed by reflection on medicine and medical education. Cultivation of medical humanism requires in-depth discussions of…

  3. The need for reviewing log books in Birjand University of Medical Sciences clinical wards: Letter to Editor

    Directory of Open Access Journals (Sweden)

    Zoya Tahergorabi


    Furthermore, due to the pervasive use of electronic log books in recent years in medical universities across the country that are in line with developments and innovations in medical education, it is recommended that the log books at this university too, should be presented and evaluated electronically. Electronic log books with ongoing record of activities and clinical techniques based on educational objectives, in addition to learning consolidation, determine unavailable measures to achieve clinical objectives and, thus, cause regular monitoring and evaluation on the part of students.

  4. Integration of Cognitive Skills as a Cross-Cutting Theme Into the Undergraduate Medical Curriculum at Tehran University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Akbar Soltani


    Full Text Available Nowadays, improvement of thinking skills of students is one of the universally supported aims in the majority of medical schools. This study aims to design longitudinal theme of reasoning, problem-solving and decision-making into the undergraduate medical curriculum at Tehran University of Medical Sciences (TUMS. A participatory approach was applied to design the curriculum during 2009-2011. The project was conducted by the contribution of representatives of both basic and clinical faculty members, students and graduates at Tehran University of Medical Sciences. The first step toward integrating cognitive skills into the curriculum was to assemble a taskforce of different faculty and students, including a wide variety of fields with multidisciplinary expertise using nonprobability sampling and the snowball method. Several meetings with the contribution of experts and some medical students were held to generate the draft of expected outcomes. Subsequently, the taskforce also determined what content would fit best into each phase of the program and what teaching and assessment methods would be more appropriate for each outcome. After a pilot curriculum with a small group of second-year medical students, we implemented this program for all first-year students since 2011 at TUMS. Based on findings, the teaching of four areas, including scientific and critical thinking skills (Basic sciences, problem-solving and reasoning (Pathophysiology, evidence-based medicine (Clerkship, and clinical decision-making (Internship were considered in the form of a longitudinal theme. The results of this study could be utilized as a useful pattern for integration of psycho-social subjects into the medical curriculum.

  5. Feasibility of Exploiting Celution^ System in Autologous Cell Therapy in Dokkyo Medical University Hospital:Safety and Reproducibility


    Ken-ichi, Inoue; Hiroshi, Nomura; Ryoichi, Sohma; Kazumi, Akimoto; Naohiko, Kobayashi; Takao, Kamai; Tomonori, Yamanishi; Isao, Taguchi; Hiroki, Asato; Teruo, Inoue; Tomoyuki, Mitsumori; Hideki, Iwaguro; Ken-ichiro, Yoshida; Research Support Center, Dokkyo Medical University School Of Medicine:Center For Regenerative Medicine, Dokkyo Medical University School Of Medicine; Center For Regenerative Medicine, Dokkyo Medical University School Of Medicine:Department Of Plastic And Reconstructive Surgery, Dokkyo Medical University School Of Medicine


    In 2012, we established the Center for Regenerative Medicine in Dokkyo Medical University Hospital, and are now preparing the necessary equipment and preclinical evidence for cell therapy. Liposuction is a commonly used procedure in plastic surgery and the lipoaspirate is discarded as a medical waste. However, the lipoaspirate is known to contain abundant mesenchymal stem cells, and thus, it is currently one of the most feasible options of regenerative medicine. Several ongoing clinical trial...

  6. The pattern of time management in college students of Kerman University of Medical Sciences in the year 2006


    Ali Ravari; Fatemeh Alhani; Monireh Anoosheh; Tayebeh Mirzaie-Khalilabadi


    Background: One potential coping strategy frequently offered by university counseling services is time management for studying. Besides stress relief, time management skills will positively influence key outcomes such as academic performance, problem-solving ability, and health. Thus, it is necessary to investigate how college students manage their timing for studying. The aim of the present study was to assess the pattern of college students' time management in Kerman University of Medical S...

  7. Mental health status of newly Admitted students of Mazandaran university of medical sciences in 1999-2000 Academic year.


    S.H.Hosseini; S.E.Mousavi


    SummaryBackground and purpose: Major changes occur in an individuals life after his acceptance in the university which cloud be considered as every important period of his life. This new condition is stressful and can affect the newly admitted student’s mental health. In this article we analyze the mental health status of newly admitted students to Mazandaran university of medical sciences in the academic year 1999-2000.Materials and Methods: In this descriptive study all the newl...

  8. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K


    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  9. Evaluation of the quality of the college library websites in Iranian medical Universities based on the Stover model. (United States)

    Nasajpour, Mohammad Reza; Ashrafi-Rizi, Hasan; Soleymani, Mohammad Reza; Shahrzadi, Leila; Hassanzadeh, Akbar


    Today, the websites of college and university libraries play an important role in providing the necessary services for clients. These websites not only allow the users to access different collections of library resources, but also provide them with the necessary guidance in order to use the information. The goal of this study is the quality evaluation of the college library websites in Iranian Medical Universities based on the Stover model. This study uses an analytical survey method and is an applied study. The data gathering tool is the standard checklist provided by Stover, which was modified by the researchers for this study. The statistical population is the college library websites of the Iranian Medical Universities (146 websites) and census method was used for investigation. The data gathering method was a direct access to each website and filling of the checklist was based on the researchers' observations. Descriptive and analytical statistics (Analysis of Variance (ANOVA)) were used for data analysis with the help of the SPSS software. The findings showed that in the dimension of the quality of contents, the highest average belonged to type one universities (46.2%) and the lowest average belonged to type three universities (24.8%). In the search and research capabilities, the highest average belonged to type one universities (48.2%) and the lowest average belonged to type three universities. In the dimension of facilities provided for the users, type one universities again had the highest average (37.2%), while type three universities had the lowest average (15%). In general the library websites of type one universities had the highest quality (44.2%), while type three universities had the lowest quality (21.1%). Also the library websites of the College of Rehabilitation and the College of Paramedics, of the Shiraz University of Medical Science, had the highest quality scores. The results showed that there was a meaningful difference between the quality

  10. Quality management of medical education at the Carl Gustav Carus Faculty of Medicine, University of Technology Dresden, Germany. (United States)

    Dieter, Peter Erich


    The Carl Gustav Carus Faculty of Medicine, University of Technology Dresden, Germany, was founded in 1993 after the reunification of Germany. In 1999, a reform process of medical education was started together with Harvard Medical International. The traditional teacher and discipline-centred curriculum was replaced by a student-centred, interdisciplinary and integrative curriculum which has been named DIPOL (Dresden Integrative Patient/Problem- Oriented Learning). The reform process was accompanied and supported by a parallel-ongoing Faculty Development Program. In 2004, a Quality Management Program in medical education was implemented, and in 2005 medical education received DIN EN ISO 9001:2000 certification. Quality Management Program and DIN EN ISO 9001:2000 certification were/are unique for the 34 medical schools in Germany. The students played a very important strategic role in all processes. They were/are members in all committees like the Faculty Board, the Board of Study Affairs (with equal representation) and the ongoing audits in the Quality Management Program. Students are the only ones who experience all years of the curriculum and are capable of detecting, for example gaps, overlaps, inconsistencies of the curriculum and assessments. Therefore, the in-depth knowledge of students about the medical school's curriculum is a very helpful and essential tool in curriculum reform processes and Quality Management Programs of medical education. The reform in medical education, the establishment of the Quality Management program and the certification resulted in an improvement of quality and output of medical education and medical research.

  11. Medication errors: classification of seriousness, type, and of medications involved in the reports from a university teaching hospital

    Directory of Open Access Journals (Sweden)

    Gabriella Rejane dos Santos Dalmolin


    Full Text Available Medication errors can be frequent in hospitals; these errors are multidisciplinary and occur at various stages of the drug therapy. The present study evaluated the seriousness, the type and the drugs involved in medication errors reported at the Hospital de Clínicas de Porto Alegre. We analyzed written error reports for 2010-2011. The sample consisted of 165 reports. The errors identified were classified according to seriousness, type and pharmacological class. 114 reports were categorized as actual errors (medication errors and 51 reports were categorized as potential errors. There were more medication error reports in 2011 compared to 2010, but there was no significant change in the seriousness of the reports. The most common type of error was prescribing error (48.25%. Errors that occurred during the process of drug therapy sometimes generated additional medication errors. In 114 reports of medication errors identified, 122 drugs were cited. The reflection on medication errors, the possibility of harm resulting from these errors, and the methods for error identification and evaluation should include a broad perspective of the aspects involved in the occurrence of errors. Patient safety depends on the process of communication involving errors, on the proper recording of information, and on the monitoring itself.

  12. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men


    Saghir, Sheeba; Hyland, Lynda


    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  13. Education services quality of Kashan Medical Science University, based on SERVQUAL model in viewpoints of students

    Directory of Open Access Journals (Sweden)

    Ebrahim Kouchaki


    Full Text Available Introduction: Sustainable development of higher educational systems, as a dynamic system, requires a coherent moderate growth both in qualitative and quantitative dimensions. Since students are the major clients of higher education systems and their perspectives can play a key role in the quality promotion of the services; this study has been conducted based on SERVQUAL model aiming at the assessment of educational services quality in Kashan Medical Science University in 2016. Study Methodology: A total of 212 students of Kashan Medical Science University were selected with a population of 616 subjects through random sampling, using Morgan tables for this descriptive-analytical research. Data collection tools were the standard SERVQUAL questionnaire composing of three sections of basic information and 28 items, according to Likert six-option scale for the measurement of services quality current and desired expected conditions. The difference between the average of current and desirable statuses was measured as the services gap. Descriptive deductive statistics were used to analyze the obtained data. Results: The students aged averagely 23 ± 1.8, 65% (138 subjects were female, and 35% (74 subjects were male. About 72% (153 subjects were single, and 28% (59 subjects were married. The obtained results revealed that there was a negative gap in all dimensions of quality. The results also showed that the minimum gap obtained for learning assist tools (physical and tangibility dimensions with an amount of −0.38 and the maximum gap for guide instructor availability once needed by the students (accountability dimension with an amount of −2.42. Total mean of perceptions and expectations measurement for the students obtained 2.28 and 3.85, respectively. Conclusion: Respecting the negative gap obtained for all dimensions of educational services quality and insufficiencies to meet the students' expectations, it is recommended to assign further resources

  14. Psychosocial problems of pre-clinical students in the University of Ibadan Medical School. (United States)

    Omokhodion, F O


    Recent changes in the psychosocial environment of the university campus such as the steep rise in student numbers, the high cost