WorldWideScience

Sample records for pakistani domestic fuels

  1. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.

    1992-10-01

    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  2. On the domestic fuel channel for BWR

    International Nuclear Information System (INIS)

    Fukada, Hiroshi

    1979-01-01

    Kobe Steel Ltd. started the domestic manufacture of fuel channel boxes for BWRs in 1967, and entered the actual production stage four years after that. Since 1976, the mass production system was adopted with the increase of the demand. The requirements about the surface contamination and the dimensional accuracy over whole length are very strict in the fuel channel boxes, moreover, special consideration must be given so as to prevent the deformation in use. The unique working methods such as electron beam welding, high temperature press forming and so on are employed in Kobe Steel Ltd. to satisfy such strict requirements, therefore the quality of the produced fuel channel boxes is superior to imported ones. At present, the fuel channel boxes domestically made by Kobe Steel Ltd. are used for almost all BWRs in Japan. The functions of fuel channel boxes are to flow boiling coolant uniformly upward, to guide control rods, and to increase the rigidity of fuel assembly. The fuel channel boxes are the square tubes of zircaloy 4 of 134.06 mm inside width, 2.03 mm thickness, and 4118 or 4239 mm length. The progress of the development and the features of the fuel channel boxes and the manufacturing processes are described. Zircaloy plates are formed into channels, and two channels are electron beam-welded after the edge preparation, to make a box. Ultrasonic examination and stress relief treatment are applied, and clips and spacers are welded. (Kako, I.)

  3. Domestic fuel question and the charcoal solution

    Energy Technology Data Exchange (ETDEWEB)

    Krishna Rao, E G

    1981-06-01

    Domestic fuel for cooking forms one of the basic needs of human society. In India, the pressure of this need has exceeded the regeneration potential of the growing forests which supply a large proportion of this basic need. The pressure can be greatly relieved by converting wood to charcoal before it reaches the consumer. The present paper examines this aspect and reviews the modern methods of charcoal production on fuelwood resources. Besides being a choice domestic fuel, charcoal is a valuable raw material in various industries. Charcoal making industry can be established as a rural based industry (as part of community forestry projects) and would generate much needed cash income at grassroot level. The strategy would be important in dealing with the problem of chronic poverty at this level. (Refs. 5).

  4. Association of various reproductive rights, domestic violence and marital rape with depression among Pakistani women

    Directory of Open Access Journals (Sweden)

    Israr Syed M

    2009-12-01

    Full Text Available Abstract Background Depression among women is common in developing countries. Gender inequality can contribute to women's risk for depression. Lack of reproductive and sexual rights is an important marker of gender inequality and women do not have the freedom to express their reproductive and sexual needs in many parts of the world. Therefore we designed this study to determine the association of depression with lack of various reproductive rights and domestic violence among married women in Karachi, Pakistan. Methods A case-control study with 152 cases and 152 controls, which included women 15-48 years, recruited from two teaching hospitals from 1st June 2007 through 31st August 2007. The SRQ was administered to all subjects. A cut off score of 8 was used to confirm cases of depression diagnosed by physicians, and to exclude cases of depression from the controls. Self-administered questionnaire was used to assess the risk factors. Results 61% of the cases and 43% of the controls were ever abused by spouse and the frequency of marital rape was 33% in cases and 13% in controls. After adjusting for the effects of other variables in the model, less than 18 years of age at marriage (OR 2.00; 95% CI = 1.07, 3.7, decision for marriage by parents (OR 3.51; 95% CI = 1.67, 7.37, abuse by in laws (OR 4.91; 95% CI = 2.66, 9.06, ≤ 3 hours per day spent with husband (OR 2.33; 95% CI = 1.34, 4.08, frequency of intercourse ≤ 2 times per week (OR 1.85; 95% CI = 1.06, 3.22 and marital rape (OR 3.03; 95% CI = 1.50, 6.11 were associated with depression among women. Conclusion In our study depression in married women was associated with younger age at marriage, lack of autonomy in marriage decisions, marital rape and domestic abuse by in-laws. Efforts should be directed towards creating awareness about the reproductive and sexual rights of women in Pakistan. Physicians should be trained to screen and identify women who may be at risk for psychological distress

  5. Association of various reproductive rights, domestic violence and marital rape with depression among Pakistani women.

    Science.gov (United States)

    Ali, Faridah A; Israr, Syed M; Ali, Badar S; Janjua, Naveed Z

    2009-12-01

    Depression among women is common in developing countries. Gender inequality can contribute to women's risk for depression. Lack of reproductive and sexual rights is an important marker of gender inequality and women do not have the freedom to express their reproductive and sexual needs in many parts of the world. Therefore we designed this study to determine the association of depression with lack of various reproductive rights and domestic violence among married women in Karachi, Pakistan. A case-control study with 152 cases and 152 controls, which included women 15-48 years, recruited from two teaching hospitals from 1st June 2007 through 31st August 2007. The SRQ was administered to all subjects. A cut off score of 8 was used to confirm cases of depression diagnosed by physicians, and to exclude cases of depression from the controls. Self-administered questionnaire was used to assess the risk factors. 61% of the cases and 43% of the controls were ever abused by spouse and the frequency of marital rape was 33% in cases and 13% in controls. After adjusting for the effects of other variables in the model, less than 18 years of age at marriage (OR 2.00; 95% CI = 1.07, 3.7), decision for marriage by parents (OR 3.51; 95% CI = 1.67, 7.37), abuse by in laws (OR 4.91; 95% CI = 2.66, 9.06), rape (OR 3.03; 95% CI = 1.50, 6.11) were associated with depression among women. In our study depression in married women was associated with younger age at marriage, lack of autonomy in marriage decisions, marital rape and domestic abuse by in-laws. Efforts should be directed towards creating awareness about the reproductive and sexual rights of women in Pakistan. Physicians should be trained to screen and identify women who may be at risk for psychological distress as a result of denial of reproductive rights so that they can support positive mental health outcomes through individual, family or marital counseling.

  6. Reintegration of Pakistani return migrants from the Middle East in the domestic labour market.

    Science.gov (United States)

    Arif, G M

    1998-01-01

    This study compared the unemployment rates among return migrants and nonmigrants and examined the reintegration pattern of returnees in the domestic labor market. The study utilized three data sets: the 1980 World Bank Survey of Return Migrant Households; the 1986 ILO/ARTEP Survey of Return Migrant Households; the 1991 Pakistan Integrated Household Survey. Findings showed that unemployment rates were much higher among return migrants than nonmigrants. Although this difference narrowed with the passage of time, even among those who returned to Pakistan at least 18 months prior to the surveys, more than 10% of workers were unemployed. The multivariate analysis further showed that returnees, irrespective of the period elapsed since their return, were more likely to be unemployed than nonmigrants. With respect to the reintegration pattern of return migrants, the study revealed that variables indicating their human capital, such as occupation and pre-migration and during-migration work experience, appear to have a greater influence on their post-return adjustment than the variables related to economic positions such as savings. The results also showed that the types of jobs unemployed returnees were looking for differed substantially from those held by employed return migrants. A possibility was that unemployed returnees could not save enough from their overseas earnings to become self-employed. Thus, provision of credit for self-employment seems to be the right way to accommodate these workers.

  7. Fuel for domestic and metallurgical uses

    Energy Technology Data Exchange (ETDEWEB)

    Basu, D.; Chakrabarti, R.K.

    1981-02-01

    To meet the energy requirements in the domestic and metallurgical sectors CMPDI have taken in hand some developmental projects using coal as a feedback. 4 projects are described - mechanized conversion of coal to domestic coke, formed coke making by Didier-Keihan-Sumitomo process, domestic briquette making based on non-copking coal resources, and smokeless coal blocks utilising inferior grade raw coal and washery by-products.

  8. United States Domestic Research Reactor Infrastructure TRIGA Reactor Fuel Support

    International Nuclear Information System (INIS)

    Morrell, Douglas

    2011-01-01

    The United State Domestic Research Reactor Infrastructure Program at the Idaho National Laboratory manages and provides project management, technical, quality engineering, quality inspection and nuclear material support for the United States Department of Energy sponsored University Reactor Fuels Program. This program provides fresh, unirradiated nuclear fuel to Domestic University Research Reactor Facilities and is responsible for the return of the DOE-owned, irradiated nuclear fuel over the life of the program. This presentation will introduce the program management team, the universities supported by the program, the status of the program and focus on the return process of irradiated nuclear fuel for long term storage at DOE managed receipt facilities. It will include lessons learned from research reactor facilities that have successfully shipped spent fuel elements to DOE receipt facilities.

  9. Historical overview of domestic spent fuel shipments

    International Nuclear Information System (INIS)

    Pope, R.B.; Wankerl, M.W.; Armstrong, S.; Hamberger, C.; Schmid, S.

    1991-01-01

    The purpose of this paper is to provide available historical data on most commercial and research reactor spent fuel shipments that have been completed in the United States between 1964 and 1989. This information includes data on the sources of spent fuel that has been shipped, the types of shipping casks used, the number of fuel assemblies that have been shipped, and the number of shipments that have been made. The data are updated periodically to keep abreast of changes. Information on shipments is provided for planning purposes; to support program decisions of the US Department of Energy's (DOE's) Office of Civilian Radioactive Waste Management (OCRWM); and to inform interested members of the public, federal, state, and local government, Indian tribes, and the transportation community. 5 refs., 7 figs., 2 tabs

  10. 14 CFR 121.639 - Fuel supply: All domestic operations.

    Science.gov (United States)

    2010-01-01

    ... nontransport category airplanes type certificated after December 31, 1964, to fly for 30 minutes at normal... § 121.639 Fuel supply: All domestic operations. No person may dispatch or take off an airplane unless it has enough fuel— (a) To fly to the airport to which it is dispatched; (b) Thereafter, to fly to and...

  11. The european domestic fuel oil champions its assets

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    The meeting of Eurofuel Group european club members has taken place in Paris on June 8-9, 1995. The aim of this meeting was to exchange opinions and concert action to encourage the use of domestic fuel oil heating in housing. A comparative sectoral analysis of heating energies in different european countries is given. (J.S). 1 tab., 1 photo

  12. Economic Efficiency of Establishing Domestic Production of Synthetic Liquid Fuel

    Directory of Open Access Journals (Sweden)

    Kyzym Mykola O.

    2017-06-01

    Full Text Available The article notes a stable tendency to increasing the oil dependence of Ukraine, which creates a threat to the national economic security, and proves an expediency of establishing domestic production of synthetic liquid fuel. The technical, organizational and economic features of establishing synthetic liquid fuel production in Ukraine are presented. There proved a hypothesis on the expediency of organizing the production of synthetic liquid fuels based on steam-plasma coal gasification technology. The forecast resource cycle of the country until 2020 under conditions of developing this technology is modeled.

  13. Experimental investigations on a diesel engine operated with fuel blends derived from a mixture of Pakistani waste tyre oil and waste soybean oil biodiesel.

    Science.gov (United States)

    Qasim, Muhammad; Ansari, Tariq Mahmood; Hussain, Mazhar

    2017-10-18

    The waste tyre and waste cooking oils have a great potential to be used as alternative fuels for diesel engines. The aim of this study was to convert light fractions of pyrolysis oil derived from Pakistani waste vehicle tyres and waste soybean oil methyl esters into valuable fuel and to reduce waste disposal-associated environmental problems. In this study, the waste tyre pyrolysis liquid (light fraction) was collected from commercial tyre pyrolysis plant and biodiesel was prepared from waste soybean oil. The fuel blends (FMWO10, FMWO20, FMWO30, FMWO40 and FMWO50) were prepared from a 30:70 mixture of waste tyre pyrolysis liquid and waste soybean oil methyl esters with different proportions of mineral diesel. The mixture was named as the fuel mixture of waste oils (FMWO). FT-IR analysis of the fuel mixture was carried out using ALPHA FT-IR spectrometer. Experimental investigations on a diesel engine were carried out with various FMWO blends. It was observed that the engine fuel consumption was marginally increased and brake thermal efficiency was marginally decreased with FMWO fuel blends. FMWO10 has shown lowest NOx emissions among all the fuel blends tested. In addition, HC, CO and smoke emissions were noticeably decreased by 3.1-15.6%, 16.5-33.2%, and 1.8-4.5%, respectively, in comparison to diesel fuel, thereby qualifying the blends to be used as alternative fuel for diesel engines.

  14. United States Domestic Research Reactor Infrastructure - TRIGA Reactor Fuel Support

    International Nuclear Information System (INIS)

    Morrell, Douglas

    2008-01-01

    The purpose of the United State Domestic Research Reactor Infrastructure Program is to provide fresh nuclear reactor fuel to United States universities at no, or low, cost to the university. The title of the fuel remains with the United States government and when universities are finished with the fuel, the fuel is returned to the United States government. The program is funded by the United States Department of Energy - Nuclear Energy division, managed by Department of Energy - Idaho Field Office, and contracted to the Idaho National Laboratory's Management and Operations Contractor - Battelle Energy Alliance. Program has been at Idaho since 1977 and INL subcontracts with 26 United States domestic reactor facilities (13 TRIGA facilities, 9 plate fuel facilities, 2 AGN facilities, 1 Pulstar fuel facility, 1 Critical facility). University has not shipped fuel since 1968 and as such, we have no present procedures for shipping spent fuel. In addition: floor loading rate is unknown, many interferences must be removed to allow direct access to the reactor tank, floor space in the reactor cell is very limited, pavement ends inside our fence; some of the surface is not finished. The whole approach is narrow, curving and downhill. A truck large enough to transport the cask cannot pull into the lot and then back out (nearly impossible / refused by drivers); a large capacity (100 ton), long boom crane would have to be used due to loading dock obstructions. Access to the entrance door is on a sidewalk. The campus uses it as a road for construction equipment, deliveries and security response. Large trees are on both sides of sidewalk. Spent fuel shipments have never been done, no procedures approved or in place, no approved casks, no accident or safety analysis for spent fuel loading. Any cask assembly used in this facility will have to be removed from one crane, moved on the floor and then attached to another crane to get from the staging area to the reactor room. Reactor

  15. Domestic fuel energy consumption in an Indian urban ecosystem

    International Nuclear Information System (INIS)

    Misra, M.K.; Rao, B.G.; Nisanka, S.K.; Sahu, N.C.

    1995-01-01

    Berhampur is one of the oldest and biggest towns of Orissa State where 93% of people earn their living from non-primary economic activities. The fuel consumption structure reveals an element of rural bias since the domestic sector derives 49% of its energy used for cooking and heating from biomass sources. Firewood is the only fuel used by all income groups and almost all occupations. Other traditional fuels such as dungcake, agricultural waste and leaf litter are used in the town with different degrees of dominance in various occupation groups and income classes. The inequality of income distribution is reflected in the fuel consumption structure of the rich and poor with greater dependence on non-biomass in the high income group and biomass in the low income group. Family size is an important determinant of biomass fuel use. For the urban poor, there is a relationship between income and fuel consumption. There exists scope for enlarging the biomass base by utilising the available bio-wastes and developing a green belt around the town. This requires some rural features in the urban area using new technologies. (author)

  16. Domestic nuclear fuels supply: possibility of an independent technology

    International Nuclear Information System (INIS)

    Cirimello, R.O.

    1982-01-01

    After considering the different energy sources, their consumption and their respective periods of exploitation, technological considerations in the nuclear fuel field are made. The main subject is the Domestic Supply Project of Embalse Fuel (CANDU type). The different aspects which had to be developed during the realization of this project still under progress, and which are fundamental for the command of the technology, are described: 1) Qualification of the produced fuel elements: fuel elements' characteristics; the reactors' operating parameters, and the prototype fuel elements' characteristics; 2) Development of materials and/or suppliers: the obtainment of UO 2 and its physical properties are considered, as well as those of Zircaloy-4, the development of suppliers and the respective developments for the obtainment of materials such as beryllium, helium and colloidal graphite; 3) Processes development; the following processes are studied and defined: UO 2 pellets fabrication with UO 2 granulated powder; beryllium coating under vaccum; and induction brazing of bearing pads and spacers, end cap and end plate resistance welding and stamping of Zircaloy components, graphite-coating of cladding's internal face; 4) Development of special production equipments; automatic equipment for end cap-to-cladding resistance welding among others. The need for a specific program of quality assurance for nuclear fuels supply is emphasized and the basic criteria are established. The IAEA's quality asssurance requirements are also analyzed. (M.E.L.) [es

  17. Fluegas condensation of domestic fuels. Kotimaisten polttoaineiden savukaasulauhdutus

    Energy Technology Data Exchange (ETDEWEB)

    Kankkunen, A; Fagerholm, N E

    1988-01-01

    The suitability of domestic fuel for condensation heat recovery was studied. With the developed computer program, enthalpies of flue gas as function of temperature were computed and also the theoretical advandages aquired by condensation were compared with different fuels. The maximal advantages of condensation were 39 % with wooden chips and 31 % with peat. The domestic fuels were found to be useful for condensation heat recovery because of the high water content and the high dewpoint of flu egas. Condensation was found to have a purifying effect on flue gases. It was found experimentaly that 30 % the sulfur of the peat dissolved to the condensed liquid. The composition of condensed liquid of peat- and wooden chip flue gases was studied to find out the corrosion and enviromental effects. The risk of corrosion to metallic heat exhanger was concluded from the compositio of peat condensat. Chip condensate was found to be almost neutral. Normally the condensate liquids were fit for sewering without aftertreatment. Heat transfer coefficient from flue gases to the wall of the condenser was measured to be 150-170 W/Km{sup 2}. Heat transfer coefficients were three times higher compared to condensing heat transfer.

  18. Fuel for Life: Domestic Cooking Fuels and Women’s Health in Rural China

    Science.gov (United States)

    Nie, Peng; Sousa-Poza, Alfonso; Xue, Jianhong

    2016-01-01

    Background: There is evidence that household air pollution is associated with poor health in China, and that this form of air pollution may even be more of a health concern in China than the much-publicized outdoor air pollution. However, there is little empirical evidence on the relationship between household air pollution and health in China based on nationally representative and longitudinal data. This study examines the association between the type of domestic cooking fuel and the health of women aged ≥16 in rural China. Methods: Using longitudinal and biomarker data from the China Family Panel Studies (n = 12,901) and the China Health and Nutrition Survey (n = 15,539), we investigate the impact of three major domestic cooking fuels (wood/straw, coal, liquefied petroleum gas (LPG)) on health status using both cross-sectional and panel approaches. Results: Compared to women whose households cook with dirty fuels like wood/straw, women whose households cook with cleaner fuels like LPG have a significantly lower probability of chronic or acute diseases and are more likely to report better health. Cooking with domestic coal instead of wood or straw is also associated with elevated levels of having certain risks (such as systolic blood pressure) related to cardiovascular diseases. Conclusions: Our study provides evidence that using cleaner fuels like LPG is associated with better health among women in rural China, suggesting that the shift from dirty fuels to cleaner choices may be associated with improved health outcomes. PMID:27517950

  19. DoD use of Domestically-Produced Alternative Fuels and Alternative Fuel Vehicles

    Science.gov (United States)

    2014-04-10

    85 $21,927 Electric $171 Hydrogen $3 Liquefied Natural Gas (LNG) $4 Liquefied Petroleum Gas ( LPG ) $14 Total $25,053 Data source: GSA’s FAST Data...919 407 5,802 GAS PH 13 77 94 10 10 204 HYD DE 5 5 LNG BI 1 1 LPG BI 47 47 LPG DE 1 1 Conventional DSL DE 867 16,174 16,028 5,698 2,508 41,275...includes information on the status of: (1) use and potential use of domestically-produced alternative fuels including but not limited to, natural gas

  20. Domestic fuel price and economic sectors in Malaysia: a future of renewable energy?

    OpenAIRE

    Jee, Hui-Siang Brenda; Lau, Evan; Puah, Chin-Hong; Abu Mansor, Shazali

    2010-01-01

    This study empirically examines the relation between the domestic fuel prices with the ten disaggregated economic sectors in Malaysia with the spanning of data from 1990:Q1 to 2007:Q4. We found that only three sectors (agriculture, trade and other services sectors) are cointegrated with the fuel price and fuel price does Granger cause these sectors. Despite the evidence of non-cointegrated in most of the economic sectors, fuel price able to influence these sectors over a longer period. Policy...

  1. RANKING OF LOCAL AND DOMESTIC FUEL-ENERGY RECOURSES IN GROSS CONSUMPTION OF BELARUSSIAN FUEL-ENERGY RECOURSES

    Directory of Open Access Journals (Sweden)

    Y. N. Rumiantsava

    2008-01-01

    Full Text Available Local and domestic fuel-energy recourses of theRepublicofBelarusin gross consumption of fuel-energy  recourses  has  been ranked on the  basis of the  analysis of scientific  literature,  statistical information and also fundamental documentation in the sphere of energy policy and power saving. The paper proposes to give a special emphasis on usage of products after processing domestically manufactured fuel-energy recourses that have been obtained from local and imported raw-materials with the purpose to estimate a power security level of the Republic from a new point of view.

  2. Preferences for domestic fuel. Analysis with socio-economic factors and rankings in Kolkata, India

    International Nuclear Information System (INIS)

    Gupta, Gautam; Koehlin, Gunnar

    2006-01-01

    The choice of domestic fuel is a matter of great concern for households and policy makers in India. This paper investigates the demand for domestic fuels when households face four choices: Fuelwood, Coal, Kerosene and LPG. The study is based on a survey of 500 households in Kolkata, India. The demand estimates are conducted using a two-stage process where the first stage investigates choice and the second the quantity used. Determinants of fuel demand are identified and their relative importance shown. Extending the study, the paper also analyses the choice of the main cooking fuel in terms of the households' stated rankings of six fuels for five attributes. The policy discussion indicates that subsidies have less potential to reduce polluting fuels such as coal and fuelwood due to weak cross-price elasticities, while increased availability of LPG and potentially also increased awareness of indoor air pollution have greater prospect. (author)

  3. Historical overview of domestic spent fuel shipments: Update

    International Nuclear Information System (INIS)

    1991-07-01

    This report presents available historic data on most commercial and research reactor spent fuel shipments in the United States from 1964 through 1989. Data include sources of the spent fuel shipped, types of shipping casks used, number of fuel assemblies shipped, and number of shipments made. This report also addresses the shipment of spent research reactor fuel. These shipments have not been documented as well as commercial power reactor spent fuel shipment activity. Available data indicate that the greatest number of research reactor fuel shipments occurred in 1986. The largest campaigns in 1986 were from the Brookhaven National Laboratory, Brooklyn, New York, to the Idaho Chemical Processing Plant (ICPP) and from the Oak Ridge National Laboratory's High Flux Isotope Reactor (HFIR) in Tennessee and the Rockwell International Reactor in California to the Savannah River Plant near Aiken, South Carolina. For all years addressed in this report, DOE facilities in Idaho Falls and Savannah River were the major recipients of research reactor spent fuel. In 1989, 10 shipments were received at the Idaho facilities. These originated from universities in California, Michigan, and Missouri. 9 refs., 12 figs., 7 tabs

  4. Domestic fuel consumption in Estonia (The first half of 1993)

    International Nuclear Information System (INIS)

    Veski, Rein

    1993-01-01

    According to the data of the Estonian Statistics Department the consumption of fuels in Estonia over the period of January-June 1993 was a follows: coal 77,053 t, oil shale 7,981,840 t, fuel peat 127,376 t, peat briquette 42,041 t, firewood 154,511 solid metres, wood chip 55,648 solid metres. The consumption of fuel peat (chiefly for producing briquette) was more considerable in the town of Kohtla-Jaerve and in the districts of Paernu and Tartu where Estonia's major peat-briquette plants are located. The share of peat in the other industries has been less significant. (author)

  5. [Progress and prospect of bio-jet fuels industry in domestic and overseas].

    Science.gov (United States)

    Qiao, Kai; Fu, Jie; Zhou, Feng; Ma, Huixia

    2016-10-25

    We reviewed the progress of the bio-jet fuels industry in recent years and systematically analyzed the technical routes that have been approved or in the pipeline for approval by ASTM D7566. In addition, we highlighted a novel pathway to produce drop-in fuel by near-critical hydrolysis of waste cooking oils or algal oils followed by catalytic decarboxylation. Also, we introduced the source of oils and fats feedstock and the domestic bio-jet fuel industry status during the 12th Five-Year-Plan period. Based on our own research, we discussed the prospect of the bio-jet fuel industry and future research needs.

  6. Domestic fuel oil spill prevention committee : report to Ministers of Government Services and Lands and Environment

    International Nuclear Information System (INIS)

    2001-07-01

    The number of reported spills from domestic fuel oil systems increased dramatically in Newfoundland, which prompted the Minister of Government Services and Lands to arrange a meeting with representatives from consumers, the fuel service industry and the insurance industry to ensure proper measures were taken for the prevention of domestic fuel spills. A joint committee consisting of industry and government representatives was formed as a result of this meeting, to examine and investigate the situation and report to the Minister of Government Services and Lands. Advice on means to address the problems associated with domestic fuel oil spills was provided, as well as mechanisms to minimize such occurrences in the future. Also included in the review were small commercial storage tanks units of no more than 2500 litres, as small commercial establishments often have heating systems similar in size to residential units. Gradual leaks that go undetected for years often occur, as do the catastrophic rupture of the fuel storage tank itself. Rusting and exterior tubing are some of the causes of spills. The contamination of surrounding soil and/or groundwater can occur as a result of the spills, and fumes can enter residences through foundation walls of the sewer system. Condensation within the tank can lead to corrosion of the fuel tanks. A number of recommendations were made in the report, such as the establishment of regulations pertaining to the construction, installation, servicing and fueling of domestic and small commercial fuel systems, the proper enforcement of the regulations, a public education campaign, an emergency response capability, tax incentives to consumers for expenditures associated with the upgrading or replacement of inadequate systems, support funding, the establishment of an emergency respond fund, and environmental cleanup requirements. figs

  7. The Middle East. Domestic sufficiency of fossil fuel resources

    Energy Technology Data Exchange (ETDEWEB)

    Swegle, John A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Kessinger, Samuel E. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2016-08-01

    In this paper, we’ve compared energy production and consumption across the broader Middle East, paying special attention to three different countries; Saudi Arabia, one of the world’s largest oil producers (second in the CIA World Factbook ranking of crude oil producing countries), with a growing population in the mid-range (47th in the world, according to the CIA World Factbook, and fifth among the nations in this region), a large GDP and GDP per capita (15th in the world, second in this region in GDP, and 21st in GDP per capita in the world, just behind the US at 19th); Qatar, the world’s fourth largest producer of natural gas, with a small native population (and a relatively large foreign labor contingent) that is very wealthy (with the world’s highest GDP per capita, more than twice that of the US); and Egypt, the most populous nation in the region (with the world’s 16th largest population), but relatively poor (with a GDP per capita of about a fifth that of the US and a twelfth that of Qatar); Egypt is a significant energy producer – 29th in the world in crude oil production and 17th in natural gas production – but production has stalled or declined in recent years, and domestic consumption has overtaken production.

  8. Importance of hydrogen fuels as sustainable alternative energy for domestic and industrial applications

    International Nuclear Information System (INIS)

    Sharifan, H.R.; Banan, N.; Davari, A.

    2009-01-01

    Energy demand is increasing continuously due to rapid growth in population and industrialization development. As a result greenhouse gases especially CO 2 produced by the combustion of fossil fuels cause depletion of fossil fuels and deterioration of environmental conditions worldwide. The goal of global energy sustainability implies the replacement of all fossil fuels by renewable energy sources . Hydrogen fuel is one of the sustainable energy sources can be available by conversion of biomass into biological hydrogen gas and ethanol. Rate of biomass generation in domestic wastes in Iranian culture is high. Therefore there is suitable potential for hydrogen generation in rural and urban areas of Iran. On the other hand energy extraction from these fossil fuels causes pollution and diseases. Globally, hydrogen is already produced in significant quantities (around 5 billion cubic metres per annum). It is mainly used to produce ammonia for fertiliser (about 50%), for oil refining (37%), methanol production (8%) and in the chemical and metallurgical industries (4%). On the other hand, increase in emissions rates of greenhouse gases, i.e., CO 2 present a threat to the world climate. Also new legislation of Iran has been approved the higher costs of conventional fuels for consuming in vehicles for reduction of greenhouse gases reduction as environmental policies. Demand is rising in all cities of Iran for cleaner fuels such as mixed fuels and natural gas, but unfortunately they are exporting to foreign countries or the required technologies are not available and economically option. Nuclear industries in Iran are also small and expanding only slowly. So importance of alternative energies as hydrogen powers are increasing daily. Presently both major consumers of domestic and industrial such as plants and manufacturers are using fossil fuels for their process that consequently contribute to the global warming and climate change. This paper reviews these options, with

  9. Inspection of domestic nuclear fuel rods using neutron radiography at the Tehran research reactor

    Energy Technology Data Exchange (ETDEWEB)

    Dastjerdi, Mohammad Hosein Choopan; Khalafi, Hossein; Kasesaz, Yaser [Nuclear Science and Technology Research Institute, Tehran (Iran, Islamic Republic of); Movafeghi, Amir

    2016-11-01

    Three unused domestic fuel rods were investigated qualitatively and quantitatively by means of thermal neutron radiography. The neutron radiography tests were performed by the image plate method at Tehran research reactor in order to check the fuel properties. The pellets of these three fuel rods contained three different U-235 enrichments and different sizes that were filled into a zircalloy tube. In the qualitative investigations, the difference in size and enrichment between the pellets and the gaps between them were obviously recognized in the image of the fuel rods. In the quantitative investigations, data of the pellets compositions, their sizes (lengths and diameters) and the gaps between them were extracted from obtained images. It was found that the measured data and the manufacturer's specifications are in good agreement.

  10. Inspection of domestic nuclear fuel rods using neutron radiography at the Tehran research reactor

    International Nuclear Information System (INIS)

    Dastjerdi, Mohammad Hosein Choopan; Khalafi, Hossein; Kasesaz, Yaser; Movafeghi, Amir

    2016-01-01

    Three unused domestic fuel rods were investigated qualitatively and quantitatively by means of thermal neutron radiography. The neutron radiography tests were performed by the image plate method at Tehran research reactor in order to check the fuel properties. The pellets of these three fuel rods contained three different U-235 enrichments and different sizes that were filled into a zircalloy tube. In the qualitative investigations, the difference in size and enrichment between the pellets and the gaps between them were obviously recognized in the image of the fuel rods. In the quantitative investigations, data of the pellets compositions, their sizes (lengths and diameters) and the gaps between them were extracted from obtained images. It was found that the measured data and the manufacturer's specifications are in good agreement.

  11. Impact on indoor air quality during burning of Pakistani coal briquettes

    International Nuclear Information System (INIS)

    Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.

    1993-01-01

    A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside

  12. A Study on Response Strategy to Cope with International and Domestic Constraints on the Development of Nuclear Fuel Cycle.

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Chung in; Park, Hahn Kyu; Kim, Tak Won; Lee, Dong Yoon; Lee, Yong Hwan [Yonsei University, Seoul (Korea, Republic of)

    1997-12-01

    The purpose of this study is to analyze international and domestic constraints on the development of nuclear fuel cycle technology in Korea and to develop response strategies to deal with these constraints. This study proceeded as follows: Chapter 2 examined multilateral international constrains including IAEA safeguards system and NPT, bilateral international constraints such as the U.S.-Korea Nuclear Energy Cooperation Agreement and the U.S. nonproliferation policy, and domestic constraints like residents' anti nuclear movement and environmental protest movement. In Chapter 3, this study conducted a case study on Japan's nuclear fuel cycle programs as a basic research for the establishment of relevant response strategies vis-a-vis the international and domestic constraints. In this chapter, the focus of analysis was on Japan's strategies to deal with multilateral and bilateral pressures and domestic constraints. In Chapters 4 and 5, this study sought to elaborate Korea's strategies to cope with multilateral international constraints and U.S. constraints on the development of a domestic nuclear fuel cycle in Korea, respectively. The response strategies to domestic constraints were also illuminated in Chapter 6. 44 refs., 2 tabs., 9 figs. (author)

  13. Combustion, Performance, and Emission Evaluation of a Diesel Engine with Biodiesel Like Fuel Blends Derived From a Mixture of Pakistani Waste Canola and Waste Transformer Oils

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2017-07-01

    Full Text Available The aim of this work was to study the combustion, performance, and emission characteristics of a 5.5 kW four-stroke single-cylinder water-cooled direct-injection diesel engine operated with blends of biodiesel-like fuel (BLF15, BLF20 & BLF25 obtained from a 50:50 mixture of transesterified waste transformer oil (TWTO and waste canola oil methyl esters (WCOME with petroleum diesel. The mixture of the waste oils was named as biodiesel-like fuel (BLF.The engine fuelled with BLF blends was evaluated in terms of combustion, performance, and emission characteristics. FTIR analysis was carried out to know the functional groups in the BLF fuel. The experimental results revealed the shorter ignition delay and marginally higher brake specific fuel consumption (BSFC, brake thermal efficiency (BTE and exhaust gas temperature (EGT values for BLF blends as compared to diesel. The hydrocarbon (HC and carbon monoxide (CO emissions were decreased by 10.92–31.17% and 3.80–6.32%, respectively, as compared to those of diesel fuel. Smoke opacity was significantly reduced. FTIR analysis has confirmed the presence of saturated alkanes and halide groups in BLF fuel. In comparison to BLF20 and BLF25, the blend BLF15 has shown higher brake thermal efficiency and lower fuel consumption values. The HC, CO, and smoke emissions of BLF15 were found lower than those of petroleum diesel. The fuel blend BLF15 is suggested to be used as an alternative fuel for diesel engines without any engine modification.

  14. Insight from a Critical Review on the Safety Analysis of Nuclear Fuel Cycle Facility for Domestic Regulatory System

    International Nuclear Information System (INIS)

    Hong, Soon Joon; Chung, Young Wook; Jeong, Seung Young

    2010-01-01

    Korea has 20 nuclear power plants in operation, and 10,761 ton of spent fuel deposited in plant sites. The capacity of reservoir for spent fuel in plant sites is to begin to be full in 2016. The light water reactors of 16 units generate around 320 ton/year and the heavy water reactors of 4 units around 380 ton/year in Korea. And the electricity generated by nuclear power plants is planned to increase up to 59% share by 2030. Spent fuel classified as high level radioactive waste in law is characterized by high level radiation, high heat generation, and high radiological toxicity. In the contrary, it is also a very useful domestic energy source. Thus, the safe management of spent fuel is very important confronting job in nuclear industry. Advanced fuel cycle (AFC) using pyro-process is an innovative technology, by which environmental load is drastically relieved because the extracted long-lived fission products are burn in fast breeder reactors. Domestic nuclear industry also has a perspective road map for the construction of AFC facilities. However, there is not a sufficiently detailed licensing regulatory system yet. Moreover, there is no systematic frame for the safety evaluation. This paper reviews the safety analysis system of foreign fuel cycle facilities. Critical review leads to the insight for setting-up safety analysis system of domestic AFC facilities

  15. Assessment of the implementation issues for fuel cells in domestic and small scale stationary power generation and CHP applications

    Energy Technology Data Exchange (ETDEWEB)

    Graham, G.; Cruden, A.; Hart, J.

    2002-07-01

    This report discusses implementation issues associated with the use of fuel cells in <10 kW domestic, small-scale power generation and combined heat and power (CHP) operations in the UK. The report examines the key issues (fuel cell system standards and certification, fuel infrastructure, commercial issues and competing CHP technologies), before discussing non-technical issues including finance, ownership, import and export configuration, pricing structure, customer acceptability, installation, operation and training of servicing and commissioning personnel. The report goes on to discuss market and technical drivers, grid connection issues and solutions, operations and maintenance. Recommendations for the future are made.

  16. Experience in the manufacture and performance of CANDU fuel for KANUPP

    International Nuclear Information System (INIS)

    Salim, M.; Ahmed, I.; Butt, P.

    1995-01-01

    Karachi Nuclear Power Plant (KANUPP) a 137 MWe CANDU unit is In operation since 1971. Initially, it was fueled with Canadian fuel bundles. In July 1980 Pakistani manufactured fuel was introduced in the reactor core, irradiated to a burnup of about 7500 MWd-teU -1 and successfully discharged in May 1984. The core was progressively fuelled with Pakistani fuel and in August 1990 the reactor core contained all Pakistani made fuel. As of the present, 3 core equivalent Pakistani fuel bundles have been successfully discharged at an average bumup of 6500 MWd-teU -1 . with a maximum burnup of ∼ 10,200 MWd-teU -1 . No fuel failure of Pakistani bundles has been observed so far. This paper presents the indigenous efforts towards manufacture and operational aspects of KANUPP fuel and compares its behaviour with that of Canadian supplied fuel. The Pakistani fuel has performed well and is as good as the Canadian fuel. (author)

  17. Municipal solid waste generation in municipalities: quantifying impacts of household structure, commercial waste and domestic fuel.

    Science.gov (United States)

    Lebersorger, S; Beigl, P

    2011-01-01

    Waste management planning requires reliable data concerning waste generation, influencing factors on waste generation and forecasts of waste quantities based on facts. This paper aims at identifying and quantifying differences between different municipalities' municipal solid waste (MSW) collection quantities based on data from waste management and on socio-economic indicators. A large set of 116 indicators from 542 municipalities in the Province of Styria was investigated. The resulting regression model included municipal tax revenue per capita, household size and the percentage of buildings with solid fuel heating systems. The model explains 74.3% of the MSW variation and the model assumptions are met. Other factors such as tourism, home composting or age distribution of the population did not significantly improve the model. According to the model, 21% of MSW collected in Styria was commercial waste and 18% of the generated MSW was burned in domestic heating systems. While the percentage of commercial waste is consistent with literature data, practically no literature data are available for the quantity of MSW burned, which seems to be overestimated by the model. The resulting regression model was used as basis for a waste prognosis model (Beigl and Lebersorger, in preparation). Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Municipal solid waste generation in municipalities: Quantifying impacts of household structure, commercial waste and domestic fuel

    International Nuclear Information System (INIS)

    Lebersorger, S.; Beigl, P.

    2011-01-01

    Waste management planning requires reliable data concerning waste generation, influencing factors on waste generation and forecasts of waste quantities based on facts. This paper aims at identifying and quantifying differences between different municipalities' municipal solid waste (MSW) collection quantities based on data from waste management and on socio-economic indicators. A large set of 116 indicators from 542 municipalities in the Province of Styria was investigated. The resulting regression model included municipal tax revenue per capita, household size and the percentage of buildings with solid fuel heating systems. The model explains 74.3% of the MSW variation and the model assumptions are met. Other factors such as tourism, home composting or age distribution of the population did not significantly improve the model. According to the model, 21% of MSW collected in Styria was commercial waste and 18% of the generated MSW was burned in domestic heating systems. While the percentage of commercial waste is consistent with literature data, practically no literature data are available for the quantity of MSW burned, which seems to be overestimated by the model. The resulting regression model was used as basis for a waste prognosis model (Beigl and Lebersorger, in preparation).

  19. Household level domestic fuel consumption and forest resource in relation to agroforestry adoption: Evidence against need-based approach

    Energy Technology Data Exchange (ETDEWEB)

    Sood, Kamal Kishor [Division of Agroforestry, Shere-Kashmir University of Agricultural Sciences and Technology of Jammu Main Campus-Chatha, Jammu (J and K) 180 009 (India); Mitchell, C. Paul [Institute of Energy Technologies, Fraser Noble Building, University of Aberdeen, Aberdeen AB24 3UE (United Kingdom)

    2011-01-15

    The need-based approach (assuming that higher consumption of tree products would motivate farmers to adopt agroforestry) has led to uneven success, in many cases failure, of many agroforestry projects. Current study investigated the association between fuelwood and forest resource use, and agroforestry adoption based on a survey of 401 households in the Indian Western Himalaya. Data on household domestic fuel utilisation and forest resource use were collected using a questionnaire in personal interviews. Agroforestry adoption increased significantly with increase in distance of nearest State forest from the house, distance travelled to collect fuelwood, and consumption of cattle dung, crop residues, charcoal, kerosene and liquid petroleum gas as domestic fuels by the household. Agroforestry adoption was also significantly higher in households with non-forest than those with State forests as primary source of fuelwood and timber. The proportion of adopters decreased significantly with increase in quantity of fuelwood used for domestic consumption, frequency of collection from State forests, total domestic energy consumption, fuelwood dependency, timber consumption and availability of timber through rights of households on State forests. Logistic regression analysis revealed that none of the factors related to need (quantity of fuelwood and timber used) appeared in the model but primary source of fuelwood, distance travelled to collect fuelwood and availability of timber through rights on the State forests appeared as important factors. This implies that need of the tree products is not a necessary condition to motivate farmers to adopt agroforestry, rather, it is accessibility of tree products which influence agroforestry adoption. (author)

  20. Spatiotemporal variation of domestic biomass burning emissions in rural China based on a new estimation of fuel consumption.

    Science.gov (United States)

    Xing, Xiaofan; Zhou, Ying; Lang, Jianlei; Chen, Dongsheng; Cheng, Shuiyuan; Han, Lihui; Huang, Dawei; Zhang, Yanyun

    2018-06-01

    Domestic biomass burning (DBB) influences both indoor and outdoor air quality due to the multiple pollutants released during incomplete and inefficient combustion. The emissions are not well quantified because of insufficient information, which were the key parameters related to fuel consumption estimation, such as province- and year-specific percentage of domestic straw burning (P straw ) and firewood consumption (Fc). In this study, we established the quantitative relationship between rural-related socioeconomic parameters (e.g., rural per-capita income and rural Engel's coefficient) and P straw /Fc. DBB emissions, including 12 crop straw types and firewood for 12 kinds of pollutants in China during the period 1995-2014, were estimated based on fuel-specific emission factors and detailed fuel consumption data. The results revealed that the national emissions generally increased initially and then decreased with the turning point around 2007-2008. Firewood burning was the major source of the NH 3 and BC emissions; straw burning contributed more to SO 2 , NMVOC, CO, OC, and CH 4 emissions; while the major contributor changed from firewood to domestic straw burning for NOx, PM 10 , PM 2.5 , CO 2 , and Hg emissions. The emission trends varied among the 31 provinces. The major agricultural regions of north-eastern, central, and south-western China were always characterized by high emissions. The spatial variation mainly occurred in the northeast and north China (increase), and central-south and coastal regions of China (decrease). Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  2. Effect of Fuels and Domestic Heating Appliance Types on Emission Factors of Selected Organic Pollutants

    Czech Academy of Sciences Publication Activity Database

    Šyc, Michal; Horák, J.; Hopan, F.; Krpec, K.; Tomšej, T.; Ocelka, T.; Pekárek, Vladimír

    2011-01-01

    Roč. 45, č. 21 (2011), s. 9427-9434 ISSN 0013-936X R&D Projects: GA MŽP(CZ) SP/1A2/116/07 Institutional research plan: CEZ:AV0Z40720504 Keywords : domestic combustion * PCDD/F * emission factors Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 5.228, year: 2011

  3. Analysis of the structural changes in domestic consumption of FUEL and energetic resources of Moscow

    Directory of Open Access Journals (Sweden)

    L. G. Moiseykina

    2017-01-01

    Full Text Available Purpose of the study. The fuel and energy complex is one of the important components of the mechanism of functioning of the national economy in general and municipal economy in particular, since the main tasks of the complex include: provision of hot water supply all year round and heat during the winter period, meeting the needs of the population and municipal economy in gas, supply of gasoline and diesel fuel to satisfy consumers, as well as the supply of coal, peat, fuel oil and other fuels for the urban economy. An important role is played by enterprises of the fuel and energy complex in terms of providing jobs to the population. The fuel and energy complex of Moscow is one of the largest in Russia. A feature of its functioning is the concentrated consumption of gas, fuel, electricity, heat energy and other energy resources. The formation and development of the fuel and energy complex in Moscow is largely due to the rapidly developing economy of the megapolis – large-scale construction of housing and infrastructure, sustainable population growth entails a constant increase in consumption of fuel and energy resources. Monitoring the efficiency of the use of fuel and energy resources makes it possible to identify ways to reduce the volume of consumption to a level that allows, within the approved limit, to implement the planned rate of social and economic development of the city. Materials and methods. Information base of the research was made by statistical data characterizing the volume of consumption of certain types of fuel and energy resources in the market of the Moscow region. The methodological basis of the study is made up of statistical methods of analysis of structure and structural shifts, dynamics. Their use made it possible to conduct a thorough analysis of the differentiation of consumption of various types of fuel and energy resources, as well as structural changes in the differentiations in question. It made it possible to

  4. Women's personal and indoor exposures to PM 2.5 in Mysore, India: Impact of domestic fuel usage

    Science.gov (United States)

    Andresen, Penny Rechkemmer; Ramachandran, Gurumurthy; Pai, Pramod; Maynard, Andrew

    In traditional societies, women are more likely to be adversely affected by exposures to fine particulates from domestic fuel combustion due to their role in the family as the primary cooks. In this study, 24-h gravimetric personal and indoor PM 2.5 exposures were measured for 15 women using kerosene and another 15 women using liquefied petroleum gas (LPG) as their main cooking fuel in Mysore, India. The women also answered a detailed questionnaire regarding their residential housing characteristics, health status, cooking practices and socioeconomic status. Repeated measurements were obtained during two seasons. The main objective of this study was to determine whether exposures to PM 2.5 differed according to fuel usage patterns. A repeated-measures general linear model (GLM) was used to analyze the data. Women using kerosene as their primary cooking fuel had significantly higher exposures. During summer, the arithmetic mean (± standard error) for kerosene users personal exposure was 111±13 and 71±15 μg m -3 for LPG users. Kerosene users had higher exposures in winter (177±21 μg m -3) compared to summer exposures. However, for LPG users there was no difference in their seasonal geometric mean exposures at 71±13 μg m -3. Indoor concentrations followed similar patterns. In summer, kerosene-using households had an arithmetic mean concentration of 98±9 μg m -3 and LPG-using households had an arithmetic mean concentration of 71±9 μg m -3. Winter concentrations were significantly higher than summer concentrations for kerosene users (155±13 μg m -3). Again, LPG users showed only slightly higher indoor concentrations (73±6 μg m -3) than kerosene users. Socioeconomic status, age, season and income were significant predictors of cooking fuel choice.

  5. Allocation of uranium enrichment services to fuel foreign and domestic nuclear reactors

    International Nuclear Information System (INIS)

    1975-01-01

    This interim report was made in response to a request for information concerning the sale of U.S. uranium enrichment services to foreign countries and its effect on AEC's ability to meet domestic demands. Long-term enrichment services (June 30, 1974), both domestic and foreign, totaled 364,000 MW, or 44,000 MW more than its available capability. The first-come-first-served policy was modified to give preferential treatment to Yugoslav and Mexican requests because of IAEA commitments, and to shift six standard contracts from Japan. From Aug. to Sept. 1974, standard contracts were signed for all 15 pending domestic requests and for 33 pending foreign requests, with the remaining 45 foreign requests depending on NRC's approval of Pu recycle, although private enrichment or stockpile enriched U could meet these needs. There is no firm commitment in the private sector to build and operate the needed enrichment plant. The acceleration of foreign nuclear programs coupled with ERDA's termination of further long-term contracts, may lead to the emergence of foreign supply sources, and U.S. may lose its favorable balance-of-payments and its influence on international nuclear policies

  6. Spatial graduation of fuel taxes; consequences for cross-border and domestic fuelling

    Energy Technology Data Exchange (ETDEWEB)

    Rietveld, P.; Bruinsma, F.R.; Vuuren, D.J. van [Vrije University, Amsterdam (Niger). Faculty of Economics, Business Administration and Econometrics, Department of Spatial Economics and Tinbergen Institute

    2001-07-01

    Substantial differences exist among fuel taxes between various countries. These differences represent a form of fiscal competition that has undesirable side effects because it leads to cross-border fuelling and hence to extra kilometres driven. One possible way of dealing with this problem of low fuel taxes in neighbouring countries is to introduce a spatial differentiation of taxes: low near the border and higher farther away. This paper contains an empirical analysis of the consequences of such a spatial graduation of fuel taxes for The Netherlands. Impacts on fuelling behaviour, vehicle kilometres driven, tax receipts, and sales by owners of gas stations are analysed. The appropriate slope of the graduation curve in order to prevent fuel-fetching trips is also discussed. Our conclusion is that in a small country such as The Netherlands, a spatial graduation of fuel taxes will lead to considerable problems, even when the graduation curve is not steep that fuel-fetching trips are prevented. The reason is that - given their activity patterns - car drivers will change the location of their fuelling activity leading to substantial problems for owners of gas stations in areas with high taxes. (author)

  7. Measurement of the gap and grain boundary inventories of Cs, Sr and I in domestic used PWR fuels

    International Nuclear Information System (INIS)

    Kim, S. S.; Choi, J. W.; Seo, H. S.; Cho, W. J.; Kang, K. C.; Kwon, S. H.

    2007-01-01

    Inventories of soluble elements in the gap and grain boundaries of domestic used PWR fuel pellets were measured to estimate the quantities of radionuclides that are liable to be rapidly released into the groundwater of a disposal site. The gap inventory of cesium for the pellets in the used fuel with a burn-up range of 45 to 66 GWD/MTU showed 0.85 to 1.7% of its total inventory, which was close to 1/6 to 1/3 of the fission gas release fraction (FGRF). However, the amounts of cesium released from the gaps of the pellets below 40 GWD/MTU of a burn-up and less than 1% FGRF were so erratic that the gap inventory could not be defined by its FGRF. Strontium inventories in the gap and grain boundaries of the pellets in the same rod were not significantly varied, and the iodine inventory in the gap of the used PWR fuels was estimated to be less than or the same as the FGRF

  8. Comparative Analysis of the Indian and Pakistani Nuclear Energy Development Programmes

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2015-01-01

    Full Text Available Due to the traditional competition between India and Pakistan, their strategic fields developing are interdependent. Nuclear power development programs are concerned as well. Pakistan falls behind India in this branch, however the specifics of the nuclear infrastructure let the potential of the states be relatively balanced. After Nuclear Suppliers Group granted a waiver to India in 2008 and Russia, France and USA, the new participants, broke into the market, India obtained an opportunity to make a breakthrough in the national nuclear program development, thus violating a status quo in fuel cycle technologies. Such chances stimulated China to violate the NSG guidelines and non-proliferations principles to get involved in Pakistani nuclear program development. The nuclear power Indian-Pakistani competition prospects largely depend on the Chinese position. Despite the international community suspects the Pakistani officials in nuclear black market dealing and the NSG guidelines China obviously supports the Pakistani nuclear field. This may result in preventing of escalation of tensions in the region. 

  9. Improving domestic wastewater treatment efficiency with constructed wetland microbial fuel cells: Influence of anode material and external resistance.

    Science.gov (United States)

    Corbella, Clara; Puigagut, Jaume

    2018-08-01

    For the past few years, there has been an increasing interest in the operation of constructed wetlands as microbial fuel cells (CW-MFCs) for both the improvement of wastewater treatment efficiency and the production of energy. However, there is still scarce information on design and operation aspects to maximize CW-MFCs efficiency, especially for the treatment of real domestic wastewater. The aim of this study was to quantify the extent of treatment efficiency improvement carried out by membrane-less MFCs simulating a core of a shallow un-planted horizontal subsurface flow constructed wetland. The influence of the external resistance (50, 220, 402, 604 and 1000Ω) and the anode material (graphite and gravel) on treatment efficiency improvement were addressed. To this purpose, 6 lab-scale membrane-less MFCs were set-up and loaded in batch mode with domestic wastewater for 13weeks. Results showed that 220Ω was the best operation condition for maximising MFCs treatment efficiency, regardless the anode material employed. Gravel-based anode MFCs operated at closed circuit showed ca. 18%, 15%, 31% and 25% lower effluent concentration than unconnected MFCs to the COD, TOC, PO 4 -3 and NH 4 + -N, respectively. Main conclusion of the present work is that constructed wetlands operated as MFCs is a promising strategy to improve domestic wastewater treatment efficiency. However, further studies at pilot scale under more realistic conditions (such as planted systems operated under continuous mode) shall be performed to confirm the findings here reported. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah

    2005-01-01

    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  11. A monetary comparison of energy recovered from microbial fuel cells and microbial electrolysis cells fed winery or domestic wastewaters

    Energy Technology Data Exchange (ETDEWEB)

    Cusick, Roland D.; Kiely, Patrick D.; Logan, Bruce E. [Department of Civil and Environmental Engineering, H2E Center, Penn State University, University Park, PA 16802 (United States)

    2010-09-15

    Microbial fuel (MFCs) and electrolysis cells (MECs) can be used to recover energy directly as electricity or hydrogen from organic matter. Organic removal efficiencies and values of the different energy products were compared for MFCs and MECs fed winery or domestic wastewater. TCOD removal (%) and energy recoveries (kWh/kg-COD) were higher for MFCs than MECs with both wastewaters. At a cost of 4.51/kg-H{sub 2} for winery wastewater and 3.01/kg-H{sub 2} for domestic wastewater, the hydrogen produced using MECs cost less than the estimated merchant value of hydrogen (6/kg-H{sub 2}). 16S rRNA clone libraries indicated the predominance of Geobacter species in anodic microbial communities in MECs for both wastewaters, suggesting low current densities were the result of substrate limitations. The results of this study show that energy recovery and organic removal from wastewater are more effective with MFCs than MECs, but that hydrogen production from wastewater fed MECs can be cost effective. (author)

  12. Performance of two different types of anodes in membrane electrode assembly microbial fuel cells for power generation from domestic wastewater

    KAUST Repository

    Hays, Sarah

    2011-10-01

    Graphite fiber brush electrodes provide high surface areas for exoelectrogenic bacteria in microbial fuel cells (MFCs), but the cylindrical brush format limits more compact reactor designs. To enable MFC designs with closer electrode spacing, brush anodes were pressed up against a separator (placed between the electrodes) to reduce the volume occupied by the brush. Higher maximum voltages were produced using domestic wastewater (COD = 390 ± 89 mg L-1) with brush anodes (360 ± 63 mV, 1000 Ω) than woven carbon mesh anodes (200 ± 81 mV) with one or two separators. Maximum power densities were similar for brush anode reactors with one or two separators after 30 days (220 ± 1.2 and 240 ± 22 mW m-2), but with one separator the brush anode MFC power decreased to 130 ± 55 mW m-2 after 114 days. Power densities in MFCs with mesh anodes were very low (<45 mW m-2). Brush anodes MFCs had higher COD removals (80 ± 3%) than carbon mesh MFCs (58 ± 7%), but similar Coulombic efficiencies (8.6 ± 2.9% brush; 7.8 ± 7.1% mesh). These results show that compact (hemispherical) brush anodes can produce higher power and more effective domestic wastewater treatment than flat mesh anodes in MFCs. © 2011 Elsevier B.V. All rights reserved.

  13. Historical overview of domestic spent nuclear fuel shipments in the United States

    International Nuclear Information System (INIS)

    Pope, R.B.; Wankerl, M.W.; Hamberger, C.R.; Schmid, S.P.

    1992-01-01

    The information in this paper summarizes historical data on spent nuclear fuel shipments in the United States (US) from the period from 1964 to 1991. Information on shipments has been developed to establish a basis for developing a transportation system in the US for initiating shipments of spent nuclear fuel beginning in 1998. The paper shows that approximately 2700 power reactor spent nuclear fuel rail and truck casks have been shipped within the US during the past 28 years. In total, approximately 2000 metric tonnes of uranium (MTU) have been shipped to date, which compares with projected shipping rates of from 3000 to greater than 6000 MM per year when the US Civilian Radioactive Waste Management System is in full operation

  14. Historical overview of domestic spent nuclear fuel shipments in the United States

    International Nuclear Information System (INIS)

    Pope, R.B.; Wankerl, M.W.; Hamberger, C.R.; Schmid, S.P.

    1993-01-01

    The information in this paper summarized historical data on spent nuclear fuel shipments in the United States (U.S.) from the period from 1964 to 1991. Information on shipments has been developed to establish a basis for developing a transportation system in the U.S. for initiating shipments of spent nuclear fuel beginning in 1988. The paper shows that approximately 2700 power spent nuclear fuel rail and truck casks have been shipped within the U.S. during the past 28 years. In total, approximately 2000 metric tonnes of uranium (MTU) have been shipped to date, which compares with projected shipping rates of from 3000 to greater than 6000 MTU per year when the U.S. Civilian Radiation Waste Management System is in full operation. (author)

  15. Impact of domestic air pollution from cooking fuel on respiratory allergies in children in India

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, R.; Nagar, J.K.; Raj, N.; Kumar, P.; Kushwah, A.S.; Meena, M.; Gaur, S.N. [University of Delhi, Delhi (India)

    2008-12-15

    This study undertaken in India was aimed at identifying the effects of the indoor air pollutants SO{sub 2}, NO{sub 2} and total suspended particulate matter (SPM) generated from fuel used for cooking on respiratory allergy in children in Delhi. A total of 3,456 children were examined (59.2% male and 40.8% female). Among these, 31.2% of the children's families were using biomass fuels for cooking and 68.8% were using liquefied petroleum gas. Levels of indoor SO{sub 2}, NO{sub 2} and SPM, measured using a Handy Air Sampler (Low Volume Sampler), were 4.60 {+-} 5.66 {mu}g/m{sup 3}, 30.70 {+-} 23.95 {mu}g/m{sup 3} and 705 {+-} 441.6 {mu}g/m{sup 3}, respectively. The mean level of indoor SO{sub 2} was significantly higher (p = 0.016) for families using biomass fuels (coal, wood, cow dung cakes and kerosene) for cooking as compared to families using LP gas. The mean level of indoor NO{sub 2} for families using biomass fuels for cooking was significantly higher in I.T.O. (p = 0.003) and Janakpuri (p = 0.007), while indoor SPM was significantly higher in Ashok Vihar (p = 0.039) and I.T.O. (p = 0.001), when compared to families using LP gas. Diagnoses of asthma, rhinitis and upper respiratory tract infection (URTI) were made in 7.7%, 26.1% and 22.1% of children, respectively. Respiratory allergies in children, which included asthma, rhinitis and URTI, could be associated with both types of fuels (liquefied petroleum gas (LPG) and biomass) used for cooking in the different study areas. This study suggests that biomass fuels increased the concentrations of indoor air pollutants that cause asthma, rhinitis and URTI in children. LP gas smoke was also associated with respiratory allergy.

  16. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  17. Global considerations on fuel cells for mobile and domestic operation connected to the AC-line

    Energy Technology Data Exchange (ETDEWEB)

    Rufer, A.; Favrat, D.; Mc Evoy, A. [Ecole Polytechnique Federale, LEI, LENI, ICP, Lausanne (Switzerland)

    2000-07-01

    Three labs at EPFL which are bound through CRETE (Centre de Recherche et d'Enseignement en Technologies Energetiques) have oriented some of their research activities on integrated fuel cells equipment. Technological and systemic optimization research programs are currently under way, mainly in the field of electro-chemical materials, of systemic approach, and in the field of optimising the static conversion system for injection in an electrical network. Efficiency calculations and comparisons are given.

  18. Domestic use of overseas renewable energy -Potential as power generating fuel

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Tomofumi; Murata, Kenji; Kamiya, Shoji; Ota, Ken-ichiro; Sakata, Ko; Fukuda, Kenzo; Ishimoto, Yuki

    2010-09-15

    For Japan, it will be very important in the future to establish a social system that can consistently import or produce a set amount of resource supplies without green house gas emissions. In this study, we developed a concept for a global hydrogen energy system using wind power generation as a hydrogen source, investigated its economic efficiency, compared it with power generating fuels used at existing thermal power plants, and examined the feasibility of the global hydrogen energy system. As a result, it would be more effective to decommission existing oil-fired thermal power plants and construct new hydrogen turbine plants.

  19. Changes in domestic heating fuel use in Greece: effects on atmospheric chemistry and radiation

    Science.gov (United States)

    Athanasopoulou, Eleni; Speyer, Orestis; Brunner, Dominik; Vogel, Heike; Vogel, Bernhard; Mihalopoulos, Nikolaos; Gerasopoulos, Evangelos

    2017-09-01

    For the past 8 years, Greece has been experiencing a major financial crisis which, among other side effects, has led to a shift in the fuel used for residential heating from fossil fuel towards biofuels, primarily wood. This study simulates the fate of the residential wood burning aerosol plume (RWB smog) and the implications on atmospheric chemistry and radiation, with the support of detailed aerosol characterization from measurements during the winter of 2013-2014 in Athens. The applied model system (TNO-MACC_II emissions and COSMO-ART model) and configuration used reproduces the measured frequent nighttime aerosol spikes (hourly PM10 > 75 µg m-3) and their chemical profile (carbonaceous components and ratios). Updated temporal and chemical RWB emission profiles, derived from measurements, were used, while the level of the model performance was tested for different heating demand (HD) conditions, resulting in better agreement with measurements for Tmin < 9 °C. Half of the aerosol mass over the Athens basin is organic in the submicron range, of which 80 % corresponds to RWB (average values during the smog period). Although organic particles are important light scatterers, the direct radiative cooling of the aerosol plume during wintertime is found low (monthly average forcing of -0.4 W m-2 at the surface), followed by a minor feedback to the concentration levels of aerosol species. The low radiative cooling of a period with such intense air pollution conditions is attributed to the timing of the smog plume appearance, both directly (longwave radiation increases during nighttime) and indirectly (the mild effect of the residual plume on solar radiation during the next day, due to removal and dispersion processes).

  20. Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments.

    Science.gov (United States)

    Liu, Guangli; Yates, Matthew D; Cheng, Shaoan; Call, Douglas F; Sun, Dan; Logan, Bruce E

    2011-08-01

    Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118 h) was similar to that obtained by adding acetate or fumarate (110-115 h), and less than that with glucose (181 h) or Fe(III) (353 h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149 h (25 mM) to 251 h (50 mM) and 526 h (100 mM). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 200 to 600 μg/cm(2) for all amendments except Fe(Ш) (1650 μg/cm(2)). Wastewater produced 91 mW/m(2), with the other MFCs producing 50 mW/m(2) (fumarate) to 103mW/m(2) (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments

    KAUST Repository

    Liu, Guangli

    2011-08-01

    Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118h) was similar to that obtained by adding acetate or fumarate (110-115h), and less than that with glucose (181h) or Fe(III) (353h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149h (25mM) to 251h (50mM) and 526h (100mM). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 200 to 600μg/cm2 for all amendments except Fe(Sh{cyrillic}) (1650μg/cm2). Wastewater produced 91mW/m2, with the other MFCs producing 50mW/m2 (fumarate) to 103mW/m2 (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. © 2011 Elsevier Ltd.

  2. Assessment of PM10 concentrations from domestic biomass fuel combustion in two rural Bolivian highland villages

    International Nuclear Information System (INIS)

    Albalak, R.; Haber, M.

    1999-01-01

    PM 10 concentrations were measured in two contrasting rural Bolivian villages that cook with biomass fuels. In one of the villages, cooking was done exclusively indoors, and in the other, it was done primarily outdoors. Concentrations in all potential microenvironments of exposure (i.e., home, kitchen, and outdoors) were measured for a total of 621 samples. Geometric mean kitchen PM 10 concentrations were 1830 and 280 microg/m 3 and geometric mean home concentrations were 280 and 440 microg/m 3 for the indoor and outdoor cooking villages, respectively. An analysis of pollutant concentrations using generalized estimating equation techniques showed significant effects of village location, and interaction of village and location on log-transformed PM 10 concentrations. Pollutant concentrations and activity pattern data were used to estimate total exposure using the indirect method of exposure assessment. Daily exposure for women during the nonwork season was 15 120 and 6240 microg h -1 m -3 for the indoor and outdoor cooking villages, respectively. Differences in exposure to pollution between the villages were not as great as might be expected based on kitchen concentration alone. This study underscores the importance of measuring pollutant concentrations in all microenvironments where people spend time and of shifting the focus of air pollution studies to include rural populations in developing countries

  3. Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments

    KAUST Repository

    Liu, Guangli; Yates, Matthew D.; Cheng, Shaoan; Call, Douglas F.; Sun, Dan; Logan, Bruce E.

    2011-01-01

    Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118h) was similar to that obtained by adding acetate or fumarate (110-115h), and less than that with glucose (181h) or Fe(III) (353h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149h (25mM) to 251h (50mM) and 526h (100mM). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 200 to 600μg/cm2 for all amendments except Fe(Sh{cyrillic}) (1650μg/cm2). Wastewater produced 91mW/m2, with the other MFCs producing 50mW/m2 (fumarate) to 103mW/m2 (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. © 2011 Elsevier Ltd.

  4. Different electrode configurations to optimize performance of multi-electrode microbial fuel cells for generating power or treating domestic wastewater

    KAUST Repository

    Ahn, Yongtae

    2014-03-01

    Scaling-up of microbial fuel cells (MFCs) for practical applications requires compact, multiple-electrode designs. Two possible configurations are a separator electrode assembly (SEA) or closely spaced electrodes (SPA) that lack a separator. It is shown here that the optimal configuration depends on whether the goal is power production or rate of wastewater treatment. SEA MFCs produced a 16% higher maximum power density (328 ± 11 mW m-2) than SPA MFCs (282 ± 29 mW m-2), and higher coulombic efficiencies (SEAs, 9-31%; SPAs, 2-23%) with domestic wastewater. However, treatment was accomplished in only 12 h with the SPA MFC, compared to 36 h with the SEA configuration. Ohmic resistance was not a main factor in performance as this component contributed only 4-7% of the total internal resistance. Transport simulations indicated that hindered oxygen diffusion into the SEA reactor was the primary reason for the increased treatment time. However, a reduction in the overall rate of substrate diffusion also may contribute to the long treatment time with the SEA reactor. These results suggest that SEA designs can more effectively capture energy from wastewater, but SPA configurations will be superior in terms of treatment efficiency due to a greatly reduced time needed for treatment. © 2013 Elsevier B.V. All rights reserved.

  5. Different electrode configurations to optimize performance of multi-electrode microbial fuel cells for generating power or treating domestic wastewater

    KAUST Repository

    Ahn, Yongtae; Hatzell, Marta C.; Zhang, Fang; Logan, Bruce E.

    2014-01-01

    Scaling-up of microbial fuel cells (MFCs) for practical applications requires compact, multiple-electrode designs. Two possible configurations are a separator electrode assembly (SEA) or closely spaced electrodes (SPA) that lack a separator. It is shown here that the optimal configuration depends on whether the goal is power production or rate of wastewater treatment. SEA MFCs produced a 16% higher maximum power density (328 ± 11 mW m-2) than SPA MFCs (282 ± 29 mW m-2), and higher coulombic efficiencies (SEAs, 9-31%; SPAs, 2-23%) with domestic wastewater. However, treatment was accomplished in only 12 h with the SPA MFC, compared to 36 h with the SEA configuration. Ohmic resistance was not a main factor in performance as this component contributed only 4-7% of the total internal resistance. Transport simulations indicated that hindered oxygen diffusion into the SEA reactor was the primary reason for the increased treatment time. However, a reduction in the overall rate of substrate diffusion also may contribute to the long treatment time with the SEA reactor. These results suggest that SEA designs can more effectively capture energy from wastewater, but SPA configurations will be superior in terms of treatment efficiency due to a greatly reduced time needed for treatment. © 2013 Elsevier B.V. All rights reserved.

  6. Brand equity in the Pakistani hotel industry

    OpenAIRE

    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

    2014-01-01

    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  7. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  8. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements

    Science.gov (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim

    2015-01-01

    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  9. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  10. Bacteriological (fecal and total coliform) quality of Pakistani coastal water

    International Nuclear Information System (INIS)

    Mashiatullah, A.; Qureshi, R.M.; Javed, T.; Khan, M.S.; Chaudhary, M.Z.; Khalid, F.

    2010-01-01

    The coliform bacteria group consists of several genera of bacteria belonging to the family enterobacteriaceae. These are harmless bacteria, mostly live in soil, water, and digestive system of animals. Fecal coliform bacteria, which belongs to this group, are present in large numbers in feces and intestinal tract of human beings and other warm-blooded animals which can enter into water bodies from human and animal waste. Swimming in water having high levels of Fecal coliform bacteria increases the chance of developing illness (fever, nausea or stomach cramps) from pathogens entering the body through mouth, nose, ears or cuts in the skin. The objective of the present study was to characterize the bathing quality of Pakistani coastal water with respect to coliform bacteria. Total and Fecal coliform bacteria were determined at seven different locations along Pakistan coast using membrane filtration (MF) technique. 100 ml of water was passed through 0.45 micron (mu) filter paper. These filter papers were put on pads, soaked in Lauryle sulphate broth in petri-dishes and incubated at 44 deg. C for Fecal and 37 deg. for Total coliform for 24 hours. Significantly high population of Fecal and Total coliform bacteria was recorded at Karachi harbour area and Indus delta region. Results indicate that a large amount of domestically originated waste is being discharged into these locations without any pre-treatment (e.g., screening, activated sludge, by using filtration beds etc.) resulting in a poor seawater quality making it unfit for bathing. (author)

  11. Religion, male violence, and the control of women: Pakistani Muslim men in Bradford, UK.

    Science.gov (United States)

    Macey, M

    1999-03-01

    This paper examines Pakistani Muslim male violence in the public and private spheres in Bradford, UK. The article also explores the relationship between male violence and ideas of culture and religion. The material used was collected over a 4-year period from students and staff in further and higher education institutions; working women (prostitutes); survivors of domestic violence; police personnel who work with Asian women fleeing domestic violence or forced marriages; and staff of a children's society working with teenage prostitutes. Methodologies included lectures, seminars, focus groups, and interviews. Findings reveal that there is a difference between male and female attitudes towards Islam. Some men are using it to justify violence against women, while women of all ages and backgrounds are using it as a source of strength and to negotiate (with ingenuity and humor) the cultural and religious requirements which men try to impose upon them.

  12. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  13. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.

    2015-01-01

    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  14. VAT on domestic energy

    International Nuclear Information System (INIS)

    Crawford, Ian; Smith, Stephen; Webb, Steven.

    1993-01-01

    This publication traces the background to the imposition of VAT on domestic energy, and considers the current patterns of spending. Results of a simulation of the effects of imposition of 17.5% VAT on domestic fuels are presented, and policy measures to offset the impact on poorer households are considered. (UK)

  15. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif

    2017-09-01

    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  16. Suicidal ideation in Pakistani college students.

    Science.gov (United States)

    Khokher, Sehar; Khan, Murad M

    2005-01-01

    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  17. Emission and economic performance assessment of a solid oxide fuel cell micro-combined heat and power system in a domestic building

    International Nuclear Information System (INIS)

    Elmer, Theo; Worall, Mark; Wu, Shenyi; Riffat, Saffa B.

    2015-01-01

    Combined heat and power (CHP) is a promising technological configuration for reducing energy consumption and increasing energy security in the domestic built environment. Fuel cells, on account of their: high electrical efficiency, low emissions and useful heat output have been identified as a key technological option for improving both building energy efficiency and reducing emissions in domestic CHP applications. The work presented in this paper builds upon results currently reported in the literature of fuel cells operating in domestic building applications, with an emission and economic performance assessment of a real, commercially available SOFC mCHP system operating in a real building; under a UK context. This paper aims to assess the emission and economic performance of a commercially available solid oxide fuel cell (SOFC) mCHP system, operating at The University of Nottingham's Creative Energy Homes. The performance assessment evaluates, over a one year period, the associated carbon (emission assessment) and operational costs (economic assessment) of the SOFC mCHP case compared to a ‘base case’ of grid electricity and a highly efficient gas boiler. Results from the annual assessment show that the SOFC mCHP system can generate annual emission reductions of up to 56% and cost reductions of 177% compared to the base case scenario. However support mechanisms such as; electrical export, feed in tariff and export tariff, are required in order to achieve this, the results are significantly less without. A net present value (NPV) analysis shows that the base case is still more profitable over a 15 year period, even though the SOFC mCHP system generates annual revenue; this is on account of the SOFC's high capital cost. In summary, grid interaction and incubator support is essential for significant annual emission and cost reductions compared to a grid electricity and gas boiler scenario. Currently capital cost is the greatest barrier to the economic

  18. Alternative fuels in domestic heating markets. Experimental testing of n-butanol as component in domestic heating oil; Alternative fluessige Energietraeger im Raumwaermemarkt. Experimentelle Ueberpruefung von n-Butanol als Beimischung zu Heizoel EL

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, H.; Dohn, N.; Rheinberg, O. van [RWTH Aachen (Germany). OWI Oel-Waerme-Inst. GmbH

    2012-02-15

    N-butanol has already been tested successfully as partial substitute for diesel fuel. However, to date there are no corresponding studies available regarding the use of n-butanol as bio-component in domestic heating oil. Thus, physical and chemical norm parameters of n-butanol/heating oil blends and their combustion specific characteristics in steady operation were examined. The combustion of blends of domestic heating oil and butanol (up to 20 % (v/v)) in a common yellow burner did not indicate negative influence and did not yield a significant change in emissions of carbon monoxide, nitrogen oxides or soot. All tests were conducted without any modifications of the burner to the use of n-butanol. The flash point drops below the limit of 55 C with 1 % (v/v) butanol already and is therefore a flammable liquid. Its use as a substitute for heating oil is therefore limited by safety regulations. Practical applications of n-butanol as bio-component could be its utilization in low concentrations or in facilities providing suitable storage capabilities. (orig.)

  19. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  20. PECUNIA EX MACHINA: PAKISTANI ENTREPRENEURS IN THE CITY OF BARCELONA

    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García

    2010-12-01

    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  1. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2007-01-01

    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  2. Homecell: design and development of a 2 kW fuel cell based electric energy generating system, for the domestic market

    Energy Technology Data Exchange (ETDEWEB)

    Bordallo, C.R.; Moreno, E.; Brey, J.J.; Garcia, C.; Castro, A.; Sarmiento, B. [Hynergreen Technologies, S.A., Seville (Spain)

    2004-07-01

    'Full text:' Even though fuel cell technology has been known in industry for decades now, it has come to the fore in recent years hand in hand with renewable energy sources and the hydrogen vector, as a clean, reliable and efficient electric energy source. Within the stationary applications of fuel cells, the production of high output electric energy has always stood out and this could range from several hundreds of watts to megawatts to supply large plants. The objective of this project is to develop, construct and experimentally validate an electric energy generating system for domestic applications of up to 2 kW. This is due to the fact that multiple domestic applications currently exist for which an electric output of 2 kW is sufficient. On the other hand, an electricity supply might not exist, or might be deficient; and this system will enable electricity supply even under these circumstances. Moreover, the existing system is very versatile and could be complemented with other hydrogen production ones (using photovoltaic energy for example), or else two systems could be used in parallel if outputs up to 4 kW were required, and other applications in other markets, such as telecommunications or tele-metering systems, could be undertaken. (author)

  3. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq

    2012-03-01

    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  4. Acceptability of GM foods among Pakistani consumers

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-01-01

    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  5. Acceptability of GM foods among Pakistani consumers.

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-04-02

    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  6. A two-stage microbial fuel cell and anaerobic fluidized bed membrane bioreactor (MFC-AFMBR) system for effective domestic wastewater treatment.

    KAUST Repository

    Ren, Lijiao; Ahn, Yongtae; Logan, Bruce E

    2014-01-01

    Microbial fuel cells (MFCs) are a promising technology for energy-efficient domestic wastewater treatment, but the effluent quality has typically not been sufficient for discharge without further treatment. A two-stage laboratory-scale combined treatment process, consisting of microbial fuel cells and an anaerobic fluidized bed membrane bioreactor (MFC-AFMBR), was examined here to produce high quality effluent with minimal energy demands. The combined system was operated continuously for 50 days at room temperature (∼25 °C) with domestic wastewater having a total chemical oxygen demand (tCOD) of 210 ± 11 mg/L. At a combined hydraulic retention time (HRT) for both processes of 9 h, the effluent tCOD was reduced to 16 ± 3 mg/L (92.5% removal), and there was nearly complete removal of total suspended solids (TSS; from 45 ± 10 mg/L to <1 mg/L). The AFMBR was operated at a constant high permeate flux of 16 L/m(2)/h over 50 days, without the need or use of any membrane cleaning or backwashing. Total electrical energy required for the operation of the MFC-AFMBR system was 0.0186 kWh/m(3), which was slightly less than the electrical energy produced by the MFCs (0.0197 kWh/m(3)). The energy in the methane produced in the AFMBR was comparatively negligible (0.005 kWh/m(3)). These results show that a combined MFC-AFMBR system could be used to effectively treat domestic primary effluent at ambient temperatures, producing high effluent quality with low energy requirements.

  7. A two-stage microbial fuel cell and anaerobic fluidized bed membrane bioreactor (MFC-AFMBR) system for effective domestic wastewater treatment.

    KAUST Repository

    Ren, Lijiao

    2014-03-10

    Microbial fuel cells (MFCs) are a promising technology for energy-efficient domestic wastewater treatment, but the effluent quality has typically not been sufficient for discharge without further treatment. A two-stage laboratory-scale combined treatment process, consisting of microbial fuel cells and an anaerobic fluidized bed membrane bioreactor (MFC-AFMBR), was examined here to produce high quality effluent with minimal energy demands. The combined system was operated continuously for 50 days at room temperature (∼25 °C) with domestic wastewater having a total chemical oxygen demand (tCOD) of 210 ± 11 mg/L. At a combined hydraulic retention time (HRT) for both processes of 9 h, the effluent tCOD was reduced to 16 ± 3 mg/L (92.5% removal), and there was nearly complete removal of total suspended solids (TSS; from 45 ± 10 mg/L to <1 mg/L). The AFMBR was operated at a constant high permeate flux of 16 L/m(2)/h over 50 days, without the need or use of any membrane cleaning or backwashing. Total electrical energy required for the operation of the MFC-AFMBR system was 0.0186 kWh/m(3), which was slightly less than the electrical energy produced by the MFCs (0.0197 kWh/m(3)). The energy in the methane produced in the AFMBR was comparatively negligible (0.005 kWh/m(3)). These results show that a combined MFC-AFMBR system could be used to effectively treat domestic primary effluent at ambient temperatures, producing high effluent quality with low energy requirements.

  8. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

    Science.gov (United States)

    Islam, Kazi Md Mukitul; Asadullah, M Niaz

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

  9. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

    Science.gov (United States)

    Islam, Kazi Md. Mukitul

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

  10. Domestic violence

    Science.gov (United States)

    ... violence; Spousal abuse; Elder abuse; Child abuse; Sexual abuse - domestic violence ... 2016. National Domestic Violence Hotline website. What is domestic violence? www.thehotline.org/is-this-abuse/abuse-defined . Accessed July 10, 2016.

  11. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2006-01-01

    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  12. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  13. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  14. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2012-12-01

    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  15. Advancing an energy justice perspective of fuel poverty: Household vulnerability and domestic retrofit policy in the United Kingdom

    OpenAIRE

    Gillard, Ross; Snell, Carolyn Jane; Bevan, Mark Alistair

    2017-01-01

    The concept of energy justice is increasingly relevant in industrialised countries, where policymakers face significant challenges to establishing affordable, low-carbon and secure energy systems. This emerging field has brought philosophies of ethics and principles of social justice to bear on a range of contemporary energy issues. More inter-disciplinary and applied endeavours are now needed to take this field forward. One such application is to the issue of fuel poverty and the challenge o...

  16. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.

    2016-01-01

    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  17. Domestic Violence

    Science.gov (United States)

    Domestic violence is a type of abuse. It usually involves a spouse or partner, but it can also ... a child, elderly relative, or other family member. Domestic violence may include Physical violence that can lead to ...

  18. Domestic violence

    OpenAIRE

    Tačík, Michal

    2015-01-01

    Domestic violence The present thesis deals with the phenomenon of domestic violence, from the substantive, procedural and criminological aspects. The first part defines the specifics of domestic violence, its signs and forms. It shows a typology of victims and perpetrators. It analyzes in detail the basic facts of the crimes that are the most commonly perpetrated forms of domestic violence. It also describes the sanctions and some of the treatment programs that are available for perpetrators ...

  19. [Evolution of salaries and the price of food and domestic fuels in the city of La Paz (1975-1985)].

    Science.gov (United States)

    Laure, J

    1987-03-01

    An analysis was performed on the variations of the food purchasing power of the average industry wage during the period comprised between 1975 and 1984 (increase of 7%), and of the minimum wage between November 1982 and August 1985 (decline of 73%). Development of retail prices in La Paz, for the main food groups, beverages and fuels, was analyzed over the same periods. Variations in work time, paid at average industry wage or at minimum wage, needed to acquire such foodstuffs, beverages or fuels, were also carefully studied. Similarly, development of the cost of calories and proteins was examined. Trends in accessibility of calories and proteins are described. Between 1975 and 1984 these included: a progressive decline in the number of foods that are sources of "cheap" or "very cheap" calories; the same trend was observed with regard to foods which are sources of "cheap" or "very cheap" proteins: A decline in their number and even the disappearance of any source of "very cheap" proteins, and an ever-increasing dependence on agro-industry and foreign imports (notably wheat). Finally, some proposals are made for the purpose of contributing to the establishment of food and nutrition planning. In particular, suggestion is made to automatically reevaluate the minimum wage on the basis of monetary inflation, in order to maintain at least the food purchasing power of the minimum wage. Maintaining this purchasing power greatly determines the nutritional status of the wage-earning population which purchases the most essential foodstuffs.

  20. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

    Science.gov (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

    2010-01-01

    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  1. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  2. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.

    2018-01-01

    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  3. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  4. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  5. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan

    2014-08-01

    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  6. First performance assessment of blends of jatropha, palm oil and soya bean biodiesel with kerosene as fuel for domestic purposes in rural-Ghana

    Energy Technology Data Exchange (ETDEWEB)

    Quansah, E.; Preko, K.; Amekudzi, L.K. [Department of Physics, Kwame Nkrumah, University of Science and Technology (KNUST), University Post Office, PMB Kumasi (Ghana)

    2011-07-01

    Performance assessments of jatropha, palm oil and soya bean based biodiesel were carried out to investigate their potential use as conventional substitute for kerosene for domestic purposes in rural- Ghana. The assessments were done by comparing some of the combustion characteristics of blends of the biodiesel with kerosene. The blends were categorised as B100 (100% biodiesel), B80 (80% biodiesel and 20% kerosene), B60 (60% biodiesel and 40% kerosene), B40 (40% biodiesel and 60% kerosene), B20 (20% biodiesel and 80% kerosene) and B0 (pure kerosene). The results showed that the calorific values of the B100s were less than that of the B0 and decreasing in the order of jatropha, soya bean and palm oil. The wick wastage results for both the B100s and B0, revealed higher rates in the WTL than the BB even though the BB recorded low fuel consumption rates than the WTL for both B100s and B0. Similarly, the luminous intensity test with the B100s showed low values in WTL than the BB in a decreasing order of jatropha, soya bean and palm oil. However, B0 recorded higher luminous intensity values that were quite comparable in both WTL and BB.

  7. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia.

    Science.gov (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali

    2008-06-30

    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  8. Understanding the Influence of the Pakistani Government in South Asia

    Science.gov (United States)

    2010-11-01

    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  9. Factors Affecting job satisfaction of employees in Pakistani banking sector

    OpenAIRE

    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

    2010-01-01

    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

  10. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    OpenAIRE

    Syeda Bushra Zaidi

    2016-01-01

    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  11. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  12. LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

    Directory of Open Access Journals (Sweden)

    Muhammad Usman

    2014-12-01

    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  13. Domestic violence

    OpenAIRE

    Kiurski Jasmina

    2003-01-01

    Since the 1960s, there has been growing awareness regarding the issue of domestic violence as a form of violence against women, which has been largely influenced by the work of feminist activist and scholars in North America and Europe (Dobash and Dobash 1992). Other terms have been used to describe the same phenomenon, including domestic abuse, spousal abuse, wife battering, marital violence, intimate partner violence. Though there is no doubt that this problem has existed for much more than...

  14. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

    Science.gov (United States)

    Ali, Zarqa S.

    2014-01-01

    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  15. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    OpenAIRE

    Summaira Naz

    2015-01-01

    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  16. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-

    2006-01-01

    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  17. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen.

    Science.gov (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes

    2017-01-20

    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  18. PAKISTANIS IN ITALY: THE DISENCHANTMENTS OF “LIVING TRANSNATIONALLY”

    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad

    2010-12-01

    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  19. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

    OpenAIRE

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-01-01

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  20. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  1. H.R. 5433: This Act may be cited as the Nuclear Fuel Utilization and Domestic Production Act of 1988. Introduced in the House of Representatives, One Hundredth Congress, Second Session, September 30, 1988

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    H.R. 5433 is a bill to assist in creating a viable domestic uranium enrichment industry, to insure the maximum economic utilization of the existing diffusion plant assets, to establish mechanisms which would permit the creation of a privately owned corporation to utilize the Federal Government's investment in centrifuge technology and in the centrifuge assets, to establish alternate sources of enrichment supply, so as to create American jobs, to return moneys to the Government and to increase American industrial competitiveness in world wide nuclear fuel sales

  2. Domestic and Foreign Banks’ Profitability: Differences and Their Determinants

    Directory of Open Access Journals (Sweden)

    Muhammad AZAM

    2012-01-01

    Full Text Available The purpose of this study to analyze and compare the profitability of domestic (Public & Private and foreign banks operating in the Pakistan Banking market between 2004 and 2010 on quarterly basis. Total 36 Commercial Banks of Pakistani Industry have represented our sample. To control for the effect of bank ownership on performance, we split the sample into three categories: (1 domestic banks with Government Control, (2 domestic banks with Private control, and (3 foreign banks. This study also finds that foreign banks are more profitable than all domestic banks regardless of their ownership structure by applying regression analysis. This may suggest that it is better for a multinational bank to establish a subsidiary/branch rather than acquiring an “existing player” in the host country. We also found that domestic and foreign banks have different profitability determinants, i.e. factors that are important in shaping domestic banks’ profitability are not necessary important for the foreign banks and vice versa. Empirical results show that foreign banks are less affected by the macroeconomic factors of the host country than domestic banks and they have a higher profitability margin in Pakistan.

  3. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

    2013-11-29

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  4. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

    2016-01-01

    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  5. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

    2013-01-01

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  6. Blueprint for domestic uranium enrichment

    International Nuclear Information System (INIS)

    1981-01-01

    The AEC advisory committee on domestic production of uranium enrichment has studied for more than a year how to achieve the domestic enrichment of uranium by the construction and operation of a commercial enriching plant using centrifugal separation method, and the report was submitted to the Atomic Energy Commission on August 18, 1980. Japan has depended wholly on overseas services for her uranium enrichment needs, but the development of domestic enrichment has been carried on in parallel. The AEC decided to construct a uranium enrichment pilot plant using centrifuges, and it has been forwarded as a national project. The plant is operated by the Power Reactor and Nuclear Fuel Development Corp. since 1979. The capacity of the plant will be raised to approximately 75 ton SWU a year. The centrifuges already operated have provided the first delivery of fuel of about 1 ton for the ATR ''Fugen''. The demand-supply balance of uranium enrichment service, the significance of the domestic enrichment of uranium, the evaluation of uranium enrichment technology, the target for domestic enrichment plan, the measures to promote domestic uranium enrichment, and the promotion of the construction of a demonstration plant are reported. (Kako, I.)

  7. Domestic energy fact file

    Energy Technology Data Exchange (ETDEWEB)

    Shorrock, L D; Henderson, G [Building Research Establishment, Watford (United Kingdom); Bown, J H.F. [NBA Tectonics, London (United Kingdom)

    1992-01-01

    The purpose of this publication to gather together in one volume some of the more important United Kingdom data on domestic energy and the measures that have been taken to improve the efficiency with which it is used. The introductory section discusses the main underlying trends affecting domestic energy use. It is followed by six main sections: Section 1 deals with fuel prices and household expenditure on energy. Section 2 is concerned with basic statistics on population, households and the housing stock (age, tenure, dwelling type and regional distribution). Section 3 presents information on the uptake of insulation measures in the housing stock. Section 4 presents information on changes to the housing stock heat loss, heating systems, temperatures and energy use. This section looks at what would have happened to the energy use of the housing stock if energy efficiency improvements had not been introduced. Section 4 contains the main conclusions on the effectiveness of insulation, improvements in efficiency and the rising standards of service achieved within the housing stock. Section 5 draws together the topics discussed in section 4 to illustrate the individual effects of rising levels of service, external temperature variations, improved insulation and improved heating efficiency, and how these combine to determine domestic section energy consumption. Section 6 considers the fuels used to meet the energy demand of the housing stock and the carbon dioxide emissions which result from this fuel use. The primary energy consumption associated with the energy delivered to the housing stock is also addressed in this section. A final energy balance diagram draws together the various topics discussed in the report by showing the main energy flows related to the housing stock. (author)

  8. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

    2012-01-01

    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  9. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K

    2017-01-01

    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  10. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

    OpenAIRE

    Saghir, Sheeba; Hyland, Lynda

    2017-01-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  11. Important TQM Implementation Contributors in Pakistani Petrochemical Sector

    Directory of Open Access Journals (Sweden)

    Yasir Latif

    2014-10-01

    Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

  12. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    Directory of Open Access Journals (Sweden)

    Syeda Bushra Zaidi

    2016-05-01

    Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

  13. Analysis of toxic metals in branded Pakistani herbal products

    International Nuclear Information System (INIS)

    Saeed, M.; Muhammad, N.; Khan, H.

    2010-01-01

    The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

  14. Statistical Analysis of Pakistani Currency Regime before and after Floatation

    Directory of Open Access Journals (Sweden)

    Shahid ALI

    2011-05-01

    Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

  15. HVDC Transmission an Outlook and Significance for Pakistani Power Sector

    Science.gov (United States)

    Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

    2018-04-01

    Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

  16. Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

    Science.gov (United States)

    Qureshi, Mustafa; Abbas, Zaigham

    2015-01-01

    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  17. Domestic cat

    Science.gov (United States)

    Diffendorfer, James E.

    2017-01-01

    The familiar domestic cat is not native to southern California and is considered an invasive spe-cies by biologists and conservation organizations. When owners abandon their cats, wild or feral populations may arise, as they have in San Diego County. Cats’ pelage color, tail length, and hair thickness vary widely, given human fascination with breeding diverse phenotypes, but all have a typical felid body with upright ears, forward-looking eyes adapted for nocturnal foraging, protractible claws, and a sinuous, flexible body. Cats allowed outdoors and feral cats kill and eat a wide variety of vertebrates such as small mammals, birds, and reptiles

  18. Domestic violence

    Directory of Open Access Journals (Sweden)

    Kiurski Jasmina

    2003-01-01

    Full Text Available In this article author examines a definition of a family, the role of a family as a social and legal institution as well as state reaction in a situation of mal function of a family. Special attention is given to a definition of a family, its protective function and criminal law in modern legal systems. Author also analyzes recent reform of our legislation firstly new criminal offence (Article 118a of the Criminal Code of Republic of Serbia - Domestic Violence - and its relation to other similar criminal offences. Finally, author gives an overview of up-to-now practice from District and Municipal Prosecutors Offices in Belgrade and suggestions for solving observed problems in implementation of this criminal offence.

  19. Rigid Basement and the Evolution of the Pakistani Convergent Margin

    Science.gov (United States)

    Haq, S. S.; Davis, D. M.

    2007-12-01

    In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

  20. Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

    Science.gov (United States)

    Mac an Ghaill, Mairtin; Haywood, Chris

    2014-01-01

    This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

  1. Coronary anomalies in Pakistani children with tetralogy of fallot

    International Nuclear Information System (INIS)

    Hussain, I.; Patel, N.

    2010-01-01

    To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

  2. Genetic characterization of different pakistani date palm varieties

    International Nuclear Information System (INIS)

    Akhtar, W.; Rashid, A.; Mahmood, T.

    2014-01-01

    Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

  3. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi

    2012-09-01

    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  4. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2003-01-01

    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  5. The prevalence of Y chromosome microdeletions in Pakistani infertile men

    Directory of Open Access Journals (Sweden)

    Rubina Tabassum Siddiqui

    2013-01-01

    Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.

  6. OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

    Directory of Open Access Journals (Sweden)

    Khan Shoaib

    2016-07-01

    Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

  7. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

    Science.gov (United States)

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-04-23

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

  8. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  9. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    Directory of Open Access Journals (Sweden)

    Summaira Naz

    2015-03-01

    Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

  10. Domestic wastewater treatment and power generation in continuous flow air-cathode stacked microbial fuel cell: Effect of series and parallel configuration.

    Science.gov (United States)

    Estrada-Arriaga, Edson Baltazar; Hernández-Romano, Jesús; García-Sánchez, Liliana; Guillén Garcés, Rosa Angélica; Bahena-Bahena, Erick Obed; Guadarrama-Pérez, Oscar; Moeller Chavez, Gabriela Eleonora

    2018-05-15

    In this study, a continuous flow stack consisting of 40 individual air-cathode MFC units was used to determine the performance of stacked MFC during domestic wastewater treatment operated with unconnected individual MFC and in series and parallel configuration. The voltages obtained from individual MFC units were of 0.08-1.1 V at open circuit voltage, while in series connection, the maximum power and current density were 2500 mW/m 2 and 500 mA/m 2 (4.9 V), respectively. In parallel connection, the maximum power and current density was 5.8 mW/m 2 and 24 mA/m 2 , respectively. When the cells were not connected to each other MFC unit, the main bacterial species found in the anode biofilms were Bacillus and Lysinibacillus. After switching from unconnected to series and parallel connections, the most abundant species in the stacked MFC were Pseudomonas aeruginosa, followed by different Bacilli classes. This study demonstrated that when the stacked MFC was switched from unconnected to series and parallel connections, the pollutants removal, performance electricity and microbial community changed significantly. Voltages drops were observed in the stacked MFC, which was mainly limited by the cathodes. These voltages loss indicated high resistances within the stacked MFC, generating a parasitic cross current. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

    Science.gov (United States)

    Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

    2015-05-01

    In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

  12. Stories of pain and health by elderly Pakistani women in Norway.

    Science.gov (United States)

    Sverre, Beate Lie; Solbrække, Kari Nyheim; Eilertsen, Grethe

    2014-11-01

    This ethnographic study investigates the stories of elderly Pakistani women living in Norway. Migration studies indicate that elderly migrant women are passive, ill victims caught in a marginalized position due to age, ethnicity and gender, and thus have little access to opposition and agency. To broaden the picture it is necessary to develop an innovative approach to understand what is implicated in the process of migration. The importance of considering life conditions that surrounds potential health promotion behaviors of immigrants is stressed by several researchers. However, up to now limited research guided by this perspective has been done in Norway. Therefore, this study explored how elderly Pakistani women in Norway promote their health and well-being through some distinct social interactions. The intention is to bring awareness to how health, even by so-called disadvantaged social groups, may take place. These practices are important to take into consideration when developing health-promoting policies for elderly immigrants. An ethnographic study of 15 Pakistani women, aged 53-75, was carried out in a multisided fieldwork in Oslo using participant observation and ethnographic interviews. The analytical approach was inspired by the constructivist theoretical framework of narrative ethnography. The elderly Pakistani women in Norway construct stories of living in-between cultures and experiences of acculturative stress caused by being elderly, immigrants and women. However, this analysis also suggests that through distinct social relationships, primarily in the context of a voluntary organization, elderly Pakistani women do health by the way they interact and construct a repertoire of social identities. The healing practices taking place among elderly Pakistani women may counteract the negative health outcomes associated with age, migration and gender implications for immigrant health-promoting policy in Norway may be to increase the establishment and

  13. Model Estimates Of Gross Domestic Product In Relation to Export And Import Of Fuels, Focused on the Elasticity and Determination Of Directly and Indirectly Associated Rates

    Directory of Open Access Journals (Sweden)

    Gheorghe Săvoiu

    2016-03-01

    Full Text Available The article is based on several interrogative assumptions related to the positive impact of the crises and the recession on determinations in the econometric models of Romania’s GDP as a variable dependent in relation to the export and import of fuels. After a short introductory section, which details, in a relative manner, the overall goal and the objectives of the paper, a first section makes use of elasticity and the modern solutions of building the coefficient of elasticity, proposing an original alternative to existing variants, and afterwards the next section builds on these statistical tools in the econometric modeling of Romania’s GDP, starting from the ratios and value indicators and offering a few original models where the export and import of fuels are the key initial explanatory factors. The final remarks reinterpret the role of the energy resources, as well as that of the related flows, in enhancing statistical connections, and especially the role of crises and recessions in validating econometric models, by raising their degree of predictability.

  14. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  15. Evaluation of genetic diversity in different Pakistani wheat land races

    International Nuclear Information System (INIS)

    Mahmood, T.; Siddiqua, A.; Rasheed, A.; Nazar, N.

    2011-01-01

    Wheat is one of the main sources of nutrition worldwide. Genetic improvement of the seed makes wheat a source of high quality flour for human consumption and for other industrial uses. With the help of molecular markers, the available germplasm of wheat can be assessed for future breeding programs. Therefore, the aim of the present work was to analyze the genetic diversity among 15 Pakistani wheat land races based on Random Amplified Polymorphism DNA (RAPD) markers. A total of 284 DNA fragments were amplified, ranging in size from 200bp to 1100bp by using six primers. The number of DNA fragments for each primer varied from 2 (OPC-6) to 9 (OPC-8) with an average of 6 fragments per primer. Out of 284 amplified products, 120 were monomorphic and 137 were polymorphic showing an average of 7.8% polymorphism per primer. One specific marker was detected both for OPC-1 and OPC-8, two for OPC-5, while no RAPD specific marker was detected for the remaining primers. The genetic similarity index values ranged from 0.36 to 0.93, with an average of 0.64. Maximum genetic similarity (91%) was observed between Sur bej and Khushkawa. On the contrary, minimum genetic similarity (32%) was observed in Khushkaba-1 and Khushkawa. The dendrogram resulting from the NTSYS cluster analysis showed that the studied genotypes are divided into two main clusters from the same node. The first cluster contained 13 land races, while the second cluster contained only 2 land races. The dendrogram clustered the genotypes into 5 groups and showed efficiency in identifying genetic variability. These results indicated the usefulness of RAPD technique in estimating the genetic diversity among wheat genetic resources. (author)

  16. Cultural perceptions and the productive roles of rural Pakistani women.

    Science.gov (United States)

    Ibraz, T S

    1992-01-01

    The roles of rural Pakistani women in agricultural production are described with numerous examples from a village study by Anwar and Bilquees, and the author's research in a Punjabi village (Rajpur) to show cultural perceptions of women and their work, and the nature of productive activities inside the house and outside on the farm. The cultural perceptions are related to the image of women as dependent/private wives and mothers. A broad definition of production is used to include activities, such as churning milk which generates income and saves expenditures and making butter which fulfills household needs and is sold in the market for cash. Rajpur is a village engaged in social change. Men seek work outside the villages, and women take on work previously assumed by men. Women contribute considerably to the year-round production and processing of major crops. The productive labor of women by major crop type and activity type are described and charted. Tending livestock is performed exclusively by men. Handicraft activity at home reduces expenditure for buying these items in the local markets. Most women were unaware of the savings and "indirect" income their work contributed to the household. Work for wages is viewed as men's work. Women's mobility beyond the fields and home is still limited; market activity must be conducted with a male present and women do not earn cash. The division of labor is conceived by men for women because of women's cultural identity. Women are perceived as "chase daughters/sisters, fertile wives, and nurturing mothers." There are punishments or social rewards for proper behavior. Women in their private domain are expected to "look good within the house," which is viewed as a feminine world. The outside world is masculine. Women are also seen as lacking reasoning ability and their motherhood roles limit their capability to cope with external affairs. There is great value attached to the invisibility of women physically, socially, and

  17. Pakistani medical students' specialty preference and the influencing factors.

    Science.gov (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

    2011-07-01

    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  18. Domestic Waste: Sources, Effects, and Management

    International Nuclear Information System (INIS)

    Saad, A.; Hegazi, N.

    1999-01-01

    Waste is any discarded material. Domestic wastes are those produced by individual activities. In common with other living organisms, humans discharge waste substances to the environment that in turn re-energize the endless cycle of nature. Human activities are closely associated with ambient environment (soil , water, or air) through accumulation of domestic waste. Such household hazardous waste deposit arise from the discharge of domestic activities in the form of municipal solid waste (household, commercial and public street wastes), night soil (human and animal body wastes, excreta, or excrement). In rural areas, night soil is one of several components of the refuse that pollute the land. The surface water may be also directly polluted by domestic wastes or agricultural wastes. But in urbanized areas, household wastes, bathroom and laundry are conveniently flushed away by water as domestic wastewater through sewerage system, and disposed onto land or into receiving water, or in some countries it is treated and re-discharged for domestic usage. Solid waste in the form of kitchen garbage and other household refuse is collected for landfill disposal or for re-industrialization. Many domestic waste influence indoor air quality in urban and rural areas as for example the fuel used for cooking, smoke from cooking and from smoking habits, modern building materials, insulation, fabrics and furniture, cleaning materials, solvents, pesticides, personal care products, organic material or vegetable origin and dander from domestic life

  19. Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

    Science.gov (United States)

    Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

    2015-01-01

    The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

  20. Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2016-01-01

    The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

  1. Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

    Science.gov (United States)

    Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

    2015-01-01

    Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

  2. Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Claussen Bjorgulf

    2006-06-01

    Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

  3. Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2007-01-01

    Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

  4. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  5. Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

    Science.gov (United States)

    Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

    2011-01-01

    Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

  6. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  7. Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

    Science.gov (United States)

    Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

    2011-01-01

    This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

  8. Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

    OpenAIRE

    Shakari, Yasmine

    2013-01-01

    Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

  9. Spent fuels program

    International Nuclear Information System (INIS)

    Shappert, L.B.

    1983-01-01

    The goal of this task is to support the Domestic Spent Fuel Storage Program through studies involving the transport of spent fuel. A catalog was developed to provide authoritative, timely, and accessible transportation information for persons involved in the transport of irradiated reactor fuel. The catalog, drafted and submitted to the Transportation Technology Center, Sandia National Laboratories, for their review and approval, covers such topics as federal, state, and local regulations, spent fuel characteristics, cask characteristics, transportation costs, and emergency response information

  10. Report of the Subcommittee on Domestic Uranium Enrichment

    International Nuclear Information System (INIS)

    1981-01-01

    A report by the Subcommittee on Domestic Uranium Enrichment to the Atomic Energy Commission is described; which covers the procedure of the domestic uranium enrichment by centrifugal process up to the commercial production, reviewing the current situation in this field. Domestic uranium enrichment is important in the aspects of securing stable enrichment service, establishing sound fuel cycle, and others. As the future target, the production around the year 2000 is set at 3,000 tons SWU per year at least. The business of uranium enrichment, which is now developed in the Power Reactor and Nuclear Fuel Development Corporation, is to be carried out by private enterprise. The contents are as follows: demand and supply balance of uranium enrichment service, significance of domestic uranium enrichment, evaluation of centrifugal uranium enrichment technology, the target of domestic uranium enrichment, the policy of domestic uranium enrichment promotion. (J.P.N.)

  11. She stands alone: Pakistani woman film director, Shireen Pasha.

    Science.gov (United States)

    Mustafa, A

    1995-01-01

    This article describes the activities of film director Shireen Pasha in promoting truth in the mass media in Pakistan. Pasha is described as one who finds it inexcusable in a state-subsidized system that national problems of poverty are not aired openly. Pasha has pursued the goal of exposing the real lives of Pakistanis on film in contrast to the publicly aired segments of "pretty girls in nice drawing rooms." Foreign channels available through satellite communications technology are viewed by Pasha as inappropriate with regard to people's needs and uncreative. Pakistan began with one channel, PTV, which recently refused to air her documentary on living conditions in Pakistan's rural areas "The Travelogue Pakistan." "The Walled City of Lahore" was her film about life in the old city. Both films poetically depicted the honor of humans and their struggle to stay alive. Some of her documentaries are made to show the value of indigenous skills, centuries old know-how, and traditions, regardless of the poverty. Pasha is described as fighting with PTV management over use of resources. Pasha desires to invest in training people to do documentaries or be more field-oriented rather than investing in equipment. Pasha joined PTV in 1975 and left in 1990. Pasha is recognized for her isolation as a woman in the business world, her commitment to exposing remote cultures and truth, and the odds she must confront in attaining her goals. Pasha is committed to doing extensive research, usually conducted during the summer months, in order to construct a credible story line that is produced usually during the winter months. One model of film story line is defined as one where women are portrayed as starting from an indigenous skill or knowledge and shifting to a greater position of power and control over their lives. Pasha believes that people who make films have the responsibility to evoke a reaction in people and to offer solutions. Two acclaimed films, which were supported by

  12. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

    Science.gov (United States)

    Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

    2006-07-10

    In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

  13. British-Pakistani women's perspectives of diabetes self-management: the role of identity.

    Science.gov (United States)

    Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

    2015-09-01

    To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

  14. Domestic Violence - Multiple Languages

    Science.gov (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Domestic Violence URL of this page: https://medlineplus.gov/languages/ ... V W XYZ List of All Topics All Domestic Violence - Multiple Languages To use the sharing features on ...

  15. Azolla domestication towards a biobased economy?

    NARCIS (Netherlands)

    Brouwer, Paul; Brautigam, A.; Kulahoglu, C.; Tazelaar, A.O.E.; Kurz, S.; Nierop, K.G.J.; Werf, van der A.K.; Weber, A.P.M.; Schluepmann, H.

    2014-01-01

    Due to its phenomenal growth requiring neither nitrogen fertilizer nor arable land and its biomass composition, the mosquito fern Azolla is a candidate crop to yield food, fuels and chemicals sustainably. To advance Azolla domestication, we research its dissemination, storage and transcriptome.

  16. Azolla domestication towards a biobased economy?

    NARCIS (Netherlands)

    Brouwer, Paul; Bräutigam, A.; Külahoglu, C.; Tazelaar, A.O.E.; Kurz, S.; Nierop, K.G.J.; van der Werf, A.; Weber, A.P.M.; Schlupmann, Henriette

    Due to its phenomenal growth requiring neither nitrogen fertilizer nor arable land and its biomass composition, the mosquito fern Azolla is a candidate crop to yield food, fuels and chemicals sustainably. To advance Azolla domestication, we research its dissemination, storage and transcriptome.

  17. FY 1999 Report on results of development of high-efficiency energy system technologies for transportation and domestic use. R and D of polymer electrolyte fuel cells, power system technologies, and several kW class domestic power systems operating at normal pressure; 1999 nendo un'yu minseiyo kokoritsu energy system gijutsu kaihatsu, kotai kobunshigata nenryo denchi no kenkyu kaihatsu, hatsuden system gijutsu kaihatsu, joatsu sadogata su kW kyu kateiyo dengen system no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Described herein are the FY 1999 results of the research and development project aimed at development of fuel cell systems for power source systems suitable for domestic use. The programs for development of fuel cell body include improvement of the anode forming method for increasing its CO tolerance, enhancing cell performance at 0.5mg-metal/cm{sup 2} as the catalyst quantity to a level almost comparable to that obtainable at 0.9mg-metal/cm{sup 2}. The programs for development of the fuel supply system include studies on endurance of the elements, e.g., starting-up/shutting-down of the Ru/Al{sub 2}O{sub 3} catalyst, using a microreactor, confirming that it is serviceable for at least 1,000 hours. The natural gas reformer is developed and operated, on a trial basis, achieving stable supply of steam and fuel, and thermal efficiency of 82.7%. The operation researches include development and operation of a 1kW class module, achieving the performance surpassing the FY 1999 targets (average cell voltage: 0.70V, output: 1.27kW) with a simulated reformate gas at an air utilization rate of 20% and current density of 0.3A/cm{sup 2}. (NEDO)

  18. Nuclear fuel

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, H [Power Reactor and Nuclear Fuel Development Corp., Tokyo (Japan)

    1976-10-01

    It is expected that nuclear power generation will reach 49 million kW in 1985 and 129 million kW in 1995, and the nuclear fuel having to be supplied and processed will increase in proportion to these values. The technical problems concerning nuclear fuel are presented on the basis of the balance between the benefit for human beings and the burden on the human beings. Recently, especially the downstream of nuclear fuel attracts public attention. Enriched uranium as the raw material for light water reactor fuel is almost monopolized by the U.S., and the technical information has not been published for fear of the diversion to nuclear weapons. In this paper, the present situations of uranium enrichment, fuel fabrication, transportation, reprocessing and waste disposal and the future problems are described according to the path of nuclear fuel cycle. The demand and supply of enriched uranium in Japan will be balanced up to about 1988, but afterwards, the supply must rely upon the early establishment of the domestic technology by centrifugal separation method. No problem remains in the fabrication of light water reactor fuel, but for the fabrication of mixed oxide fuel, the mechanization of the production facility and labor saving are necessary. The solution of the capital risk for the construction of the second reprocessing plant is the main problem. Japan must develop waste disposal techniques with all-out efforts.

  19. Access to Power: Governance and Development in the Pakistani Electrical Power Sector

    Science.gov (United States)

    Naqvi, Ijlal

    This dissertation explores governance in Pakistan through a study of the state-run electrical power sector. At both the micro and macro level, the Pakistani power sector provides a lens into the heart of the Pakistani state and its governance institutions. This ethnographic and historical study offers an in-depth look at state operations in a developing country, situates the current Pakistani power crisis in a larger context of continuity through periods of dictatorship and democracy, and suggests how efforts to make state service delivery more responsive to citizens might be reconceived. A historical review of the Pakistani power sector establishes first and foremost that the current crisis is the product of longer-term processes for which the policy solutions currently being proposed (with the support of international donors and multilateral lenders) are inadequate. Depoliticized attempts at power sector reform have little to offer in light of the pervasively informal and negotiated nature of the fragmented Pakistani state. The institutions of power sector governance are mutually constituted by the formal rules and the informal---personal relationships, language, violence, money, and power. These rules of the game are as relevant to relations within and between public sector organizations as they are to the engagement of citizens with their state. The same rules apply at the margins of the state---informal squatter settlements---as at the core, though the resources brought to bear and the resultant outcomes are different. The internal incoherence of this state underscores the limitations of formal rules in determining outcomes, and the poor prospects for reform efforts that focus exclusively on the formal aspects of governance. To proactively engage with the question of political will leads away from top-down policy perspectives and counter to the depoliticizing tendencies that currently shape policy reforms. Instead, an energized and informed local participation

  20. Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

    Directory of Open Access Journals (Sweden)

    Abdul Haque

    2011-01-01

    Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

  1. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

    Science.gov (United States)

    Saghir, Sheeba; Hyland, Lynda

    2017-07-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

  2. Social and cultural construction of obesity among Pakistani Muslim women in North West England.

    Science.gov (United States)

    Ludwig, Alison F; Cox, Peter; Ellahi, Basma

    2011-10-01

    The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

  3. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

    Science.gov (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

    2017-10-01

    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  4. HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Naqi, N.; Ahmed, T.A.; Bashir, M.M.

    2011-01-01

    Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

  5. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

    OpenAIRE

    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

    2013-01-01

    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  6. Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

    Directory of Open Access Journals (Sweden)

    Barton Pelham M

    2011-06-01

    Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

  7. Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

    Directory of Open Access Journals (Sweden)

    IRFAN UL HASAN

    Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

  8. Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

    Science.gov (United States)

    Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

    2013-01-01

    Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

  9. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Hussain Akthar

    2006-07-01

    Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

  10. Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

    Science.gov (United States)

    Mythen, Gabe

    2012-09-01

    Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

  11. Criminal aspects domestic violence

    OpenAIRE

    Smetanová, Kristina

    2013-01-01

    Smetanová, Kristina. Criminal aspects of domestic violence The topic of this thesis is the criminal aspects of domestic violence. The aim of the thesis is to describe this dangerous and complicated social problem and focus on outlining the possibilities of protection under Czech criminal law. The thesis consists of eight chapters. The first chapter explains what the domestic violence is and which sources, types and characters does it have.The second chapter shows who can be the violent person...

  12. Domestic violence : evidence review.

    OpenAIRE

    Westmarland, Nicole; Thorlby, Katie; Wistow, Jane; Gadd, David

    2014-01-01

    While domestic violence is high on the public policy agenda in the UK, successive reviews have highlighted policing problems. A recent HMIC report found domestic violence is not policed at the same level as other offences and identified a catalogue of policing failures that have a long history of recurrence. With domestic violence accounting for around a large proportion of violent crime incidents reported to the police, and the majority of all female homicides (Office for National Statistics...

  13. Physicians and domestic violence

    OpenAIRE

    Joslin, Jonathan

    1994-01-01

    Domestic violence, spouse abuse, and battering all refer to the victimization of a person with whom the abuser has or has had an intimate relationship. Domestic violence may take the form of physical, sexual and psychological abuse, is generally repeated, and often escalates within relationships. Most evidence indicates that domestic violence is predominantly perpetrated by men against women. Some evidence suggests that women are just as likely to use violence against male partners as men are...

  14. Domestic violence against children

    OpenAIRE

    Mihić Biljana D.

    2002-01-01

    In this paper the author is analysing definitions and basic notions related to domestic violence against children, as one of the most serious forms of violence. The special chapter deals with effects of violence against children and causes of domestic violence against them. Also, the author is analysing different forms of social reaction and considering the problem of legal regulation of mandatory reporting domestic violence against children.

  15. De-domestication

    DEFF Research Database (Denmark)

    Gamborg, Christian; Gemmen, Bart; Christiansen, Stine Billeschou

    2010-01-01

    as wild or non-wild and the effect this has on questions about how they should be treated. It also concerns the value of nature, and the kind and degree of nature management considered appropriate. The paper first describes actual de-domestication practices and considers the character of human duties...... to animals in process of de-domestication. Secondly, the paper explores the implications of de-domestication for nature management, focusing on notions of naturalness and wildness. Finally, because the current division of ethical topics, with its dependence upon whether animals and nature are domesticated...

  16. Different sex ratios of children born to Indian and Pakistani immigrants in Norway

    Directory of Open Access Journals (Sweden)

    Brekke Torkel

    2010-08-01

    Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

  17. 76 FR 15855 - Denial of Petitions for Reconsideration of Regulation of Fuels and Fuel Additives: Changes to...

    Science.gov (United States)

    2011-03-22

    ... Petitions for Reconsideration of Regulation of Fuels and Fuel Additives: Changes to Renewable Fuel Standard..., published on March 26, 2010 (75 FR 14670), which amended the Renewable Fuel Standard Program pursuant to... renewable fuels to verify domestic crops and crop residues used to produce the renewable fuels complied with...

  18. A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

    Science.gov (United States)

    Chaudhry, N; Husain, N; Tomenson, B; Creed, F

    2012-06-01

    The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

  19. Comparative emissions from Pakistani coals and traditional coals

    Energy Technology Data Exchange (ETDEWEB)

    Du, Y X [Guangzhou Medical College (China). Dept. of Hygiene; Huang, L F [Guangzhou Health and Anti-epidemic Station (China)

    1994-12-31

    Briquette coal has been widely used for domestic cooking and heating in many Chinese cites over the last two decades. To determine whether burning briquette coal contributes significantly to indoor air pollution, a study was performed in cities-of Southern China in which the measured levels of SO{sub 2}, NO{sub x}, TSP, SD, B(a)P in the kitchens of coal burning families were compared with levels obtained in families using gas. Significantly higher contentions of these pollutants, whose peaks correlated with daily cooking episodes, were detected in coal burning families. The levels of TSP and B(a)P were further found to be dependent on cooking methods, with deep frying and stir-frying of meat generating the most indoor TSP and B(a)P. Briquette coal burning was found to be the source of B(a)P contamination in food. A higher incidence of chronic pharyngitis as well as a suppressed salivary bacteriolytic enzyme activity were found in children of coal burning families. Epidemiologic and laboratory studies also show a close association between coal burning and the incidence of lung cancer in females. (author)

  20. Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

    Science.gov (United States)

    Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

    2007-01-01

    Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

  1. A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-04-11

    Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  2. Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2014-01-01

    The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

  3. Demand Response on domestic thermostatically controlled loads

    DEFF Research Database (Denmark)

    Lakshmanan, Venkatachalam

    . For a safe and reliable operation of electric power systems, the balance between electricity generation and consumption has to be maintained. The conventional fossil fuel based power generation achieves this balance by adjusting the generation to follow the consumption. In the electric power system......Electricity has become an inevitable part of human life in present day world. In the past two centuries, the electric power system has undergone a lot of changes. Due to the awareness about the adverse impact of the fossil fuels, the power industry is adopting green and sustainable energy sources....... In general, the electricity consumers are classified as industrial, commercial and domestic. In this dissertation, only the thermostatically controlled loads (TCLs) in the domestic segment are considered for the demand response study. The study is funded by Danish Council for Strategic Research (DCSR...

  4. Narratives of Domestic Violence

    OpenAIRE

    Hunter, Rosemary

    2006-01-01

    Second wave feminists in Australia brought the social issue of domestic violence out of the suburban shadows and into the activist and policy spotlight in the 1970s. Subsequent feminist-inspired law reforms around domestic violence included the introduction of state domestic violence order regimes in the 1980s, and amendments to the Family Law Act 1975 (Cth) in 1995 to specify family violence as one of the matters to be taken into account by the Family Court in\\ud determining the best interes...

  5. Electric wiring domestic

    CERN Document Server

    Coker, A J

    1992-01-01

    Electric Wiring: Domestic, Tenth Edition, is a clear and reliable guide to the practical aspects of domestic electric wiring. Intended for electrical contractors, installation engineers, wiremen and students, its aim is to provide essential up to date information on modern methods and materials in a simple, clear, and concise manner. The main changes in this edition are those necessary to bring the work into line with the 16th Edition of the Regulations for Electrical Installations issued by the Institution of Electrical Engineers. The book begins by introducing the basic features of domestic

  6. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  7. Domestic Communication Satellites

    Science.gov (United States)

    Horowitz, Andrew

    1974-01-01

    A discussion of the Federal Communications Commission's new policy on domestic satellites in light of our 1) military and economic history; 2) corporate interests; 3) citizen surveillance; and 4) media control. (HB)

  8. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    OpenAIRE

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

  9. Evaluating Domestic Violence Initiatives

    OpenAIRE

    Parmar, Alpa; Sampson, Alice

    2006-01-01

    This paper critiques the approach of identifying ‘best practice’ projects and discusses the problem with simply transferring projects into different contexts. The argument is illustrated by explaining the evaluation process of three domestic violence projects which all had the same aim, which was to reduce domestic violence. The evaluated projects all delivered advocacy programmes and were located in disadvantaged areas in the United Kingdom. A more suitable evaluation approach is proposed wh...

  10. Domestic abuse and the duties of physicians: a case report.

    Science.gov (United States)

    Hossain, Nazli; Khan, Sharmeen

    2015-01-01

    Domestic violence against women is a global issue. An earlier report from the Centers for Disease Control and Prevention (CDC), USA, reported that injury caused by domestic violence was the second most common cause of death during pregnancy and in the postpartum period (1). The pregnancy-associated homicide ratio was found to be 1.7 per 100,000 deliveries and firearms were identified as the main source of injury. Domestic violence is more common in developing countries than in the developed world, and rural areas are worse affected than urban ones. The risk factors associated with intimate partner violence include husbands being unemloyed, belonging to a lower socioeconomic group, poor educational status, and alcohol and substance abuse. In a hospital-based study of 500 women, around 12.6% reported physical abuse by their spouses in index pregnancy (2). In another hospital-based study in which women were interviewed during the postpartum period, 23% reported physical abuse during index pregnancy (3). Death as a result of violence is not a new phenomenon. In 1994 the Human Rights Commission of Pakistan reported 372 cases of domestic violence, due to which around 274 women died during an 8-month period. According to a report for the year 2012-13 around 389 cases of domestic violence were reported in the Pakistani media that year. The same report states that in 2013, more than 800 women committed suicide due to domestic violence. In 2013, the Provincial Assembly of Sindh, Pakistan, passed The Domestic Violence (Prevention and Protection) Bill, 2013, which imposes a fine of Rs 20,000 for violent offences against women. Such bills have not been passed in other provincial assemblies of the country. Other countries in South Asia (India, Nepal, Bangladesh, the Maldives, Sri Lanka and Afghanistan) have national laws which make provision for extending medical assistance to women who have suffered domestic violence (4). However, a lot remains to be done to translate these

  11. House of Commons No 2027. Proposal of law aiming at applying the reduced AVT rate to the selling and delivery of electricity, gas and fuel oil for domestic space heating use

    International Nuclear Information System (INIS)

    Nicolin, Y.

    2005-01-01

    The aim of this proposal is to apply the same 5.5% reduced added value tax to all energy sources when used for domestic space heating. This reduce tax rate is today only applied to wood wastes and products. (J.S.)

  12. Know Your Rights: Domestic Violence

    Science.gov (United States)

    ... 3224 TTD You CAN do something about domestic violence Domestic violence is a pattern of many behaviors directed ... violence. Look in the Yellow Pages under “domestic violence help,” “domestic violence shelters,” “human services organizations,” or “crisis intervention” ...

  13. Preliminary evaluation of fuel oil produced from pyrolysis of waste ...

    African Journals Online (AJOL)

    It could be refined further to produce domestic kerosene and gasoline. The physical and structural properties of the fuel oil produced compared favorably with that of Aviation fuel JP-4 (a wide-cut US Air force fuel). Presently African countries are importing aviation fuels. The fuel oil produced from the pyrolysis of waste water ...

  14. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    Science.gov (United States)

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

  15. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  16. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  17. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad

    2014-06-01

    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  18. Molecular and clinical studies of X-linked deafness among Pakistani families.

    Science.gov (United States)

    Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

    2011-07-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

  19. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.

    2015-01-01

    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  20. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    Energy Technology Data Exchange (ETDEWEB)

    Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

    2011-06-15

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  1. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    International Nuclear Information System (INIS)

    Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

    2011-01-01

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  2. Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

    Science.gov (United States)

    Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

    2015-01-01

    Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

  3. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  4. Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2010-11-01

    To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

  5. Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

    Science.gov (United States)

    Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

    2017-07-01

    Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

  6. Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

    Directory of Open Access Journals (Sweden)

    Jaworek Thomas J

    2012-06-01

    Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

  7. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

    Science.gov (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

    2014-01-01

    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  8. "Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

    Science.gov (United States)

    Ghaffar-Kucher, Ameena

    2015-01-01

    Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

  9. Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

    NARCIS (Netherlands)

    Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

    Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

  10. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  11. A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

    NARCIS (Netherlands)

    Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

    2014-01-01

    With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

  12. Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

    Science.gov (United States)

    Nauman, Sarwat; Hussain, Nasreen

    2017-01-01

    Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

  13. A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

    Science.gov (United States)

    Khurshid, Ayesha

    2012-01-01

    Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

  14. When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

    OpenAIRE

    Marwah, Ane Frislid Sveinhaug

    2008-01-01

    This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

  15. The burden of domestication

    DEFF Research Database (Denmark)

    Sandøe, Peter; Nørspang, Annika Patursson; Forkman, Björn

    2017-01-01

    The way in which domestic cats are kept and bred has changed dramatically over the last two centuries. Notably, a significant number of cats are kept indoors, most of them are neutered and many are selectively bred. This likely has consequences for their welfare. A few studies link housing, neuter......; that a smaller proportion of the free-roaming cats suffered from the behavioural problems investigated; and that entire cats had significantly more behavioural problems than neutered cats. Finally, significantly more purebred cats than domestic shorthair cats were found to have diseases. Being confined, being...

  16. Oil palm: domestication achieved?

    NARCIS (Netherlands)

    Gerritsma, W.; Wessel, M.

    1997-01-01

    The natural habitat of the oil palm comprises very wet and relatively dry niches in the lowland rain forest in West and Central Africa. The domestication of the oil palm started with the extraction of fruits from wild forest resources. When forests were cleared for shifting cultivation, oil palms

  17. Dominance in domestic dogs

    NARCIS (Netherlands)

    Borg, Van Der J.A.M.; Schilder, M.B.H.; Vinke, C.M.; Vries, De Han; Petit, Odile

    2015-01-01

    A dominance hierarchy is an important feature of the social organisation of group living animals. Although formal and/or agonistic dominance has been found in captive wolves and free-ranging dogs, applicability of the dominance concept in domestic dogs is highly debated, and quantitative data are

  18. Signs of domestic abuse.

    Science.gov (United States)

    Pearce, Lynne

    2017-07-13

    Essential facts The government's definition of domestic violence and abuse, published in 2016 by the Home Office, is: 'Any incident or pattern of incidents of controlling, coercive, threatening behaviour, violence or abuse between those 16 years or over who are, or have been, intimate partners or family members, regardless of gender or sexuality.'

  19. Unemployment and domestic violence

    OpenAIRE

    Dan Anderberg; Helmut Rainer; Jonathan Wadsworth; Tanya Wilson

    2014-01-01

    Contrary to popular belief, the incidence of domestic violence in Britain does not seem to have risen during the recession. But according to research by Jonathan Wadsworth and colleagues, men and women have experienced different risks of unemployment - and these have had contrasting effects on the level of physical abuse.

  20. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  1. Hydrogen system (hydrogen fuels feasibility)

    International Nuclear Information System (INIS)

    Guarna, S.

    1991-07-01

    This feasibility study on the production and use of hydrogen fuels for industry and domestic purposes includes the following aspects: physical and chemical properties of hydrogen; production methods steam reforming of natural gas, hydrolysis of water; liquid and gaseous hydrogen transportation and storage (hydrogen-hydride technology); environmental impacts, safety and economics of hydrogen fuel cells for power generation and hydrogen automotive fuels; relevant international research programs

  2. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  3. Domestic wastewater treatment using multi-electrode continuous flow MFCs with a separator electrode assembly design

    KAUST Repository

    Ahn, Yongtae; Logan, Bruce E.

    2012-01-01

    Treatment of domestic wastewater using microbial fuel cells (MFCs) will require reactors with multiple electrodes, but this presents unique challenges under continuous flow conditions due to large changes in the chemical oxygen demand (COD

  4. Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

    Directory of Open Access Journals (Sweden)

    Habib Hussain Khan

    2017-06-01

    Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

  5. STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

    Directory of Open Access Journals (Sweden)

    Abdul RAZIQ

    2014-10-01

    Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

  6. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

    Science.gov (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

    2015-06-01

    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  7. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2011-06-01

    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  8. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  9. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    International Nuclear Information System (INIS)

    Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

    2010-01-01

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  10. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  11. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

    2010-04-15

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  12. Visual representation of gender in flood coverage of Pakistani print media

    Directory of Open Access Journals (Sweden)

    Zarqa S. Ali

    2014-08-01

    Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

  13. Patient perspectives on type 2 diabetes and medicine use during Ramadan among Pakistanis in Denmark

    DEFF Research Database (Denmark)

    Mygind, Anna; Kristiansen, Maria; Wittrup, Inge

    2013-01-01

    of Ramadan without adequate counselling on how to adjust their medicines. Objective To explore patient perspectives on medicine use during Ramadan, reasons for fasting and experiences with counselling on medicine use during Ramadan among people of Pakistani background with type 2 diabetes and at least one...... (six interviewers). Results All interviewees pointed out that Islam allows ill people to refrain from fasting during Ramadan. However, all had fasted during Ramadan despite being diagnosed with type 2 diabetes. While fasting, they adapted their use of medicines in different ways, e.g. by changing...... the time of intake or by skipping morning medicines. Fasting during Ramadan meant a feeling of improvement in well-being for all interviewees. Reasons for this improvement included physiological, social and religious aspects. Healthcare professionals were rarely included in the decision-making process...

  14. Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

    DEFF Research Database (Denmark)

    Andersen, Rikke; Brot, Christine; Mejborn, Heddie

    2009-01-01

    Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

  15. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  16. Criminal aspects of domestic violence

    OpenAIRE

    Váňová, Radka

    2013-01-01

    Criminal aspects of domestic violence SUMMARY Domestic violence is a serious social concern with high level of latency. The domestic violence victims protection is ensured by legal standarts of Civil, Administrative and Criminal Law and other legal standarts. Criminal Law is one of the important instruments for tackling of serious forms of domestic violence. However Criminal Law is an instrument "ultima ratio" which needs claiming of subsidiarity principal of the crime repression. The purpose...

  17. An encyclopedia on domestic electricity

    International Nuclear Information System (INIS)

    1982-12-01

    This book describes the footprint of domestic electrification with domestic energy and the role of electrification, basic knowledge on domestic electrification, the basic things electric equipment in domestic, materials, part and making, demand of electricity, electrification and life, various electric equipment in the kitchen, rationalization of house chore, environment and hygiene like electric iron, electric stove, electric mat and dining wagon, beauty treatment and health, refinement and entertainment and lighting in houses.

  18. Environmental assessment of domestic wood heating

    International Nuclear Information System (INIS)

    Labouze, E.; Le Guerin, Y.

    2009-01-01

    In France, more than 6 million families are concerned with the domestic use of wood energy. The wood energy plan of ADEME aims at encouraging the development of wood energy in three sectors: domestic, collective/tertiary, industrial. In that context, ADEME commissioned BIO Intelligence Service a life cycle assessment of collective and industrial heating in order to give objective environmental information and to analyse the strength and weakness of wood heating. Three scenarios were defined according to the origin of wood: firewood, granules and sawmill chips. The study also proposes a comparison to other heating systems: gas, fuel oil and electricity. The life cycle analysis applied to domestic heating consists in quantifying the environmental impacts of the whole linked steps: extraction of fuel, distribution, final use... Every system under study has been divided according to three main stages: - Extraction of raw materials; - Transport of fuels until the place of storage or distribution; - Use (combustion or upstream production of energy in the case of electricity). The environmental impacts are estimated with the following indicators: - Non renewable primary energy balance sheet; - Global warming potential; - Air acidification potential; - Eutrophication potential; - Emissions of toxic metals in air and in soils. The results show that wood heating have the best energy and global warming balance sheets. For air acidification, the combustion stage is pre-dominant regardless of the energy resource. This is mainly due to nitrogen and sulphur oxides airborne emissions. For wood heating, preparation requires fuel consumption which also contributes significantly to nitrogen oxides emissions. The comparison with conventional energy shows that the wood scenarios are well positioned in relation to fuel and electricity for this indicator. Gas appears to be the best heating option for this indicator. The contribution eutrophication is also due to nitrogen oxides airborne

  19. A winter survey of domestic heating among elderly patients.

    Science.gov (United States)

    Morgan, R; Blair, A; King, D

    1996-02-01

    Elderly people have a greater need for domestic heating given the time they spend at home and the decline in the body thermoregulation that occurs with ageing. The use of domestic heating by 200 mentally competent newly admitted elderly in patients was evaluated by means of a questionnaire survey. Most patients (69%) were aware of the addition of value added tax (VAT) to their fuel bill and 31% said they had reduced the amount of heating they use because of this. A third of patients (29.5%) said they had difficulty keeping warm prior to this admission. The majority of patients said they could not manage to keep warm in the winter without financial hardship. In addition, 29% said they had reduced the amount spent on food in order to pay for fuel bills. This study suggests that cold may contribute to hospital admissions in elderly patients. This should have implications for government spending and taxation policy on domestic heating.

  20. Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

    Directory of Open Access Journals (Sweden)

    Shahid Ubeera

    2011-09-01

    Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

  1. Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

    International Nuclear Information System (INIS)

    Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

    2017-01-01

    To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

  2. Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

    International Nuclear Information System (INIS)

    Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

    2017-01-01

    Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

  3. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

    Science.gov (United States)

    Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

    2012-01-01

    The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

  4. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-04-01

    Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

  5. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2014-12-01

    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  6. Potential Effects of Domestic Energy on the Health of Women ...

    African Journals Online (AJOL)

    Objective: To highlight the various potential health problems women and others exposed to gases/substances emitted from domestic sources of energy are at risk of. A review of the literature on the health problems associated with use of various forms of energy fuels was done. Review: Not much literature has emanated ...

  7. Domestic wastes: assault course

    International Nuclear Information System (INIS)

    Durand, C.; Bergey, J.L.

    1997-01-01

    In the management of domestic waste, some incoherencies persist. The tax on waste is always 20.6% instead of 5.5% for water or transport. The price of buying back electric power by Electricite de France is too low according to the appreciation of the cogeneration club. Regarding to the sell of stream to industrial, stream buyers are not always reliable, no enough guarantee are given by them to allow to cogeneration club to invest. (N.C.)

  8. Deconstructing domestic violence policy

    OpenAIRE

    Branney, PE

    2006-01-01

    The primary objectives of this thesis are to, circularly, deconstruct contemporary domestic violence policy while developing and evaluating methods for deconstructing policy. Policy is theorised as a discursive practice, which allows a variety of policies to be compared and critiqued by how they position the people they affect. These are known as subject positions, or subjectivities, and throughout this thesis I attempt to critique policy by examining the (re)construction of subjectivity. In ...

  9. Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

    Science.gov (United States)

    Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

    2011-08-01

    The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

  10. Particle Emissions from Domestic Gas Cookers

    DEFF Research Database (Denmark)

    Glarborg, Peter; Livbjerg, Hans; Wagner, Ayten Yilmaz

    2010-01-01

    The authors experimentally studied the formation of submicron particles from a domestic gas cooker in a compartment free from external particle sources. The effects of fuel (methane, natural gas, odorant-free natural gas), primary aeration, flow rate, and fuel sulphur content on particle emissions...... of the emitted particles were found to have a mean value of about 7 nm for partially premixed flames, increasing to ∼10 nm for nonpremixed flames. The quantity of primary air had a strong impact on the particle emissions, showing a minimum at a primary aeration level of 60-65%. Presence of sulphur in small...... quantities may enhance particle formation under some conditions, but results were not conclusive....

  11. Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

    Directory of Open Access Journals (Sweden)

    Dr. Abdul Muhaimin

    2017-02-01

    Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

  12. Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

    Science.gov (United States)

    Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

    2018-02-02

    Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

  13. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    OpenAIRE

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2012-01-01

    Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

  14. Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

    Science.gov (United States)

    Uphoff, Eleonora P; Pickett, Kate E; Wright, John

    2016-10-01

    This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

  15. Przemoc domowa = Domestic violence

    OpenAIRE

    Łepecka-Klusek, Celina; Pawłowska-Muc, Agnieszka Konstancja; Pilewska-Kozak, Anna Bogusława; Stadnicka, Grażyna; Pałucka, Klaudia

    2015-01-01

    Łepecka-Klusek Celina, Pawłowska-Muc Agnieszka Konstancja, Pilewska‑Kozak Anna Bogusława, Stadnicka Grażyna, Pałucka Klaudia. Przemoc domowa = Domestic violence. Journal of Education, Health and Sport. 2015;5(6):169-182. ISSN 2391-8306. DOI 10.5281/zenodo.18420 http://ojs.ukw.edu.pl/index.php/johs/article/view/2015%3B5%286%29%3A169-182 https://pbn.nauka.gov.pl/works/564476 http://dx.doi.org/10.5281/zenodo.18420 Formerly Journal of Health Sciences. ISSN 1429-9623 / 2300-665X. A...

  16. Selection signature in domesticated animals.

    Science.gov (United States)

    Pan, Zhang-yuan; He, Xiao-yun; Wang, Xiang-yu; Guo, Xiao-fei; Cao, Xiao-han; Hu, Wen-ping; Di, Ran; Liu, Qiu-yue; Chu, Ming-xing

    2016-12-20

    Domesticated animals play an important role in the life of humanity. All these domesticated animals undergo same process, first domesticated from wild animals, then after long time natural and artificial selection, formed various breeds that adapted to the local environment and human needs. In this process, domestication, natural and artificial selection will leave the selection signal in the genome. The research on these selection signals can find functional genes directly, is one of the most important strategies in screening functional genes. The current studies of selection signal have been performed in pigs, chickens, cattle, sheep, goats, dogs and other domestic animals, and found a great deal of functional genes. This paper provided an overview of the types and the detected methods of selection signal, and outlined researches of selection signal in domestic animals, and discussed the key issues in selection signal analysis and its prospects.

  17. Correlation of COD and BOD of domestic wastewater with the power output of bioreactor

    Energy Technology Data Exchange (ETDEWEB)

    Khan, A M; Ataullah,; Shaheen, A; Ahmad, I; Malik, F; Shahid, H A [Federal Urdu University of Arts, Science and Technology, Gulshan-e-Iqbal Campus, University Road, Karachi-75300 (Pakistan). Research Laboratory of Bioenergy, Department of Chemistry

    2011-04-15

    This research article deals with the studies on the development of the correlation of COD, BOD, and BOD/sub 5/ of domestic wastewater (DWW), and fermented domestic wastewater (FDWW) with the power output of the microbial fuel cell (MFC). The fermentation of DWW was carried out with yeast (Saccharomyces cerevisiae), and yogurt bacteria (Streptococcus lactis) to produce biohydrogen which was converted to the electrical energy through the development of microbial fuel cell (MFC). The values of COD, BOD, and BOD/sub 5/ for yogurt fermented domestic wastewater (Yogurt-FDWW) were found to be greater than the values of yeast fermented domestic wastewater (Yeast-FDWW). The power output of DWW and FDWW was increased with the increase in COD, BOD and BOD/sub 5/ values. The main objective of this article is to develop the renewable alternative of fossil fuels which are the major cause of global warming and global pollution. (author)

  18. Correlation of COD and BOD of domestic wastewater with the power output of bioreactor

    International Nuclear Information System (INIS)

    Khan, A.M.; Ataullah; Shaheen, A.; Ahmad, I.; Malik, F.; Shahid, H.A.

    2011-01-01

    This research article deals with the studies on the development of the correlation of COD, BOD, and BOD/sub 5/ of domestic wastewater (DWW), and fermented domestic wastewater (FDWW) with the power output of the microbial fuel cell (MFC). The fermentation of DWW was carried out with yeast (Saccharomyces cerevisiae), and yogurt bacteria (Streptococcus lactis) to produce biohydrogen which was converted to the electrical energy through the development of microbial fuel cell (MFC). The values of COD, BOD, and BOD/sub 5/ for yogurt fermented domestic wastewater (Yogurt-FDWW) were found to be greater than the values of yeast fermented domestic wastewater (Yeast-FDWW). The power output of DWW and FDWW was increased with the increase in COD, BOD and BOD/sub 5/ values. The main objective of this article is to develop the renewable alternative of fossil fuels which are the major cause of global warming and global pollution. (author)

  19. Assessment of potential toxicity of a smokeless tobacco product (naswar) available on the Pakistani market.

    Science.gov (United States)

    Zakiullah; Saeed, Muhammad; Muhammad, Naveed; Khan, Saeed Ahmad; Gul, Farah; Khuda, Fazli; Humayun, Muhammad; Khan, Hamayun

    2012-07-01

    'Naswar' is a smokeless tobacco product (STP) widely used in Pakistan. It has been correlated with oral and oesophageal cancer in recent clinical studies. The toxic effects associated with STPs have been associated with trace level contaminants present in these products. The toxin levels of Pakistani naswar are reported for the first time in this study. A total of 30 Pakistani brands of naswar were tested for a variety of toxic constituents and carcinogens such as cadmium, arsenic, lead and other carcinogenic metals, nitrite and nitrate, and nicotine and pH. The average values of all the toxins studied were well above their allowable limits, making the product a health risk for consumers. Calculated lifetime cancer risk from cadmium and lead was 1 lac (100,000) to 10 lac (1,000,000) times higher than the minimum 10E-4 (0.00001) to 10E-6 (0.000001), which is the 'target range' for potentially hazardous substances, according to the US Environmental Protection Agency. Similarly, the level of arsenic was in the range of 0.15 to 14.04 μg/g, the average being 1.25 μg/g. The estimated average bioavailable concentration of arsenic is 0.125-0.25 μg/g, which is higher than the allowable standard of 0.01 μg/g. Similarly, the average minimum daily intake of chromium and nickel was 126.97 μg and 122.01 μg, as compared to allowable 30-35 μg and 35 μg, respectively; a 4-5 times higher exposure. However, beryllium was not detected in any of the brands studied. The pH was highly basic, averaging 8.56, which favours the formation of tobacco specific amines thus making the product potentially toxic. This study validates clinical studies correlating incidence of cancer with naswar use in Pakistan. This study shows that the production, packaging, sale and consumption of naswar should be regulated so as to protect the public from the health hazards associated with its consumption.

  20. Nothing stays ever the same. Stationary fuel cells, the revolution in domestic and industrial power supply; Nichts bleibt, wie es ist.... Revolution der Energieversorgung in der Haustechnik und Industrie mit stationaeren Brennstoffzellen

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2001-02-01

    Helmut Kaiser Unternehmensberatung (HKU), an organisation that claims to be a leading consultant in the fields of environmental engineering, energy engineering, health and life science, investigated the current trends in stationary fuel cell applications world-wide. The study covers market and technology forecasts and an analysis of the competitive standing of suppliers world-wide. [German] Die Helmut Kaiser Unternehmensberatung (HKU), nach eigenen Angaben weltweit eines der fuehrenden Forschungs- und Beratungsunternehmen in der Umwelt-, Energietechnik sowie Gesundheit (Life Science), untersuchte in einer neuen Studie die Entwicklung der Brennstoffzellen in der stationaeren Anwendung weltweit. Die Studie umfasst Markt- und Technologieprognosen sowie eine Wettbewerbsanalyse der Anbieter weltweit. (orig.)

  1. Medicolegal characteristics of domestic violence

    OpenAIRE

    Antović Aleksandra R.; Stojanović Jovan

    2017-01-01

    Introduction/Objective. Domestic violence is a phenomenon as old as the history of human civilization, present in all cultures, epochs and social systems. Despite the fact that domestic violence represents a dangerous and unacceptable social phenomenon, as well as a significant medical problem, there are still no precise data on the prevalence of this phenomenon in our country. This study aims to determine the elementary forensic characteristics of domestic violence that would represented the...

  2. Transnational Journeys and Domestic Histories

    OpenAIRE

    Webster, Wendy

    2006-01-01

    This essay considers the potential of histories of transnational movements of people, and the erosion of boundaries between British domestic and imperial history, to expand and revise the history of nineteenth- and twentieth-century British domestic life and work. Literatures on migration demonstrate how far the history of home involves transnational themes, including the recruitment of migrants and refugees who crossed national borders to do domestic work—in Britain and empire—and their deve...

  3. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  4. Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

    2017-12-01

    South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

  5. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

    Science.gov (United States)

    Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

    2016-12-09

    There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  6. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

    Directory of Open Access Journals (Sweden)

    Atta Abbas Naqvi

    2016-12-01

    Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  7. Fuel Exhaling Fuel Cell.

    Science.gov (United States)

    Manzoor Bhat, Zahid; Thimmappa, Ravikumar; Devendrachari, Mruthyunjayachari Chattanahalli; Kottaichamy, Alagar Raja; Shafi, Shahid Pottachola; Varhade, Swapnil; Gautam, Manu; Thotiyl, Musthafa Ottakam

    2018-01-18

    State-of-the-art proton exchange membrane fuel cells (PEMFCs) anodically inhale H 2 fuel and cathodically expel water molecules. We show an unprecedented fuel cell concept exhibiting cathodic fuel exhalation capability of anodically inhaled fuel, driven by the neutralization energy on decoupling the direct acid-base chemistry. The fuel exhaling fuel cell delivered a peak power density of 70 mW/cm 2 at a peak current density of 160 mA/cm 2 with a cathodic H 2 output of ∼80 mL in 1 h. We illustrate that the energy benefits from the same fuel stream can at least be doubled by directing it through proposed neutralization electrochemical cell prior to PEMFC in a tandem configuration.

  8. Measuring domestic water use

    DEFF Research Database (Denmark)

    Tamason, Charlotte C.; Bessias, Sophia; Villada, Adriana

    2016-01-01

    Objective: To present a systematic review of methods for measuring domestic water use in settings where water meters cannot be used. Methods: We systematically searched EMBASE, PubMed, Water Intelligence Online, Water Engineering and Development Center, IEEExplore, Scielo, and Science Direct...... databases for articles that reported methodologies for measuring water use at the household level where water metering infrastructure was absent or incomplete. A narrative review explored similarities and differences between the included studies and provide recommendations for future research in water use....... Results: A total of 21 studies were included in the review. Methods ranged from single-day to 14-consecutive-day visits, and water use recall ranged from 12 h to 7 days. Data were collected using questionnaires, observations or both. Many studies only collected information on water that was carried...

  9. Foreign Firms, Domestic Wages

    DEFF Research Database (Denmark)

    Malchow-Møller, Nikolaj; Markusen, James R.; Schjerning, Bertel

    to the firm?s productivity. Foreign-owned firms have, on average, higher productivity in equilibrium due to entry costs, which means that low-productivity foreign firms cannot enter. Foreign firms have higher wage growth and, with some exceptions, pay higher average wages, but not when compared to similarly...... large domestic firms. The empirical implications of the model are tested on matched employer-employee data from Denmark. Consistent with the theory, we find considerable evidence of higher wages and wage growth in large and/or foreign-owned firms. These effects survive controlling for individual...... characteristics, but, as expected, are reduced significantly when controlling for unobservable firm heterogeneity. Furthermore, acquired skills in foreign-owned and large firms appear to be transferable to both subsequent wage work and self-employment...

  10. Correlation of bone mineral density with biochemical markers in different menopausal statuses of Pakistani women

    International Nuclear Information System (INIS)

    Maqsood, A.; Nadia, N.; Farzana, A.; Bashir, A.

    2005-01-01

    Aim: The present study is aimed to use bone mineral density (BMD) and various biochemical markers to predict the fracture risk at different menopausal statuses in Pakistani women. Method: Seventy women aged between 28-80 years at various menopausal statuses participated in this study. BMD (T score) of right calcaneus was determined using SAHARA ultrasound bone densitometer that measures the transmission of high frequency from heel. Various biochemical markers such as alkaline phosphates, calcium and inorganic phosphorus were measured from the serum of venous blood using standard kits of Randox. Results: Alkaline phosphates was raised in per menopausal, postmenopausal and postmenopausal with hysterectomy and ligation groups of women as compared to premenopausal women but did not achieve significance (P>0.05). Serum calcium level was significantly lower in postmenopausal women than premenopausal women and inorganic phosphorus decrease significantly when compared with premenopausal and postmenopausal with ligation and hysterectomy. BMD (T score) values of postmenopausal osteopenic and postmenopausal osteoprotic women were significantly lower than those of premenopausal women. BMD values of women under study have negative correlation with age, alkaline phosphates and calcium. Conclusion: Our study conclude that in addition to BMD, serum levels of alkaline phosphate, calcium and inorganic phosphorus can be valuable biochemical markers in predicting bone fracture risk at different menopausal states. (author)

  11. Toxic metals distribution in different components of Pakistani and imported cigarettes by electrothermal atomic absorption spectrometer

    International Nuclear Information System (INIS)

    Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.

    2009-01-01

    It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy

  12. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  13. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  14. Construct validation of emotional labor scale for a sample of Pakistani corporate employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-02-01

    To translate, adapt and validate emotional labour scale for Pakistani corporate employees. This study was conducted in locale of Rawalpindi and Islamabad from October 2014 to December 2015, and comprised customer service employees of commercial banks and telecommunication companies. It comprised of two independent parts. Part one had two steps. Step one involved translation and adaptation of the instrument. In the second step psychometric properties of the translated scale were established by administering it to customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of emotional labour. Part two comprised the main study. Commercial bank employees were included in the sample by using convenient sampling technique. SPSS 20 was used for data analysis. There were 145 participants in the first study and 495 in the second study . Exploratory factor analysis initially generated three-factor model of emotional labour which was further confirmed by confirmatory factor analysis suggesting that emotional labour had three distinct dimensions, i.e. surface acting, deep acting and genuine expressions of emotions. The emotional labour scale was found to be a valid and reliable measure.

  15. Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

    Directory of Open Access Journals (Sweden)

    Muhammad Arif Soomro

    2016-08-01

    Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

  16. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  17. Chemical composition of particles from traditional burning of Pakistani wood species

    Science.gov (United States)

    Shahid, Imran; Kistler, Magdalena; Mukhtar, Azam; Ramirez-Santa Cruz, Carlos; Bauer, Heidi; Puxbaum, Hans

    2015-11-01

    Total particulate matter (TPM) emitted during burning of three types of Pakistani wood (eucalyptus camaldulensis, local name Safeeda; acacia nilotica, local name Kikar, Babul; dalbergia sissoo, Shisham, Tali) in a traditional brick stove were collected and analyzed for anhydrosugars, sugar alcohols, trace metals, soluble ions and carbonaceous species. This is a first study reporting anhydrosugars in wood smoke particles emitted during traditional burning of common wood types in Pakistan. Carbonaceous species showed the highest contribution to the particulate matter. Although the total carbon (TC) contribution was similar for all burnings (64.8-70.2%), the EC/OC ratio varied significantly, from 0.2 to 0.3 for Accacia and Dalbergia to 0.7-0.8 for Eucalyptus and Wood-mix. Among inorganic constituents potassium chloride and silicon were found at levels higher than 1%. The levoglucosan concentrations ranged from 3.0 to 6.6% (average 5.6%) with the highest value for Accacia and lowest value for the wood-mix. The high levoglucosan/mannosan ratios of 20-28 were typical for hardwood. The ratio between levoglucosan and galactosan varied stronger and was found to be around 13-20 for Accacia, Eucalyptus and Wood mix, and 43 for Dalbergia. The determined levoglucosan concentrations allowed assessing the conversion factor for calculation of biomass smoke contribution to ambient particulate matter levels in Pakistan.

  18. Assessment of dietary intake of trace elements through Pakistani integrated diets

    International Nuclear Information System (INIS)

    Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

    1994-01-01

    A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

  19. Research Output of the Pakistani Library and Information Science Authors: A Bibliometric Evaluation of Their Impact

    Directory of Open Access Journals (Sweden)

    Anwar, Mumtaz Ali

    2017-06-01

    Full Text Available This paper uses 601 cited papers of Pakistani LIS researchers with the purpose to examine the individual performance of these Library and Information Science (LIS researchers in terms of their research output and its impact on the LIS (national/international literature by using various bibliometric indicators. A list of 139 authors was compiled with the help of the Library, Information Science, and Technology Abstracts (LISTA and some other sources. Data were collected from Google Scholar and SPSS version 20 was utilized in order to identify the relationship between self-citations and various performance indices of the authors. The average citations received per paper vary from 1.80 to 10.08. About half of the papers were single-authored whereas less than one-fifth were by three or more authors. The authors who worked in collaboration produced more papers and received more citations. The h-index, g-index, hI-index, hI-norm, and e-index were used to determine the rank for each author. The intra-group citations grid revealed the volume of self-citations and a small group who cite each other more due to close academic and social relationships. The correlations between self-citations and the impact indices used revealed significant differences. Findings are useful for concerned institutions regarding award, promotions, etc. Further, future research should seriously consider the self-citations and social networking of authors while examining their citations-based research performance.

  20. Pakistani Immigrant Children and Adults in Denmark Have Severely Low Vitamin D Status

    DEFF Research Database (Denmark)

    Andersen, Rikke; Mølgaard, C.; Skovgaard, L. T.

    2008-01-01

    association with S-25OHD for men (P = 0.04) and women (P = 0.0008). Twenty-one per cent of the women and 34% of the men had osteopenia. Neither S-25OHD nor S-iPTH was associated with lumbar spine or whole body bone mineral content. Conclusions: Severely low vitamin D status and elevated S-iPTH is common among......, Copenhagen (55 degrees N), January- November. Serum 25-hydroxyvitamin D (S-25OHD), serum intact parathyroid hormone (S-iPTH), bone turnover markers and whole body and lumbar spine bone mineral density were measured. Sun, smoking and clothing habits, age, body mass index (BMI), and vitamin D and calcium from......Objective: To determine vitamin D and bone status in adolescent girls, pre-menopausal women and men of Pakistani origin, to single out determinants of vitamin D status and to determine the association between vitamin D status, bone metabolism and bone status. Subjects/Methods: Cross-sectional study...

  1. Viral Etiologies of Acute Dehydrating Gastroenteritis in Pakistani Children: Confounding Role of Parechoviruses

    Directory of Open Access Journals (Sweden)

    Muhammad Masroor Alam

    2015-01-01

    Full Text Available Despite substantial interventions in the understanding and case management of acute gastroenteritis, diarrheal diseases are still responsible for a notable amount of childhood deaths. Although the rotavirus is known to cause a considerable burden of pediatric diarrheal cases, the roles of other viruses remain undefined for the Pakistani population. This study was based on tertiary care hospital surveillance, from January 2009 to December 2010, including the detection of rotavirus, norovirus, astrovirus, and human parechovirus in children under the age of five using serological or molecular assays. Rotavirus, human parechovirus, norovirus, and astrovirus were detected in 66%, 21%, 19.5%, and 8.5% subjects, respectively. Human parechovirus genotypes, determined through analysis of VP1 gene sequences, showed a great diversity among co-circulating strains. Eighty percent of hospitalized children had dual or multiple viral infections, while 98% parechovirus positive cases were co-infected with rotavirus. The remarkable diversity of viruses associated with the childhood diarrhea in Pakistan calls for large-scale epidemiological surveys, coupled with case control studies, to ascertain their role in clinical manifestations. In addition, these findings also highlight the need for the implementation of up-to-date health interventions, such as the inclusion of a rotavirus vaccine in routine immunization programs for the improvement of quality in child health care.

  2. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  3. Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

    2014-01-01

    Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

  4. Experience of dietary advice among Pakistani-born persons with type 2 diabetes in Oslo.

    Science.gov (United States)

    Fagerli, Rønnaug Aa; Lien, Marianne E; Wandel, Margareta

    2005-12-01

    Experience and implementation of dietary advice are influenced by various factors including ethnic, cultural and religious background. The aim is to explore how ethnic minority persons with diabetes experience dietary advice given by Norwegian health-workers, which strategies they have in response to the advice and how they explain their actions. In-depth interviews were performed with 15 Pakistani-born persons with type 2 diabetes living in Oslo. The analyses are based on the principles of Giorgi's interpretation of phenomenology. The participants expressed great concern to follow the advice. However, narratives about constraints were numerous. These concerned different life-situational factors, but more importantly they were related to communication problems arising from discontinuities between universalising medical knowledge and lay knowledge, as well as between different types of culturally defined lay knowledge. As a consequence, advice was generally experienced as inadequately based on the participant's food-cultural background, leaving the person with diabetes to do the translation between different levels of knowledge. In general health-workers would benefit from expanding their knowledge of the many positive aspects of their patients' cultural background, and apply their knowledge thereafter, whether it concerns (food)-culture or the impact of religion in everyday life.

  5. Lenses on metacognition: Teachers’ perceptions toward strategies in reading in a Pakistani context

    Directory of Open Access Journals (Sweden)

    Channa, Mansoor A.

    2017-03-01

    Full Text Available The research in the field of metacognition for developing reading is not new; metacognition has been used for many years to identify ways to develop students’ reading comprehension. Most previous research has addressed either primary or secondary level students. However, notably few studies have been conducted at the undergraduate level. This study has attempted to initiate strategies to assist first-year engineering students in developing their reading abilities within a Pakistani context. The primary objective of this research was to identify what strategies first-year engineering students use in developing their reading at Quaid-e-Awam University of engineering science and technology in Pakistan. This study used qualitative instruments that included semi-structured interviews with teachers and classroom observations during read-aloud sessions. The data were organized through NVivo version 8 for obtaining nodes, codes, and main themes for interpreting the results. The results of this study demonstrated that teachers should use metacognitive strategies for developing students’ reading abilities. Findings also revealed that reading strategies, such as text scanning, guesses from contextual clues, drawing on prior knowledge, and using a dictionary, are the most important strategies to use for developing the reading skills and comprehension of engineering students. This study has suggested metacognitive strategies be used for promoting students’ reading abilities and that teachers should design and develop more courses using these strategies to enhance the reading and listening skills of engineering students.

  6. Depressive disorder and social stress in Pakistan compared to people of Pakistani origin in the UK.

    Science.gov (United States)

    Husain, Nusrat; Chaudhry, Nasim; Tomenson, Barbara; Jackson, Judy; Gater, Richard; Creed, Francis

    2011-11-01

    Depressive disorder is more common in low to middle than high-income countries, but the reasons for this have not been explicitly defined. We compared the results of two population-based studies of people of Pakistani origin: one living in rural Pakistan and one in UK. Both samples were screened with the self-reporting questionnaire followed by research interview to determine depressive disorders and social stress. Logistic regression was used to compare the prevalence of depressive disorder in the two countries after adjustment for socio-demographic characteristics and social stress. The estimated prevalence of depression for men was 35.8% (95% CI 16.1-55.5) in Pakistan and 9% (5.0-13.0) in Manchester (pstress (both sexes). 35% of women in Pakistan and 71% of those in UK had received 8 years or more of education. Extremely poor housing and marked poverty were experienced by 36.1% of women in Pakistan and 0.6% of those in Manchester. In Pakistan, housing and poverty predominated as correlates of depression, whereas in Manchester it was marked difficulties in physical health and close relationships. The results suggest that the higher rate of depressive disorder amongst women in Pakistan compared to UK can be attributed to less education and frequent severe social difficulties. These differences have implications for treatment.

  7. Attitudes towards euthanasia and physician-assisted suicide among Pakistani and Indian doctors: A survey

    Directory of Open Access Journals (Sweden)

    Syed Qamar Abbas

    2008-01-01

    Full Text Available Aim: This study attempts to assess the attitude of Pakistani and Indian doctors to euthanasia and physician-assisted suicide. Methods: We used a questionnaire survey that included one case history of a patient with cancer and another of one suffering from motor neurone disease (MND. Results: Fifty-two of 100 doctors from Pakistan returned the completed questionnaires. Eight of the 52 (15.3% doctors agreed with the concept of euthanasia being an acceptable option for the patient with MND. Six of the 52 (11.5% supported a similar approach for the cancer patient. From India, 60/100 doctors returned the completed questionnaires. Sixteen of the 60 (26.6% doctors supported euthanasia as an option for the patient with MND whereas 15 (25% supported a similar option for the cancer patient. Conclusion: We conclude that only a minority of the doctors support euthanasia. This group belongs to a younger age group. In Pakistan, they were more likely to be males. The religion of the doctors did not appear to be a determining factor.

  8. Characterizing bread wheat genotypes of Pakistani origin for grain zinc biofortification potential.

    Science.gov (United States)

    Rehman, Abdul; Farooq, Muhammad; Nawaz, Ahmad; Al-Sadi, Abdullah M; Al-Hashmi, Khalid S; Nadeem, Faisal; Ullah, Aman

    2018-03-15

    Zinc (Zn) is essential for all life forms and its deficiency is a major issue of malnutrition in humans. This study was carried out to characterize 28 wheat genotypes of Pakistani origin for grain zinc biofortification potential, genetic diversity and relatedness. There was low genetic differentiation among the tested genotypes. However, they differed greatly in yield-related traits, grain mineral (Zn, calcium (Ca) and protein) concentrations and Zn bioavailability. Zinc application increased the concentration of Zn in wheat grain (32.1%), embryo (19.8%), aleurone (47%) and endosperm (23.7%), with an increase in bioavailable Zn (22.2%) and a reduction in phytate concentration (6.8%). Application of Zn also enhanced grain protein and Ca concentrations. Among wheat genotypes, Blue Silver had the highest concentration of Zn in grain, embryo, aleurone and endosperm, with high bioavailable Zn, while Kohinoor-83 had low phytate concentration. Wheat genotypes of Pakistan are genetically less diverse owing to continuous focus on the development of high-yielding varieties only. Therefore genetically diverse wheat genotypes with high endospermic Zn concentration and better grain yield should be used in breeding programs approaches, aiming at improving Zn bioavailability. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  9. Prevalence and risk factors of helicobacter pylori infection among Pakistani population

    International Nuclear Information System (INIS)

    Rasheed, F.; Ahmad, T.; Bilal, B.

    2012-01-01

    Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

  10. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  11. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    International Nuclear Information System (INIS)

    Bhatti, S.M.; Dhakam, S.; Khan, M.A.

    2009-01-01

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  12. Nuclear fuel cycle system analysis

    International Nuclear Information System (INIS)

    Ko, W. I.; Kwon, E. H.; Kim, S. G.; Park, B. H.; Song, K. C.; Song, D. Y.; Lee, H. H.; Chang, H. L.; Jeong, C. J.

    2012-04-01

    The nuclear fuel cycle system analysis method has been designed and established for an integrated nuclear fuel cycle system assessment by analyzing various methodologies. The economics, PR(Proliferation Resistance) and environmental impact evaluation of the fuel cycle system were performed using improved DB, and finally the best fuel cycle option which is applicable in Korea was derived. In addition, this research is helped to increase the national credibility and transparency for PR with developing and fulfilling PR enhancement program. The detailed contents of the work are as follows: 1)Establish and improve the DB for nuclear fuel cycle system analysis 2)Development of the analysis model for nuclear fuel cycle 3)Preliminary study for nuclear fuel cycle analysis 4)Development of overall evaluation model of nuclear fuel cycle system 5)Overall evaluation of nuclear fuel cycle system 6)Evaluate the PR for nuclear fuel cycle system and derive the enhancement method 7)Derive and fulfill of nuclear transparency enhancement method The optimum fuel cycle option which is economical and applicable to domestic situation was derived in this research. It would be a basis for establishment of the long-term strategy for nuclear fuel cycle. This work contributes for guaranteeing the technical, economical validity of the optimal fuel cycle option. Deriving and fulfillment of the method for enhancing nuclear transparency will also contribute to renewing the ROK-U.S Atomic Energy Agreement in 2014

  13. Japan's fuel recycling policy

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    The Atomic Energy Commission (AEC) has formulated Japanese nuclear fuel recycling plan for the next 20 years, based on the idea that the supply and demand of plutonium should be balanced mainly through the utilization of plutonium for LWRs. The plan was approved by AEC, and is to be incorporated in the 'Long term program for development and utilization of nuclear energy' up for revision next year. The report on 'Nuclear fuel recycling in Japan' by the committee is characterized by Japanese nuclear fuel recycling plan and the supply-demand situation for plutonium, the principle of the possession of plutonium not more than the demand in conformity with nuclear nonproliferation attitude, and the establishment of a domestic fabrication system of uranium-plutonium mixed oxide fuel. The total plutonium supply up to 2010 is estimated to be about 85 t, on the other hand, the demand will be 80-90 t. The treatment of plutonium is the key to the recycling and utilization of nuclear fuel. By around 2000, the private sector will commercialize the fabrication of the MOX fuel for LWRs at the annual rate of about 100 t. Commitment to nuclear nonproliferation, future nuclear fuel recycling program in Japan, MOX fuel fabrication system in Japan and so on are reported. (K.I.)

  14. [Healthcare aspects of domestic abuse].

    Science.gov (United States)

    Kórász, Krisztián

    2015-03-08

    The paper reviews the forms of domestic abuse, its causes, prevalence and possible consequences. British and Hungarian Law, guidelines and the roles and responsibilities of healthcare professionals in relation to dealing with domestic abuse in their practice is also addressed within the paper.

  15. Domestic violence screening in pregnancy.

    Science.gov (United States)

    Bunn, Mikiko Yazawa; Higa, Nicole A; Parker, Willie J; Kaneshiro, Bliss

    2009-11-01

    Domestic violence is an important health concern that has been shown to have adverse effects on maternal and neonatal outcomes. The objectives of this study were to compare the prevalence of prenatal screening for domestic violence in a hospital-based resident clinic setting with screening practices in private obstetric offices in Honolulu, Hawai'i and to explore physician attitudes towards domestic violence screening during pregnancy. A retrospective chart review was conducted at Queen's Medical Center in Honolulu, Hawai'i in women who delivered between 2003 and 2004. A 6 item written survey was also given to all attending and resident physicians with obstetric privileges. Descriptive statistics including frequency measures were generated and chi square tests were used to compare categorical variables. A total of 270 charts were reviewed. There was a statistically significant difference (p obstetric practices (39.3 percent) that were screened for domestic violence. While the majority of respondents (77.6%) to the domestic violence survey were aware that the American College of Obstetricians and Gynecologists recommends domestic violence screening in pregnancy most respondents (69.0 percent) indicated that they "never or rarely" screened their patients for domestic violence. Despite professional recommendations and an awareness of these recommendations, between 2003 and 2004, routine prenatal screening for domestic violence was markedly lacking for patients in this study population.

  16. Domestic Violence as Everyday Terrorism

    DEFF Research Database (Denmark)

    Cooper-Cunningham, Dean

    2016-01-01

    Seeing bride kidnapping and domestic violence as everyday terrorism unpacks the political nature of so-called “private” phenomena and how they reify patriarchal society.......Seeing bride kidnapping and domestic violence as everyday terrorism unpacks the political nature of so-called “private” phenomena and how they reify patriarchal society....

  17. KNF's fuel service technologies and experiences

    International Nuclear Information System (INIS)

    Shin, Jung Cheol; Kwon, Jung Tack; Kim, Jaeik; Park, Jong Youl; Kim, Yong Chan

    2009-01-01

    In Korea, since 1978, the commercial nuclear power plant was operated. After 10 years, from 1988, the nuclear fuel was produced by KNF (Korea Nuclear Fuel). The Fuel Service Team was established at KNF in 1995. Through the technical self reliance periods in cooperate with advanced foreign companies for 5 years, KNF has started to carry out fuel service activities onsite in domestic nuclear power plants. By ceaseless improving and advancing our own methodologies, after that, KNF is able to provide the most safe and reliable fuel repair services and poolside examinations including the root cause analysis of failed fuels. Recently, KNF developed the fuel cleaning system using ultrasonic technique for crud removal, and the CANDU fuel sipping system to detect a failed fuel bundle in PHWR. In this paper, all of KNF's fuel service technologies are briefly described, and the gained experience in shown

  18. Domestic Politics and Nuclear Proliferation

    International Nuclear Information System (INIS)

    Kim, Chul Min; Yim, Man Sung

    2016-01-01

    The external security threat is known as the most important factor of nuclear weapons program, the domestic politics situation can also affect the nuclear proliferation decision of a country. For example, when a leader wants nuclear weapons as an ultimate weapon, the domestic politics situation can determine the effectiveness of the weapons program of a country. This study analyzes the current knowledge of the relationship between domestic politics and nuclear proliferation and suggests the main challenges of the quantitative models trying to calculate nuclear proliferation risk of countries. The domestic politics status is one of the most important indicators of nuclear program. However, some variables have never been used in quantitative analyses; for example, number of veto players and the public opinion on nuclear weapons; despite they are considered to be important in various qualitative studies. Future studies should focus on how should they be coded and how can they be linked with existing domestic politics variables

  19. Domestic Politics and Nuclear Proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chul Min; Yim, Man Sung [KAIST, Daejeon (Korea, Republic of)

    2016-05-15

    The external security threat is known as the most important factor of nuclear weapons program, the domestic politics situation can also affect the nuclear proliferation decision of a country. For example, when a leader wants nuclear weapons as an ultimate weapon, the domestic politics situation can determine the effectiveness of the weapons program of a country. This study analyzes the current knowledge of the relationship between domestic politics and nuclear proliferation and suggests the main challenges of the quantitative models trying to calculate nuclear proliferation risk of countries. The domestic politics status is one of the most important indicators of nuclear program. However, some variables have never been used in quantitative analyses; for example, number of veto players and the public opinion on nuclear weapons; despite they are considered to be important in various qualitative studies. Future studies should focus on how should they be coded and how can they be linked with existing domestic politics variables.

  20. Fuels. Deliveries and consumption of fuels during 4th quarter 2001 and during 2001

    International Nuclear Information System (INIS)

    2002-01-01

    The total volume of oil product deliveries (excluded lubricants, bitumen etc.) from the oil companies was 3 per cent higher during 2001 compared with 2000. The deliveries of motor gasoline and diesel oil increased by 1 per cent. Domestic heating oil decreased by 2 per cent and heavy fuel oils increased by 17 per cent, all compared with 2000. Under the forth quarter 2001 the deliveries of oil products (excluded lubricants bitumen etc.) was 5 per cent higher compared with the same quarter 2000. The deliveries of domestic heating oil and heavy fuel oils increased by 4 per cent and 28 per cent respectively. Motor gasoline increased by 3 per cent while the deliveries of diesel oil decreased by 1 per cent. The consumption of fuels in mining and manufacturing decreased by 5 per cent during 2001 compared with 2000. Most of the reduction came from the lower use of domestic fuel in manufacture of pulp, paper and paper products, printing and publishing. The total consumption in mining and manufacturing was unchanged during the 4 th quarter 2001 compared with the same period 2000. The consumption of domestic fuels decreased by 6 per cent and the oil consumption increased by 11 per cent. Higher consumption of fuels in electricity, gas and district heating services. The consumption of fuels in electricity, gas and district heating services increased by 14 per cent 2001 compared with 2000. The consumption of domestic fuels raised with 12 per cent and the use of fossil fuels raised with 17 per cent. The highest increasing, 27 per cent, was found within the use of oil. Electricity, gas and district heating services increased there fuel consumption with 29 per cent during the 0 quarter 2001 compared with the same period 2000. The raise can be explained with the fact that the 4th quarter 2000 was unusually warm. The increasing is found both in the use of domestic and fossil fuels

  1. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

    International Nuclear Information System (INIS)

    Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

    2010-01-01

    Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

  2. Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

    International Nuclear Information System (INIS)

    RIZK, M.A.

    2010-01-01

    This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

  3. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

    Science.gov (United States)

    Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

    2012-02-27

    A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

  4. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

    Science.gov (United States)

    Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

    2017-01-01

    Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

  5. The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

    Science.gov (United States)

    Goodwin, Laura; Hunter, Billie; Jones, Aled

    2018-02-01

    In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  6. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

  7. POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

    Science.gov (United States)

    Rafique, Rafia; Anjum, Afifa

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  8. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Mir Mohammed

    2012-02-01

    Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

  9. Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Hempler NF

    2015-02-01

    Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

  10. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  11. Domestic uranium exploration activities

    International Nuclear Information System (INIS)

    Chenoweth, W.L.

    1980-01-01

    Uranium exploration in the United States reached its alltime high in 1978 when the chief exploration indicator, surface drilling, totaled 47 million feet. In 1979, however, total drilling declined to 41 million feet, and during the first 8 months of 1980 the trend continued, as surface drilling was 27% less than for the same period in 1979. The total drilling for 1980 now is expected to be below 30 million feet, far less than the 39.4 million feet planned by industry at the beginning of the year. Falling uranium prices, the uncertainties of future uranium demand, rising costs, and the possibility of stiff foreign competition are the prime causes for the current reduction in domestic uranium exploration. Uranium exploration in the United States continues to be concentrated in the vicinity of major producing areas such as the San Juan Basin, Wyoming Basins, Texas Coastal Plain, Paradox Basin, and northeastern Washington, and in areas of recent discoveries including the Henry Mountains, Utah, the McDermitt caldera in Nevada and Oregon, and central Colorado. The distributions, by location, of total surface drilling for 1979 and the first half of 1980 are presented

  12. Environmental assessment of wood domestic heating. Synthetic report

    International Nuclear Information System (INIS)

    2005-12-01

    This report proposes a synthesis of the results of an environmental assessment of wood domestic heating. This study is based on a life cycle analysis which quantifies the impacts on the environment of all the related activities: fuel extraction, retailing, final use, and so on. Environmental impacts are assessed by means of different indicators: energetic assessment, greenhouse effect assessment, air pollution (acidification), water pollution (eutrophication), toxic material emissions in air and into the soils. Wood is compared to other heating sources (gas, fuel, electricity). Ways to improve this environmental assessment are discussed for the different types of wood (logs, pellets)

  13. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA

    2017-07-01

    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  14. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    International Nuclear Information System (INIS)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S.

    2013-01-01

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  15. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    Energy Technology Data Exchange (ETDEWEB)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S. [Mayo Hospital, Lahore (Pakistan). Dept. of Medicine

    2013-01-15

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  16. Genotype and phenotype relationships in 10 Pakistani unrelated patients with inherited factor VII deficiency.

    Science.gov (United States)

    Borhany, M; Boijout, H; Pellequer, J-L; Shamsi, T; Moulis, G; Aguilar-Martinez, P; Schved, J-F; Giansily-Blaizot, M

    2013-11-01

    Inherited factor VII (FVII) deficiency is one of the commonest rare bleeding disorders. It is characterized by a wide molecular and clinical heterogeneity and an autosomal recessive pattern of inheritance. Factor VII-deficient patients are still scarcely explored in Pakistan although rare bleeding disorders became quite common as a result of traditional consanguineous marriages. The aim of the study was to give a first insight of F7 gene mutations in Pakistani population. Ten unrelated FVII-deficient patients living in Pakistan were investigated (median FVII:C = 2%; range = 2-37%). A clinical questionnaire was filled out for each patient and direct sequencing was performed on the coding regions, intron/exon boundaries and 5' and 3' untranslated regions of the F7 gene. Nine different mutations (eight missense mutations and one located within the F7 promoter) were identified on the F7 gene. Five of them were novel (p.Cys82Tyr, p.Cys322Ser, p.Leu357Phe, p.Thr410Ala, c-57C>T, the last being predicted to alter the binding site of transcription factor HNF-4). Half of the patients had single mutations in Cys residues involved in disulfide bridges. The p.Cys82Arg mutation was the most frequent in our series. Six of seven patients with FVII:C levels below 10% were homozygous in connection with the high percentage of consanguinity in our series. In addition, we graded the 10 patients according to three previously published classifications for rare bleeding disorders. The use of the bleeding score proposed by Tosetto and co-workers in 2006 appears to well qualify the bleeding tendency in our series. © 2013 John Wiley & Sons Ltd.

  17. Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya.

    Science.gov (United States)

    Adnan, Muhammad; Hölscher, Dirk

    2012-12-01

    Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya Medicinal plants collected in Himalayan forests play a vital role in the livelihoods of regional rural societies and are also increasingly recognized at the international level. However, these forests are being heavily transformed by logging. Here we ask how forest transformation influences the diversity and composition of medicinal plants in northwestern Pakistan, where we studied old-growth forests, forests degraded by logging, and regrowth forests. First, an approximate map indicating these forest types was established and then 15 study plots per forest type were randomly selected. We found a total of 59 medicinal plant species consisting of herbs and ferns, most of which occurred in the old-growth forest. Species number was lowest in forest degraded by logging and intermediate in regrowth forest. The most valuable economic species, including six Himalayan endemics, occurred almost exclusively in old-growth forest. Species composition and abundance of forest degraded by logging differed markedly from that of old-growth forest, while regrowth forest was more similar to old-growth forest. The density of medicinal plants positively correlated with tree canopy cover in old-growth forest and negatively in degraded forest, which indicates that species adapted to open conditions dominate in logged forest. Thus, old-growth forests are important as refuge for vulnerable endemics. Forest degraded by logging has the lowest diversity of relatively common medicinal plants. Forest regrowth may foster the reappearance of certain medicinal species valuable to local livelihoods and as such promote acceptance of forest expansion and medicinal plants conservation in the region. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s12231-012-9213-4) contains supplementary material, which is available to authorized users.

  18. Evidence based workplace interventions to promote breastfeeding practices among Pakistani working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina

    2013-03-01

    Breastfeeding is an essential source of nutrition for young babies; however, it is challenging for employed mothers to continue breastfeeding with employment, especially if workplace support is minimal or missing. In Pakistan, from 1983 to 2008, the prevalence of breastfeeding at 6 months has decreased from 96% to 31%. In this region, workplace barriers have been reported as one of the reasons that result in early cessation of breastfeeding among working mothers. This paper aims at reviewing global literature to explore workplace interventions that can promote the breastfeeding practices among working mothers in Pakistan. A literature search of peer reviewed databases, including CINHAL (1980-2009), MEDLINE (1980-2009), Pub Med (1980-2009), Springer Link (1980-2008), and Cochrane Database of Systematic Reviews (3rd quarter, 2008), was undertaken. Considering the pre-set inclusion and exclusion criteria, out of more than 500 literature sources, 50 were shortlisted and reviewed. A review of global literature revealed that in order to promote breastfeeding practices among employed mothers, the most powerful workplace interventions include: educating working mothers about management of breastfeeding with employment; enhancing employers' awareness about benefits of breastfeeding accommodation at workplace; arranging physical facilities for lactating mothers (including privacy, childcare facilities, breast pumps, and breast milk storage facilities); providing job-flexibility to working mothers; and initiating mother friendly policies at workplace that support breastfeeding. In Pakistani workplace settings, where little attention is paid to sustain breastfeeding practices among working mothers, there is a need to initiate lactation support programmes. These programmes can be made effective by implementing composite interventions at the level of breastfeeding working mothers, employers, and workplace. Copyright © 2012 Australian College of Midwives. Published by Elsevier

  19. A case - control study of risk factors for coronary artery disease in Pakistani females

    International Nuclear Information System (INIS)

    Nazeer, M.; Naveed, T.; Ullah, A.

    2010-01-01

    Objectives: To establish the strength of association of conventional risk factors for coronary artery disease in native Pakistani females. Methods: We conducted a case - control hospital based study on 198 females (age 30 - 80 years) scheduled for their first coronary angiography at Punjab Institute of Cardiology, Lahore. Patients were divided into pre-menopausal group (age: 45.1 +- 6.3) and post-menopausal group (62.1 +- 9.1). For each risk factor, patients with significant CAD (= 50% luminal diameter stenosis) were regarded as cases an those without significant CAD were taken as controls. Odds Ratios (OR) and their 95% confidence intervals (CI) were calculated by univariate analysis. Results: In total study cohort, Diabetes mellitus (OR 3.65 95% CI 2.0 - 6.5), Family history of premature coronary artery disease (OR 2.3, 95% CI 1.2 - 4.4), and increased waist circumference (OR 2.11, 95% CI 1.2 - 3.8) were strongly associated with significant CAD. In post menopausal age group, diabetes mellitus (OR 2.66 CI 1.3 - 5.1), hyperlipidaemia (OR 2.25 CI 1.2 - 2.3) and increased waist circumference (OR 2.16 CI 1.1 - 4.2) reached statistical significance. In pre-menopausal females only diabetes was strongly associated with significant coronary artery disease (OR 10 CI 2.6 - 37.4). Association of hypertension was not significant in any of subgroups studied. Very few cases of smoking (6 / 198) were found in our study to merit any further statistical analysis. Conclusions: Diabetes mellitus was the only risk factor in pre-menopausal females associated with coronary artery disease While diabetes, hyperlipidaemia and increased waist circumference were significantly associated with CAD in post menopausal females. (author)

  20. Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

    Directory of Open Access Journals (Sweden)

    Vaqar Talha

    2008-04-01

    Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

  1. Nucleic acid amplification test for detection of west nile virus infection in pakistani blood donors

    International Nuclear Information System (INIS)

    Niazi, S.K.; Alam, M.

    2017-01-01

    Background: The study was planned to determine the presence of West Nile Virus (WNV) infection in Pakistani blood donors, using Nucleic Acid Amplification Test (NAT). Methods: The blood donors for study were selected on the basis of the standard questionnaire and routine screening results. Six donors were pooled using an automated pipettor and NAT for WNV was performed on Roche Cobas s 201 NAT system. The reactive pools were resolved in Individual Donation-NAT (ID-NAT) format and a sample from FFP bags of reactive donations was retrieved. NAT was again performed on retrieved plasma bag (RPB) sample to confirm the reactive donations. The donors were also recalled and interviewed about history of illness related to recent WNV infection. Results: After serological screening of 1929 donors during the study period, 1860 donors were selected for NAT test for WNV detection. The mean age of the donors was 28±8.77 (range: 18–57 years). 1847 (99.3%) donors were male and 13 (0.7%) were female. NAT for WNV identified six initially reactive pools (0.32%). On follow-up testing with RPB samples, 4 donors (0.21%) were found confirmed reactive for WNV RNA (NAT yield of 1 in 465 blood donors). Conclusion: WNV is a threat to safety of blood products in Pakistan. A screening strategy can be implemented after a large-scale study and financial considerations. One of the reduced cost screening strategies is seasonal screening of blood donors for WNV, with pooling of samples. (author)

  2. Postoperative pain assessment using four behavioral scales in Pakistani children undergoing elective surgery

    Directory of Open Access Journals (Sweden)

    Faisal Shamim

    2015-01-01

    Full Text Available Background: Several measurement tools have been used for assessment of postoperative pain in pediatric patients. Self-report methods have limitations in younger children and parent, nurse or physician assessment can be used as a surrogate measure. These tools should be tested in different cultures as pain can be influenced by sociocultural factors. The objective was to assess the inter-rater agreement on four different behavioral pain assessment scales in our local population. Materials and Methods: This prospective, descriptive, observational study was conducted in Pakistan. American Society of Anesthesiologists I and II children, 3-7 years of age, undergoing elective surgery were enrolled. Four pain assessment scales were used, Children′s Hospital of Eastern Ontario Pain Scale (CHEOPS, Toddler Preschool Postoperative Pain Scale (TPPPS, objective pain scale (OPS, and Face, Legs, Activity, Cry, Consolability (FLACC. After 15 and 60 min of arrival in the postanesthesia care unit (PACU, each child evaluated his/her postoperative pain by self-reporting and was also independently assessed by the PACU nurse, PACU anesthetist and the parent. The sensitivity and specificity of the responses of the four pain assessment scales were compared to the response of the child. Results: At 15 min, sensitivity and specificity were >60% for doctors and nurses on FLACC, OPS, and CHEOPS scales and for FLACC and CHEOPS scale for the parents. Parents showed poor agreement on OPS and TPPS. At 60 min, sensitivity was poor on the OPS scale by all three observers. Nurses showed a lower specificity on FLACC tool. Parents had poor specificity on CHEOPS and rate of false negatives was high with TPPS. Conclusions: We recommend the use of FLACC scale for assessment by parents, nurses, and doctors in Pakistani children aged between 3 and 7.

  3. Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

    Directory of Open Access Journals (Sweden)

    Malik Samina

    2010-01-01

    Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

  4. Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

    2017-10-26

    Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

  5. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  6. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  7. Relationship of thyroid-stimulating hormone with metabolic syndrome in a sample of euthyroid Pakistani population

    International Nuclear Information System (INIS)

    Saleem, M.S.; Khan, K.A.

    2011-01-01

    Metabolic Syndrome is a group of factors that predispose to cardiovascular diseases. The prevalence of metabolic syndrome is rising rapidly. Recently, a few studies have suggested that lower thyroid function in the reference range may be associated with metabolic syndrome, but the issue remains unsettled. We aimed to elucidate the relationship between thyroid function and components of metabolic syndrome in a sample of euthyroid Pakistani population. Methods: This analytical, cross-sectional study was conducted at the Department of Physiology, University of Health Sciences, Lahore, Pakistan, and extended over a period of 12 months. It included 100 subjects with metabolic syndrome in the study group and thirty subjects without metabolic syndrome in the control group with age ranging 45-55 years. Both groups had normal thyroid function. After a detailed history and clinical examination, fasting blood was analysed for glucose, triglycerides, high density lipoprotein-cholesterol along with thyroid-stimulating hormone (TSH) and free thyroxine. Results: Serum TSH was significantly higher in study group than in control group (p=0.040). Serum free thyroxine values of study group were slightly but not significantly lower than those of control group. Serum TSH correlated significantly and positively with serum triglycerides in all subjects and with waist circumference and diastolic blood pressure in men. Serum TSH showed a positive and linear relationship with the number of components of metabolic syndrome (p=0.016) in all subjects. Conclusion: High-normal TSH is associated with metabolic syndrome and its components. There may be increased risk of cardiovascular diseases with high-normal TSH levels. (author)

  8. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Science.gov (United States)

    Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad

    2014-01-01

    Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

  9. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, S M; Dhakam, S; Khan, M.A., E-mail: drsehran@yahoo.co

    2009-10-15

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P< 0.0001). Regarding triglyceride concentrations, 16% had high-risk triglyceride levels, 34% were in the borderline-risk category, whereas 50% had a low-risk triglyceride levels (P< 0.0001). Patient proportion with None, One, Two, or Three Values outside clinical targets on percentage basis were 2, 16, 48, and 34%, respectively (P< 0.0001). Women were found to have greater odds of having LDL cholesterol above the target level i.e. >100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  10. Azolla domestication towards a biobased economy?

    Science.gov (United States)

    Brouwer, Paul; Bräutigam, Andrea; Külahoglu, Canan; Tazelaar, Anne O E; Kurz, Samantha; Nierop, Klaas G J; van der Werf, Adrie; Weber, Andreas P M; Schluepmann, Henriette

    2014-05-01

    Due to its phenomenal growth requiring neither nitrogen fertilizer nor arable land and its biomass composition, the mosquito fern Azolla is a candidate crop to yield food, fuels and chemicals sustainably. To advance Azolla domestication, we research its dissemination, storage and transcriptome. Methods for dissemination, cross-fertilization and cryopreservation of the symbiosis Azolla filiculoides-Nostoc azollae are tested based on the fern spores. To study molecular processes in Azolla including spore induction, a database of 37 649 unigenes from RNAseq of microsporocarps, megasporocarps and sporophytes was assembled, then validated. Spores obtained year-round germinated in vitro within 26 d. In vitro fertilization rates reached 25%. Cryopreservation permitted storage for at least 7 months. The unigene database entirely covered central metabolism and to a large degree covered cellular processes and regulatory networks. Analysis of genes engaged in transition to sexual reproduction revealed a FLOWERING LOCUS T-like protein in ferns with special features induced in sporulating Azolla fronds. Although domestication of a fern-cyanobacteria symbiosis may seem a daunting task, we conclude that the time is ripe and that results generated will serve to more widely access biochemicals in fern biomass for a biobased economy. No claim to original European Union works. New Phytologist © 2014 New Phytologist Trust.

  11. Revisiting the Link Between Economic Distress, Race, and Domestic Violence.

    Science.gov (United States)

    Leguizamon, J Sebastian; Leguizamon, Susane; Howden, Wesley

    2017-06-01

    Male unemployment may decrease the incidence of domestic violence, due to loss of economic power in the relationship, or increase the incidence of domestic violence, due to emotional outbursts fueled by increased stress. We hypothesize that Black men may face a greater loss of expected future earnings after an unemployment shock due to a more unfavorable labor market relative to White men. Consequently, we would expect that Black men would, on net, exhibit a greater reduction (or a smaller increase) in incidences of domestic violence following an employment shock. This study uses mass layoff events reported by the Bureau of Labor Statistics (BLS) at the county level ( N = 3,377) for the years 2003-2008. Mass layoff events occur when a firm lays off at least 50 workers and are uncorrelated with individual-level characteristics ( N = 28,939 events, affecting N = 5,337,481 individuals). Domestic violence data are taken from the National Archive of Criminal Justice and defined as occurring when an accused perpetrator is charged, but not necessarily convicted. We use a multivariate regression model to estimate how differences in the change in reported incidences of domestic violence by race correlate with changes in mass layoffs by race. We control for the poverty rate, real per capita income, percent Black, percent women, and percent of females laid off. The standard errors are clustered at the county level and include county and time dummies to account for regional and time specific trends. We observe that an increase in the number of Blacks subject to a mass layoff event do exert a negative associated influence on domestic violence while layoffs of White men exert a positive influence. Our results shed light on how the influence of economic uncertainty on incidences of domestic violence has been found to be positive in some previous research but negative in other research.

  12. [Mycoses in domestic animals].

    Science.gov (United States)

    García, M E; Blanco, J L

    2000-03-01

    In the present paper we will present a general view of the main mycoses affecting domestic animals. In the dog, we show the importance of the dermatophytoses, increased by its zoonosic character and the problem of the false negatives in the traditional microbiological culture. Under the general term of systemic mycoses we include a series of conditions considered usually as aspergillosis, bat with more and more fungal species implicated as possible etiological agents. In addition, fungi, especially yeasts, are being implicated in canine otitis; in our laboratory 86 % of canine chronic otitis involve a yeast etiology, alone or in collaboration with bacteria. In the cat, dermatophytes are more common than in the dog, and are the main source of infection in man, with the description of a high percentage of healthy carrier animals. Cryptococcosis is a severe disease, usually secondary to other process, especially feline immunodeficiency. In cows we refer to fungal abortion, with three main fungi implicated: Aspergillus, Candida and Zygomycetes. In some areas of our country the percentage of fungal abortion is around 10 %. A consequence of the multiple use of antibiotics in mastitis is selection of yeasts, especially those included in the genera Candida and Cryptococcus. Bovine dermatophytoses is an extensively disseminated disease in our country, with a commercial specific vaccine available. In small ruminants, Cryptococcus causes severe pneumonic processes that could be confused clinically with other conditions. An additional important question is the description of isolation of this fungus from tree leaves. In poultry, aspergillosis is a known and controlled disease, but with more importance in captive wild birds with an ecological value. In horses, we emphasize the lung infections by different fungi, specially Pneumocystis carinii, and arthritis by yeasts as consequence of wound contamination or surgery.

  13. Improving Fuel Statistics for Danish Aviation

    DEFF Research Database (Denmark)

    Winther, M.

    This report contains fuel use figures for Danish civil aviation broken down into domestic and international numbers from 1985 to 2000, using a refined fuel split procedure and official fuel sale totals. The results from two different models are used. The NERI (National Environmental Research...... Institute) model estimates the fuel use per flight for all flights leaving Danish airports in 1998, while the annual Danish CORINAIR inventories are based on improved LTO/aircraft type statistics. A time series of fuel use from 1985 to 2000 is also shown for flights between Denmark and Greenland/the Faroe...... Islands, obtained with the NERI model. In addition a complete overview of the aviation fuel use from the two latter areas is given, based on fuel sale information from Statistics Greenland and Statistics Faroe Islands, and fuel use data from airline companies. The fuel use figures are presented on a level...

  14. Domestic Violence and Social Time

    Directory of Open Access Journals (Sweden)

    Donald Black

    2018-05-01

    Full Text Available A violência doméstica é o uso da força entre parceiros que vivem juntos como um casal. A maioria é uma forma de gestão de conflitos conhecida como autoajuda: o tratamento de uma queixa com agressão. Em Violência doméstica e tempo social eu introduzo dois princípios de violência doméstica que explicam 1 quais casais têm mais violência e 2 o que causa sua violência. O primeiro princípio - a violência doméstica é uma função direta da distância doméstica – explica por que algumas estruturas domésticas (como “patriarquias frias” têm mais violência do que outras (como “democracias estreitas”. O segundo princípio – a violência doméstica é uma função direta do movimento do tempo doméstico – explica casos particulares de violência doméstica com mudanças (como diminuição da intimidade ou aumento da desigualdade nas relações domésticas onde elas ocorrem. Esses princípios explicam a violência doméstica nas sociedades tradicionais e modernas, entre homens e mulheres, e em casais heterossexuais e do mesmo sexo. Domestic violence is the use of force between partners who live together as a couple. Most is a form of conflict management known as self-help: the handling of a grievance with aggression. Here I introduce two principles of domestic violence that explain 1 which couples have more violence and 2 what causes their violence. The first principle – domestic violence is a direct function of domestic distance – explains why some domestic structures (such as “cold patriarchies” have more violence than others (such as “close democracies”. The second principle – domestic violence is a direct function of the movement of domestic time – explains particular cases of domestic violence with changes (such as decreases of intimacy or increases of inequality in the domestic relationships where they occur. These principles explain domestic violence in traditional and modern societies, by men and

  15. What is LPG-fuel?

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    The LPG-f (Liquefied Petroleum Gas) fuels are better known by the public users for their domestic applications (cooking, sanitary water heating and building heating). This paper describes the chemical composition and properties of LPG fuels together with their environmental advantages (low S content and NOx and CO emissions, no particulates) with respect to other fossil fuels. Advantages for vehicle engines (cleaner combustion, no dilution of the engine lubricant) and passengers (reduction of noise pollution) are summarized. The worldwide production/consumption of LPG is given. (J.S.)

  16. U.s. Energy Independence: An Assessment Of Mechanisms To Help Promote Domestic Energy Security

    OpenAIRE

    O’Rear, Eric G.; Sarica, Kemal; Tyner, Wallace

    2013-01-01

    The two primary objectives of recent energy initiatives and/or policies are the reducing of both domestic emissions of greenhouse gases (GHG) and our dependence on foreign oil commodities. Republican senators Richard Lugar, Lindsay Graham, and Lisa Murkowski introduced the “Primary Energy Plan Act of 2011” with plans of: (1) reducing U.S. dependency on foreign oil; (2) increasing investment in more diverse, cleaner energy producing technologies; and (3) better utilizing domestic fossil fuel r...

  17. Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-10-01

    To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

  18. Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-06-01

    To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

  19. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  20. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    Energy Technology Data Exchange (ETDEWEB)

    Kamal, N.

    1999-01-01

    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  1. Fuel assemblies

    International Nuclear Information System (INIS)

    Mukai, Hideyuki

    1987-01-01

    Purpose: To prevent bending of fuel rods caused by the difference of irradiation growth between coupling fuel rods and standards fuel rods thereby maintain the fuel rod integrity. Constitution: The f value for a fuel can (the ratio of pole of zirconium crystals in the entire crystals along the axial direction of the fuel can) of a coupling fuel rod secured by upper and lower tie plates is made smaller than the f value for the fuel can of a standard fuel rod not secured by the upper and the lower tie plates. This can make the irradiation growth of the fuel can of the coupling fuel rod greater than the irradiation growth of the fuel can of the standard fuel rod and, accordingly, since the elongation of the standard fuel rod can always by made greater, bending of the standard fuel rod can be prevented. (Yoshihara, M.)

  2. RODOS - The domestic counterpart

    International Nuclear Information System (INIS)

    Vamanu, Dan V.

    1999-01-01

    One term of reference for validly teaming up with Project RODOS (Real-Time-On-Line Decision Support System for Nuclear Emergencies in Europe) is to institutionally - contribute research initiatives geared towards emulating the RODOS functions on novel conceptual pathways, expand system's coverage of issues that are relevant in a nuclear crisis management and bring in a domestic perspective on how the system may best perform in each and every national - i.e. legal, managerial, logistic and cultural environment. On this line, one reviews the approach taken in the IFIN-HH RODOS Group to address the challenge, as well a number of representative outputs. These include: i) A phase-one, pre-RODOS, period (1990 - 1994), involving topical field orientation, feasibility demonstrations and expertise acquisition by hands-on training in environmental radiology modeling and DSS code development, the resulting products - codes in the 'APUD' and 'ACA-IFA' family, including custom versions developed by appointment of the IAEA Safety Section and AECL-Research, Ontario, Canada - being favourably reviewed by the NEA/OECD Data Bank; ii) A phase-two, upgrading and consolidation period (1994 -1996), assisted by the IAEA fellowship system and the US Government via the Nuclear Regulatory Commission in Washington, D.C, having on record an effective participation in the development of the US NRC, EPA, and DOE's 'FRMAC Assessment Manual - The Federal manual for Assessing Environmental Data during a Radiological Emergency', and the 'RTM-95 International Technical Response Manual', and the research initiative of developing a software support for the manuals' implementation - the codes 'ROBOT' (Rule-Oriented Basic Operational Tool); iii) A phase-three period (1996 - ), evolving within the RODOS framework and featuring, inter alia: (a) the application of the ROBOT concept in the development of a standalone software platform, code-named NOTEPAD for DSS support in field operations, nuclear accident

  3. Analysis of high burnup fuel safety issues

    International Nuclear Information System (INIS)

    Lee, Chan Bock; Kim, D. H.; Bang, J. G.; Kim, Y. M.; Yang, Y. S.; Jung, Y. H.; Jeong, Y. H.; Nam, C.; Baik, J. H.; Song, K. W.; Kim, K. S

    2000-12-01

    Safety issues in steady state and transient behavior of high burnup LWR fuel above 50 - 60 MWD/kgU were analyzed. Effects of burnup extension upon fuel performance parameters was reviewed, and validity of both the fuel safety criteria and the performance analysis models which were based upon the lower burnup fuel test results was analyzed. It was found that further tests would be necessary in such areas as fuel failure and dispersion for RIA, and high temperature cladding corrosion and mechanical deformation for LOCA. Since domestic fuels have been irradiated in PWR up to burnup higher than 55 MWD/kgU-rod. avg., it can be said that Korea is in the same situation as the other countries in the high burnup fuel safety issues. Therefore, necessary research areas to be performed in Korea were derived. Considering that post-irradiation examination(PIE) for the domestic fuel of burnup higher than 30 MWD/kgU has not been done so far at all, it is primarily necessary to perform PIE for high burnup fuel, and then simulation tests for RIA and LOCA could be performed by using high burnup fuel specimens. For the areas which can not be performed in Korea, international cooperation will be helpful to obtain the test results. With those data base, safety of high burnup domestic fuels will be confirmed, current fuel safety criteria will be re-evaluated, and finally transient high burnup fuel behavior analysis technology will be developed through the fuel performance analysis code development

  4. Analysis of high burnup fuel safety issues

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Chan Bock; Kim, D. H.; Bang, J. G.; Kim, Y. M.; Yang, Y. S.; Jung, Y. H.; Jeong, Y. H.; Nam, C.; Baik, J. H.; Song, K. W.; Kim, K. S

    2000-12-01

    Safety issues in steady state and transient behavior of high burnup LWR fuel above 50 - 60 MWD/kgU were analyzed. Effects of burnup extension upon fuel performance parameters was reviewed, and validity of both the fuel safety criteria and the performance analysis models which were based upon the lower burnup fuel test results was analyzed. It was found that further tests would be necessary in such areas as fuel failure and dispersion for RIA, and high temperature cladding corrosion and mechanical deformation for LOCA. Since domestic fuels have been irradiated in PWR up to burnup higher than 55 MWD/kgU-rod. avg., it can be said that Korea is in the same situation as the other countries in the high burnup fuel safety issues. Therefore, necessary research areas to be performed in Korea were derived. Considering that post-irradiation examination(PIE) for the domestic fuel of burnup higher than 30 MWD/kgU has not been done so far at all, it is primarily necessary to perform PIE for high burnup fuel, and then simulation tests for RIA and LOCA could be performed by using high burnup fuel specimens. For the areas which can not be performed in Korea, international cooperation will be helpful to obtain the test results. With those data base, safety of high burnup domestic fuels will be confirmed, current fuel safety criteria will be re-evaluated, and finally transient high burnup fuel behavior analysis technology will be developed through the fuel performance analysis code development.

  5. Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

    Science.gov (United States)

    Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

    2013-01-01

    Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

  6. Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

    Directory of Open Access Journals (Sweden)

    Syed Muhammad Aamir Shah

    2012-09-01

    Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

  7. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  8. The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

  9. Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

    Science.gov (United States)

    Tahir, Khazima

    2017-01-01

    This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

  10. Domestic biomass combustion and associated atmospheric emissions in West Africa

    Science.gov (United States)

    Brocard, Delphine; Lacaux, Jean-Pierre; Eva, Hugh

    1998-03-01

    Biofuel is the main source of energy for cooking and heating in Africa. In order to estimate the consumption of this resource at a regional level, a database with a spatial resolution of 1° latitude by 1° longitude of the distribution of the amounts of fuel wood and charcoal annually burned in West Africa has been derived. Chemical emission factors for fuel wood, for charcoal burning, and for charcoal fabrication measured during two field experiments are then used in conjunction with this database to produce a second 1° latitude by 1° longitude database of the emissions due to domestic fires for the region. A comparison of these emissions from domestic fires with those of savanna fires, the dominant form of biomass burning in tropical Africa, shows that the relative contribution of the wood fuel (i.e. fuel wood and charcoal) combustion is important for CH4 (46%), CO (42%), and nonmethane hydrocarbons (NMHC) (44%), less so for CO2 (32%). This source of biomass burning has a different spatial and temporal distribution than that of savanna fires and represents an atmospheric background noise throughout the year, whereas the savanna fires occur during a limited season.

  11. Domestic connectivity: media, gender and the domestic sphere in Kenya

    DEFF Research Database (Denmark)

    Gustafsson, Jessica

    2017-01-01

    This article explores how increased media access influences Kenyan women’s everyday life and alters the domestic space. The study, which is set in Uasin Gishu County, Kenya, is based on 30 in-depth interviews with women. The article demonstrates that women have incorporated newly attained media i...... their traditional gender roles.......This article explores how increased media access influences Kenyan women’s everyday life and alters the domestic space. The study, which is set in Uasin Gishu County, Kenya, is based on 30 in-depth interviews with women. The article demonstrates that women have incorporated newly attained media...... into their daily lives and routines and that increased media access has opened up the home, turned the domestic space from a secluded place to a connected space, where women can get input from, connect and interact with the world beyond their immediate surrounding, while remaining at home concurrently fulfilling...

  12. Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ilyas Mahwish

    2007-09-01

    Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

  13. Pharmacokinetic study of atorvastain after single dose administration among pakistani population

    International Nuclear Information System (INIS)

    Maqsood, I.; Najmi, M. H.; Mazhar, W.; Janjua, A.; Tayyaba, B.; Sabah, S.; Bader, Z.

    2017-01-01

    Objective: To obtain pharmacokinetic data of Orvastin, a newly launched formulation of atorvastatin, in healthy males of Pakistan. Study Design: It was quasi-experimental design. Place and Duration of Study: Study was conducted at Centre for Research in Experimental and Applied Medicine (CREAM) Army Medical College, Rawalpindi and duration of study was about ten months. Material and Methods: Twenty-four healthy male subjects were taken conveniently from Pakistani population. Two tablets of Orvastin, each containing atorvastatin 40mg, were administered orally as a single dose. Multiple blood samples were taken with small gaps in between up to the period of 48hrs. High Performance Liquid Chromatography (HPLC) with UV-detector was used for quantification of atorvastatin in plasma; wavelength of UV-detector was adjusted at 247nm. Mobile phase was made up of 60 percent acetonitrile and 40 percent 0.05M sodium phosphate buffer. Flow rate of mobile phase was maintained at 1.5ml/min with 5.5 pH. Progesterone was used as an internal standard. Stock solutions of atorvastatin were made by dissolving it into methanol and acetonitrile was used for making stock solution of progesterone. Calibration curves were made for atorvastatin and internal standard from oncentration time data, values for time to achieve maximum plasma concentration. (Tmax) and maximum plasma concentration (Cmax) were directly calculated. Computer program (APO, MW PHARM, and Ver. 3.60) was used for calculation of pharmacokinetic profile of atorvastatin. Results: Atorvastatin was detected in plasma samples of all volunteers. The absorption rate constant (Ka) was 0.41 l/hr. Cmax was 26.69 ± 6.67 µg/l and Tmax was 3.33 ± 0.41 hrs. Apparent volume of distribution (Vd), of atorvastatin, was 3244.84 ± 1237.36 liters. The elimination rate constant was 0.15 l/hr. Elimination half-life of atorvastatin was 6.14 hours. Trapezoidal rule was used for calculation of AUC /sub 0-48/ and AUC /sub 0-∞/ and it was found

  14. Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

    International Nuclear Information System (INIS)

    Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

    2017-01-01

    (dihydropyrimidine) deficiency, GA-2, NKH (non-ketotic hyperglycinemia), AADC (aromatic amino acid decarboxylase) deficiency. Conclusion: This study presents frequency of OA and AA in the high-risk Pakistani pediatric population analyzed locally. (author)

  15. Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families.

    Directory of Open Access Journals (Sweden)

    Sobia Shafique

    Full Text Available The frequency of inherited bilateral autosomal recessive non-syndromic hearing loss (ARNSHL in Pakistan is 1.6/1000 individuals. More than 50% of the families carry mutations in GJB2 while mutations in MYO15A account for about 5% of recessive deafness. In the present study a cohort of 30 ARNSHL families was initially screened for mutations in GJB2 and MYO15A. Homozygosity mapping was performed by employing whole genome single nucleotide polymorphism (SNP genotyping in the families that did not carry mutations in GJB2 or MYO15A. Mutation analysis was performed for the known ARNSHL genes present in the homozygous regions to determine the causative mutations. This allowed the identification of a causative mutation in all the 30 families including 9 novel mutations, which were identified in 9 different families (GJB2 (c.598G>A, p.Gly200Arg; MYO15A (c.9948G>A, p.Gln3316Gln; c.3866+1G>A; c.8767C>T, p.Arg2923* and c.8222T>C, p.Phe2741Ser, TMC1 (c.362+18A>G, BSND (c.97G>C, p.Val33Leu, TMPRSS3 (c.726C>G, p.Cys242Trp and MSRB3 (c.20T>G, p.Leu7Arg. Furthermore, 12 recurrent mutations were detected in 21 other families. The 21 identified mutations included 10 (48% missense changes, 4 (19% nonsense mutations, 3 (14% intronic mutations, 2 (9% splice site mutations and 2 (9% frameshift mutations. GJB2 accounted for 53% of the families, while mutations in MYO15A were the second most frequent (13% cause of ARNSHL in these 30 families. The identification of novel as well as recurrent mutations in the present study increases the spectrum of mutations in known deafness genes which could lead to the identification of novel founder mutations and population specific mutated deafness genes causative of ARNSHL. These results provide detailed genetic information that has potential diagnostic implication in the establishment of cost-efficient allele-specific analysis of frequently occurring variants in combination with other reported mutations in Pakistani populations.

  16. The System Dynamics of U.S. Automobile Fuel Economy

    Directory of Open Access Journals (Sweden)

    Todd K. BenDor

    2012-05-01

    Full Text Available This paper analyzes the dynamics of U.S. automobile gasoline consumption since 1975. Using background literature on the history of domestic fuel economy and energy policy, I establish a conceptual model that explains historical trends in adoption of increased fuel economy. I then create a system dynamics simulation model to understand the relationship between increased fuel economy standards and potential changes to gas tax policies. The model suggests that when increases in mandated fuel economy are not conducted in an environment with rising fuel costs, fuel economy improvements may be directly counteracted by shifting tastes of consumers towards larger automobiles with lower fuel economy.

  17. Multi-perpetrator domestic violence.

    Science.gov (United States)

    Salter, Michael

    2014-04-01

    A significant proportion of reports of domestic violence against women involve multiple perpetrators. Although the number of perpetrators has been consistently identified as a measure of abuse severity, only a minority of studies of domestic violence examine the role of multiple offenders. Data on multi-perpetrator domestic violence (MDV) is frequently removed from analysis in domestic violence studies, or multi-perpetrator incidents are treated as single-perpetrator incidents. However, the available research links MDV to negative mental and physical health outcomes, intimate partner homicide, homelessness among women, and severe mental illness and suicidality. This article reviews the available prevalence data on MDV and draws together research on the contexts in which MDV takes place. It highlights two groups that are particularly vulnerable to MDV: (1) girls and women partnered to members of gangs and organized crime groups and (2) girls and women in some ethnic minority communities. While discussions of honor in relation to domestic violence are often racialized in Western media, this article highlights the cross-cultural role of masculine honor in collective violence against women in the working class and impoverished communities of majority cultures as well as in migrant and ethnic minority communities. It is clear that such complex forms of violence present a range of challenges for intervention and treatment and the article emphasizes the need for specialized and coordinated modes of investigation, support, and care.

  18. Domestic Violence Among Pregnant Women.

    Science.gov (United States)

    Habib, Sadia; Abbasi, Nasreen; Khan, Bushra; Danish, Nargis; Nazir, Quratulain

    2018-01-01

    Domestic violence during pregnancy is an important social & health issue in all societies. In Muslim world and particularly underdeveloped countries, domestic violence is often under reported. It is the need of hour to encourage reporting of such events & implementation of research-based policies for prevention of women abuse & support of the victims of domestic violence (DV). The objective of this study was to highlight this neglected social problem of our society & to identify at risk population. This is a cross sectional study conducted at Ayub Teaching Hospital & Benazir Bhutto Shaheed Teaching Hospital, Abbottabad (January 2014 to December. 2016). Pregnant women were inquired regarding history of abuse by husband and sociodemographic characteristics were noted in a Performa to analyse the risk factors for domestic violence. The overall prevalence was found to be 35%. Out of 1000 pregnant women, 270 (27%) suffered from simple violence and 60 (6%) were victims of grievous assault. Violence among pregnant women is found to be more prevalent among residents of urban areas, women of older age being uneducated & belonging to poor socioeconomic status. Domestic violence during pregnancy is a common & often neglected psychosocial health problem. High risk population needs to be identified so that preventive strategies can be planned & implemented.

  19. Plant domestication slows pest evolution.

    Science.gov (United States)

    Turcotte, Martin M; Lochab, Amaneet K; Turley, Nash E; Johnson, Marc T J

    2015-09-01

    Agricultural practices such as breeding resistant varieties and pesticide use can cause rapid evolution of pest species, but it remains unknown how plant domestication itself impacts pest contemporary evolution. Using experimental evolution on a comparative phylogenetic scale, we compared the evolutionary dynamics of a globally important economic pest - the green peach aphid (Myzus persicae) - growing on 34 plant taxa, represented by 17 crop species and their wild relatives. Domestication slowed aphid evolution by 13.5%, maintained 10.4% greater aphid genotypic diversity and 5.6% higher genotypic richness. The direction of evolution (i.e. which genotypes increased in frequency) differed among independent domestication events but was correlated with specific plant traits. Individual-based simulation models suggested that domestication affects aphid evolution directly by reducing the strength of selection and indirectly by increasing aphid density and thus weakening genetic drift. Our results suggest that phenotypic changes during domestication can alter pest evolutionary dynamics. © 2015 John Wiley & Sons Ltd/CNRS.

  20. National Policy on Nuclear Fuel Cycle

    International Nuclear Information System (INIS)

    Soedyartomo, S.

    1996-01-01

    National policy on nuclear fuel cycle is aimed at attaining the expected condition, i.e. being able to support optimality the national energy policy and other related Government policies taking into account current domestic nuclear fuel cycle condition and the trend of international nuclear fuel cycle development, the national strength, weakness, thread and opportunity in the field of energy. This policy has to be followed by the strategy to accomplish covering the optimization of domestic efforts, cooperation with other countries, and or purchasing licences. These policy and strategy have to be broken down into various nuclear fuel cycle programmes covering basically assesment of the whole cycle, performing research and development of the whole cycle without enrichment and reprocessing being able for weapon, as well as programmes for industrialization of the fuel cycle stepwisery commencing with the middle part of the cycle and ending with the edge of the back-end of the cycle

  1. Preliminary evaluation of fuel oil produced from pyrolysis of low ...

    African Journals Online (AJOL)

    MICHAEL

    The wax content decreases as temperature increases .The highest quantity ... polyethylene are generated . The producers of ... increase in the volume of waste generated daily by its usage in .... aviation industry and other domestic fuel users.

  2. Improved oxidative stability of biodiesel fuels : antioxidant research and development.

    Science.gov (United States)

    2011-01-01

    Biodiesel is a domestic, renewable fuel that is gaining wide acceptance, especially in Europe. : When blended with conventional petroleum diesel, biodiesel reduces hydrocarbon, particulate : and carbon monoxide emissions, while having minimal to no e...

  3. World nuclear fuel cycle requirements 1991

    Energy Technology Data Exchange (ETDEWEB)

    1991-10-10

    The nuclear fuel cycle consists of mining and milling uranium ore, processing the uranium into a form suitable for generating electricity, burning'' the fuel in nuclear reactors, and managing the resulting spent nuclear fuel. This report presents projections of domestic and foreign requirements for natural uranium and enrichment services as well as projections of discharges of spent nuclear fuel. These fuel cycle requirements are based on the forecasts of future commercial nuclear power capacity and generation published in a recent Energy Information Administration (EIA) report. Also included in this report are projections of the amount of spent fuel discharged at the end of each fuel cycle for each nuclear generating unit in the United States. The International Nuclear Model is used for calculating the projected nuclear fuel cycle requirements. 14 figs., 38 tabs.

  4. World nuclear fuel cycle requirements 1991

    International Nuclear Information System (INIS)

    1991-01-01

    The nuclear fuel cycle consists of mining and milling uranium ore, processing the uranium into a form suitable for generating electricity, ''burning'' the fuel in nuclear reactors, and managing the resulting spent nuclear fuel. This report presents projections of domestic and foreign requirements for natural uranium and enrichment services as well as projections of discharges of spent nuclear fuel. These fuel cycle requirements are based on the forecasts of future commercial nuclear power capacity and generation published in a recent Energy Information Administration (EIA) report. Also included in this report are projections of the amount of spent fuel discharged at the end of each fuel cycle for each nuclear generating unit in the United States. The International Nuclear Model is used for calculating the projected nuclear fuel cycle requirements. 14 figs., 38 tabs

  5. Environmental benefits of domestic solar energy systems

    International Nuclear Information System (INIS)

    Kalogirou, Soteris A.

    2004-01-01

    All nations of the world depend on fossil fuels for their energy needs. However the obligation to reduce CO 2 and other gaseous emissions in order to be in conformity with the Kyoto agreement is the reason behind which countries turn to non-polluting renewable energy sources. In this paper the pollution caused by the burning of fossil fuels is initially presented followed by a study on the environmental protection offered by the two most widely used renewable energy systems, i.e. solar water heating and solar space heating. The results presented in this paper show that by using solar energy, considerable amounts of greenhouse polluting gasses are avoided. For the case of a domestic water heating system, the saving, compared to a conventional system, is about 80% with electricity or Diesel backup and is about 75% with both electricity and Diesel backup. In the case of space heating and hot water system the saving is about 40%. It should be noted, however, that in the latter, much greater quantities of pollutant gasses are avoided. Additionally, all systems investigated give positive and very promising financial characteristics. With respect to life cycle assessment of the systems, the energy spent for manufacture and installation of the solar systems is recouped in about 1.2 years, whereas the payback time with respect to emissions produced from the embodied energy required for the manufacture and installation of the systems varies from a few months to 9.5 years according to the fuel and the particular pollutant considered. Moreover, due to the higher solar contribution, solar water heating systems have much shorter payback times than solar space heating systems. It can, therefore, be concluded that solar energy systems offer significant protection to the environment and should be employed whenever possible in order to achieve a sustainable future

  6. Minimizing fuel wood consumption through the evolution of hot ston ...

    African Journals Online (AJOL)

    The central objective of this paper is to minimize fuelwood consumption through evolving alternative domestic energy. Data on alternative domestic energy sources, and use fuel wood consumption during scarcity of petroleum were collected using structured questionnaires. Data on time spent to cook yam, race and beans ...

  7. Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

    2013-06-01

    breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

  8. Production of leu high density fuels at Babcock and Wilcox

    International Nuclear Information System (INIS)

    Freim, J.B.

    1983-01-01

    A large number of fuel elements of all types are produced for both international and domestic customers by Nuclear Fuel Division of Babcock and Wilcox. A brief history of the division, included previous and present research reactor fuel element fabrication experience is discussed. The manufacturing facilities are briefly described. The fabrication of LEU fuels and economic analysis of the production are included. (A.J.)

  9. Alternative Fuels

    Science.gov (United States)

    Alternative fuels include gaseous fuels such as hydrogen, natural gas, and propane; alcohols such as ethanol, methanol, and butanol; vegetable and waste-derived oils; and electricity. Overview of alternative fuels is here.

  10. New Insights on Water Buffalo Genomic Diversity and Post-Domestication Migration Routes From Medium Density SNP Chip Data

    Directory of Open Access Journals (Sweden)

    Licia Colli

    2018-03-01

    Full Text Available The domestic water buffalo is native to the Asian continent but through historical migrations and recent importations, nowadays has a worldwide distribution. The two types of water buffalo, i.e., river and swamp, display distinct morphological and behavioral traits, different karyotypes and also have different purposes and geographical distributions. River buffaloes from Pakistan, Iran, Turkey, Egypt, Romania, Bulgaria, Italy, Mozambique, Brazil and Colombia, and swamp buffaloes from China, Thailand, Philippines, Indonesia and Brazil were genotyped with a species-specific medium-density 90K SNP panel. We estimated the levels of molecular diversity and described population structure, which revealed historical relationships between populations and migration events. Three distinct gene pools were identified in pure river as well as in pure swamp buffalo populations. Genomic admixture was seen in the Philippines and in Brazil, resulting from importations of animals for breed improvement. Our results were largely consistent with previous archeological, historical and molecular-based evidence for two independent domestication events for river- and swamp-type buffaloes, which occurred in the Indo-Pakistani region and close to the China/Indochina border, respectively. Based on a geographical analysis of the distribution of diversity, our evidence also indicated that the water buffalo spread out of the domestication centers followed two major divergent migration directions: river buffaloes migrated west from the Indian sub-continent while swamp buffaloes migrated from northern Indochina via an east-south-eastern route. These data suggest that the current distribution of water buffalo diversity has been shaped by the combined effects of multiple migration events occurred at different stages of the post-domestication history of the species.

  11. A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

    Directory of Open Access Journals (Sweden)

    Rebecca Garcia

    2017-04-01

    Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  12. Mineralization and volatilization of 14C-ring labelled 2,4-dichlorophenoxy acetic acid in Pakistani soils

    International Nuclear Information System (INIS)

    Hussain, Altaf; Iqbal, Zafar; Asi, Muhammad Rafique; Chaudhry, Jamil Anwar

    2001-01-01

    The mineralization and volatilization of [U-ring 14 C] 2,4-D in three Pakistani soils was investigated under laboratory conditions using 50 g of soil and uniform distribution of 1.345 μg/g of 2,4-D. Maximum losses of 14 CO 2 and volatile organic compounds occurred at day 7 and losses gradually slowed down after 21 days of incubation. The relative distribution of 14 C losses differed with soil type. Volatilization was higher in control soil as compared to test and treated soil in both the study seasons. The contribution of volatile material to the total loss in 1997 was highest in test soil (24.4%), and lowest in farm soil (19.8%) but in 1998 was highest in control soil (26%) and lowest in test and farm soils (7%) during 1998. (author)

  13. Preservation of Cultural Heritage Embodied in Traditional Crafts in the Developing Countries. A Case Study of Pakistani Handicraft Industry

    Directory of Open Access Journals (Sweden)

    Yongzhong Yang

    2018-04-01

    Full Text Available Cultural heritage embodied in traditional crafts is an integral part of any nation which reflects the culture and tradition of a particular region. Although the importance of handicraft has been widely recognized, the literature regarding preservation of traditional craft is scarce. The present paper aimed to explore and identify issues faced by traditional craftsmanship in developing countries and to address those issues in order to contribute to the sustainability of traditional craft heritage and ensure continuous transmission of craft skills and knowledge from generation to generation. Our study identified several key issues which poses substantial challenges to the preservation of traditional craft heritage in developing countries. In order to add empirical evidence, we examined the case of Pakistani handicraft industry that provided further understanding of highlighted issues which traditional craft heritage face. We have suggested some policies to promote, develop and preserve the traditional craft heritage. The significance of these policy suggestions is underlined with the case study of Pakistan.

  14. Factors Contributing to Use of Biomass as Domestic Fuel and ...

    African Journals Online (AJOL)

    Biomass energy dominates household cooking energy in developing countries and Nigeria is not exceptional. However, a number of implications such as indoor air pollution, environmental degradation and social burden have been associated with the use of biomass energy. The paper discusses factors that determine the ...

  15. Fuel assembly

    International Nuclear Information System (INIS)

    Chaki, Masao; Nishida, Koji; Karasawa, Hidetoshi; Kanazawa, Toru; Orii, Akihito; Nagayoshi, Takuji; Kashiwai, Shin-ichi; Masuhara, Yasuhiro

    1998-01-01

    The present invention concerns a fuel assembly, for a BWR type nuclear reactor, comprising fuel rods in 9 x 9 matrix. The inner width of the channel box is about 132mm and the length of the fuel rods which are not short fuel rods is about 4m. Two water rods having a circular cross section are arranged on a diagonal line in a portion of 3 x 3 matrix at the center of the fuel assembly, and two fuel rods are disposed at vacant spaces, and the number of fuel rods is 74. Eight fuel rods are determined as short fuel rods among 74 fuel rods. Assuming the fuel inventory in the short fuel rod as X(kg), and the fuel inventory in the fuel rods other than the short fuel rods as Y(kg), X and Y satisfy the relation: X + Y ≥ 173m, Y ≤ - 9.7X + 292, Y ≤ - 0.3X + 203 and X > 0. Then, even when the short fuel rods are used, the fuel inventory is increased and fuel economy can be improved. (I.N.)

  16. Fuel assembly

    International Nuclear Information System (INIS)

    Yamazaki, Hajime.

    1995-01-01

    In a fuel assembly having fuel rods of different length, fuel pellets of mixed oxides of uranium and plutonium are loaded to a short fuel rod. The volume ratio of a pellet-loaded portion to a plenum portion of the short fuel rod is made greater than the volume ratio of a fuel rod to which uranium fuel pellets are loaded. In addition, the volume of the plenum portion of the short fuel rod is set greater depending on the plutonium content in the loaded fuel pellets. MOX fuel pellets are loaded on the short fuel rods having a greater degree of freedom relevant to the setting for the volume of the plenum portion compared with that of a long rod fuel, and the volume of the plenum portion is ensured greater depending on the plutonium content. Even if a large amount of FP gas and He gas are discharged from the MOX fuels compared with that from the uranium fuels, the internal pressure of the MOX fuel rod during operation is maintained substantially identical with that of the uranium fuel rod, so that a risk of generating excess stresses applied to the fuel cladding tubes and rupture of fuels are greatly reduced. (N.H.)

  17. Design in Domestic Wastewater Irrigation

    NARCIS (Netherlands)

    Huibers, F.P.; Raschid-Sally, L.

    2005-01-01

    When looking at the domestic wastewater streams, from freshwater source to destination in an agricultural field, we are confronted with a complexity of issues that need careful attention. Social and economic realities arise, along with technical, biological and institutional issues. Local realities

  18. Lead poisoning in domestic ducks

    Energy Technology Data Exchange (ETDEWEB)

    Rac, R; Crisp, C S

    1954-05-01

    The death of wild ducks, due to the ingestion of lead shop, occurs frequently and is well documented. This paper discusses the death of domestic ducks due to the ingestion of lead. It describes the symptoms, and pathology of the lead poisoning of a clutch of 11 ducklings which were being raised on a farm in Australia. 3 references, 1 table.

  19. How People Domesticated Amazonian Forests

    NARCIS (Netherlands)

    Levis, C.; Flores, Bernardo; Moreira, Priscilla; Luize, Bruno G.; Alves, Rubana; Franco-Moraes, Juliano; Lins, Juliana; Konings, Evelien; Pena Claros, M.; Bongers, F.; Costa, Flavia; Clement, Charles

    2018-01-01

    For millennia, Amazonian peoples have managed forest resources, modifying the natural environment in subtle and persistent ways. Legacies of past human occupation are striking near archaeological sites, yet we still lack a clear picture of how human management practices resulted in the domestication

  20. Energy optimisation of domestic refrigerators

    DEFF Research Database (Denmark)

    Jakobsen, Arne; Rasmussen, Bjarne D.

    1998-01-01

    This paper describes the main results of a research project with the objective of reducing the energy consumption of domestic refrigerators by increasing the efficiency of the refrigeration system. The improvement of the system efficiency was to be obtained by:1) Introducing continuous operation ...

  1. The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

    Science.gov (United States)

    Williams, Lisa; Ralphs, Rob; Gray, Paul

    2017-03-21

    The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

  2. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  3. Effect of domestic violence training

    Science.gov (United States)

    Zaher, Eman; Keogh, Kelly; Ratnapalan, Savithiri

    2014-01-01

    Abstract Objective To describe and evaluate the effectiveness of domestic violence education in improving physicians’ knowledge, recognition, and management of abused women. Data sources The Cochrane Database of Systematic Reviews, MEDLINE, PubMed, PsycINFO, ERIC, and EMBASE were searched for articles published between January 1, 2000, and November 1, 2012. This search was supplemented by manual searches for relevant articles using a combined text-word and MeSH-heading search strategy. Study selection Randomized controlled trials were selected that used educational interventions among physicians and provided data on the effects of the interventions. Synthesis Nine randomized controlled trials were included that described different educational approaches with various outcome measures. Three studies examined the effects of educational interventions among postgraduate trainee physicians and found an increase in knowledge but no change in behaviour with regard to identifying victims of domestic violence. Six studies examined educational interventions for practising physicians. Three of these studies used multifaceted physician training that combined education with system support interventions to change physician behaviour, such as increasing general awareness of domestic violence with brochures and posters, providing aids to remind physicians how to identify victims, facilitating physician access to victim support services, and providing audits and feedback. Multifaceted educational interventions included interactive workshops, Web-based learning, and experiential training. Another study used focus-group discussions and training, and showed improved domestic violence reporting among physicians. The remaining 2 studies showed improved perceptions of practising physicians’ self-efficacy using problem-based online learning. Conclusion It was difficult to determine the most effective educational strategy, as the educational interventions and the outcome measures varied

  4. Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

    Directory of Open Access Journals (Sweden)

    Barton Pelham

    2011-08-01

    Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

  5. Nuclear fuels

    International Nuclear Information System (INIS)

    Gangwani, Saloni; Chakrabortty, Sumita

    2011-01-01

    Nuclear fuel is a material that can be consumed to derive nuclear energy, by analogy to chemical fuel that is burned for energy. Nuclear fuels are the most dense sources of energy available. Nuclear fuel in a nuclear fuel cycle can refer to the fuel itself, or to physical objects (for example bundles composed of fuel rods) composed of the fuel material, mixed with structural, neutron moderating, or neutron reflecting materials. Long-lived radioactive waste from the back end of the fuel cycle is especially relevant when designing a complete waste management plan for SNF. When looking at long-term radioactive decay, the actinides in the SNF have a significant influence due to their characteristically long half-lives. Depending on what a nuclear reactor is fueled with, the actinide composition in the SNF will be different. The following paper will also include the uses. advancements, advantages, disadvantages, various processes and behavior of nuclear fuels

  6. Fuel and nuclear fuel cycle

    International Nuclear Information System (INIS)

    Prunier, C.

    1998-01-01

    The nuclear fuel is studied in detail, the best choice and why in relation with the type of reactor, the properties of the fuel cans, the choice of fuel materials. An important part is granted to the fuel assembly of PWR type reactor and the performances of nuclear fuels are tackled. The different subjects for research and development are discussed and this article ends with the particular situation of mixed oxide fuels ( materials, behavior, efficiency). (N.C.)

  7. Proceedings of fuel safety research specialists' meeting

    International Nuclear Information System (INIS)

    Suzuki, Motoe

    2002-08-01

    Fuel Safety Research Specialists' Meeting, which was organized by Japan Atomic Energy Research Institute, was held on March 4-5, 2002 at JAERI in Tokai Establishment. Purposes of the Meeting are to exchange information and views on LWR fuel safety topics among the specialist participants from domestic and foreign organizations, and to discuss the recent and future fuel research activities in JAERI. In the Meeting, presentations were given and discussions were made on general report of fuel safety research activities, fuel behaviors in normal operation and accident conditions, FP release behaviors in severe accident conditions, and JAERI's ''Advanced LWR Fuel Performance and Safety Research Program''. A poster exhibition was also carried out. The Meeting significantly contributed to planning future program and cooperation in fuel research. This proceeding integrates all the pictures and papers presented in the Meeting. The 10 of the presented papers are indexed individually. (J.P.N.)

  8. DUPIC fuel cycle economics assessment (1)

    International Nuclear Information System (INIS)

    Choi, H. B.; Roh, G. H.; Kim, D. H.

    1999-04-01

    This is a state-of-art report that describes the current status of the DUPIC fuel cycle economics analysis conducted by the DUPIC fuel compatibility assessment group of the DUPIC fuel development project. For the DUPIC fuel cycle economics analysis, the DUPIC fuel compatibility assessment group has organized the 1st technical meeting composed of 8 domestic specialists from government, academy, industry, etc. and a foreign specialist of hot-cell design from TRI on July 16, 1998. This report contains the presentation material of the 1st technical meeting, published date used for the economics analysis and opinions of participants, which could be utilized for further DUPIC fuel cycle and back-end fuel cycle economics analyses. (author). 11 refs., 7 charts

  9. Hydrogen: Fueling the Future

    International Nuclear Information System (INIS)

    Leisch, Jennifer

    2007-01-01

    As our dependence on foreign oil increases and concerns about global climate change rise, the need to develop sustainable energy technologies is becoming increasingly significant. Worldwide energy consumption is expected to double by the year 2050, as will carbon emissions along with it. This increase in emissions is a product of an ever-increasing demand for energy, and a corresponding rise in the combustion of carbon containing fossil fuels such as coal, petroleum, and natural gas. Undisputable scientific evidence indicates significant changes in the global climate have occurred in recent years. Impacts of climate change and the resulting atmospheric warming are extensive, and know no political or geographic boundaries. These far-reaching effects will be manifested as environmental, economic, socioeconomic, and geopolitical issues. Offsetting the projected increase in fossil energy use with renewable energy production will require large increases in renewable energy systems, as well as the ability to store and transport clean domestic fuels. Storage and transport of electricity generated from intermittent resources such as wind and solar is central to the widespread use of renewable energy technologies. Hydrogen created from water electrolysis is an option for energy storage and transport, and represents a pollution-free source of fuel when generated using renewable electricity. The conversion of chemical to electrical energy using fuel cells provides a high efficiency, carbon-free power source. Hydrogen serves to blur the line between stationary and mobile power applications, as it can be used as both a transportation fuel and for stationary electricity generation, with the possibility of a distributed generation energy infrastructure. Hydrogen and fuel cell technologies will be presented as possible pollution-free solutions to present and future energy concerns. Recent hydrogen-related research at SLAC in hydrogen production, fuel cell catalysis, and hydrogen

  10. Storytelling and story testing in domestication

    DEFF Research Database (Denmark)

    Gerbault, Pascale; Allaby, Robin G; Boivin, Nicole

    2014-01-01

    The domestication of plants and animals marks one of the most significant transitions in human, and indeed global, history. Traditionally, study of the domestication process was the exclusive domain of archaeologists and agricultural scientists; today it is an increasingly multidisciplinary...

  11. Helping Children Exposed to Domestic Violence

    Science.gov (United States)

    ... for Families - Vietnamese Spanish Facts for Families Guide Domestic Violence and Children No. 109; Updated April 2013 As ... each year. This kind of violence is called domestic violence or intimate partner violence. The US Department of ...

  12. Fuels. Deliveries and consumption of fuels during 4th quarter 2002 and year 2002

    International Nuclear Information System (INIS)

    2003-01-01

    The total volume of oil product deliveries (excluded lubricants, bitumen etc.) from the oil companies was 1 per cent lower during 2002 compared with 2001. The deliveries of motor gasoline and diesel oil increased by 2 and 5 per cent. Domestic heating oil and heavy fuel oils decreased by 3 and 5 per cent compared with 2001. Under the 4th quarter 2002 the deliveries of oil products (excluded lubricants, bitumen etc.) was 10 per cent higher compared with the same quarter 2001. The deliveries of domestic heating oil and heavy fuel oils increased by 22 per cent in each case. Motor gasoline was unchanged while the deliveries of diesel oil increased by 7 per cent. The consumption of fuels in mining and manufacturing increased by 3 % during the year 2002. The consumption of hard coal and coke increased by 5 % and the rest of the fossil fuels by 7 %. Renewable fuels decreased by 1 %. During the 4th quarter 2002 increased the fuel consumption in industry by 2 % compared with same quarter 2001. Renewable fuels decreased by 7 % while fossil fuels increased by 18 %. The consumption of fuels in electricity, gas and district heating services increased by 12 % during 2002. The consumption of oils increased by 16 %. During year 2002 the renewable fuels accounts for 68 % of the final consumption. During the 4th quarter the consumption of fuels was almost twice as high as the consumption during the 4th quarter 2001

  13. Generation of transportation fuel from solid municipal waste plastics

    Energy Technology Data Exchange (ETDEWEB)

    Sarker, Moinuddin

    2010-09-15

    Transportation fuels derived from fossil fuels are subjected to the price fluctuations of the global marketplace, and constitute a major expense in the operation of a vehicle. Emissions from the evaporation and combustion of these fuels contribute to a range of environmental problems, causing poor air quality and emitting greenhouse gases that contribute to global warming. Alternative fuels created from domestic sources have been proposed as a solution to these problems, and many fuels are being developed based on biomass and other renewable sources. Natural State Research, Inc. developed different alternative hydrocarbon fuel which is produced from waste plastic materials.

  14. Problems and perspectives of domestic violence prevention

    OpenAIRE

    Kasperskis, Darius

    2009-01-01

    This paper will analyze the domestic violence prevention problems and perspectives. The goal of this work is to discuss the main domestic violence characteristics, analyze Lithuanian and international prevention means and offer suggestions to improve Lithuanian domestic violence prevention. This work consentrates on mens violence over women. The conseption of violence is analyzed – the general violence features in criminology and law literature are discussed, the main domestic violence forms ...

  15. Fuel assembly

    International Nuclear Information System (INIS)

    Sakuyama, Tadashi; Mukai, Hideyuki.

    1988-01-01

    Purpose: To prevent the bending of a fuel rod caused by the difference in the elongation between a joined fuel rod and a standard fuel rod thereby maintain the fuel rod integrity. Constitution: A joined fuel rod is in a thread engagement at its lower end plug thereof with a lower plate, while passed through at its upper end plug into an upper tie plate and secured with a nut. Further, a standard fuel rod is engaged at its upper end plug and lower end plug with the upper tie plate and the lower tie plate respectively. Expansion springs are mounted to the upper end plugs of these bonded fuel rods and the standard fuel rods for preventing this lifting. Each of the fuel rods comprises a plurality of sintered pellets of nuclear fuel materials laminated in a zircaloy fuel can. The content of the alloy ingredient in the fuel can of the bonded fuel rod is made greater than that of the alloy ingredient of the standard fuel rod. this can increase the elongation for the bonded fuel rod, and the spring of the standard fuel rod is tightly bonded to prevent the bending. (Yoshino, Y.)

  16. A practical approach in porous medium combustion for domestic application: A review

    Science.gov (United States)

    Ismail, A. K.; Ibrahim, N. H.; Shamsuddin, K. A.; Abdullah, M. Z.; Zubair, M.

    2018-05-01

    Combustion in porous media has been widely studied. Many application involving the combustion of porous media has been reported in various way with most consider on numerical works and industrial application. Besides, recent application of porous medium combustion for domestic is the topic of interest among researchers. In this paper, a review was conducted on the combustion of porous media in term of practical application for domestic consumers. Details on the type of fuel used including bio fuel and their system have been search thoroughly. Most of the system have utilized compressed air system to provide lean combustion in domestic application. Some self-aspirating system of porous medium burner was also reported. The application of new technology such as cogeneration by using thermoelectric cells in tandem with porous medium combustion is also revised according to recent work which have already been published. Besides, the recent advances which include coating of porous material is also considered at the end of this paper.

  17. 77 FR 23105 - Supporting Safe and Responsible Development of Unconventional Domestic Natural Gas Resources

    Science.gov (United States)

    2012-04-17

    ... 2011, natural gas provided 25 percent of the energy consumed in the United States. Its production creates jobs and provides economic benefits to the entire domestic production supply chain, as well as to... appropriate safeguards, natural gas can provide a cleaner source of energy than other fossil fuels. For these...

  18. Nuclear fuel reprocessing expansion strategies

    International Nuclear Information System (INIS)

    Gallagher, J.M.

    1975-01-01

    A description is given of an effort to apply the techniques of operations research and energy system modeling to the problem of determination of cost-effective strategies for capacity expansion of the domestic nuclear fuel reprocessing industry for the 1975 to 2000 time period. The research also determines cost disadvantages associated with alternative strategies that may be attractive for political, social, or ecological reasons. The sensitivity of results to changes in cost assumptions was investigated at some length. Reactor fuel types covered by the analysis include the Light Water Reactor (LWR), High-Temperature Gas-Cooled Reactor (HTGR), and the Fast Breeder Reactor (FBR)

  19. Domestic competitiveness in secondary wood industries

    Science.gov (United States)

    Matthew Bumgardner; Urs Buehlmann; Albert Schuler; Rich Christianson

    2004-01-01

    As imports capture a substantial portion of the domestic wood furniture market, there is much speculation and concern as to the future of this and related industries. This study sought to obtain an industry perspective of trends in domestic manufacturing and importing, and to identify factors that might enhance domestic competitiveness. A mail survey was conducted...

  20. Risk Factors for Domestic Violence in Curacao

    Science.gov (United States)

    van Wijk, N. Ph. L.; de Bruijn, J. G. M.

    2012-01-01

    One out of three people (25% of men, 38% of women) in Curacao have experienced some form of domestic violence at some point in their adult lives. The most significant risk factors for domestic violence in Curacao are the female gender, a young age, low education, and experiencing domestic violence victimization in childhood. Divorce, single…

  1. Domestic Violence against Men: Know the Signs

    Science.gov (United States)

    Healthy Lifestyle Adult health Domestic violence against men isn't always easy to identify, but it can be a serious threat. Know how to recognize if ... Staff Women aren't the only victims of domestic violence. Understand the signs of domestic violence against men, ...

  2. 31 CFR 535.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 535.320 Section 535... § 535.320 Domestic bank. (a) The term domestic bank shall mean any branch or office within the United States of any of the following which is not Iran or an Iranian entity: any bank or trust company...

  3. 31 CFR 515.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 515.320 Section 515... § 515.320 Domestic bank. The term domestic bank shall mean any branch or office within the United States of any of the following which is not a national of a designated foreign country; any bank or trust...

  4. 31 CFR 500.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 500.320 Section 500... § 500.320 Domestic bank. The term domestic bank shall mean any branch or office within the United States of any of the following which is not a national of any designated foreign country: Any bank or trust...

  5. Risk factors for domestic violence in Curacao

    NARCIS (Netherlands)

    van Wijk, N.Ph.L.; de Bruijn, J.G.M.

    2012-01-01

    One out of three people (25% of men, 38% of women) in Curacao have experienced some form of domestic violence at some point in their adult lives. The most significant risk factors for domestic violence in Curacao are the female gender, a young age, low education, and experiencing domestic violence

  6. Fuel processing

    International Nuclear Information System (INIS)

    Allardice, R.H.

    1990-01-01

    The technical and economic viability of the fast breeder reactor as an electricity generating system depends not only upon the reactor performance but also on a capability to recycle plutonium efficiently, reliably and economically through the reactor and fuel cycle facilities. Thus the fuel cycle is an integral and essential part of the system. Fuel cycle research and development has focused on demonstrating that the challenging technical requirements of processing plutonium fuel could be met and that the sometimes conflicting requirements of the fuel developer, fuel fabricator and fuel reprocessor could be reconciled. Pilot plant operation and development and design studies have established both the technical and economic feasibility of the fuel cycle but scope for further improvement exists through process intensification and flowsheet optimization. These objectives and the increasing processing demands made by the continuing improvement to fuel design and irradiation performance provide an incentive for continuing fuel cycle development work. (author)

  7. Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2013-01-01

    To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

  8. Multi-objective regulations on transportation fuels: Comparing renewable fuel mandates and emission standards

    International Nuclear Information System (INIS)

    Rajagopal, D.; Plevin, R.; Hochman, G.; Zilberman, D.

    2015-01-01

    We compare two types of fuel market regulations — a renewable fuel mandate and a fuel emission standard — that could be employed to simultaneously achieve multiple outcomes such as reduction in fuel prices, fuel imports and greenhouse gas (GHG) emissions. We compare these two types of regulations in a global context taking into account heterogeneity in carbon content of both fossil fuels and renewable fuels. We find that although neither the ethanol mandate nor the emission standard is certain to reduce emissions relative to a business-as-usual baseline, at any given level of biofuel consumption in the policy region, a mandate, relative to an emission standard, results in higher GHG emissions, smaller expenditure on fuel imports, lower price of ethanol-blended gasoline and higher domestic fuel market surplus. This result holds over a wide range of values of model parameters. We also discuss the implications of this result to a regulation such as the US Renewable Fuel Standard given recent developments within the US such as increase in shale and tight oil production and large increase in average vehicle fuel economy of the automotive fleet. - Highlights: • Biofuel mandates and fuel GHG emission standards are analyzed from a multiple criteria perspective • An emission-standard always results in lower global emissions while requiring less biofuel relative to a biofuel mandate • An emission-standard results in higher fuel price in the home region relative to a biofuel mandate • Emission standards lead to more shuffling of both fossil fuels and biofuels between home and abroad • The relative impact of the policies on fuel imports depends on the relative cost-effectiveness of domestic & imported biofuel • Recent developments oil production and fuel economy increase the net benefits of an LCFS approach relative to RFS

  9. Ambient air pollution associated to domestic wood burning heating systems

    International Nuclear Information System (INIS)

    Friboulet, I.; Durif, M.; Malherbe, L.

    2009-01-01

    Main publications are considering effects of wood burning appliances on indoor air quality, which is a major issue in some countries. But impacts on ambient air, close environment and human exposure are rather poorly characterised so far. Besides, woods burning for domestic purpose may develop in the next years while promoting bio fuels. The aim of the ongoing study is to assess in which conditions associated air pollution and population exposure could be significant, this poster shows preliminary results of the impact of a village of 98 houses equipped with a wood burning heating system. (N.C.)

  10. Domestic kraudfandinh: problems and prospects

    Directory of Open Access Journals (Sweden)

    L.V. Mihalchuk

    2015-03-01

    Full Text Available The description kraudfandinh as an innovative tool to attract private investment in promising business projects as a special type of financing over the Internet. Powered its classification and kraud lists of successful projects, clearly illustrated by comparison of the normal business process to create a product and a similar process using kraudfandinh, given the differences between them and the main advantages. Based on the summaries of the literature and current practices of foreign companies and kraud platforms, defined the prospects of its application by domestic enterprises in various industries, proved its positive impact on the economy of Ukraine. The main problem of the use of this instrument in the domestic business, according to national circumstances, given their explanations. Described the prospects for its implementation at Ukrainian enterprises in terms of economic instability. The characteristic of the first Ukrainian kraudfandinh platforms by their future prospects in this direction

  11. French views on the nuclear fuel cycle

    International Nuclear Information System (INIS)

    Chavardes, D.

    1986-01-01

    Fuel cycle activities are viewed in France as a very important and indissociable part of our nuclear program. Supply of material and services are firmly assured for domestic needs and overcapacities provide opportunities for industry to compete on the international market. A permanent and consistent R and D effort is continuously undertaken, aiming to apply new advanced technologies improving safety, economy and reliability of fuel cycle installations

  12. Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

    Science.gov (United States)

    Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

    2010-06-01

    Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

  13. Isolation, identification, screening of toxicity and oligopeptides of some marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the search for bioactive natural compounds

    OpenAIRE

    Hameed, Shaista

    2009-01-01

    Cyanobacteria produce a number of bioactive compounds, most of them are oligopeptides. Almost all are known from freshwater species. The aim of this study was to search for marine and brackish water species producing bioactive compounds. To reach this goal, new strains were isolated from Norwegian and Pakistani coastal waters. These and additional strains from NIVA, UiO and UiB culture collections (24 in total), belonging to Chroococcales and Oscillatoriales, were identified based on morpholo...

  14. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  15. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  16. Abused domestic workers in Europe

    DEFF Research Database (Denmark)

    Stenum, Helle

    This study analyses au pair arrangements in six EU Member States (Denmark, Germany, Ireland, the Netherlands, Poland and Spain) through descriptions of national and international legal frameworks and practices of au pairing. The findings show different patterns of au pair migration and different ...... situations of au pairing as well as different strategies to protect the au pairs. The overall recommendation is to separate current au pair immigration into two programmes: one of cultural exchange and one of domestic and care work....

  17. Domestic heating - the biomass challenge

    International Nuclear Information System (INIS)

    Rakos, C.

    1999-01-01

    This article highlights currently available efficient, low emission technical concepts for the combustion of wood, log-burning boilers, woodchip boilers, and the use of wood pellets. The economics of domestic heating with wood, the higher costs incurred with modern efficient wood burners as compared with fuelwood costs, and the proposed European Commission's campaign to implement more wood heated dwellings are discussed, and the transition from traditional to modern wood heating, and options for stimulating growth in renewable energy are considered

  18. Children's experiences of domestic violence

    OpenAIRE

    Callaghan, Jane

    2016-01-01

    This paper describes the key findings of a two year project focused on children's experiences of domestic violence. It draws on 107 interviews with children in Greece, Italy, Spain and the UK. The paper explores children's capacity to articulate their experiences, and highlights that they are not 'witnesses' to intimate partner violence, but experience it directly and make meaning of it, as members of a family affected by violence. I argue that children need to be recognised as direct victims...

  19. Reconsidering Our Domestic Violence System.

    Science.gov (United States)

    Starsoneck, Leslie; Ake, George

    2018-01-01

    Children's exposure to domestic violence is well established as an adverse childhood experience (ACE). Much is known about the impact of this exposure, but efforts to ameliorate its effects are too often unsuccessful. Reconsidering our response requires a candid assessment of whether convening large and disparate systems leads to the best outcome. ©2018 by the North Carolina Institute of Medicine and The Duke Endowment. All rights reserved.

  20. KNF's fuel service technologies and experiences

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jung Cheol; Kwon, Jung Tack; Kim, Jaeik; Park, Jong Youl; Kim, Yong Chan [KNF, Daejeon (Korea, Republic of)

    2009-04-15

    In Korea, since 1978, the commercial nuclear power plant was operated. After 10 years, from 1988, the nuclear fuel was produced by KNF (Korea Nuclear Fuel). The Fuel Service Team was established at KNF in 1995. Through the technical self reliance periods in cooperate with advanced foreign companies for 5 years, KNF has started to carry out fuel service activities onsite in domestic nuclear power plants. By ceaseless improving and advancing our own methodologies, after that, KNF is able to provide the most safe and reliable fuel repair services and poolside examinations including the root cause analysis of failed fuels. Recently, KNF developed the fuel cleaning system using ultrasonic technique for crud removal, and the CANDU fuel sipping system to detect a failed fuel bundle in PHWR. In this paper, all of KNF's fuel service technologies are briefly described, and the gained experience in shown.

  1. State Support of Domestic Production

    Energy Technology Data Exchange (ETDEWEB)

    Amy Wright

    2007-12-30

    This project was developed in response to a cooperative agreement offering by the U.S. Department of Energy (DOE) and the National Energy Technology Laboratory (NETL) under the State Support of Domestic Production DE-FC26-04NT15456. The Interstate Oil and Gas Compact Commission (IOGCC) performed efforts in support of State programs related to the security, reliability and growth if our nation's domestic production of oil and natural gas. The project objectives were to improve the States ability to monitor the security of oil and gas operations; to maximize the production of domestic oil and natural gas thereby minimizing the threat to national security posed by interruptions in energy imports; to assist States in developing and maintaining high standards of environmental protection; to assist in addressing issues that limit the capacity of the industry; to promote the deployment of the appropriate application of technology for regulatory efficiency; and to inform the public about emerging energy issues.

  2. Artificial cloning of domestic animals.

    Science.gov (United States)

    Keefer, Carol L

    2015-07-21

    Domestic animals can be cloned using techniques such as embryo splitting and nuclear transfer to produce genetically identical individuals. Although embryo splitting is limited to the production of only a few identical individuals, nuclear transfer of donor nuclei into recipient oocytes, whose own nuclear DNA has been removed, can result in large numbers of identical individuals. Moreover, clones can be produced using donor cells from sterile animals, such as steers and geldings, and, unlike their genetic source, these clones are fertile. In reality, due to low efficiencies and the high costs of cloning domestic species, only a limited number of identical individuals are generally produced, and these clones are primarily used as breed stock. In addition to providing a means of rescuing and propagating valuable genetics, somatic cell nuclear transfer (SCNT) research has contributed knowledge that has led to the direct reprogramming of cells (e.g., to induce pluripotent stem cells) and a better understanding of epigenetic regulation during embryonic development. In this review, I provide a broad overview of the historical development of cloning in domestic animals, of its application to the propagation of livestock and transgenic animal production, and of its scientific promise for advancing basic research.

  3. Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Eivind Andersen

    2011-08-01

    Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

  4. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

    Science.gov (United States)

    Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

    2017-09-01

    Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

  5. Brachypodium distachyon genomics for sustainable food and fuel production

    Science.gov (United States)

    Grasses are a vital source of food for humanity and are projected to be become an important source of renewable fuel. To provide food, feed and fuel for an ever expanding human population it will be necessary to improve existing grass crops (e.g. wheat, maize, rice) and domesticate perennial grasses...

  6. Strategies for Corporate Global Expansion of Pakistani Companies in the Age of Technology

    Directory of Open Access Journals (Sweden)

    Jawaid Ahmed Qureshi

    2015-04-01

    Full Text Available This study intends to meticulously probe about the applications of cutting-edge strategies of globally expanding companies operative in several industrial sectors of Pakistan. Many companies craft and execute various strategies to globalize their operations and networks in several continents, which can not only benefit them but add value in the domestic cum global economy. Many researchers expounded that along with many other factors, capacity-building and competitive edges of business provide these companies the competitive strengths to excel in their global operations. Regarding such strengths, advancement in technology inclusive of research in business R&D (Research & Development, and marketing and business research, process design, automation, and e-commerce play a decisive role in providing them the core competitive edges that they leverage to advance their growth and expansion in the global market. This paper employs hybrid research techniques including qualitative and quantitative research. Semi-structured interviews have been taken for qualitative enquiry and structured survey has been undertaken for quantitative enquiry. The samples are drawn from multiple populations pertaining top-five export sectors of Pakistan by applying convenience sampling procedures for interviews and proportionate stratified sampling articulated with systematic sampling for survey. The findings uncover that after turning as retrenched domestic entities, many of the companies in Pakistan prefer global expansion. They usually resume from export operations in various countries especially where they develop a network of business associates, and then gradually move to open subsidiaries abroad. They avail technological edges to upgrade their processes, plants, products

  7. Nuclear fuels

    International Nuclear Information System (INIS)

    Beauvy, M.; Berthoud, G.; Defranceschi, M.; Ducros, G.; Guerin, Y.; Limoge, Y.; Madic, Ch.; Santarini, G.; Seiler, J.M.; Sollogoub, P.; Vernaz, E.; Guillet, J.L.; Ballagny, A.; Bechade, J.L.; Bonin, B.; Brachet, J.Ch.; Delpech, M.; Dubois, S.; Ferry, C.; Freyss, M.; Gilbon, D.; Grouiller, J.P.; Iracane, D.; Lansiart, S.; Lemoine, P.; Lenain, R.; Marsault, Ph.; Michel, B.; Noirot, J.; Parrat, D.; Pelletier, M.; Perrais, Ch.; Phelip, M.; Pillon, S.; Poinssot, Ch.; Vallory, J.; Valot, C.; Pradel, Ph.; Bonin, B.; Bouquin, B.; Dozol, M.; Lecomte, M.; Vallee, A.; Bazile, F.; Parisot, J.F.; Finot, P.; Roberts, J.F.

    2009-01-01

    Fuel is one of the essential components in a reactor. It is within that fuel that nuclear reactions take place, i.e. fission of heavy atoms, uranium and plutonium. Fuel is at the core of the reactor, but equally at the core of the nuclear system as a whole. Fuel design and properties influence reactor behavior, performance, and safety. Even though it only accounts for a small part of the cost per kilowatt-hour of power provided by current nuclear power plants, good utilization of fuel is a major economic issue. Major advances have yet to be achieved, to ensure longer in-reactor dwell-time, thus enabling fuel to yield more energy; and improve ruggedness. Aside from economics, and safety, such strategic issues as use of plutonium, conservation of resources, and nuclear waste management have to be addressed, and true technological challenges arise. This Monograph surveys current knowledge regarding in-reactor behavior, operating limits, and avenues for R and D. It also provides illustrations of ongoing research work, setting out a few noteworthy results recently achieved. Content: 1 - Introduction; 2 - Water reactor fuel: What are the features of water reactor fuel? 9 (What is the purpose of a nuclear fuel?, Ceramic fuel, Fuel rods, PWR fuel assemblies, BWR fuel assemblies); Fabrication of water reactor fuels (Fabrication of UO 2 pellets, Fabrication of MOX (mixed uranium-plutonium oxide) pellets, Fabrication of claddings); In-reactor behavior of UO 2 and MOX fuels (Irradiation conditions during nominal operation, Heat generation, and removal, The processes involved at the start of irradiation, Fission gas behavior, Microstructural changes); Water reactor fuel behavior in loss of tightness conditions (Cladding, the first containment barrier, Causes of failure, Consequences of a failure); Microscopic morphology of fuel ceramic and its evolution under irradiation; Migration and localization of fission products in UOX and MOX matrices (The ceramic under irradiation

  8. Nuclear fuels

    Energy Technology Data Exchange (ETDEWEB)

    Beauvy, M.; Berthoud, G.; Defranceschi, M.; Ducros, G.; Guerin, Y.; Limoge, Y.; Madic, Ch.; Santarini, G.; Seiler, J.M.; Sollogoub, P.; Vernaz, E.; Guillet, J.L.; Ballagny, A.; Bechade, J.L.; Bonin, B.; Brachet, J.Ch.; Delpech, M.; Dubois, S.; Ferry, C.; Freyss, M.; Gilbon, D.; Grouiller, J.P.; Iracane, D.; Lansiart, S.; Lemoine, P.; Lenain, R.; Marsault, Ph.; Michel, B.; Noirot, J.; Parrat, D.; Pelletier, M.; Perrais, Ch.; Phelip, M.; Pillon, S.; Poinssot, Ch.; Vallory, J.; Valot, C.; Pradel, Ph.; Bonin, B.; Bouquin, B.; Dozol, M.; Lecomte, M.; Vallee, A.; Bazile, F.; Parisot, J.F.; Finot, P.; Roberts, J.F

    2009-07-01

    Fuel is one of the essential components in a reactor. It is within that fuel that nuclear reactions take place, i.e. fission of heavy atoms, uranium and plutonium. Fuel is at the core of the reactor, but equally at the core of the nuclear system as a whole. Fuel design and properties influence reactor behavior, performance, and safety. Even though it only accounts for a small part of the cost per kilowatt-hour of power provided by current nuclear power plants, good utilization of fuel is a major economic issue. Major advances have yet to be achieved, to ensure longer in-reactor dwell-time, thus enabling fuel to yield more energy; and improve ruggedness. Aside from economics, and safety, such strategic issues as use of plutonium, conservation of resources, and nuclear waste management have to be addressed, and true technological challenges arise. This Monograph surveys current knowledge regarding in-reactor behavior, operating limits, and avenues for R and D. It also provides illustrations of ongoing research work, setting out a few noteworthy results recently achieved. Content: 1 - Introduction; 2 - Water reactor fuel: What are the features of water reactor fuel? 9 (What is the purpose of a nuclear fuel?, Ceramic fuel, Fuel rods, PWR fuel assemblies, BWR fuel assemblies); Fabrication of water reactor fuels (Fabrication of UO{sub 2} pellets, Fabrication of MOX (mixed uranium-plutonium oxide) pellets, Fabrication of claddings); In-reactor behavior of UO{sub 2} and MOX fuels (Irradiation conditions during nominal operation, Heat generation, and removal, The processes involved at the start of irradiation, Fission gas behavior, Microstructural changes); Water reactor fuel behavior in loss of tightness conditions (Cladding, the first containment barrier, Causes of failure, Consequences of a failure); Microscopic morphology of fuel ceramic and its evolution under irradiation; Migration and localization of fission products in UOX and MOX matrices (The ceramic under

  9. Thermo-climatic cost of the domestic consumption products

    Energy Technology Data Exchange (ETDEWEB)

    Szargut, Jan; Stanek, Wojciech [Institute of Thermal Technology, Silesian University of Technology, Konarskiego 22, 44-100 Gliwice (Poland)

    2010-02-15

    The thermo-climatic cost (TCC) expresses the cumulative emission of CO{sub 2} burdening all the steps of production processes connected with the fabrication of particular consumption products. The TCC of the considered product results from the consumption of semi-finished products and energy carriers. The TCC of hydrocarbon fuels contains three components: the immediate emission of CO{sub 2} resulting from the combustion of carbon, the TCC of delivery and processing and the TCC resulting from import of fuels. The TCC-component connected with import results from the TCC of the domestic products exported in order to gain the financial means for import. The values of the TCC can be used for the minimization of climatic damages by the selection of the production technology or the design and operation parameters of new processes. (author)

  10. Fuel assembly

    International Nuclear Information System (INIS)

    Fujibayashi, Toru.

    1970-01-01

    Herein disclosed is a fuel assembly in which a fuel rod bundle is easily detachable by rotating a fuel rod fastener rotatably mounted to the upper surface of an upper tie-plate supporting a fuel bundle therebelow. A locking portion at the leading end of each fuel rod protrudes through the upper tie-plate and is engaged with or separated from the tie-plate by the rotation of the fastener. The removal of a desired fuel rod can therefore be remotely accomplished without the necessity of handling pawls, locking washers and nuts. (Owens, K.J.)

  11. Nuclear fuel

    International Nuclear Information System (INIS)

    D Hondt, P.

    1998-01-01

    The research and development programme on nuclear fuel at the Belgian Nuclear Research Centre SCK/CEN is described. The objective of this programme is to enhance the quantitative prediction of the operational limits of nuclear fuel and to assess the behaviour of fuel under incidental and accidental conditions. Progress is described in different domains including the modelling of fission gas release in LWR fuel, thermal conductivity, basic physical phenomena, post-irradiation examination for fuel performance assessment, and conceptual studies of incidental and accidental fuel experiments

  12. Market study on the potential for peat as a fuel

    International Nuclear Information System (INIS)

    1991-01-01

    A report is given on the market potential for peat as a fuel in Scotland. It is concluded that there are two distinct market segments, domestic and industrial/commercial. There is no potential for peat as a fuel in the industrial/commercial segment but there is opportunity for increased peat usage in the domestic sector. The greatest potential for market development is conversion of existing solid fuel users to peat. Pro-active input is required to realise this market potential. The market is constrained by demand. (UK)

  13. CANDU type fuel activities in Argentina

    International Nuclear Information System (INIS)

    Lavarez, L.; Casario, J.A.; Moreno, C.

    2003-01-01

    Domestic fuel performance in Embalse NPP during the last two years has been excellent without a significant occurrence of fuel failures. The defect rate level was reasonably low with a lowest value of 0.02 % in 2002. The implementation of fuel design optimizations to increase uranium content was fully completed by the end of year 2000. The in-reactor performance was not affected and shows the high degree of maturity reached for both the design and the manufacturing procedures and capabilities. A feasibility study for the utilization of SEU in Embalse NPP mainly conducted by NA-SA and AECL is almost completed. Some fuel related activities are still in progress. As part of them fuel behavior simulations using simplified power histories were performed to assess the influence of SEU fuel burnup extension. (author)

  14. Romanian nuclear fuel cycle development

    International Nuclear Information System (INIS)

    Rapeanu, S.N.; Comsa, Olivia

    1998-01-01

    Romanian decision to introduce nuclear power was based on the evaluation of electricity demand and supply as well as a domestic resources assessment. The option was the introduction of CANDU-PHWR through a license agreement with AECL Canada. The major factors in this choice have been the need of diversifying the energy resources, the improvement the national industry and the independence of foreign suppliers. Romanian Nuclear Power Program envisaged a large national participation in Cernavoda NPP completion, in the development of nuclear fuel cycle facilities and horizontal industry, in R and D and human resources. As consequence, important support was being given to development of industries involved in Nuclear Fuel Cycle and manufacturing of equipment and nuclear materials based on technology transfer, implementation of advanced design execution standards, QA procedures and current nuclear safety requirements at international level. Unit 1 of the first Romanian nuclear power plant, Cernavoda NPP with a final profile 5x700 Mw e, is now in operation and its production represents 10% of all national electricity production. There were also developed all stages of FRONT END of Nuclear Fuel Cycle as well as programs for spent fuel and waste management. Industrial facilities for uranian production, U 3 O 8 concentrate, UO 2 powder and CANDU fuel bundles, as well as heavy water plant, supply the required fuel and heavy water for Cernavoda NPP. The paper presents the Romanian activities in Nuclear Fuel Cycle and waste management fields. (authors)

  15. Frequency of different disorders requiring warfarin therapy and its outcome in terms of dosage and inr value in pakistani population

    International Nuclear Information System (INIS)

    Qayyum, A.; Najmi, M.H.

    2014-01-01

    To determine the frequency of different disorders requiring warfarin therapy and to see the target INR and warfarin dose requirement in Pakistani population. Study Design:Descriptive study. Setting and Duration of Study: The study was carried out at Armed Forces Institut e of Cardiology (AFIC) Rawalpindi, Military Hospital Rawalpindi and National Institute of Cardiovascular Diseases (NICVD), Karachi, Pakistan from October 2010 to March 2012. Patients and Methods: Stable patients taking warfarin therapy were recruited after detailed medical history, physical examination and laboratory tests. The demographic and clinical data of individuals were entered in a pre-structured proforma. Patients suffering from hepatic and renal disease, any co-morbid disease or taking any concurrent medication or diet which would have affected warfarin therapy, were excluded. Data was analyzed using PSS version 20.0. Results: A total of 607 stable patients fulfilling the eligibility criteria, participated in the study. There were 297 (48.9%) male and 310 (51.1%) female patients. The mean age was 37.93 +- 12.23 years (range 18-65 years). The most common indication for warfarin therapy was valvular heart diseases (93.4%) followed by atrial fibrillation (2.3%) whereas other indications for warfarin use are less commonly seen in our study population. Patients had mean international normalized ratio (INR) value of 2.3 +9- 0.8 (range 1.5-3.5). Mean daily dose of warfarin calculated in 607 patients was 5.62 and 1.98 mg with the range of 0.36-15 g whereas mean weekly dose was 39.36 +- 13.8 mg with the range of 2.5-105 mg. Conclusion: In Pakistani population the most common indications for warfarin use are valvular heart diseases followed by atrial fibrillation. The mean INR values were within recommended range of 2-3. The mean daily dose observed in long-term therapy is comparable to the empirical dose of 5 mg routinely started in clinical practice. (author)

  16. Analysis of assembly serial number usage in domestic light-water reactors

    International Nuclear Information System (INIS)

    Reich, W.J.; Moore, R.S.

    1991-05-01

    Domestic light-water reactor (LWR) fuel assemblies are identified by a serial number that is placed on each assembly. These serial numbers are used as identifiers throughout the life of the fuel. The uniqueness of assembly serial numbers is important in determining their effectiveness as unambiguous identifiers. The purpose of this study is to determine what serial numbering schemes are used, the effectiveness of these schemes, and to quantify how many duplicate serial numbers occur on domestic LWR fuel assemblies. The serial numbering scheme adopted by the American National Standards Institute (ANSI) ensures uniqueness of assembly serial numbers. The latest numbering scheme adopted by General Electric (GE), was also found to be unique. Analysis of 70,971 fuel assembly serial numbers from permanently discharged fuel identified 11,948 serial number duplicates. Three duplicate serial numbers were found when analysis focused on duplication within the individual fuel inventory at each reactor site, but these were traced back to data entry errors and will be corrected by the Energy Information Administration (EIA). There were also three instances where the serial numbers used to identify assemblies used for hot cell studies differed from the serial numbers reported to the EIA. It is recommended that fuel fabricators and utilities adhere to the ANSI serial numbering scheme to ensure serial number uniqueness. In addition, organizations collecting serial number information, should request that all known serial numbers physically attached or associated with each assembly be reported and identified by the corresponding number scheme. 10 refs., 5 tabs

  17. Fuel management

    International Nuclear Information System (INIS)

    Schwarz, E.R.

    1975-01-01

    Description of the operation of power plants and the respective procurement of fuel to fulfil the needs of the grid. The operation of the plants shall be optimised with respect to the fuel cost. (orig./RW) [de

  18. Fuel gases

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    This paper gives a brief presentation of the context, perspectives of production, specificities, and the conditions required for the development of NGV (Natural Gas for Vehicle) and LPG-f (Liquefied Petroleum Gas fuel) alternative fuels. After an historical presentation of 80 years of LPG evolution in vehicle fuels, a first part describes the economical and environmental advantages of gaseous alternative fuels (cleaner combustion, longer engines life, reduced noise pollution, greater natural gas reserves, lower political-economical petroleum dependence..). The second part gives a comparative cost and environmental evaluation between the available alternative fuels: bio-fuels, electric power and fuel gases, taking into account the processes and constraints involved in the production of these fuels. (J.S.)

  19. Fuel cycles

    International Nuclear Information System (INIS)

    Hawley, N.J.

    1983-05-01

    AECL publications, from the open literature, on fuels and fuel cycles used in CANDU reactors are listed in this bibliography. The accompanying index is by subject. The bibliography will be brought up to date periodically

  20. Nuclear fuels

    International Nuclear Information System (INIS)

    2008-01-01

    The nuclear fuel is one of the key component of a nuclear reactor. Inside it, the fission reactions of heavy atoms, uranium and plutonium, take place. It is located in the core of the reactor, but also in the core of the whole nuclear system. Its design and properties influence the behaviour, the efficiency and the safety of the reactor. Even if it represents a weak share of the generated electricity cost, its proper use represents an important economic stake. Important improvements remain to be made to increase its residence time inside the reactor, to supply more energy, and to improve its robustness. Beyond the economical and safety considerations, strategical questions have to find an answer, like the use of plutonium, the management of resources and the management of nuclear wastes and real technological challenges have to be taken up. This monograph summarizes the existing knowledge about the nuclear fuel, its behaviour inside the reactor, its limits of use, and its R and D tracks. It illustrates also the researches in progress and presents some key results obtained recently. Content: 1 - Introduction; 2 - The fuel of water-cooled reactors: aspect, fabrication, behaviour of UO 2 and MOX fuels inside the reactor, behaviour in loss of tightness situation, microscopic morphology of fuel ceramics and evolution under irradiation - migration and localisation of fission products in UOX and MOX matrices, modeling of fuels behaviour - modeling of defects and fission products in the UO 2 ceramics by ab initio calculations, cladding and assembly materials, pellet-cladding interaction, advanced UO 2 and MOX ceramics, mechanical behaviour of the fuel assembly, fuel during a loss of coolant accident, fuel during a reactivity accident, fuel during a serious accident, fuel management inside reactor cores, fuel cycle materials balance, long-term behaviour of the spent fuel, fuel of boiling water reactors; 3 - the fuel of liquid metal fast reactors: fast neutrons radiation

  1. Endothermic technology for domestic houses

    International Nuclear Information System (INIS)

    Virk, G.S.

    2005-01-01

    The paper introduces the endothermic energy systems being developed for buildings. These use the concept of solar assisted heat pumps where thermal energy is harvested using large integrated solar collectors connected to energy stores. The low grade energy is upgraded using heat pumps to provide thermal energy effectively to a wide variety of applications for space heating and cooling and hot water. The domestic housing sector is focused upon here and a current EC funded project aimed at assessing the potential of the endothermic technology for providing the thermal energy for space heating and cooling and hot water is presented. (author)

  2. THE DOMESTIC VIOLENCE ON CHILDREN

    Directory of Open Access Journals (Sweden)

    SAVCA Lucia

    2017-11-01

    Full Text Available Any form of domestic violence leaves its mark on minority's personality forma¬tion and generates dysfunctions in the behavioral, cognitive and emotional sphere. The study found that in the modern family up to 30% of children suffer from physical violence and up to 45% by psychological violence. Sexual violence, unlike other forms of violence, is more difficult to discover. It has more dramatic consequences and re¬quires a longer time for psychological recovery. In this study, are described a few cases of sexual violence in the family literally

  3. [Atopic dermatitis and domestic animals].

    Science.gov (United States)

    Song, M

    2000-09-01

    Several arguments are raised attributing to aeroallergens an important role in atopic dermatitis. The aeroallergens that penetrate the epidermis could be fixed by IgE on the Langerhans cells and then induce a cellular mediator reaction comparable to that of allergic contact eczema. Patch tests have been developed to evaluate the role of aeroallergens (dust mites, animal dander, etc.). Preventive anti-dust mites measures in the home of atopic patients are recommended. Eviction of domestic animals (cat, dog, etc.) or avoidance measures for animal dander in the home can produce improvement in atopic dermatitis. Oral specific immunotherapy is being validated as a treatment for this disease.

  4. Domestic demand for petroleum products in MENA countries

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, Subhes C.; Blake, Andon [CEPMLP, Dundee University, Dundee DD1 4HN (United Kingdom)

    2009-04-15

    The purpose of this paper is to analyse the domestic demand for petroleum products in the Middle East and North African (MENA) countries employing a recent data series (1982-2005). Understanding the domestic demand of oil producing countries is important due to the existence of subsidised supply, loss of foreign exchange income and the environmental effects of oil use. The paper analyses the evolution of petroleum product demand in MENA and presents an econometric analysis of demand using a simple log-linear specification for four petroleum products, namely gasoline, diesel, kerosene and fuel oil. The study covers seven MENA countries, namely Algeria, Iran, Kuwait, Libya, Saudi Arabia, UAE and Qatar. The results show that demand has grown quite fast in these countries probably because the fuel price has been kept very low while income has risen fast and thus demand has grown fast. The gasoline demand model has performed better than other models in terms of producing expected signs for the parameters. The results for the kerosene model was the least satisfactory as most of the coefficients were found to be statistically insignificant. However, in terms of numerical results, this study compares well with other similar studies of the past. (author)

  5. Domestic demand for petroleum products in MENA countries

    International Nuclear Information System (INIS)

    Bhattacharyya, Subhes C.; Blake, Andon

    2009-01-01

    The purpose of this paper is to analyse the domestic demand for petroleum products in the Middle East and North African (MENA) countries employing a recent data series (1982-2005). Understanding the domestic demand of oil producing countries is important due to the existence of subsidised supply, loss of foreign exchange income and the environmental effects of oil use. The paper analyses the evolution of petroleum product demand in MENA and presents an econometric analysis of demand using a simple log-linear specification for four petroleum products, namely gasoline, diesel, kerosene and fuel oil. The study covers seven MENA countries, namely Algeria, Iran, Kuwait, Libya, Saudi Arabia, UAE and Qatar. The results show that demand has grown quite fast in these countries probably because the fuel price has been kept very low while income has risen fast and thus demand has grown fast. The gasoline demand model has performed better than other models in terms of producing expected signs for the parameters. The results for the kerosene model was the least satisfactory as most of the coefficients were found to be statistically insignificant. However, in terms of numerical results, this study compares well with other similar studies of the past. (author)

  6. Fuel pellet

    International Nuclear Information System (INIS)

    Hayashi, K.

    1980-01-01

    Fuel pellet for insertion into a cladding tube in order to form a fuel element or a fuel rod. The fuel pellet has got a belt-like projection around its essentially cylindrical lateral circumferential surface. The upper and lower edges in vertical direction of this belt-like projection are wave-shaped. The projection is made of the same material as the bulk pellet. Both are made in one piece. (orig.) [de

  7. Fossil Fuels.

    Science.gov (United States)

    Crank, Ron

    This instructional unit is one of 10 developed by students on various energy-related areas that deals specifically with fossil fuels. Some topics covered are historic facts, development of fuels, history of oil production, current and future trends of the oil industry, refining fossil fuels, and environmental problems. Material in each unit may…

  8. Fuel element

    International Nuclear Information System (INIS)

    1974-01-01

    A new fuel can with a loose bottom and head is described. The fuel bar is attached to the loose bottom and head with two grid poles keeping the distance between bottom and head. A bow-shaped handle is attached to the head so that the fuel bar can be lifted from the can

  9. Qinshan NPP in-core fuel management improvement

    International Nuclear Information System (INIS)

    Kong Deping; Liao Zejun; Wu Xifeng; Wei Wenbin; Wang Yongming; Li Hua

    2006-01-01

    In the 10-year operation of Qinshan Nuclear Power Plant, the initial designed reloading strategy has been improved step by step based on the operation experiences and the advanced domestic and international fuel management methods. Higher burnup has been achieved and more economic operation gained through the loading pattern improvement and the fuel enrichment increased. The article introduces the in-core fuel management strategy improvement of Qinshan Nuclear Power Plant in its 10-year operation. (authors)

  10. MTR radiological database for SRS spent nuclear fuel facilities

    International Nuclear Information System (INIS)

    Blanchard, A.

    2000-01-01

    A database for radiological characterization of incoming Material Test Reactor (MTR) fuel has been developed for application to the Receiving Basin for Offsite Fuels (RBOF) and L-Basin spent fuel storage facilities at the Savannah River Site (SRS). This database provides a quick quantitative check to determine if SRS bound spent fuel is radiologically bounded by the Reference Fuel Assembly used in the L-Basin and RBOF authorization bases. The developed database considers pertinent characteristics of domestic and foreign research reactor fuel including exposure, fuel enrichment, irradiation time, cooling time, and fuel-to-moderator ratio. The supplied tables replace the time-consuming studies associated with authorization of SRS bound spent fuel with simple hand calculations. Additionally, the comprehensive database provides the means to overcome resource limitations, since a series of simple, yet conservative, hand calculations can now be performed in a timely manner and replace computational and technical staff requirements

  11. Contribution of domestic industry to the spanish nuclear program

    International Nuclear Information System (INIS)

    Palacios, L.

    1987-01-01

    The incorporation of nuclear energy to the spanish electricity supply system dates back to the 1960's, when the industrial infrastructure of the country was being modernized. The first round of Nuclear Power Plants was ordered on a turnkey basis from foreign established vendors and the participation of domestic suppliers of mechanical and electrical equipment was smaller than that of engineering, construction and erection companies. The 1960's and early 1970's witnessed a high rate of growth in electricity consumption. This fact plus the scarcity of domestic energy resources prompted an ambitious energy plan with a strong nuclear component. A second round of non-turnkey orders was placed by the Spanish utilities. Spanish industry, on the basis of a reliable market and the government guidelines to increase substantially the domestic participation, launched a determined effort to reorganize its activities to produce high quality, competitive components. The main thrust of this effort was directed to creating quality asurance systems, assimilating construction codes such as ASME Section III and realizing some investment in equipment and acquisition of manufacturing knowhow. Existing plants were largely used. A third round of plants was ordered during the 1970's for which full participation was targeted. During this phase this industrial infrastructure was completed with some new plants (for primary components and fuel fabrication) and a host of smaller, specialized firms for parts and services. The present situation is one of maturity in the design and manufacturing capacity for most components, with the exception of some raw materials and specialized items for which the economic threshold far exceeds the domestic needs... (author)

  12. DOMESTIC DEVELOPMENT IN THE LABYRINTH

    Directory of Open Access Journals (Sweden)

    Arnoldo Oscar, Delgado

    2010-01-01

    Full Text Available Since its installation in our country, domestic development theory and practice have been object of diverse assimilation that, at times, contributed to dilute an essential feature of those clusters of Small and Medium Enterprises (SMEs that founded the domestic interest in 1970’s: the continuous innovation of products and production processes, possible only by the imprint of cultural factors in the establishment of a socio-institutional environment self-regulated to benefit it. The stage begun in 2003 seems to be at a similar risk: in order to reverse the terrible consequences of the previous decade and achieving a growth with an inclusion, now it assimilates into the social economy trying to go beyond mere social welfares and form a socio/productive mesh based on solidarity and cooperation ties. Beyond the legitimacy of the pose, the precariousness of the underlying setting demonstrates a gap that still separates us from the ideal model, requiring from us to agree seriously with the medium and long term state policy to promote the territorial development according to the contemporary society requirements.

  13. Analytical methodology and facility description spent fuel policy

    Energy Technology Data Exchange (ETDEWEB)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs.

  14. Analytical methodology and facility description spent fuel policy

    International Nuclear Information System (INIS)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs

  15. Bilateral Moyamoya Disease in a 2-Year-Old Pakistani Male Treated with Bilateral Encephaloduroarteriosynangiosis: A Positive Outcome

    Directory of Open Access Journals (Sweden)

    Shahvaiz Magsi

    2016-01-01

    Full Text Available Background. We present a rare case of bilateral moyamoya disease presenting as multiple strokes and neurological deficits, treated with the neurosurgical procedure, encephaloduroarteriosynangiosis (EDAS, in a 2-year-old male Pakistani minor. A positive outcome was achieved and the patient recovered fully. Case Summary. Our patient presented with a history of seizures and multiple episodes of hemiparesis (on and off weakness at the age of 2 years. He had a delayed speech development and could not speak more than a few words. He had a slight slurring of speech too. He was diagnosed with bilateral moyamoya disease on Computed Tomography Angiography (CTA. Bilateral EDAS was done in the same year, after which his symptoms improved and patient had moderate functional recovery. Conclusion. A rare disease, moyamoya has been left unexplored in Pakistan; physicians and surgeons when dealing with cases in the pediatric population presenting with symptoms of stroke, signs of generalized weakness, and seizures should consider moyamoya disease as a possibility. Furthermore, this case demonstrates the effectiveness of EDAS procedure for the treatment of moyamoya disease.

  16. TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

    Science.gov (United States)

    Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

    2015-01-01

    A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

  17. Influences of religion and culture on continuing bonds in a sample of British Muslims of Pakistani origin.

    Science.gov (United States)

    Hussein, Hanan; Oyebode, Jan R

    2009-11-01

    This study considered the nature of continuing bonds with deceased relatives in a sample of Pakistani Muslims living in the United Kingdom. Ten participants were interviewed following a cultural psychology approach and transcripts were analyzed using grounded theory methodology. Dreaming, talking with others about the deceased, following the deceased's example, keeping memories and mementos, and doing actions thought to help the deceased were forms of continued relationship found. These were intertwined with the process of grieving and were influenced by the family, culture, and religion. Religion was a strong influence on the prominence given by participants to finishing well and on the notion of doing actions thought to help the deceased. Cultural mores, such as the community, and collectivist ethos and the expectation that emotion would be expressed around the time of death, were found to be supportive for some but sources of tension for other participants. Expressing a continuing bond through following the deceased's example so as to make them proud or happy seemed to be reinforced by cultural roots in respect for elders. Participants gave instances of tensions in areas such as expression of emotion and communality versus individualism that arose as a result of their position between two cultural frameworks, some illustrating how assimilation into the host culture set up conflict with the expected norms of their family/ancestral culture. The study highlights how understanding different cultural and religious influences may enrich the concept of continuing bonds.

  18. The Effect of Perceiving a Calling on Pakistani Nurses' Organizational Commitment, Organizational Citizenship Behavior, and Job Stress.

    Science.gov (United States)

    Afsar, Bilal; Shahjehan, Asad; Cheema, Sadia; Javed, Farheen

    2018-03-01

    People differ considerably in the way in which they express and experience their nursing careers. The positive effects associated with having a calling may differ substantially based on individuals' abilities to live out their callings. In a working world where many individuals have little to no choice in their type of employment and thus are unable to live out a calling even if they have one, the current study examined how perceiving a calling and living a calling interacted to predict organizational commitment, organizational citizenship behavior, and job stress with career commitment mediating the effect of the interactions on the three outcome variables. The purpose of the study is to investigate the mediating effect of career commitment between the relationships of calling and (a) nurses' attitudes (organizational commitment), (b) behaviors (organizational citizenship behavior), and (c) subjective experiences regarding work (job stress). Using a descriptive exploratory design, data were collected from 332 registered nurses working in Pakistani hospitals. Descriptive analysis and hierarchical regression analysis were used for data analysis. Living a calling moderated the effect of calling on career commitment, organizational citizenship behavior, and job stress, and career commitment fully mediated the effect of calling on organizational commitment, organizational citizenship behavior, and job stress. Increasing the understanding of calling, living a calling, and career commitment may increase nurses' organizational commitment and organizational citizenship behavior and decrease job stress. The study provided evidence to help nursing managers and health policy makers integrate knowledge and skills related to calling into career interventions and help nurses discover their calling.

  19. "What is this genetics, anyway?" Understandings of genetics, illness causality and inheritance among British Pakistani users of genetic services.

    Science.gov (United States)

    Shaw, Alison; Hurst, Jane A

    2008-08-01

    Misconceptions about basic genetic concepts and inheritance patterns may be widespread in the general population. This paper investigates understandings of genetics, illness causality and inheritance among British Pakistanis referred to a UK genetics clinic. During participant observation of genetics clinic consultations and semi-structured interviews in Urdu or English in respondents' homes, we identified an array of environmental, behavioral and spiritual understandings of the causes of medical and intellectual problems. Misconceptions about the location of genetic information in the body and of genetic mechanisms of inheritance were common, reflected the range of everyday theories observed for White British patients and included the belief that a child receives more genetic material from the father than the mother. Despite some participants' conversational use of genetic terminology, some patients had assimilated genetic information in ways that conflict with genetic theory with potentially serious clinical consequences. Additionally, skepticism of genetic theories of illness reflected a rejection of a dominant discourse of genetic risk that stigmatizes cousin marriages. Patients referred to genetics clinics may not easily surrender their lay or personal theories about the causes of their own or their child's condition and their understandings of genetic risk. Genetic counselors may need to identify, work with and at times challenge patients' understandings of illness causality and inheritance.

  20. Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

    Science.gov (United States)

    Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

    2016-01-01

    We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  1. Urdu translation and validation of shorter version of Positive Affect and Negative Affect Schedule (PANAS) on Pakistani bank employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-10-01

    To translate, adapt and validate shorter version of positive affect and negative affect scale on Pakistani corporate employees. This cross-sectional study was conducted in the twin cities of Islamabad and Rawalpindi from October 2014 to December 2015. The study was completed into two independent parts. In part one, the scale was translated by forward translation. Then it was pilot-tested and administered on customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of positive affect and negative affect scale. Part two comprised the main study. Commercial bank employees were included in the sample using convenient sampling technique. Data of the main study was analysed using confirmatory factor analysis in order to establish construct validity of positive affect and negative affect scale. There were145 participants in the first part of the study and 495 in the second. Results of confirmatory factor analysis confirmed the two-factor structure of positive affect and negative affect scale suggesting that the scale has two distinct domains, i.e. positive affect and negative affect. The shorter version of positive affect and negative affect scale was found to be a valid and reliable measure.

  2. Study of Biochemical Changes and Elevated Levels of Enzymes in Salmonella typhi Infected Patients in Pakistani Population

    Directory of Open Access Journals (Sweden)

    Ayesha Shamim

    2012-04-01

    Full Text Available Typhoid fever causes significant biochemical changes and hepatic complications. As many studies have indicated several biochemical parameters that are involved in developing the risk of typhoid fever. The current study was designed to evaluate these risk factors in general Pakistani population. Serum biochemistry and liver enzymes were studied to investigate the relationship of these risk factors to Typhoid fever. Total 100 subjects were studied, 50 healthy individuals and 50 typhoid patients. Blood samples were collected from Allied and National Hospital, Faisalabad, Pakistan. In this study, Nested PCR was used to test the samples. Elevated level of ALT (P<0.0001 and AST (P<0.0001 were observed in typhoid patients. Typhoid patients had significantly higher concentrations of Triglyceride (P=0.0044, Globulin (P=0.0004 and Total protein (P=0.0978 while LDL (P=0.0197, Albumin (P<0.0001, Glucose (P=0.0006, HDL-cholesterol (P<0.0001 and Cholesterol (P=0.04 were significantly lower than those of healthy individuals. This study appears to be ample evidence based on the physiological and biochemical parameters in typhoid patients to explain influence of typhoid morbidity. Extensive research in this field would enable us to make modern drugs to treat typhoid fever patients.

  3. Evaluation of a cross-cultural training program for Pakistani educators: Lessons learned and implications for program planning.

    Science.gov (United States)

    Mazur, Rebecca; Woodland, Rebecca H

    2017-06-01

    In this paper, we share the results of a summative evaluation of PEILI, a US-based adult professional development/training program for secondary school Pakistani teachers. The evaluation was guided by the theories of cultural competence (American Psychological Association, 2003; Bamberger, 1999; Wadsworth, 2001) and established frameworks for the evaluation of professional development/training and instructional design (Bennett, 1975; Guskey, 2002; King, 2014; Kirkpatrick, 1967). The explicit and implicit stakeholder assumptions about the connections between program resources, activities, outputs, and outcomes are described. Participant knowledge and skills were measured via scores on a pre/posttest of professional knowledge, and a standards-based performance assessment rubric. In addition to measuring short-term program outcomes, we also sought to incorporate theory-driven thinking into the evaluation design. Hence, we examined participant self-efficacy and access to social capital, two evidenced-based determinants or "levers" that theoretically explain the transformative space between an intervention and its outcomes (Chen, 2012). Data about program determinants were collected and analyzed through a pre/posttest of self-efficacy and social network analysis. Key evaluation findings include participant acquisition of new instructional skills, increased self-efficacy, and the formation of a nascent professional support network. Lessons learned and implications for the design and evaluation of cross-cultural teacher professional development programs are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Investigation of total seed storage proteins of pakistani and japanese maize (zea mays l.) through sds-page markers

    International Nuclear Information System (INIS)

    Shinwari, Z.K.

    2014-01-01

    The assessment of genetic diversity among the members of a species is of vital importance for successful breeding and adaptability. In the present study 83 genotypes of maize of Pakistani and Japanese origin were evaluated for the total seed storage proteins using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) through vertical slab unit. The total protein subunits were separated on 12% polyacrylamide gel using standard protocols. A total of 18 protein subunits were noted out of which 7 (39%) were monomorphic and 11 (61%) were polymorphic, with molecular weight ranging from 10 to 122 kDa. Coefficients of similarity among the accessions ranged between 0.89 and 1.00. The dendrogram obtained through UPGMA clustering method showed two main clusters: 1 and 2. First cluster comprised of 9 genotypes including Sahiwal-2002, while second cluster contained 74 genotypes including Aaiti-2002 and Sadaf. Over all a low level of polymorphism was observed in total seed storage protein patterns of maize genotypes from Pakistan as well as Japan. It is inferred from the present study that more genotypes of maize could be brought under study and more advanced biochemical techniques with more reliable results could be followed to bring assessment of genetic diversity of maize for planning breeding programs. (author)

  5. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector. Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy. Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  6. Angiotensin Converting Enzyme Gene I/D Polymorphism in Pakistani Rheumatic Heart Disease Patients and Healthy Controls

    Directory of Open Access Journals (Sweden)

    Sadia Rehman

    2015-09-01

    Full Text Available Background: Valve scarring and collagen deposition are crucial in pathogenesis of Rheumatic Heart Disease (RHD, an autoimmune disorder of the heart. Angiotensin I-Converting Enzyme (ACE plays a major role in fibrous tissue formation. Objectives: The present research work aimed to assess the role of ACE Insertion/Deletion (I/D polymorphism in progress of RHD. Patients and Methods: DNA was pre pared from blood samples from 156 RHD patients (156 and 204 healthy ethnically-matched controls. Then, it was screened using sequence-specific Primers. Polymerase chain reaction and Agarose gel electrophoresis. The data were analyzed using Vassar stats (http://faculty.vassar.edu/lowry/VassarStats.html. Results: I allele (P = 0.024, OR = 1.42 and II genotype (P = 0.001, OR = 3.07 were significantly higher in Pakistani RHD patients compared to the healthy controls. Also, a significant difference was found between the female, but not male, patients and the controls regarding I allele and II genotype. Conclusions: The study results provided information about involvement of ACE I/D polymorphism in molecular mechanism of RHD. Thus, it can become one of the useful tools in risk assessment and help with designing strategies to combat the disease.

  7. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector.Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy.Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  8. Investigating Social Commerce as an Alternate Model for Online Commerce in Developing Countries: a case of Pakistani Economy

    Directory of Open Access Journals (Sweden)

    Amina Talat

    2013-05-01

    Full Text Available The study is an empirical quantitative research. In light of intense literature review it proposes a new model for effectiveness of social commerce in Pakistan. It has three objectives. It firstly investigates the relationship between perceived risk, social networking focus, and perceived value effect trust. It secondly investigates the relationship between affective influence, word of mouth, affective influence, advertising influence, purchasing experience and viral reach on social commerce. Lastly it investigates how consumer value (adoption and purchase intention is affected by social commerce focus and trust. The software used is SPSS 15.0. Multiple regression equation has been employed to verify the hypotheses. Results show and validate the literature that positive or favorable views of users trigger positive attitude. However, there are two variables and dimensions that do not affect the attitude of users on social networks from the perspective of shopping i.e. social commerce; these are viral reach and previous purchasing experience on different websites. The results show that Pakistani users will welcome social commerce even if they have no previous experience for purchasing goods and services online.

  9. Impact of leadership styles on employees’ attitude towards their leader and performance: Empirical evidence from Pakistani banks

    Directory of Open Access Journals (Sweden)

    Muhammad Asrar-ul-Haq

    2016-06-01

    Full Text Available This paper reports the findings of a study examining the impact of managers’ leadership styles on subordinates’ performance. The impact of leadership styles on employee performance outcomes is explored theoretically and tested empirically in the Pakistani banking sector. The sample of the study consisted of 224 full-time employees in the banking sector of Pakistan. Findings of this study reveal that there exists a significant relationship between transformational leadership and employee performance outcomes. However, laissez-faire leadership style showed negative relationship with employee performance outcomes in terms of effectiveness, and employee satisfaction. Banking industry in Pakistan is prone to numerous challenges including employee turnover. Model presented in the study will be helpful for the human resource managers and top management to design effective leadership development programs. HRD department can be established and HRD professionals can be hired to assist the managers in organizing training and development programs. Further, it may help to design strategies to satisfy, retain and motivate the employees. Also, it will help the managers decide, which leadership style they should choose in terms of outcomes.

  10. LPG fuel

    International Nuclear Information System (INIS)

    Dagnas, F.X.; Jeuland, N.; Fouquet, J.P.; Lauraire, S.; Coroller, P.

    2005-01-01

    LPG fuel has become frequently used through a distribution network with 2 000 service stations over the French territory. LPG fuel ranks number 3 world-wide given that it can be used on individual vehicles, professional fleets, or public transport. What is the environmental benefit of LPG fuel? What is the technology used for these engines? What is the current regulation? Government commitment and dedication on support to promote LPG fuel? Car makers projects? Actions to favour the use of LPG fuel? This article gathers 5 presentations about this topic given at the gas conference

  11. FUELS IN TOBACCO PRODUCTION

    Directory of Open Access Journals (Sweden)

    M. Čavlek

    2008-09-01

    Full Text Available Energy production from biomass can reduce „greenhouse effect” and contribute to solving energy security especially in the agricultural households which rely on energy from fossil fuels. In Croatia fuel-cured tobacco is produced on about 5000 ha. Gross income for the whole production is about 180 000 000 kn/year. Flue-cured tobacco is a high energy consuming crop. There are two parts of energy consumption, for mechanization used for the field production (11% and, energy for bulk-curing (89%. In each case, presently used fuels of fossil origin need to be substituted by an alternative energy source of organic origin. Hereafter attention is paid to finding a more economic and ecologically acceptable fuel for curing tobacco. Curing flue-cured tobacco is done by heated air in curing burns. Various sources of heat have been used; wood, coal, oil and gas. In each case different burning facilities of different efficiency have been used. This has had an impact on curing costs and ecology. Recently, mostly used fuel has been natural gas. However, gas is getting expensive. Consequently, an alternative fuel for curing tobacco is sought for. According to literature, agricultural crops suitable for the latter purpose could be wheat, barley, maize, sorghum, sugar beet and some other annual and perennial plant species. Wooden pellets (by-products are suitable for combustion too. Ligno-cellulose fuels have been used for heating since long time. However, not sufficient research has been done from an applied point of view (Venturi and Venturi, 2003. Fuel combustion is getting more efficient with developing technological innovations. The curing barn manufacturers are offering technology for combusting wooden pellets (by-products for curing tobacco. The pellets are available on domestic market. The same technology can be used for combustion of maize grain. Within “Hrvatski duhani” research on suitability of using wooden pellets and maize grain and whole

  12. Designating Domestic Terrorist Individuals or Groups

    Science.gov (United States)

    2010-09-01

    These individuals and groups include the Black Panther Party, Weather Underground, Covenant Sword and the Arm of the Lord, Ku Klux Klan, Earth...based and left wing and right wing groups such as the Covenant Sword and the Arm of the Lord, Ku Klux Klan, Black Panther Party, and the Weather...TERMS Watch list, domestic terrorism, validation, designation, domestic terrorism organization, material support, domestic surveillance, SHAC, animal

  13. 25 CFR 11.454 - Domestic violence.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Domestic violence. 11.454 Section 11.454 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Criminal Offenses § 11.454 Domestic violence. (a) A person who commits domestic violence by inflicting physical harm, bodily injury, or sexua...

  14. Review of the patents of Top and Bottom End Piece and fuel materials issued by overseas fuel vendors

    International Nuclear Information System (INIS)

    Yoon, Kyung Ho; Song, Kee Nam; Kim Hyung Kyu; Kang, Heung Seok; Bang, Je Geon.

    1997-06-01

    In order to develop new type nuclear fuel which can be loaded in the domestic PWRs without serious design changes, it is very important to understand the developing status of fuel components being conducted by overseas fuel vendors prior to commence the full-scale campaign. In this report, patents recorded in US patent lists have been inquired to understand the object, the background and the peculiarity of the invented components for top/bottom end piece and fuel materials. In addition, the important things which must be considered in development of new type fuel were described. (author). 18 tabs., 63 figs., 24 refs

  15. Fuel assembly

    International Nuclear Information System (INIS)

    Ueda, Makoto; Ogiya, Shunsuke.

    1989-01-01

    For improving the economy of a BWR type reactor by making the operation cycle longer, the fuel enrichment degree has to be increased further. However, this makes the subcriticality shallower in the upper portion of the reactor core, to bring about a possibility that the reactor shutdown becomes impossible. In the present invention, a portion of fuel rod is constituted as partial length fuel rods (P-fuel rods) in which the entire stack length in the effective portion is made shorter by reducing the concentration of fissionable materials in the axial portion. A plurality of moderator rods are disposed at least on one diagonal line of a fuel assembly and P-fuel rods are arranged at a position put between the moderator rods. This makes it possible to reactor shutdown and makes the axial power distribution satisfactory even if the fuel enrichment degree is increased. (T.M.)

  16. Fuel Services

    International Nuclear Information System (INIS)

    Silberstein, A.

    1982-09-01

    FRAGEMA has developed most types of inspection equipments to work on irradiated fuel assemblies and on single fuel rods during reactor outages with an efficiency compatible with the utilities operating priorities. In order to illustrate this statement, two specific examples of inspection equipments are shortly described: the on-site removable fuel rod assembly examination stand, and the fuel assembly multiple examination device. FRAGEMA has developed techniques for the identifiction of the leaking fuel rods in the fuel assembly and the tooling necessary to perform the replacement of the faulted element. These examples of methods, techniques and equipments described and the experience accumulated through their use allow FRAGEMA to qualify for offering the supply of the corresponding software, hardware or both whenever an accurate understanding of the fuel behaviour is necessary and whenever direct intervention on the assembly and associated components is necessary due to safety, operating or economical reasons

  17. Fuel assembly

    International Nuclear Information System (INIS)

    Watanabe, Shoichi; Hirano, Yasushi.

    1998-01-01

    A one-half or more of entire fuel rods in a fuel assembly comprises MOX fuel rods containing less than 1wt% of burnable poisons, and at least a portion of the burnable poisons comprises gadolinium. Then, surplus reactivity at an initial stage of operation cycle is controlled to eliminate burnable poisons remained unburnt at a final stage, as well as increase thermal reactivity. In addition, the content of fission plutonium is determined to greater than the content of uranium 235, and fuel rods at corner portions are made not to incorporate burnable poisons. Fuel rods not containing burnable poisons are disposed at positions in adjacent with fuel rods facing to a water rod at one or two directions. Local power at radial center of the fuel assembly is increased to flatten the distortion of radial power distribution. (N.H.)

  18. USSR Report: Consumer Goods and Domestic Trade

    National Research Council Canada - National Science Library

    1985-01-01

    .... This document contains articles on consumer goods and domestic trade issues within the USSR. Topics include: production, distribution, economics, housing and personal services, policies, personal income and savings.

  19. Domestic demand for petroleum in OPEC countries

    International Nuclear Information System (INIS)

    Chakravorty, U.; Fesharaki, F.; Zhou, S.

    2000-01-01

    The literature on OPEC energy policy has focused primarily on its production and export potential. The rapidly increasing domestic demand for petroleum products in OPEC countries has often been ignored. This study estimates domestic demand for petroleum products by the major OPEC economies and forecasts consumption trends under alternative assumptions regarding economic growth and price deregulation. It concludes that product demand is generally price and income inelastic and thus domestic consumption in OPEC will continue to grow rapidly, even if domestic prices are raised closer to world levels in the near future

  20. Biomass fuel exposure and respiratory diseases in India.

    Science.gov (United States)

    Prasad, Rajendra; Singh, Abhijeet; Garg, Rajiv; Giridhar, Giridhar B

    2012-10-01

    One half of the world's population relies on biomass fuel as the primary source of domestic energy. Biomass fuel exposure causes a high degree of morbidity and mortality in humans. This is especially true in the context of developing countries, which account for 99% of the world's biomass fuel use. Biomass fuel consists of fire wood, dung cakes, agricultural crop residues such as straw, grass, and shrubs, coal fuels and kerosene. Together, they supply 75% of the domestic energy in India. An estimated three-quarters of Indian households use biomass fuel as the primary means for domestic cooking. Ninety percent of rural households and 32% of urban households cook their meals on a biomass stove. There are wide variations between the rural and urban households regarding the specific type of biomass fuel used. Globally, almost 2 million deaths per year are attributable to solid fuel use, with more than 99% of these occurring in developing countries. Biomass fuel accounts for 5-6% of the national burden of disease. Burning biomass fuels emits toxic fumes into the air that consist of small solid particles, carbon monoxide, polyorganic and polyaromatic hydrocarbons, and formaldehyde. Exposure to biomass fuels has been found to be associated with many respiratory diseases such as acute lower respiratory infections, chronic obstructive pulmonary disease, lung cancer, pulmonary tuberculosis, and asthma. Biomass fuel exposure is closely related to the burden of disease in India. Hopes are that future studies will examine the morbidity associated with biomass exposure and seek to prevent it. Concerted efforts to improve stove design and transition to high-efficiency low-emission fuels may reduce respiratory disease associated with biomass fuel exposure.